Helicobacter pylori caga Gene and Expression of Cytokine Messenger RNA in Gastric Mucosa

Transcription

1 GASTROENTEROLOGY 1996;110: Helicobacter pylori caga Gene and Expression of Cytokine Messenger RNA in Gastric Mucosa YOSHIO YAMAOKA,* MASAKAZU KITA, TADASHI KODAMA,* NAOKI SAWAI,* and JIRO IMANISHI *Third Department of Internal Medicine and Department of Microbiology, Kyoto Prefectural University of Medicine, Kyoto, Japan Background & Aims: Helicobacter pylori strains pos- scription polymerase chain reaction (RT-PCR) method sessing the caga gene are thought to be associated and found that the levels of expression of IL-7 and IL-8 with gastroduodenal diseases. Furthermore, some cy- mrna were significantly higher in mucosa with H. pytokines are considered to play a role in gastric mucosal lori positive gastritis than in H. pylori negative normal inflammation. The aim of this study was to investigate mucosa. 9 IL-6 and IL-10 messenger RNA (mrna) exthe relationship between caga gene and cytokine mespression levels were also slightly higher in H. pylori senger RNA (mrna) expression in gastric mucosa. infected subjects than in controls. Methods: In 160 patients, the caga gene was detected Several potential virulence factors derived from H. pyusing polymerase chain reaction, and interleukin (IL) 1b, IL-6, IL-7, IL-8, IL-10, and tumor necrosis factor lori have also been investigated. Approximately 50% of (TNF) a mrna were detected using reverse-transcripextracellular cytotoxin that causes vacuolization in vari- clinical isolates of H. pylori are known to produce an tion polymerase chain reaction. Results: Specimens infected with caga gene positive strains (caga-positive ous mammalian cells. 10,11 This vacuolating cytotoxin ac- specimens) had significantly more severe infiltra- tivity is mediated by an 87-kilodalton protein encoded tion of polymorphonuclear leukocytes and mononuclear by vaca, and the production of this toxin has been cells than those infected with caga gene negative considered to be associated with the presence of the 128- strains (caga-negative specimens). Levels of expres- kilodalton antigenic protein termed CagA. 15,16 However, sion of IL-6, IL-7, IL-8, IL-10, and TNF-a mrna were Tummuru et al. 17 recently found that mutagenesis of the significantly higher in H. pylori positive than H. pylori caga gene disrupting CagA expression did not affect negative patients. Furthermore, the level of IL-8 mrna cytotoxin expression, suggesting that these two proteins expression was significantly higher in caga-positive than caga-negative specimens. Conclusions: caga-posprotein is therefore currently unclear, but increasing evi- were expressed independently. The function of the CagA itive strains induce the expression of IL-8 mrna, sugdence shows that this protein is associated with gastrodugesting that IL-8 may play important roles in the pathoodenal diseases. Because CagA protein is detected in algenesis of gastroduodenal diseases associated with H. pylori infection. most all patients with duodenal ulcer 11,15,18 and most of those with gastric carcinoma, 19 it has been proposed that elicobacter pylori, which is recognized as a major disease development requires infection with CagA-pro- Hcause of chronic gastritis and peptic ulcer disease, 1,2 ducing strains of H. pylori. has more recently been identified as a risk factor for Recently, Crabtree et al., 20 using gastric epithelial can- gastric cancer. 3,4 Although the pathogenesis of gastrodustimulated higher levels of IL-8 release than CagA/cyto- cer cell lines, found that CagA/cytotoxin-positive strains odenal diseases caused by this bacterium is not well untoxin-negative strains. They also showed that phenotypic derstood, some immunologic mechanisms are thought to be involved in gastric inflammation. 5 Several studies have variants of H. pylori, which were noncytotoxic but pos- shown the involvement of cytokines in the pathogenesis sessed the caga gene, induced IL However, another of gastric inflammation. Crabtree et al. 6,7 detected higher in vitro study showed that there was no decrease in IL- levels of tumor necrosis factor (TNF) a, interleukin (IL) 8 induction by isogenic strains with a mutant caga gene 6, and IL-8 in culture supernatants of H. pylori infected disrupting CagA expression. 22 However, these were in gastric biopsy specimens than in specimens from uninfected vitro studies using cancer cell lines; there are few in patients. Noach et al. 8 also detected increased lev- els of IL-1b, IL-8, and TNF-a in culture supernatants of Abbreviations used in this paper: IL, interleukin; MNC, mononu- clear cell; PMN, polymorphonuclear cell; RT-PCR, reverse-transcripantral biopsy specimens from H. pylori infected patients. tion polymerase chain reaction; TNF, tumor necrosis factor. Previously, we studied cytokine expression patterns in 1996 by the American Gastroenterological Association gastric mucosal biopsy specimens using the reverse-tran /96/$3.00

