Abstract. Anatomic Pathology / c-kit and PDGFRA Mutations

Transcription

1 Anatomic Pathology / c-kit and PDGFRA Mutations Detection of c-kit and PDGFRA Gene Mutations in Gastrointestinal Stromal Tumors Comparison of DHPLC and DNA Sequencing Methods Using a Single Population-Based Cohort Angeline Battochio, 1 Shamayel Mohammed, MD, 1 Debra Winthrop, 1 Shilo Lefresne, 1 Karen Mulder, MD, FRCPC, 2 Quincy Chu, MD, FRCPC, 2 Carolyn O Hara, MD, FRCPC, 3 and Raymond Lai, MD, PhD, FRCPC 1 Key Words: c-kit; PDGFRA; Gene mutations; Gastrointestinal stromal tumor; GIST; Denaturing high-pressure liquid chromatography; DNA sequencing DOI: /AJCP1FNW7RGZFTYU Abstract Mutational analysis of c-kit or PDGFRA has become an important laboratory assay for patients with gastrointestinal stromal tumors (GISTs) because the results are useful in predicting the responsiveness to imatinib. To assess the diagnostic usefulness of denaturing high-pressure liquid chromatography (DHPLC) in this setting, we performed DHPLC and DNA sequencing to study exons 9, 11, 13, and 17 of c-kit and exons 12 and 18 of PDGFRA in 54 consecutive cases of GIST collected from a single population. Most (40/54 [74%]) carried c-kit mutations, and 7 (13%) carried PDGFRA mutations. These results were similar to those described in the literature. It is important to note that DHPLC was found to be highly sensitive, detecting all of the mutations in these 6 exons that were identified by DNA sequencing. Our data suggest that DHPLC is a costeffective, rapid, and sensitive test for screening for mutations of c-kit and PDGFRA in GISTs. Gastrointestinal stromal tumors (GISTs) are mesenchymal neoplasms typically arising in the stomach, small intestine, colon, and other anatomic sites in the abdominal cavity. 1 These tumors are characterized by the strong expression of the receptor tyrosine kinase c-kit (CD117), which is now accepted as the most specific immunohistochemical marker for GIST. 1,2 Recent studies have shown that approximately 60% to 70% of GISTs carry mutations in c-kit, 3 which encodes a member of the type III tyrosine kinase gene family. 4 The 4 involved exons, ie, 9, 11, 13, and 17, correspond to the extracellular, juxtamembranous, tyrosine kinase 1, and tyrosine kinase 2 domains of the c-kit protein, respectively. 3 These mutations result in constitutive activation of the tyrosine kinase activity of c-kit, which is believed to be the major oncogenic event in these tumors. 4-7 For cases showing no evidence of c-kit mutations, most carry mutations of the PDGFRA gene. 8 Similar to c-kit, PDGFRA is also a member of the type III tyrosine kinase family, and PDGFRA gene mutations found in GISTs result in constitutive activation of this tyrosine kinase, which contributes to the tumorigenesis. 8 It is interesting that mutations of these 6 exons (ie, 4 in c-kit and 2 in PDGFRA) are mutually exclusive in the majority of GISTs; excluding single nucleotide polymorphisms (SNPs), cases carrying multiple mutations of these 6 exons are exceedingly rare. In view of the importance of c-kit and PDGFRA in GIST, tyrosine kinase inhibitors such as imatinib have been used to treat GIST. 9 Imatinib resistance, found in a proportion of patients with GIST, correlates with mutations of specific exons in c-kit. Specifically, patients with tumors carrying mutations of exon 9 are more likely to show resistance, whereas those with tumors carrying mutations of exon 11 are more likely to show a good response. 10 Mutations of exons 12 Am J Clin Pathol 2010;133: DOI: /AJCP1FNW7RGZFTYU 149

