Supplementary Online Content

Transcription

1 Supplementary Online Content McKiernan J, Donovan MJ, O Neill V, et al. A Novel Urine Exosome Gene Expression Assay to Predict High-Grade Prostate Cancer at Initial Biopsy [published online March 3, 216]. JAMA Oncology. doi:1.11/jamainternmed etable 1. Subject enrollment by study site 2. Supplemental Methods 3. etable 2. Primer and probe sequences and concentrations 4. Supplemental Statistical Analysis 5. etable 3. Demographics of training and validation intended use groups 6. etable 4. Clinical Characteristics of 12 False Negative Patients in Validation Cohort 7. etable 5A. Combined Initial and Repeat Biopsy cohort Demographics 8. etable 5B. Performance of EXODX PROSTATE INTELLISCORE in the combined initial and repeat biopsy cohort. 9. etable 6. 9% fixed sensitivity analysis of ExoDx Prostate IntelliScore in the intended use validation cohort with applied cut-off. 1. efigure 1. : Clinical decision curve analysis Downloaded From: on 12/31/218

2 Downloaded From: on 12/31/218 Supplement etable 1: Subject enrollment by study site

3 Site ID Trial Sites Subjects City State TCO 21st Century Oncology 12 Fort Lauderdale FL AMP Associated Medical Professionals of N.Y. PLCC 56 Syracuse NY AUN Associated Urologists of North Carolina 176 Raleigh NC COM Comprehensive Medical Center 133 Royal Oak MI DVU Delaware Valley Urology - Voorhees 234 Voorhees NJ EHS Erlanger Institute for Clinical Research 4 Chattanooga TN FVU Five Valleys Urology 33 Missoula MT JHU Johns Hopkins University 67 Baltimore MD IEL Metropolican Urologic Services 9 Elmont NY PMG Premier Medical Group of the Hudson Valley 19 Poughkeepsie NY PUG Premier Urology Group 68 Edison NJ ROS Radiation Oncology of San Antonio 59 San Antonio TX GHS Regional Urology - Cross Creek/Greenville Health System 32 Greenville SC SRG Southeastern Research Group 34 Tallahassee FL SUA Southeastern Urology Associates 2 Macon GA UMI University of Michigan Health System 27 Ann Arbor MI UUA University Urology Associates 21 New York NY USE Urologic Consultants of Southeast Pennslyvania 114 Bala Cynwyd PA UCR Urology Center Research Institute 136 Englewood NJ UNT Urology Clinics of North Texas 85 Dallas TX UHS Urology Health Specialists 16 Bryn Mawr PA UVA Urology of Virginia 172 Virginia Beach VA Supplemental Methods Exosome Isolation and RNA extraction from Urine Upon receipt in the laboratory a 2 ml volume of the submitted urine specimen was filtered through a.8 micron syringe filter and the filtered urine was frozen at -8 C. At the initiation of testing the samples were removed and thawed with gentle mixing. The exosomes were isolated from the urine using the Exosome Diagnostics (St Paul, MN) EXOPRO Urine Clinical Sample Concentrator Kit. The kit contains the exosome isolation filter; internal (QBETA bacteriophage) control and the RNA extraction reagents and materials. 12 The exosomes are collected, washed and concentrated by ultra filtration centrifugation. Prior to isolation the Internal Control was added to each 2 ml urine sample. For each extraction performed a positive control urine pool was included in the test group. The urine pool was created and evaluated by Exosome Dx clinical laboratory to detect values for all genes including SPDEF, ERG and PCA3 at CT levels equivalent to positive prostate cancer patient samples. Downloaded From: on 12/31/218