2 June 1996 caga GENE AND CYTOKINE mrna 1745 vivo studies examining the relationship between the caga under microaerophilic conditions (Campy-Pak Systems; BBL, gene and cytokine expression patterns in gastric mucosa. Cockeysville, MD) for up to 7 days. The organisms were identi- In the present study, we therefore investigated the fied as H. pylori by Gram staining, colony morphology, and presence of the caga gene using PCR and cytokine positive oxidase, catalase, and urease reactions. The strains were counted, and colony-forming units/ml was stored at mrna expression in vivo in gastric mucosa using RT- 080 C in Keep Medium (Nikken Co., Ltd., Kumamoto, Ja- PCR. pan) containing 15% (vol/vol) horse serum and 15% (vol/vol) Materials and Methods glycerol. Patients Preparation of Genomic DNA From Clinical One hundred sixty patients (85 men and 75 women; Isolates age range, years; mean age, 54.5 years), none of whom The culture medium was centrifuged for 5 minutes at had received antibiotics within the previous 3 months, partici- 10,000g, and the bacterial pellets were washed twice with pated in the study. Endoscopic findings in the patients were as phosphate-buffered saline (ph 7.4). The pellets were each susfollows: normal mucosa, 15 patients; gastric ulcer, 40 patients; pended in 50 ml of distilled water and were boiled for 10 duodenal ulcer, 25 patients; gastric cancer, 30 patients; and minutes. The supernates, obtained by centrifugation (10,000g chronic gastritis without ulcer, 50 patients. Informed consent for 5 minutes), were stored at 020 C until use as PCR temwas obtained from all patients, and the protocol was approved plates. by the ethical committee of Kyoto Prefectural University of Medicine. Preparation of RNA and Complementary Four biopsy specimens were taken from both the antrum DNA for Cytokine Measurement (pyloric gland area) and corpus (fundic gland area); two were The biopsy specimens were immediately placed in guaused for histological examination, one for culture, and one for nidine isothiocyanate buffer, frozen on dry ice, and stored at cytokine measurement. Biopsy specimens were taken at least 080 C until use. Samples were homogenized using a tissue 2 cm from ulcers or tumors in patients with gastric ulcer and homogenizer (Kontes, Vineland, NJ), and total RNA was exthose with gastric cancer. In patients with gastric cancer, two tracted by the acid guanidinium isothiocyanate phenol chloadditional biopsy specimens were taken from the cancer re- roform method as described previously. 24 The concentration gions; one was used for histological examination, and one for and quality of RNA samples were estimated by determining cytokine measurement. the absorbance at 260/280 nm. As a positive control, RNA The presence of H. pylori was determined by culture and was also prepared from normal peripheral blood lymphocytes histological examination. Patients were classified as H. pylori activated with phytohemagglutinin or lipopolysaccharide. One positive if at least one of the examinations gave a positive microgram of total RNA was incubated at 65 C for 5 minutes, result for H. pylori. Some of the H. pylori positive patients chilled on ice, and reverse-transcribed in a final volume of 10 who had gastric ulcer or duodenal ulcer were treated with ml of a solution containing 50 mmol/l Tris-HCl (ph 8.3), eradication therapy consisting of lansoprazole, 60 mg twice 75 mmol/l KCl, 3 mmol/l MgCl 2, 10 mmol/l dithiothreitol, daily; amoxicillin, 2000 mg twice daily; and clarithromycin, 200 mmol/l each of deoxyadenosine triphosphate, deoxycyti- 500 mg twice daily, for 2 weeks. Four weeks after cessation dine triphosphate, deoxyguanosine triphosphate, and deof treatment, the patients were examined endoscopically again oxthymidine triphosphate (Pharmacia Biotech AB, Uppsala, and biopsy specimens were taken as before. [ 13 C]Urea breath Sweden), 1 mmol/l oligo(dt)16 primer, 20 U RNasin (ribotest was also performed, and successful eradication of H. pylori nuclease inhibitor; Toyobo Co., Ltd. Tokyo, Japan), and 100 was determined if all test results were negative. U MoMuLV RNase H 0 reverse transcriptase (BRL Co., Gaithersburg, Histology MD). The mixture was incubated at 43 C for 90 minutes, heated to 95 C for 10 minutes, and stored at 020 C The biopsy specimens were embedded in paraffin and until use. stained with H&E and Giemsa stains. Specimens were examined without knowledge of the experimental results. The histological PCR severity of gastritis was graded from normal to severe Oligonucleotide primers were synthesized using a based on the degrees of mononuclear cell (MNC) and polymor- DNA synthesizer (Gene Assembler Plus; Pharmacia). Oligonuphonuclear leukocyte (PMN) infiltration according to the Syd- cleotide primers were designed based on the published seney system. 23 The presence of H. pylori was also assessed. quences. 16,25 30 The sense and antisense primers specific for H. pylori Culture each cytokine were designed to include at least one intron, permitting distinction between amplified complementary The biopsy specimens were spread out with an applicator DNA (cdna) and possible contaminating residual genomic and placed in Skirrow agar medium containing 8% (vol/ DNA. b-actin and H. pylori ureb genes were assayed as positive vol) horse blood, vancomycin (10 mg/ml), polymycin B (2.5 controls for cytokine measurement and for the presence of H. U/mL), and trimethoprim (5 mg/ml) and incubated at 37 C pylori, respectively. Primer sequences are shown in Table 1.