2 Battochio et al / c-kit and PDGFRA Mutations and 18 of PDGFRA also correlate with good responsiveness to imatinib, 11 except for a point mutation in amino acid 842 in PDGFRA exon 18, which confers absolute resistance. 12 Thus, detection and analysis of gene mutations of c-kit and PDGFRA have become a standard of care for patients diagnosed with GIST. With regard to the detection method, most of the previously published studies used DNA sequencing, which is a relatively labor-intensive and time-consuming procedure. A more efficient method for detecting gene mutations is that of denaturing high-pressure liquid chromatography (DHPLC), which has been used extensively to rapidly screen for gene mutations in research settings. 13 The other major advantage of DHPLC over DNA sequencing is that interpretation of the generated data is less subjective and labor-intensive. Because the vast majority of GISTs carry only 1 mutation in the 6 implicated exons, it would be more cost-effective if DNA sequencing were performed only to confirm and analyze mutations that are initially detected by DHPLC. To our knowledge, there are only a small number of publications describing the use of DHPLC to detect c-kit and PDGFRA mutations in GIST. 10,11,14-17 In most of these studies, the focus was not related to the validation of the DHPLC assay, and therefore, these studies are usually restricted to specific c-kit exons or a relatively small sample. Furthermore, only 1 of these studies used a well-defined single population cohort. 16 In this study, we aimed to validate the clinical diagnostic usefulness of DHPLC in detecting mutations of c-kit and PDGFRA in 54 consecutive cases of GIST that were derived from a well-defined population. Materials and Methods Patients and Tumor Samples Between 2006 and 2008, 54 patients were diagnosed with GIST at the Department of Laboratory Medicine and Pathology, Cross Cancer Institute, Edmonton, Canada. All of the patients resided in northern Alberta, and all of them were treated and followed up at our institution. The diagnosis of all cases was made and/or reviewed by our sarcoma pathologist (C.O.), who used the National Institutes of Health consensus risk criteria. 18 All newly diagnosed GIST cases were subjected to mutational analysis for c-kit and PDGFRA at our institution. DNA Extraction and Polymerase Chain Reaction Conditions All tumor samples were assessed for mutations in exons 9, 11, 13, and 17 of the c-kit gene and in exons 12 and 18 of the PDGFRA gene. Formalin-fixed, paraffin-embedded tissue sections were used for these studies. Specifically, at least 5 unstained tissue sections of 10 μm thickness were deparaffinized and air dried. Histologically confirmed tumorous areas were microdissected out using a sterile scalpel blade and scraped off the glass slides and added to 180 μl of ATL buffer (Qiagen, Valencia, CA). DNA was then extracted using the QIAamp DNA Mini kit (Qiagen) following the manufacturer s protocol. For DHPLC analysis, the polymerase chain reaction (PCR) mix consisted of 5 μl of 10 PCR buffer, 1 μl each of 10 μmol/l forward and reverse PCR primers, 0.4 μl of deoxynucleoside triphosphates, 0.5 μl of Optimase polymerase (Transgenomic, Omaha, NE), 2 to 3 mmol/l of magnesium (exon specific), and 200 ng of sample DNA. The PCR conditions were as follows: 94 C for 5 minutes, followed by 45 cycles of 94 C for 30 seconds, 56.5 C to 57.0 C (specific annealing temperatures in Table 1 ) for 1 minute and 72 C for 1 minute, and completed with an extension step at 72 C for 10 minutes. For DNA sequencing, the PCR mix consisted of 25 μl of HotStart master mix (Qiagen), 1 μl each of 10 μmol/l forward and reverse PCR primers, 2 mmol/l of magnesium, and 500 ng