A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset:

Size: px

Start display at page:

Download "A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset:"

Noah Davis
6 years ago
Views:

1 A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset: Josh Glason: Sales Manager, DiaSorin Australia Pty Ltd September 6, 2014 This product is not currently registered with the TGA

Background The rearrangement of chromosome 9 and 22 leads to the Philadelphia Chromosome formation, characterized by the BCR-ABL translocation ABL BCR Chromosome 22 BCR ABL Depending on chromosomal

2 Background The rearrangement of chromosome 9 and 22 leads to the Philadelphia Chromosome formation, characterized by the BCR-ABL translocation ABL BCR Chromosome 22 BCR ABL Depending on chromosomal breakpoint locations, different isoforms of BCR and ABL genes fusion are possible; the most common are: p210 (Mbcr) b2a2, b3a2 p190 (mbcr) e1a2 BCR-ABL translocation is responsible for neoplastic transformation: Chromosome 9 Chromosome Philadelphia 95% Chronic Myeloid Leukemia 30% Acute Lymphoblastic Leukemia

3 Diagnostic work-up of Philadelphia Positive Leukemias Blood withdrawal: complete cell count = hematologic disorder Morphologic analysis on peripheral blood/bone marrow = diagnosis of Acute Lymphoblastic Leukemia = Suspiction of Chronic Myeloid Leukemia Conventional Reverse Transcription- PCR Genetic testing Molecular qualitative, karyotype, FISH Immunophenotyping, flow-cytometry = diagnosis of subtype of Leukemia = risk stratification = Van Dongen et al, Leukemia 1999 TREATMENT Molecular quantitative genetic testing

4 Limitations of conventional RT-PCR

5 Limitations of conventional RT-PCR Total RNA Reverse Transcription Amplification by PCR Gel electrophoresis 3 hours TIME CONSUMING MULTISTEP LACK OF INTERNAL CONTROL LABORIOUS SUBJECTIVE INTERPRETATION In-House/Homebrew

6 Faster Results Enhanced patient management CLINICAL & Scientific NEEDS Improved Reliability Easy adoption Easy set-up

7 Q-LAMP : Multi-plex and Real Time Isothermal Amplification Techniques due to their intrinsic characteristics can overcome the limitations of conventional PCR NON-PCR method Notomi T et al, NAR 2000 further improved by DiaSorin Q-LAMP

8 What is LAMP? LAMP is Loop-Mediated Isothermal Amplification 1. Loop-mediated Refers to the loop structures formed when the LAMP primers bind to target DNA sequence 2. Isothermal Reaction takes place at a single temperature (usually o C) - relatively simple instrumentation 3. Amplification Target is amplified using a combination of intricate primer design and a polymerase enzyme with strand displacement activity The Diagnostic Specialist

9 How DiaSorin Q-LAMP is achieved Amplification monitoring (real-time) in Q-LAMP achieved Q-Primers. Fluorescent molecule conjugated to one end of the Q-Primer LED in the LIAISON Iam instrument excites it Unique property of fluorescence molecule - quenched when incorporated into amplicon: TTATTAGAGGTTCAGACAATAGGTTAGGAA CTCCAAGTCTGTTATCCAATC Quenched DYE 1. Maximum fluorescence when primer is unbound 2. Fluorescence quenched when primer binds target The Diagnostic Specialist

10 Tt (min) Basic Principles Q-LAMP quantitation Decrease in fluorescence over time (quenching) used to monitor progress of reaction. Time taken to reach X% decrease in signal is called the Threshold Time (Tt) X% Quenching Sample Tt y = -1.7x R² = Log copies/ml Threshold Time RESULT The Diagnostic Specialist

Q-LAMP vs RT-PCR Steps Enzymes PCR Temperature Enzymes Q-LAMP Temperature Reverse Transcription 1 step, 1 enzyme, 1 temperature, Reverse close tube Transcriptase format

11 Q-LAMP vs RT-PCR Steps Enzymes PCR Temperature Enzymes Q-LAMP Temperature Reverse Transcription 1 step, 1 enzyme, 1 temperature, Reverse close tube Transcriptase format 70 C 42 C 99 C Amplification DNA Thermostable Polymerase 4 C 94 C, 30 sec (Denaturation) 65 C, 60 sec (Annealing) 72 C, 60 sec (Polymerization) LAMP Polymerase 35x 65 C

Simple Procedure 1 2 3 4 Buffer Freezedried reagents Reconstitution of lyophilized