3 1746 YAMAOKA ET AL. GASTROENTEROLOGY Vol. 110, No. 6 Table 1. Oligonucleotide Primers for PCR Human cytokine-specific oligonucleotide primers for PCR Amplicon Cytokine Primer Nucleotide position Exon cdna DNA IL-1b Sense ATAAGCCCACTCTACAGCT Antisense ATTGGCCCTGAAAGGAGAGA IL-6 Sense GTACCCCCAGGAGAAGATTC Antisense CAAACTGCATAGCCACTTTC IL-7 Sense GAATTCCTCTGGTCCTCATC Antisense GGAAGTCCAAAGATATACC IL-8 Sense GCTTTCTGATGGAAGAGAGC Antisense GGCACAGTGGAACAAGGACT IL-10 Sense ATGCCCCAAGCTGAGAACCAAGAC a Antisense TCTCAAGGGGCTGGGTCAGCTATCCCA TNF-a Sense CAGAGGGAAGAGTTCCCCAG Antisense CCTTGGTCTGGTAGGAGACG H. pylori specific oligonucleotide primers for PCR Primer Nucleotide position Expected product size caga Sense GATAACAGGCAAGCTTTTGAGG Antisense CTGCAAAAGATTGTTTGGCAGA ureb Sense TGGGATTAGCGAGTATGT Antisense CCCATTTGACTCAATG a The whole genomic sequence of IL-10 has not yet been reported. Bacterial DNA and cdna from biopsy specimens were U test. A P value of õ0.05 was considered statistically denatured by heating to 95 C for 10 minutes and cooled on significant. ice for 5 minutes. Bacterial DNA and cdna (5 ml) were added to 50-mL reaction mixtures containing 5 ml 101 PCR Results reaction buffer, which consisted of 500 mmol/l KCl, 100 Expression of caga Gene and Endoscopic mmol/l Tris-HCl (ph 8.8), 15 mmol/l MgCl 2, 1% Triton X- and Histological Findings 100, 200 ml each deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and deoxythymihundred twelve of the 160 patients (70%) were shown Table 2 shows detailed patient information. One dine triphosphate (Pharmacia Biotech AB), 200 nmol/l of each primer, and 1.0 U Taq DNA polymerase (Wako Pure Chemical to be positive for H. pylori by culture or histological Industries Ltd., Osaka, Japan), and H 2 O. The mixtures were overlaid with 25 ml of mineral oil to prevent evaporation. Amplification was performed using a TP Cycler-100 (Toyobo Engineering Co. Ltd. Tokyo, Japan) for 35 cycles (for cytokine Table 2. Patient Characteristics PCRs) or 25 cycles (for ureb and caga PCRs), each of which Mean age Sex Current tobacco (yr, range) (M/F) use (%) consisted of 1 minute at 95 C for denaturation, 1 minute at 60 C (for cytokine PCRs) or 50 C (for ureb and caga PCRs) Normal mucosa for annealing, and 1 minute at 72 C for extension. The final Hp0 (n Å 15) 33.5 (19 40) 7: Chronic gastritis cycle included an extension step for 7 minutes at 72 C to Hp/ (n Å 33) 58.3 (43 82) 18: ensure full extension of the product. Ten-microliter aliquots Hp0 (n Å 17) 57.9 (21 80) 8: of each PCR product were analyzed using electrophoresis on Gastric ulcer 1.5% agarose (Dojin Chemical Co. Ltd., Kyoto, Japan) gels Hp/ (n Å 31) 60.0 (43 85) 18: containing ethidium bromide, and the bands were examined Hp0 (n Å 9) 49.6 (26 80) 5: Duodenal ulcer under UV light for the presence of the amplified DNA. Hp/ (n Å 25) 46.3 (19 68) 14: Statistical Analysis Gastric cancer Hp/ (n Å 23) 59.7 (40 79) 11: Statistical analysis was performed using the two- Hp0 (n Å 7) 67.3 (55 85) 4: tailed Fisher s Exact Probability Test and Mann Whitney Hp/, H. pylori positive; Hp0, H. pylori negative.