of sample DNA. The PCR conditions were as follows: 95 C for 15 minutes; followed by 45 cycles of 95 C for 30 seconds, 56 C (for c-kit) or 60 C (for PDGFRA) for 1 minute, and 72 C for 1 minute; and completed with an extension step at 72 C for 10 minutes. All PCR amplicons were stored at 4 C until use. The primer sequences for c-kit and PDGFRA, previously described in detail, 11,14 were purchased from Operon Technologies (Alameda, CA) and are listed in Table 1. DHPLC Analysis PCR amplicons were analyzed using the Transgenomic WAVE Nucleic Acid Fragment Analysis System (Transgenomic). The analysis was performed using 3 different melting temperatures, summarized in Table 2, which were determined by the WAVEMAKER software (Transgenomic). DNA extracted from peripheral blood mononuclear cells from healthy donors was included as wild-type control samples. DNA Sequencing PCR amplicons were purified using Exo-SAP-It (USB, Cleveland, OH) and sequenced in both directions using the BigDye Terminator version 3.1 Cycle sequencing kit and the 3100-Avant genetic analyzer (Applied Biosystems, Foster City, CA). The generated DNA sequences were analyzed using Sequence Analysis, version 5.1 (Applied Biosystems) and then aligned using SeqScape, version 2.1 (Applied Biosystems). DNA extracted from the peripheral blood mononuclear cells from healthy donors was included as wild-type control samples. All SNPs were identified based on the National Center for Biotechnology Information database of genetic variation. 19 The numbering of specific mutations and SNPs has been referenced from as of April 27, Am J Clin Pathol 2010;133: DOI: /AJCP1FNW7RGZFTYU

3 Anatomic Pathology / Original Article Table 1 Polymerase Chain Reaction Primer Sequences and Annealing Temperatures Annealing Temperature ( C) Denaturing High-Pressure Gene/Exon Primer Sequences (5 3 ) Liquid Chromatography Sequencing c-kit 9F AGCCAGGGCTTTTGTTTTCT R CAGAGCCTAAACATCCCCTTA 11F CCTTTGCTGATTGGTTTCGT R ACCCAAAAAGGTGACATGGA 13F1 GTTCCTGTATGGTACTGCATGCG R1 CAGTTTATAATCTAGCATTGCC 13F2 CATCAGTTTGCCAGTTGTGC R2 ACACGGCTTTACCTCCAATG PDGFRA 12F AAGCTCTGGTGCACTGGGACTT R ATTGTAAAGTTGTGTGCAAGGGA 18F TACAGATGGCTTGATCCTGAGT R AGTGTGGGAGGATGAGCCTG F, forward; R, reverse. The primer sets for c-kit and PDGFRA were previously described. 11,14 Table 2 Comparison of dhplc and DNA Sequencing Results for c-kit and PDGFRA Results Demographic Data Mutational analyses of c-kit and PDGFRA were assessed in 54 consecutively diagnosed cases of GIST using DHPLC and direct DNA sequencing. The patients included 33 men and 21 women, with a median age of 63.5 years (range, years) at the time of diagnosis. Of these 54 samples, the biopsy sites were stomach (30 cases [56%]), small intestine (17 cases [31%]), large intestine (4 cases [7%]), and mesentery/ omentum (3 cases [6%]). Detected by DHPLC Gene/Exon Variation Detected by DNA Sequencing Tm1 Tm2 Tm3 c-kit 9 Mutation Silent mutation SNP Mutation Mutation Mutation PDGFRA 12 Mutation Mutation SNP DHPLC, denaturing high-pressure liquid chromatography; SNP, single nucleotide polymorphism; Tm1, Tm2, and Tm3, first, second, and third sets of melting temperatures, respectively. Tm1: for c-kit, exon 9, 55.2 C; exon 11, 56.1 C; exon 13, 58.0 C; and exon 17, 57.6 C; and for PDGFRA, exon 12, 58.0 C; and exon 18, 61.0 C. Tm2: for c-kit, exon 9, 56.5 C; exon 11, 56.8 C; exon 13, 56.9 C; and exon 17, 58.0 C; and for PDGFRA, exon 12, 58.8 C; and exon 18, 61.8 C. Tm3: for c-kit, exon 9, 58.0 C; exon 11, 57.2 C; exon 13, 59.8 C; and exon 17, 58.4 C; and for PDGFRA, exon 12, 59.6 C; and exon 18, 62.6 C. DNA Sequencing Results DNA sequencing results obtained