4 The RNA extraction was performed according to the manufacturer s protocol. The kit contains a chaotropic lysis reagent and silica spin columns. The RNA was eluted from the column in a volume of 2 µl RNase-DNase free water. RNA Reverse Transcription and qpcr (RT-qPCR) The RNA (14 µl) was reverse transcribed to cdna using the random primers included in the Superscript VILO kit (Life Technologies, Carlsbad, CA) in a total volume of 24 µl, with a modification of the manufacturer s procedure. A negative (water) and positive RT control RNA (AmpTec, Hamburg, Germany) were included with each batch of samples processed. The following was added to the qpcr reaction mix (TaqMan Fast Universal PCR Master Mix, Life Technologies): 2 µl of cdna,.5 U of uracil-n-glycosylase (Roche) to eliminate potential amplicon contaminates, primers, and probes. The sequences and concentrations of primers and probes are provided in Supplementary Table 2A. Probes for all markers span the junctions of the amplified exons so that unspliced mrna is not detected. Noteworthy, the ERG primers, which target exons 1 and 11, were designed to detect wild-type ERG and most fusion partners, including the most common TMPRSS2-ERG. Real time qpcr was performed using the following program on the QIAGEN Rotor-Gene Q MDx System (Qiagen, Venlo, Netherlands): 5 C for 2 min, 95 C for 5 min, followed by 4 cycles of (95 C for 5 s, 6 C for 1 s). Results were analyzed using the Rotor-Gene Q Series Software 2.1. (Build 9). Samples were excluded based on RT-qPCR data if either of the following are not identified: A). Internal controls are within +3 s.d. from the mean of all internal control values in the cohort and B). SPDEF detected at >3 copies per reaction. Additional exclusion was related to specimen volume at the time of receipt. The validation protocol outlined sample collection volumes to be 25-49ml. Any sample outside this range was rejected. To optimize performance we restricted volume to <49mls in the validation trial. Supplemental etable 2. Primer and probe sequences and concentrations Primer/ Probe Name Sequence Ref Seq and Nucleotide Positions Final Conc. (µm) Downloaded From: on 12/31/218

5 ERG Forward GCGTCCTCAGTTAGATCCTTATCAG Ref Seq NM_ , Pos ERG Reverse CTGGCCACTGCCTGGATT Ref Seq NM_ , Pos ERG Probe 5 6FAM- CTTGGACCA/ZEN/ACAAGTAGCCGCCTTGC- 3 IABkFQ Ref Seq NM_ , Pos SPDEF Forward CCACCTGGACATCTGGAAG Ref Seq NM_ , Pos SPDEF Reverse AATCGCCCCAGGTGAAGT Ref Seq NM_ , Pos SPDEF Probe 5 6-FAM- CGGCCTGGA/ZEN/TGAAAGAGCG- 3 IABkFQ Ref Seq NM_ , Pos PCA3 Forward GCACATTTCCAGCCCCTTTA Ref Seq NR_ , Pos PCA3 Reverse GGCATTTCTCCCAGGGATCT Ref Seq NR_ , Pos PCA3 Probe 5 6FAM- CACACAGGA/ZEN/AGCACAAAAGGAAGC- 3 IABkFQ Ref Seq NR_ , Pos STATISTICAL ANALYSIS Urine samples have been collected from patients enrolled between June 214 and April 215. The interim population served as training cohort to identify a binary cut-point for the ExoDx Prostate IntelliScore assay. The objective was to obtain a binary predictor for high grade cancer with a negative predictive value greater than 9%. This was achieved by a range of possible cut-points to maximize the Youden J-Statistic for an optimal combination of sensitivity and specificity. Logistic regression was used to perform outcome prediction for high grade cancer as function of standard of care parameters (SOC). Two different models have been derived, one that uses SOC parameters alone (i.e. PSA, age, race and family history of prostate cancer), and one that uses SOC and ExoDx Prostate IntelliScore. SOC parameters have been encoded as in the PCPTRC risk calculator (age in years, log-transformed serum PSA (base 2), race (African-American=1 / Other=1), and family history of prostate cancer (yes=1/no=)). ExoDx Prostate IntelliScore has been incorporated as a continuous variable. The objective was to compare AUC performance of the linear predictor scores of the two models. The null hypothesis was that there is no difference of the AUC between the SOC-models with and without ExoDx Prostate IntelliScore. The alternative was one-sided to demonstrate an AUCimprovement by adding ExoDx Prostate IntelliScore to the SOC model. Downloaded From: on 12/31/218