4 June 1996 caga GENE AND CYTOKINE mrna 1747 Table 3. Expression of caga Gene and Endoscopic Findings Hp/ Hp//total caga//(caga/ and caga0) caga/ caga0 Not tested a Hp0 (%) (%) Chronic gastritis (n Å 50) Gastric ulcer (n Å 40) Duodenal ulcer (n Å 25) b Gastric cancer (n Å 30) Normal mucosa (n Å 15) Total (n Å 160) Hp/, H. pylori positive; Hp0, H. pylori negative; caga/, caga gene positive; caga0, caga gene negative. a The presence of caga gene was not tested because H. pylori was positive only by histological staining. b The positive rate of caga gene was significantly higher in patients with duodenal ulcer than patients with chronic gastritis and patients with gastric cancer (P õ 0.05). staining (Table 3). Nine patients were positive for H. positive specimens also had significantly more severe infiltration pylori only by histological staining. In the 103 patients of MNCs than caga-negative specimens in the with a positive culture for H. pylori, caga gene was posi- antrum, but not in the corpus. tive in 89 (86.4%). The positive rate of caga gene was significantly higher in patients with duodenal ulcer than Expression of Cytokine mrna and in patients with chronic gastritis without ulcer or patients Endoscopic Findings with gastric cancer (P õ 0.05), although there IL-1b and IL-7 mrna were found in specimens were no significant differences between patients with duodenal from normal mucosa without H. pylori infection, whereas ulcer and those with gastric ulcer. IL-6, IL-8, IL-10, and TNF-a mrna were not found In terms of the histological severity of the specimens, in these specimens (Table 5). IL-1b mrna was found specimens from patients with normal mucosa without in the majority of specimens even from normal mucosa. H. pylori infection had no infiltration of MNCs or PMNs. According to the endoscopic findings, we divided H. Specimens infected with H. pylori (H. pylori positive pylori positive specimens into the following groups: specimens) had significantly more severe infiltration of chronic gastritis without ulcer, gastritis with ulcer (gas- PMNs and MNCs than those without H. pylori (H. py- tric ulcer or duodenal ulcer), and gastric cancer (cancer lori negative specimens) both in the antrum and corpus region and noncancer region) (Table 6). The levels of (P õ ) (Table 4). Furthermore, specimens infected expression of IL-6 and IL-10 mrna were significantly with caga-positive strains (caga-positive specimens) had higher in specimens from noncancer regions of gastric significantly more severe infiltration of PMNs than those cancer than those from chronic gastritis without ulcer in infected with caga-negative strains (caga-negative specimens) the corpus (P õ 0.01 and P õ 0.005, respectively). The both in the antrum and corpus (P õ 0.001). caga- level of IL-6 mrna expression was significantly higher Table 4. H. pylori Infection and Histological Severity of Gastritis Hp/ MNC infiltration Hp/ PMN infiltration Location Grade caga/ caga0 Hp0 caga/ caga0 Hp0 Normal Mild Moderate Severe Normal Mild Moderate Severe NOTE. MNC infiltration: Hp/ vs. Hp0, P õ (antrum) and P õ (corpus); caga/ vs. caga0, P õ (antrum) and NS (corpus). PMN infiltration: Hp/ vs. Hp0, P õ (antrum) and P õ (corpus); caga/ vs. caga0, P õ (antrum) and NS (corpus) by Mann Whitney U test. Hp/, H. pylori positive; Hp0, H. pylori negative; caga/, caga gene positive; caga0, caga gene negative.

5 1748 YAMAOKA ET AL. GASTROENTEROLOGY Vol. 110, No. 6 Table 5. Expression of Cytokine mrna in Normal Mucosa Without H. pylori Infection studied (%) (%) (%) (%) (%) (%) (86.7) 0 (0.0) 2 (13.3) 0 (0.0) 0 (0.0) 0 (0.0) (93.3) 0 (0.0) 1 (6.7) 0 (0.0) 0 (0.0) 0 (0.0) in specimens from cancer regions than in those from pylori positive than in H. pylori negative specimens chronic gastritis without ulcer (antrum, P õ ; both in the antrum and corpus (Table 8). The level of corpus, P õ ) and gastric ulcer or duodenal ulcer IL-8 mrna expression was also significantly higher in (antrum, P õ ; corpus, P õ 0.01). The level of caga-positive than in caga-negative specimens both in IL-10 mrna expression was also significantly higher in the antrum (P õ 0.005) and corpus (P õ ). On specimens from cancer regions than in those from gastric the other hand, the levels of expression of IL-6, IL-7, IL- ulcer or duodenal ulcer in the antrum (P õ 0.05) and 