on all 54 samples are listed in Table 2 and summarized in Table 3. Overall, 47 (87%) cases showed evidence of a mutation in 1 of the 6 exons examined. Mutations of c-kit were detected in 40 cases (74%), with the mutations most frequently found in exon 11 (28 cases [52%]), followed by exon 9 (10 cases [19%]) and exon 13 (2 cases [4%]). No cases with mutated c-kit exon 17 were identified in our cohort. A total of 7 cases (13%) carried mutations of the PDGFRA gene, all of which involved exon 18. Mutations of these genes were mutually Am J Clin Pathol 2010;133: DOI: /AJCP1FNW7RGZFTYU 151

4 Battochio et al / c-kit and PDGFRA Mutations exclusive in all cases. We also found that the sites of mutation in c-kit and PDGFRA correlated with specific anatomic sites, as previously described in the literature. 20,21 Specifically, 9 of 10 tumors showing mutations in exon 9 of c-kit were located in the small intestine, and all 7 cases with PDGFRA mutations were found in the stomach. DHPLC Data Correlate With DNA Sequencing Results Of the 324 PCR reactions (ie, 6 reactions per case 54 cases) performed for DHPLC, PCR amplicons sufficient for DHPLC analysis were obtained in 318 reactions (98.1%). As summarized in Table 2, the sensitivity of DHPLC to detect mutations in these 6 exons was found to be 100%. In Table 3 Summary of DNA Sequencing Results in 54 Consecutive Gastrointestinal Stromal Tumor Cases Case No./ Gene Exon Nucleotides Codon No. Sex/Age (y) Anatomic Site Involved Involved Type of Mutation Involved Involved SNPs 1/F/51 Large bowel c-kit 11 Deletion /M/68 Small bowel c-kit 11 Deletion Exon 18 3/F/60 Stomach c-kit 11 Deletion /M/54 Large bowel c-kit 11 Deletion Exon 18 5/F/39 Large bowel c-kit 11 Deletion /F/77 Stomach c-kit 11 Deletion /F/72 Large bowel c-kit 11 Deletion Exon 18 8/F/59 Small bowel c-kit 11 Deletion /F/63 Small bowel c-kit 11 Deletion /F/76 Stomach c-kit 11 Deletion /F/67 Stomach c-kit 11 Deletion /M/44 Stomach c-kit 11 Duplication/insertion Starts at /M/78 Stomach c-kit 11 Duplication/insertion Starts at /M/67 Stomach c-kit 11 Duplication/insertion Starts at /M/69 Stomach c-kit 11 Point mutation /F/84 Omentum c-kit 11 Point mutation /M/72 Stomach c-kit 11 Point mutation Exon 18 18/M/70 Stomach c-kit 11 Point mutation Exon 18 19/F/71 Small bowel c-kit 11 Point mutation Exon 18 20/M/61 Stomach c-kit 11 Point mutation /F/53 Stomach c-kit 11 Point mutation /M/86 Stomach c-kit 11 Point mutation Exon 18 23/M/70 Small bowel c-kit 11 Point mutation /M/70 Stomach c-kit 11 Point mutation /F/85 Stomach c-kit 11 Point mutation /M/61 Stomach c-kit 11 Point mutation /M/82 Stomach c-kit 11 Substitution /F/73 Stomach c-kit 11 Substitution /M/72 Stomach c-kit 13 Point mutation Exon 18; exon 10 30/F/52 Small bowel c-kit 13 Point mutation /M/80 Omentum c-kit 9 Duplication Exon 10 32/M/46 Small bowel c-kit 9 Duplication Exon 18 33/M/53 Small bowel c-kit 9 Duplication /M/38 Small bowel c-kit 9 Duplication /M/73 Small bowel c-kit 9 Duplication /F/66 Small bowel c-kit 9 Duplication /M/39 Small bowel c-kit 9 Duplication /M/70 Stomach c-kit 9 Duplication Exon 18 39/M/33 Small bowel c-kit 9 Duplication Exon 10 40/M/37 Small bowel c-kit 9 Duplication Exon 10 41/M/55 Stomach PDGFRA 18 Deletion /M/50 Stomach PDGFRA 18 Deletion Exon 10 43/F/64 Stomach PDGFRA 18 Deletion Exon 10 44/M/35 Stomach PDGFRA 18 Point mutation /F/53 Stomach PDGFRA 18 Point mutation /M/46 Stomach PDGFRA 18 Point mutation Exon 18 47/M/56 Stomach PDGFRA 18 Point mutation /F/50 Small bowel None 49/M/71 Stomach None 50/M/69 Small bowel None Exon 18 51/M/22 Stomach None 52/M/59 Mesentery None 53/F/40 Stomach None Exon 18 54/F/74 Stomach None SNP, single nucleotide polymorphism. The numbering of specific mutations and SNPs was referenced from as of April 27, SNP at base pair 1697 in exon 10. Silent mutation at base pair 1714 in exon Am J Clin Pathol 2010;133: DOI: /AJCP1FNW7RGZFTYU