6 The SOC- and SOC + ExoDx Prostate IntelliScore-model have been fitted to the training set (interim analysis data set) and the validation set of patients. The AUC comparison of the SOC-models with and without ExoDx Prostate IntelliScore has been performed within both cohorts. Furthermore, models fitted to the training set have been applied to the validation set to address a potential of over-fitting bias. Within the training set and the validation set we evaluated 2 different analysis populations for an AUC difference between SOC and SOC + ExoDx Prostate IntelliScore: Analysis population 1 (intended use: PSA 2-1, first time biopsy), analysis population 2 (extended population, PSA 2-1, first and repeat biopsy). ExoDx Prostate IntelliScore Scale ExoDx Prostate IntelliScore is a score derived from qpcr-based CT values. It does not have an intuitive unit. In order to obtain an interpretable scale for ExoDx Prostate IntelliScore we transformed the ExoDx Prostate IntelliScore output to yield a number between and 3 for the majority of cases. However, there is no upper and lower limit for the score, such that extreme cases can have scores outside the range. Another approach, which was also implemented, uses univariable logistic regression to transform ExoDx Prostate IntelliScore into a number between and 1. The logistic regression model has been fitted to the training set to predict high grade cancer from the original EXODX PROSTATE INTELLISCORE score as single predictor variable. The resulting to 1 score has been used as threshold probability in decision curve analysis. Performance (sensitivity, specificity, positive predictive value [PPV], and negative predictive value [NPV]) of the binary ExoDx Prostate IntelliScore score for prediction of biopsy result (negative versus positive for high-grade cancer [Gleason Score 7]) was assessed by 2x2 contingency tables with confidence intervals (CI; Wald-intervals) computed from standard errors (SE), assuming a binomial proportion. An ExoDx Prostate IntelliScore of 15.6 was used to discriminate biopsy-positive from biopsy-negative results. The sample size was chosen based on prior studies which identified a positive biopsy rate of 45-5% with a 2-25% Gleason score >7 along with an intended use group of 7% which is sufficient to evaluate AUC and NPV assay performance in the current enrolled population. Improvement of the predictive performance of SOC parameters by the ExoDx Prostate IntelliScore was assessed as follows: SOC parameters alone (PSA, age, race and family history of PCa) as well as SOC parameters together with ExoDx Prostate IntelliScore were modeled by logistic regression to predict the binary outcome of high-grade disease in initial biopsy samples. A binary cut-point was chosen on the linear predictor scores of both models with and without ExoDx Prostate IntelliScore and at a sensitivity of 9%. ROC analysis of ExoDx Prostate IntelliScore was used to further assess the discrimination between biopsy-positive (for high-grade cancer) and biopsy negative results and to compare Downloaded From: on 12/31/218

7 Downloaded From: on 12/31/218 ExoDx Prostate IntelliScore and SOC. Further, a logistic regression model combining ExoDx Prostate IntelliScore and SOC as predictors has been added to the ROC analysis. Confidence intervals of AUCs were generated using non-parametric methods [12].

8 etable 3: Demographics fo training and validation intended use groups Train Test Total Age (Median/Range) 62 (5-79) 63 (5-9) PSA (Median/Range) 4.95 (2-1) 5.12 (2-1) Ethnicity Caucasian 174 (7%) 377 (74%) African American 46 (19%) 87 (17%) Hispanic 16 (6%) 32 (6%) Asian or Pacific Islander 6 (2%) 13 (3%) Other 6 (2%) 3 (1%) DRE Non-Suspicious 182 (77%) 352 (82%) Suspicious 55 (23%) 77 (18%) Family History No 191 (75%) 396 (77%) Yes 64 (25%) 117 (23%) Biopsy Result negative 135 (53%) 269 (52%) positive 12 (47%) 25 (48%) ASAP No 26 (81%) 455 (88%) Yes 48 (19%) 64 (12%) HGPIN No 25 (81%) 428 (82%) Yes 49 (19%) 91 (18%) Gleason Score GS=6 42 (35%) 13 (41%) GS= (37%) 84 (33%) GS= (12%) 36 (14%) GS=8 12 (1%) 11 (4%) GS=9 and higher 8 (7%) 17 (7%) Total GS=3+4 and higher 78 (31%) 148 (29%) ASAP = atypical small acinar proliferation; DRE = digital rectal examination; GS= Gleason Score; HGPIN = high-grade prostatic intraepithelial neoplasia; PSA = prostate-specific antigen. Downloaded From: on 12/31/218