10, and TNF-a mrna were not significantly higher in chronic gastritis without ulcer in the corpus (P õ 0.01). caga-positive than in caga-negative specimens. Expression of Cytokine mrna and Expression of Cytokine mrna and Histological Findings Eradication of H. pylori We examined the relationship between the extherapy. Fifteen patients were treated with eradication pression of cytokine mrna and the histological findings Eight of these 15 patients had gastric ulcer, and in H. pylori positive patients. The levels of expression the remaining 7 had duodenal ulcer; all patients were of IL-7, IL-8, and TNF-a mrna were significantly infected with H. pylori possessing the caga gene. H. pylori higher in specimens with moderate to severe infiltration was successfully eradicated in all patients. Considerable of MNCs and PMNs than in those with normal to mild improvement was observed after eradication in both infiltration in the corpus (Table 7). Furthermore, the MNC and PMN infiltration. PMNs disappeared after levels of IL-8 and TNF-a mrna expression were sigcorpus. eradication therapy, except in one specimen from the nificantly higher in specimens with moderate to severe MNC infiltration also decreased but did not dis- infiltration of MNCs and PMNs than in those with normrna appear. The expression rates of IL-6, IL-8, and TNF-a mal to mild infiltration in the antrum. were significantly decreased in specimens after eradication compared with levels before eradication ther- Expression of Cytokine mrna and caga apy in both the antrum and corpus (Table 9). Although Gene the levels of expression of IL-7 and IL-10 mrna were The levels of expression of IL-6, IL-7, IL-8, IL- also decreased after eradication, the differences were not 10, and TNF-a mrna were significantly higher in H. statistically significant. Table 6. Expression of Cytokine mrna Among the Diseases in H. pylori Positive Patients studied (%) (%) (%) (%) (%) (%) CG (93.9) 7 (21.2) 20 (60.6) 23 (69.7) 7 (21.2) 15 (45.5) GU or DU (96.4) 17 (30.4) 33 (58.9) 43(76.8) 6 (10.7) 26 (46.4) Gastric cancer (noncancer regions) (100) 10 (43.5) 12 (52.2) 18 (78.3) 4 (17.4) 10 (43.5) CG (87.9) 9 (27.3) 20 (60.6) 27 (81.8) 1 (3.0) 13 (39.4) GU or DU (98.2) 26 (46.4) 29 (51.8) 44 (78.6) 8 (14.3) 30 (53.6) Gastric cancer (noncancer regions) (100) 15 (65.2) a 10 (43.5) 22 (95.7) 7 (30.4) b 14 (60.9) Cancer regions Gastric cancer (100) 18 (78.3) c 14 (60.9) 21 (91.3) 7 (30.4) d 15 (65.2) CG, chronic gastritis without ulcer; GU or DU, gastritis with ulcer. a IL-6 mrna, gastric cancer (noncancer regions) vs. CG (P õ 0.01); b IL-10 mrna, gastric cancer (noncancer regions) vs. CG (P õ 0.005) in corpus. c IL-6 mrna, gastric cancer (cancer regions) vs. CG (antrum, P õ ; corpus, P õ ); gastric cancer (cancer regions) vs. GU or DU (antrum, P õ ; corpus, P õ 0.01); gastric cancer (cancer regions) vs. gastric cancer (noncancer regions) (antrum, P õ 0.01); d IL-10 mrna, gastric cancer (cancer regions) vs. GU or DU (antrum, P õ 0.05); gastric cancer (cancer regions) vs. CG (corpus, P õ 0.01).

6 June 1996 caga GENE AND CYTOKINE mrna 1749 Table 7. Relationship Between the Histological Findings and Cytokine Profiles in H. pylori Positive Patients Grade studied (%) (%) (%) (%) (%) (%) MNC infiltration Mild (92.3) 2 (15.4) 8 (61.5) 0 (0.0) 0 (0.0) 2 (15.4) Moderate (93.2) 12 (27.3) 23 (52.3) 30 (68.2) 4 (9.1) 17 (38.6) Severe (100) 20 (36.4) 34 (61.8) 54 (98.2) 13 (23.6) 32 (58.2) Mild vs. moderate to severe NS NS NS P õ NS P õ 0.05 Mild 9 8 (88.9) 2 (22.2) 1 (11.1) 3 (33.3) 0 (0.0) 1 (11.1) Moderate (94.8) 23 (39.7) 28 (48.3) 49 (84.5) 7 (12.1) 29 (50.0) Severe (97.8) 25 (55.6) 30 (66.7) 41 (91.1) 9 (20.2) 27 (60.0) Mild vs. moderate to severe NS NS P õ 0.05 P õ NS P õ 0.05 PMN infiltration None (91.7) 6 (25.0) 11 (45.8) 5 (20.8) 1 (4.2) 4 (16.7) Mild (86.7) 3 (20.0) 5 (33.3) 9 (60.0) 0 (0.0) 5 (33.3) Moderate (100) 11 (33.3) 24 (72.7) 32 (97.0) 8 (24.2) 19 (57.6) Severe (100) 14 (35.0) 25 (62.5) 38 (95.0) 8 (20.0) 23 (57.5) None to mild vs. moderate to severe P õ 0.05 NS P õ 0.01 P õ P õ P õ None (82.6) 3 (13.0) 5 (21.7) 12 (52.2) 0 (0.0) 5 (21.7) Mild (100) 15 (62.5) 13 (54.2) 21 (87.5) 7 (29.2) 14 (58.3) Moderate (97.9) 17 (36.2) 30 (63.8) 42 (89.4) 7 (14.9) 23 (48.9) Severe (100) 15 (83.3) 11 (61.1) 18 (100) 2 (11.1) 15 (83.3) None to mild vs. moderate to severe NS NS P õ 0.01 P õ NS P õ 0.05 Discussion However, the role of the caga gene in the pathogenesis of H. pylori infection is still unclear. Earlier studies H. pylori strains that have the caga gene are showed that cytotoxic strains almost always have the thought to be associated with gastroduodenal diseases. caga gene, 15,16 suggesting that the CagA protein might There have been some reports of high titers of serum be necessary for either transcription or production of a antibodies to the CagA protein in almost all patients functional cytotoxin. However, Tummuru et al. 17 rewith duodenal ulcer. 