5 Anatomic Pathology / Original Article other words, all 47 cases showing mutations detectable by DNA sequencing were found to have an abnormal DHPLC pattern at 1 or more melting temperatures. As illustrated in Figure 1, while most abnormal DHPLC patterns were relatively obvious, rare cases showing only subtle changes in the DHPLC pattern turned out to be positive for mutation by DNA sequencing. Based on the results summarized in Table 2, it is evident that the use of multiple melting temperatures for DHPLC is important to optimize the sensitivity because 2 (4%) of the 47 abnormal cases failed to show an abnormal pattern at all 3 melting temperatures (as illustrated in Figure 1). Specifically, the first case that carried a mutation in exon 11 of c-kit showed the abnormal DHPLC pattern at only 1 temperature; the second case that carried a mutation in exon 13 of c-kit showed the abnormal DHPLC pattern at 2 of the 3 temperatures. An abnormal DHPLC pattern was also highly specific for DNA alterations. In addition to the mutations searched for, we also detected 18 cases showing an abnormal DHPLC pattern that was related to 2 groups of heterozygous SNPs or a silent mutation in exon 10. The first group of SNPs is in exon 18 of PDGFRA, which is a single silent point mutation (C>T) at nucleotide DHPLC and DNA sequencing were successful in detecting 13 cases (24% overall) that carried this SNP. The second group of SNPs is in exon 10, which were Melting temperature 1 Melting temperature 2 Normal DHPLC pattern Abnormal DHPLC pattern seen in most cases detectable because the PCR primer set used to amplify exon 11 of c-kit covers a small segment of exon 10. This SNP is related to a point mutation at nucleotide 1697 that results in a methionine > leucine change at codon 541. A total of 3 cases (6% overall) were found to have this specific SNP, which was detectable by DHPLC and DNA sequencing. Three other cases carried a silent point mutation at nucleotide 1714 of exon 10. This alteration has not been described as an SNP. Overall, these DNA alterations are mutually exclusive, with only 1 of 18 cases carrying more than 1 of these SNPs or silent mutations (case 29, Table 3). Pattern of c-kit Mutations in Our Single Population- Based Cohort To our knowledge, there is only 1 published study in which the GIST cases were based on a defined single population. 16 Thus, we compared the frequency and pattern of c-kit and PDGFRA mutations identified in our cohort with those previously published. Overall, our findings were similar to those described in the literature. For example, mutations of c-kit were detected in 40 cases (74%) in our cohort, which is comparable to those reported previously (60%-80%). 3 In keeping with the literature, 22 these mutations were found most frequently in exon 11 (28 cases [52%]). Regardless of the type of mutation, these alterations were clustered in a Relatively subtle changes seen in rare cases Abnormal DHPLC pattern seen in only one melting temperature Melting temperature 3 Figure 1 Denaturing high-pressure liquid chromatography (DHPLC) patterns seen in the study. For the case in which the abnormal DHPLC pattern was seen at only 1 melting temperature, the arrow highlights the abnormality. Am J Clin Pathol 2010;133: DOI: /AJCP1FNW7RGZFTYU 153