12 Simple Procedure Buffer Freezedried reagents Reconstitution of lyophilized reagents Aliquote in tube strip Addition of controls and samples RNA Loading on Liaison Iam

13 Benefits of Q-LAMP? Isothermal amplification reaction 1 step, 1 enzyme, 1 temperature, close tube format Multiplex RNA Reverse Transcription DNA Amplification Internal Control Real Time Rapid

14 Q-LAMP for BCR/ABL Translocation: Triplex Multiplex BCRABL p190/p210/gusb p190 p210 GUSb To validate negative results by excluding: incorrect extraction procedure low quality of extracted RNA presence of inhibitors incorrect reaction conditions

15 Benefits of Q-LAMP? Isothermal amplification reaction 1 step, 1 enzyme, 1 temperature, close tube format Multiplex RNA cdna Amplification + Reverse Transcription signal detection Internal Control Real Time

16 Q-LAMP vs RT- PCR Temp ( C) PCR Amplification X 35 cycles Time 1 step, 1 enzyme, 1 temperature, close tube format Multiplex Temp ( C) Internal Control Real Time Q-LAMP Constant Amplification Time Rapid

17 Rapid solution constant temperature avoiding thermocycling Employment of a unique enzyme for RT and amplification High efficiency (characteristic of LAMP) 60 min 20 min 1 step, 1 enzyme, 1 temperature, close tube format Multiplex RNA Reverse Transcription cdna Amplification + signal detection Internal Control Real Time Rapid

18 Instrumentation Liaison IAM incubation constant T real time reading of fluorescence (3 channels) automatic elaboration of data Compact Design 8 wells

Q-LAMP BCR-ABL performance: Verification SPECIFICITY Specificity established on negative RNA and NTC (water): Negative cell lines Replicates HL-60 343 KASUMI 23 NB4 24 TOT replicates 390 BCR-ABL

19 Q-LAMP BCR-ABL performance: Verification SPECIFICITY Specificity established on negative RNA and NTC (water): Negative cell lines Replicates HL KASUMI 23 NB4 24 TOT replicates 390 BCR-ABL Results Negative* *validated through amplification of Gusb endogeneous control 100% specificity No Target Control Replicates BCR-ABL Results water 312 No amplification* *absence of primers dimers

Q-LAMP BCR-ABL performances SENSITIVITY 10-2 mut into wt dilution is the minimum amount of mutation found at the disease onset Sensitivity established on serial dilutions of mutated RNA into wild

20 Q-LAMP BCR-ABL performances SENSITIVITY 10-2 mut into wt dilution is the minimum amount of mutation found at the disease onset Sensitivity established on serial dilutions of mutated RNA into wild type RNA: Dilution tested (K562 RNA into HL60 RNA) BCR-ABL p210 % Detection #Reps % % 78 Dilution tested (TOM1 RNA into HL60 RNA) BCR-ABL p190 % Detection #Reps % % 78 Sensitivity required for diagnosis

21 RESULTS RT-PCR Q-LAMP BCR-ABL performances COMPARISON with RT-PCR on CLINCAL SAMPLES 85 samples RESULTS Q-LAMP BCR-ABL BCR-ABL p190 BCR-ABL p210 Negative TOT Average detection time for positive samples: 20 min BCR-ABL p BCR-ABL p Negative TOT % concordance

22 Faster Results Real time monitoring: 20 min for detection of +ve 60 min reaction time fo r Neg Control Better utilization of resources Validated, QA etc Timely administration of correct therapy Early identification of appropriate monitoring method Enhanced patient management MET CLINICAL NEEDS Improved Reliability Close tube/single step format Internal control Less risks of procedural errors Automatic elaboration of data Small Analyser Easy adoption Easy set-up Lyophilized reagents, Simple single-step procedure Less risks of procedural errors

23 Thank you!!! Giulia Amicarelli: Molecular Scientific Affairs Manager Paul Eros: Vice President Molecular Marketing AIMS Organising Committee

ONE STEP MULTIPLEX RT-PCR FOR BCRlABL GENE IN MALAY PATIENTS DIAGNOSED AS LEUKAEMIA

ONE STEP MULTIPLEX RT-PCR FOR BCRlABL GENE IN MALAY PATIENTS DIAGNOSED AS LEUKAEMIA 1Rosline H, 1Majdan R, 1Wan Zaidah A, 1Rapiaah M, 1Selamah G, 2A A Baba, 3D M Donald 1Department of Haematology, 2Department