11,15,18 In the present study, the inci- cently found that isogenic mutants of the caga gene dence of H. pylori strains positive for the caga gene was disrupting CagA expression did not affect cytotoxin significantly higher in patients with duodenal ulcer than expression, and Xiang et al. 31 also found that there in those with chronic gastritis (P õ 0.05). Therefore, were some phenotypic variants of clinical isolates in our results are in agreement with results of other studies. which the CagA and VacA proteins were not coex- Table 8. Expression of Cytokine mrna and H. pylori Infection studied (%) (%) (%) (%) (%) (%) Hp/ (96.4) 34 (30.4) 65 (58.0) 84 (75.0) 17 (15.2) 51 (45.5) caga/ (97.8) 29 (32.6) 58 (65.2) 72 (80.9) 16 (18.0) 44 (49.4) caga (85.7) 4 (28.6) 6 (42.9) 6 (42.9) 0 (0.0) 5 (35.7) Hp (91.7) 1 (2.1) 12 (25.0) 6 (12.5) 0 (0.0) 6 (12.5) Hp/ vs. Hp0 NS P õ P õ P õ P õ P õ caga/ vs. caga0 NS NS NS P õ NS NS Hp/ (95.5) 50 (44.6) 59 (52.7) 93 (83.0) 16 (14.3) 57 (50.9) caga/ (97.8) 39 (43.8) 49 (55.1) 81 (91.0) 14 (15.7) 44 (49.4) caga (92.9) 5 (35.7) 6 (42.9) 6 (42.9) 1 (7.1) 7 (50.0) Hp (91.7) 0 (0.0) 4 (8.3) 3 (6.3) 0 (0.0) 4 (8.3) Hp/ vs. Hp0 NS P õ P õ P õ P õ P õ caga/ vs. caga0 NS NS NS P õ NS NS Hp/, H. pylori positive; Hp0, H. pylori negative; caga/, caga gene positive; caga0, caga gene negative.

7 1750 YAMAOKA ET AL. GASTROENTEROLOGY Vol. 110, No. 6 Table 9. Expression of Cytokine mrna and Eradication of H. pylori studied (%) (%) (%) (%) (%) (%) Before (100) 8 (53.3) 10 (66.7) 15 (100) 4 (26.7) 10 (66.7) After (93.3) 2 (13.3) 7 (46.7) 3 (20.0) 2 (13.3) 3 (20.0) Before vs. after NS P õ 0.05 NS P õ NS P õ 0.05 Before (100) 8 (53.3) 8 (53.3) 14 (93.3) 5 (33.3) 11 (73.3) After (100) 2 (13.3) 5 (33.3) 3 (20.0) 2 (13.3) 3 (20.0) Before vs. after NS P õ 0.05 NS P õ NS P õ 0.01 Before, before eradication therapy; after, after eradication therapy. pressed, suggesting that caga gene expression is not specimens showed significantly more severe infiltration essential for functional cytotoxicity. of PMNs and MNCs than caga-negative or H. pylori Recently, Crabtree et al. 21 reported that noncytotoxic negative specimens. Crabtree et al. 18 also reported that strains that have the caga gene induced IL-8 production mucosal immune recognition of the CagA protein was by gastric epithelial cell lines, suggesting that induction strongly associated with epithelial PMN infiltration. Recent of epithelial IL-8 by the CagA protein or coexpressed studies have shown that IL-8 is produced from gasof surface factors other than the cytotoxin may be important tric epithelial cells in response to H. pylori infection in in gastric inflammation. In the present study, we found vitro, 37 and this cytokine has also been shown to be that strains having the caga gene induced expression of localized to the epithelial cell layer in vivo, 38 suggesting IL-8 mrna significantly more strongly in vivo in gastric that IL-8 mrna is expressed directly in the epithelial mucosa than strains without the caga gene. Our results cells. Because H. pylori does not typically invade the also suggest that the caga gene is closely related to the mucosa, 37 where the epithelial cells are the first line of expression of IL-8. However, Sharma et al. 22 recently defense against this bacterium, it is suggested that IL-8 showed that there was no decrease in IL-8 induction by may be a trigger of inflammation: IL-8 is produced by isogenic strains with a mutant caga gene disrupting the epithelial cells, causing activation and accumulation CagA expression. Therefore, the CagA/cagA gene itself of PMNs and MNCs in the mucosa; these cells then may only be a phenotypic marker of the expression of also produce IL-8 and other