6 Battochio et al / c-kit and PDGFRA Mutations small region between codon 552 and codon 586, as previously described. 22 Nevertheless, the reported frequencies of the mutations in exon 11 are relatively variable in the literature, and our results are slightly different from those reported in some of the previous studies. Specifically, the frequency of mutations in exon 11 in our cohort (52%) is similar to that reported by Metaxa-Mariatou et al 16 (8/16 cases [50%]) and Corless et al 15 (422/722 cases [58.4%]), but substantially different from that reported by Debiec-Rychter et al 11 (24/29 cases [83%]). Regarding cases with duplications in exon 11, we found a frequency of 11% (3/28 cases), which is similar to those reported in previous studies (12%-14.3%). 23,24 However, our finding that 12 (43%) of 28 cases with exon 11 point mutations is higher than that published in the literature (19%-27.3%). 25 This point is of clinical importance because it has been reported that gastric GISTs with point mutations of exon 11 carry a better prognosis compared with deletions in this exon. 25 With regard to the mutations in exon 9 of c-kit, all 10 cases had the same duplication of 6 base pairs resulting in codon 502 and 503 duplication, as previously published. 26 We also observed a correlation between exon 9 mutations and involvement of the small intestine. 25 However, the frequency (10/54 cases [19%]) is substantially higher than that reported in 1 study (10/200 cases [5.0%]). 25 Pattern of PDGFRA Mutations in Our Single Population- Based Cohort PDGFRA mutations were found in 7 cases (13%), and this is in accordance with published data (5%-10%). 3 All of these mutations involved exon 18, and this is also in keeping with the published data that the vast majority of mutations in PDGFRA are in exon 18. 3,27 With regard to the specific mutations, we found that most (4/7 cases [57%]) had a point mutation involving nucleotide 2673 (Asp842Val), which has been described as the most common alteration in this exon. 25 As discussed earlier, this point mutation confers absolute resistance to imatinib. 12 Of the remaining 3 cases, 2 had a deletion of 4 amino acid residues at codon , and 1 case had a deletion of 4 amino acid residues at codon ; the finding of deletions in exon 18 at a location close to codon 842 has been previously described. 25 Discussion As discussed, DHPLC has several advantages over DNA sequencing in detecting gene mutations. The major objective of this study was to determine if DHPLC can be used routinely as the initial screening assay to detect mutations of c-kit and PDGFRA in GISTs. Our results suggest that DHPLC is highly sensitive in detecting the mutations of the 6 important exons included in this study. In view of our results, we propose that DHPLC be used as the initial screening method, with DNA sequencing being used only to fully analyze the implicated exons. Because most GIST cases have only 1 mutation and only a subset of cases (ie, 18/54 [33%] in our cohort) carry a coexisting SNP or a specific silent mutation in exon 10 of c-kit, the workload related to DNA sequencing can be dramatically reduced. Specifically, in our cohort of 54 cases, we could have performed only 66 (20.4%) of a total of 324 (ie, 54 6 exons) sequencing reactions, and this represents a substantial saving on reagents and labor cost. Thus, this use of DHPLC as a screening test will result in improved cost-effectiveness and a shortened turnaround time. Our conclusion regarding the use of DHPLC for GISTs is in parallel to that of another study detecting EGFR mutations in non small cell lung cancer. 