9 Results of Secondary Endpoints Supplemental etable 4. Clinical Characteristics of 12 False Negative Patients in Validation Cohort Primary + Secondary GS False Negative High Grade Cases Total Biopsy Cores Cores Postive Age (years) Serum PSA (ng/ml) Ethnicity DRE Family Historie of Prostate Cancer Hispanic Non-Suspicious No Caucasian Non-Suspicious Yes African American Suspicious Yes Caucasian Non-Suspicious No Asian/Pacific Islander NA No Caucasian Non-Suspicious No Caucasian Suspicious No Caucasian NA No African American NA No Caucasian Non-Suspicious No Caucasian Non-Suspicious No Caucasian Non-Suspicious No Supplementary etable 5A. Combined Initial and Repeat Biopsy cohort Demographics Train Test Total Age (Median/Range) 64 (5-8) 64 (5-9) Downloaded From: on 12/31/218

10 Downloaded From: on 12/31/218 PSA (Median/Range) 5.2 (2-1) 5.3 (2-1) Ethnicity Caucasian 238 (73%) 477 (72%) African American 52 (16%) 114 (17%) Hispanic 22 (7%) 43 (7%) Asian or Pacific Islander 7 (2%) 16 (2%) Other 8 (2%) 1 (2%) DRE Non-Suspicious 238 (76%) 448 (82%) Suspicious 74 (24%) 11 (18%) Family History No 255 (76%) 54 (76%) Yes 8 (24%) 156 (24%) Biopsy Result negative 193 (58%) 368 (55%) positive 142 (42%) 3 (45%) ASAP No 275 (82%) 589 (88%) Yes 59 (18%) 79 (12%) HGPIN No 271 (81%) 542 (81%) Yes 63 (19%) 126 (19%) Gleason Score GS=6 55 (39%) 134 (45%) GS= (34%) 97 (32%) GS= (11%) 4 (13%) GS=8 14 (1%) 13 (4%) GS=9 and higher 9 (6%) 17 (6%) Total GS=3+4 and higher 87 (26%) 167 (25%)

11 Supplementary etable 5B. Performance of EXODX PROSTATE INTELLISCORE in the combined initial and repeat biopsy cohort. Biopsy Result Biopsy High Grade Biopsy negative and low grade Total Performance SE 95% CI ExoDx Prostate IntelliScore > cut point Sensitivity % ExoDx Prostate IntelliScore </= cut point Specificity % Total PPV % High Grade Biopsy Prevalence % 25. Fraction predicted negative NPV % Downloaded From: on 12/31/218

12 The binary performance measures NPV, PPV, and specificity were computed at a 9% fixed sensitivity. The impact of the ExoDx Prostate IntelliScore on predictive accuracy was further assessed by fixing the sensitivity at 9% and determining the differences in specificity, PPV and NPV (Supplementary Table 5A). With this approach ExoDx Prostate IntelliScore with or without SOC was superior to either SOC or the PCPTRC 2.. There were significant differences in specificity between the individual models, including 36% for ExoDx Prostate IntelliScore, with or without SOC vs. 23% and 22% for SOC and PCPTRC, respectively. Supplmentary etable 6: 9% fixed sensitivity analysis of ExoDx Prostate IntelliScore in the intended use validation cohort with applied cut-off. Fixed 9% Sensitivity Analysis of Intended use population Sensitivit y Specificit y 95% CI NPV 95% CI PPV 95% CI Percent negative ExoIntelliScore ExoIntelliScore +SOC SOC PCPTRC Downloaded From: on 12/31/218

13 Downloaded From: on 12/31/218 efigure 1: Clinical decision curve analysis estimating the effect of ExoDx Prostate IntelliScore in predicting Gleason 7 prostate cancer across a range of empiric threshold probabilities. ExoDx Prostate IntelliScore and SOC (PSA, age, race, family history of prostate cancer) have been subjected to a net-bentfit analysis. Both ExoDx Prostate IntelliScore (model 1): red line, and SOC (model 2): blue line, yield a clinical net- benfit over biopsying all men (black vertical line) and biopsying no men (black horizontal line). As illustrated, ExoDx Prostate IntelliScore has the highest net benefit along the range of biopsy thresholds 1% and 4%, after which there is a net benefit regardless of model selected.

14 Downloaded From: on 12/31/218