geno2pheno[ngs-freq]: a novel tool for drug resistance testing in the era of nextgeneration

Transcription

1 geno2pheno[ngs-freq]: a novel tool for drug resistance testing in the era of nextgeneration sequencing Matthias Döring Max Planck Institute for Informatics AREVIR Meeting New Strategies - May 9, 2018

2 Imagine the following patient HIV-1 positive person Source: myhaliburtonnow.com/20094/wilberforce-clinic-opens-tomorrow/ Diagnosis & Treatment Source: med.upenn.edu Sanger sequencing Genotypic drug resistance testing May 9,

3 Resistance test comes back negative Selected treatment TDF + FTC + DRV Interpretation through HIV-GRADE May 9,

4 Virological failure is identified during routine monitoring in month 6 after treatment initiation FTC + TDF + DRV Failure! Monitoring Viral load BL Month 3 Month 6 Time 500 Viral load CD4 Maybe we should investigate the resistance status again? May 9,

5 M184I found in the second resistance test NRTI resistance interpretation of HIV-GRADE Drug GRADE HIVdb geno2pheno FTC R R R TDF S S R DRV S S S Resistance to selected regimen Treatment has to be adjusted! Could this have been avoided? May 9,

6 Yes it could have if we had used nextgeneration sequencing Source: med.upenn.edu support.illumina.com Next-generation Sanger sequencing (NGS) PASeq PASeq.org HyDRA hydra.canada.ca Genotypic drug Genotypic resistance drug testing resistance for NGS testing data May 9,

7 Results from geno2pheno[ngs-freq] for the corresponding NGS sample Drug >= 10% >= 2% FTC S R TDF S R DRV S S May 9,

8 Existing web servers for NGS data PASeq PASeq.org HyDRA hydra.canada.ca GATAAATCTGGTCTTATTTCC GATAATTCTGGTCTTATTTCC GATAAATCTGGTCTTATTTCC GATAAATCTGCTCTTATTCCC GATAAATCTGGTCTTATTTCC GATAAATCTGGTCTTATTTCC CATAATTCTGGTCTTATTTCC GATAAATCTGGTCTTATTTCC CATAATTCTGGTCTTATTTCC Input: raw sequencing data Limitations - Time-intensive - Rules-based interpretation only - Support for HIV-1 only - Predetermined processing pipeline Reference sequence CTAGGATAAATCTGGTCTTATTTCCTTAG ----GATAAATCTGGTCTTATTTCC GATAATTCTGGTCTTATTTCC GATAAATCTGCTCTTATTCCC---- CTAGGATAAATCTGGTCTTATTTCC---- -TAGGATAAATCTGGTCTTATTTCCT--- --AGGATAAATCTGGTCTTATTTCCTT --AGGATAAATCTGGTCTTATTTCCTTA- --AGGATAAATCTGGTCTTATTTCCTTAG Read processing pipeline: filtering, mapping, variant calling Rules-based resistance interpretation Noguera-Julian M, Edgil D, Harrigan PR, Sandstrom P, Godfrey C, Paredes R. Next-Generation Human Immunodeficiency Virus Sequencing for Patient Management and Drug Resistance Surveillance. J. Infect. Dis. 2017;17: May 9,

9 geno2pheno[ngs-freq] relies on frequency files Excerpt from a single-nucleotide frequency file May 9,

10 How does geno2pheno[ngs-freq] work? May 9,

11 Limitations Frequency files Minority resistant variants - Co-occurrence cannot be studied - NGS data need to preprocessed - Impact needs more thorough study [1,2] - Proviral contamination possible (APOBEC) - Worst-case prediction may be too sensitive 1. Cozzi-Lepri,A. et al. (2015). J. Antimicrob. Chemother Johnson,J.A. and Geretti,A.M. (2010). J. Antimicrob. Chemother. May 9,

12 Why should you use geno2pheno[ngs-freq]? Only NGS service for HCV Access to statistical model Established methods Source: thenounproject.com Minority detection Rapid results Integrable into existing pipelines May 9,

13 Where can I find geno2pheno[ngs-freq]? Döring,M. et al. (2018) geno2pheno[ngs-freq]: a genotypic interpretation system for identifying viral drug resistance using next-generation sequencing data. Nucleic Acids Res., /nar/gky May 9,

14 Interested in real-life applications? Source: Join our NGS workshop later today! 15:45 16:45 and 16:45 17:45 May 9,

15 Thanks for your attention and thanks to Thomas Lengauer Nico Pfeifer Alejandro Pironti Prabhav Kalaghatgi Achim Büch Georg Friedrich Max Planck Institute for Informatics, Saarbrücken Methods in Medical Informatics, University of Tübingen Broad Institute, Cambridge, MA, USA Max Planck Institute for Informatics, Saarbrücken Max Planck Institute for Informatics, Saarbrücken Max Planck Institute for Informatics, Saarbrücken Martin Obermeier Alexander Thielen Martin Däumer Rolf Kaiser Elena Knops Eva Heger Medizinisches Infektionslogiezentrum Berlin (MIB), Berlin SeqIT, Kaiserslautern SeqIT, Kaiserslautern Institute for Virology, University of Cologne Institute for Virology, University of Cologne Institute for Virology, University of Cologne May 9,