28 Our results also suggest that the sensitivity of DHPLC is dependent on the use of multiple melting temperatures, as evidenced by the 2 cases in our cohort that did not show an abnormal DHPLC pattern at all 3 melting temperatures (Table 2). The importance of using multiple melting temperatures for DHPLC was revealed in another study of GIST, in which 3 of 16 cases screened for mutations in exon 11 of c-kit showed an abnormal pattern at only 1 of the 2 melting temperatures used. 16 To optimize the sensitivity of DHPLC in a clinical laboratory setting, we recommend that all suspicious patterns be subjected to DNA sequencing because changes in the DHPLC pattern can be relatively subtle, as illustrated in Figure 1. Nevertheless, in our experience, these subtle cases are relatively uncommon. We found 3 cases with point mutations in exon 10 of c-kit, all showing a silent point mutation in exon 10 at nucleotide To our knowledge, this alteration has not been previously reported, and its clinical significance is unknown. Regarding alterations of exon 10 of c-kit, there are 2 previous reports describing deletions in intron that create a novel intraexonic pre messenger RNA 3' splice acceptor site consistently leading to in-frame deletion of codon 550 to codon 558 at the protein level. 25 In 1 of these reports, these alterations in intron were found at a frequency of 3.9% (19/488 cases with c-kit exon 11 mutations). 15 However, we did not find such deletions in our cohort. In this study, we consistently detected a homozygous silent mutation in exon 12 of PDGFRA, involving a single point mutation of adenine to guanine at nucleotide 1849, in all patient samples and in the normal control samples. This mutation, which was found to be identical in all cases, has been described as an SNP in the National Center for Biotechnology Information database. 19 Nevertheless, in view of the fact that we detected this alteration in all samples we tested, we do not believe that this truly represents an SNP in our population. Of note, because this mutation is always 154 Am J Clin Pathol 2010;133: DOI: /AJCP1FNW7RGZFTYU

7 Anatomic Pathology / Original Article homozygous, its presence was not detected by DHPLC, and, therefore, it will not trigger further investigation by DNA sequencing studies. From the Departments of 1 Laboratory Medicine and Pathology and 2 Medicine, Cross Cancer Institute and University of Alberta, Edmonton, Canada; and 3 DynaLIFE Dx Diagnostic Laboratory Services, Edmonton. Address reprint requests to Dr Lai: Dept of Laboratory Medicine and Pathology, Cross Cancer Institute and University of Alberta, University Ave, Edmonton, Canada T6G 1Z2. Drs Battochio and Mohammed contributed equally to this work. Acknowledgments: We thank C.L. Corless, MD, and his laboratory for their generous sharing of the method for detecting c-kit and PDGFRA mutations. References 1. Miettinen M, Lasota J. Gastrointestinal stromal tumors: definition, clinical, histological, immunohistochemical, and molecular genetic features and differential diagnosis. Virchows Arch. 2001;438: Sarlomo-Rokala M, Kovatich AJ, Barusevicius A, et al. CD117: a sensitive marker for gastrointestinal stromal tumors that is more specific than CD34. Mod Pathol. 1998;11: Corless CL, Heinrich MC. Molecular pathobiology of gastrointestinal stromal sarcomas. Annu Rev Pathol. 2008;3: Besmer P, Murphy JE, George PC, et al. A new acute transforming feline retrovirus and relationship of its oncogene v-kit with the protein kinase gene family. Nature. 1986;320: Pawson T. Regulation and targets of receptor tyrosine kinases. Eur J Cancer. 2002;38(suppl 5):S3-S Fletcher JA. Role of KIT and platelet-derived growth factor receptors as oncoproteins. Semin Oncol. 