cytokines, which form the IL-8 mrna. Recently, Tummuru et al. 32 showed that cytokine network and cause gastric mucosal inflama novel gene termed cagc induced the production of IL- mation. Indeed, the expression of IL-8 mrna was significantly 8. The cagc gene, which is a 2655 base pair open reading greater in H. pylori positive specimens with frame encoding 101-kilodalton polypeptides, exists moderate to severe infiltration of MNCs and PMNs than on the upstream of the caga gene. However, all strains in those with normal to mild infiltration. Furthermore, possessing the cagc gene are thought to have the caga PMN enzymatic products such as protease and elastase gene, and these genes may be related to each other. Thus, are thought to be important mediators of tissue dam- we can state that the caga gene, or a related gene, appears age. 39 to play a role in induction of the expression of IL-8 In addition to IL-8 mrna, the levels of expression of mrna in vivo. Of course, we must also consider that IL-6, IL-7, IL-10, and TNF-a mrna were significantly detectable amounts of IL-8 mrna (42.9%) were expressed higher in H. pylori positive than in H. pylori negative in caga-negative specimens. Ohta et al. 33 re- specimens. IL-6, IL-10, and TNF-a mrna especially ported that IL-8 levels were significantly different among were not detected in specimens from normal mucosa the H. pylori isolates, with four restriction fragment without H. pylori infection. Furthermore, the expression length polymorphism patterns observed within the flaa rates of IL-6 and TNF-a mrna were significantly de- (flagellin gene) PCR products. Factors other than caga creased after eradication of H. pylori. gene or a related gene such as the flaa gene may also In our previous study, 9 TNF-a mrna was not de- play a role in the expression of IL-8 mrna. tected in gastric mucosa, irrespective of the presence of IL-8 possesses potent chemotactic activity for neutrophils H. pylori infection. We therefore used more sensitive 34,35 and T lymphocytes, 36 which is compatible with pairs of primers 29 so that this cytokine mrna could be the histological findings of caga-positive specimens. Indeed, detected in inflamed mucosa. Furthermore, the expres- we found in the present study that caga-positive sion of TNF-a was correlated with the severity of infil-

8 June 1996 caga GENE AND CYTOKINE mrna 1751 tration of MNCs and PMNs in H. pylori positive speci- caga-positive strains induce the expression of IL-8 mens. Because TNF-a is thought to be a potent inducer mrna and that IL-8 may play an important role in the of IL-8, 35 TNF-a may induce IL-8 in part by a positive pathogenesis of gastroduodenal diseases associated with feedback mechanism in the cytokine network. H. pylori infection. IL-6 is a proinflammatory cytokine whose functions References include B-cell differentiation, T-cell activation and differentiation, and induction of hepatocyte acute-phase 1. Blaser MJ. Epidemiology and pathophysiology of Campylobacter pylori infections. Rev Infect Dis 1990;12(Suppl 1): protein synthesis. 40 Several of these biological properties 2. Peterson WL. Helicobacter pylori and peptic ulcer disease. N Engl may be relevant to the pathogenesis of gastroduodenal J Med 1991;324: inflammation. On the other hand, IL-10 is thought to 3. Nomura A, Stemmermann GN, Chyou PH, Kato I, Perez PG, Blaser MJ. Helicobacter pylori infection and gastric carcinoma among have strong down-regulatory effects on the proinflam- Japanese Americans in Hawaii. N Engl J Med 1991;325:1132 matory cytokines such as IL-b, IL-6, IL-8, and TNF-a IL-10 may therefore be produced to down-regulate the 4. Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich N, Sibley RK. Helicobacter pylori infection and the production of these cytokines in the gastric mucosa. risk of gastric carcinoma. N Engl J Med 1991;325: IL-7 is a cytokine that was originally described as a 5. Fixa B, Komarkova O, Krejsek J, Nozicka Z, Bures J. Specific pre B cell growth factor. 