2004;31(2 suppl 6): Hirota S, Isozaki K, Moriyama Y, et al. Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors. Science. 1998;279: Heinrich MC, Corless CL, Duensin A, et al. PDGFRA activating mutations in gastrointestinal stromal tumors. Science. 2003;279: Tuveson DA, Willis NA, Jacks T, et al. STI571 inactivation of the gastrointestinal stromal tumor c-kit oncoprotein: biological and clinical implications. Oncogene. 2001;20: Corless CL, Fletcher JA, Heinrich MC. Biology of gastrointestinal stromal tumor. J Clin Oncol. 2004;22: Debiec-Rychter M, Dumez H, Judson I, et al. Use of c-kit/ PDGFRA mutational analysis to predict the clinical response to imatinib in patients with advanced gastrointestinal stromal tumours entered on phase I and II studies of the EORTC Soft Tissue and Bone Sarcoma Group. Eur J Cancer. 2004;40: Heinrich MC, Corless CL, Demetri GD, et al. Kinase mutations in imatinib response in patients with metastatic gastrointestinal stromal tumor. J Clin Oncol. 2003;21: Oefner PJ, Underhill PA. Comparative DNA sequencing by denaturing high-performance liquid chromatography (DHPLC) [abstract]. Am J Hum Genet. 1995;57(suppl):A Corless CL, McGreevey L, Haley A, et al. KIT mutations are common in incidental gastrointestinal stromal tumors one centimeter or less in size. Am J Pathol. 2002;160: Corless CL, McGreevey L, Town A, et al. KIT gene deletions at the intron 10 exon 11 boundary in GI stromal tumors. J Mol Diagn. 2004;6: Metaxa-Mariatou V, Papadopoulos S, Papadopoulou E, et al. Molecular analysis of GISTs: evaluation of sequencing and dhplc. DNA Cell Biol. 2004;23: Zamo A, Bertolaso A, Fraceschetti I, et al. Microfluidic deletion/insertion analysis for rapid screening of KIT and PDGFRA mutations in CD117-positive gastrointestinal stromal tumors. J Mol Diagn. 2007;9: Fletcher CD, Berman JJ, Corless C, et al. Diagnosis of gastrointestinal stromal tumors: a consensus approach. Hum Pathol. 2002;33: Sherry ST, Ward MH, Kholodov M, et al. dbsnp: the NCBI database of genetic variation. Nucleic Acids Res. 2001;29: Lasota J, Wozniak A, Sarlomo-Rikala M, et al. Mutations in exon 9 and 13 of KIT gene are rare events in gastrointestinal stromal tumors: study of two hundred cases. Am J Pathol. 2000;157: Lasota J, Dansonka-Mieszkowska A, Sobin LH, et al. A great majority of GISTs with PDGFRA mutations represent gastric tumors of low or no malignant potential. Lab Invest. 2004;84: Hirota S, Isozaki K. Pathology of gastrointestinal stromal tumors. Pathol Int. 2006;56: Martin J, Poveda J, Llombart-Bosch A, et al. Deletions affecting codons of the c-kit gene indicate a poor prognosis in patients with completely resected gastrointestinal stromal tumors: a study by the Spanish Group for Sarcoma Research (GEIS). J Clin Oncol. 2005;23: Andersson J, Bumming P, Meis-Kindblom JM, et al. Gastrointestinal stromal tumors with KIT exon 11 deletions are associated with poor prognosis. Gastroenterology. 2006;130: Lasota J, Miettinen M. KIT and PDGFRA mutation in gastrointestinal stromal tumors (GISTs). Semin Diagn Pathol. 2006;23: Hostein I, Longy M, Gastaldello B, et al. Detection of a new mutation in KIT exon 9 in a gastrointestinal stromal tumor. Int J Cancer. 2006;118: Corless CL, Schroeder A, Griffith D, et al. PDGFRA mutations in gastrointestinal stromal tumors: frequency, spectrum and in vitro sensitivity to imatinib. J Clin Oncol. 2005;23: Cohen V, Agulnik J, Jarry J, et al. Evaluation of denaturing high-performance liquid chromatography as a rapid detection method for identification of epidermal growth factor receptor mutations in nonsmall-cell lung cancer. Cancer. 2006;107: Am J Clin Pathol 2010;133: DOI: /AJCP1FNW7RGZFTYU 155