42 Recently, Alderson et al. 43 cellular immune response in patients with Helicobacter pylori showed that IL-7 is a potent inducer of IL-6, IL-1a, ILinfection. Hepatogastroenterology 1990;37: Crabtree JE, Shallcross TM, Heatley RV, Wyatt JI. Mucosal tumour 1b, and TNF-a expression, suggesting that IL-7 may be necrosis factor alpha and interleukin-6 in patients with Helicoan important mediator in inflammation. However, IL-7 bacter pylori associated gastritis. Gut 1991;32: mrna was expressed in a number of specimens from 7. Crabtree JE, Peichl P, Wyatt JI, Stachl U, Lindley IJD. Gastric interleukin-8 and IgA IL-8 autoantibodies in Helicobacter pylori the antrum in H. pylori negative patients, and the ex- Infection. Scand J Immunol 1993;37: pression rate of IL-7 mrna was not significantly de- 8. Noach LA, Bosma NB, Jansen J, Hoek FJ, van DS, Tytgat GN. creased after eradication of H. pylori. Further studies are Mucosal tumor necrosis factor-alpha, interleukin-1 beta, and in- terleukin-8 production in patients with Helicobacter pylori infectherefore required to determine the role of IL-7 in H. tion. Scand J Gastroenterol 1994;29: pylori infection. 9. Yamaoka Y, Kita M, Kodama T, Sawai N, Kashima K, Imanishi J. In the present study, there were no significant differpylori infection. Scand J Gastroenterol 1995;30: Expression of cytokine mrna in gastric mucosa with Helicobacter ences in the detection rate of IL-1b mrna between H. 10. Leunk RD, Johnson PT, David BC, Kraft WG, Morgan DR. Cytotoxic pylori positive and H. pylori negative specimens. IL-1b activity in broth-culture filtrates of Campylobacter pylori. J Med mrna was detected in the majority of specimens even Microbiol 1988;26: from normal mucosa. Because IL-1b has been shown to 11. Cover TL, Dooley CP, Blaser MJ. Characterization of and human serologic response to proteins in Helicobacter pylori broth culture inhibit the secretion of gastric acid, 44 IL-1b mrna may supernatants with vacuolizing cytotoxin activity. Infect Immun be expressed to regulate the secretion of gastric acid, 1990;58: irrespective of the presence of H. pylori infection. 12. Cover TL, Tummuru MK, Cao P, Thompson SA, Blaser MJ. Diver- gence of genetic sequences for the vacuolating cytotoxin among Finally, in terms of the endoscopic findings of the H. Helicobacter pylori strains. J Biol Chem 1994;269:10566 pylori positive specimens, in gastric cancer, the levels of expression of IL-6 and IL-10 mrna were higher in 13. Phadnis SH, Ilver D, Janzon L, Normark S, Westblom TU. Patho- logical significance and molecular characterization of the vacspecimens from cancer regions than in those from benign uolating toxin gene of Helicobacter pylori. Infect Immun 1994; gastroduodenal diseases. It is well known that tumor 62: cells themselves can produce various kinds of cytokines, 14. Telford JL, Ghiara P, Dell Orco M, Comanducci M, Burroni D, and it is possible that these cytokines are derived from Bugnoli M, Tecce MF, Censini S, Covacci A, Xiang Z, Papini E, Montecucco C, Parente L, Rappuoli R. Gene structure of the tumor cells as well as inflammatory cells because carcino- Helicobacter pylori cytotoxin and evidence of its key role in gastric mas are frequently accompanied by inflammatory cell disease. J Exp Med 1994;179: infiltrates. However, the data obtained using the small 15. Covacci A, Censini S, Bugnoli M, Petracca R, Burroni D, Macchia G, Massone A, Papini E, Xiang Z, Figura N, Rappuoli R. Molecular numbers of patients studied require verification in a characterization of the 128-kDa immunodominant antigen of Helilarger study, which is currently in progress in our labora- cobacter pylori associated with cytotoxicity and duodenal ulcer. tory. Proc Natl Acad Sci USA 1993;90: Tummuru MK, Cover TL, Blaser MJ. Cloning and expression of a In conclusion, we found that caga-positive specimens high-molecular-mass major antigen of Helicobacter pylori: evihad significantly more severe infiltration of PMNs and dence of linkage to cytotoxin production. Infect Immun 1993;61: MNCs than caga-negative specimens. H. pylori strains Tummuru MK, Cover TL, Blaser MJ. Mutation of the cytotoxinpossessing the caga gene had a stronger capacity to inassociated caga gene does not affect the vacuolating cytotoxin duce the expression of IL-8 mrna in gastric mucosa activity of Helicobacter pylori. Infect Immun 1994;62:2609 than strains without the caga gene. We suggest that 2613.

9 1752 YAMAOKA ET AL. GASTROENTEROLOGY Vol. 110, No Crabtree JE, Taylor JD, Wyatt JI, Heatley RV, Shallcross TM, Tomp- a homolog of the Bordetella pertussis toxin secretion protein, is kins DS, Rathbone BJ. Mucosal IgA recognition of Helicobacter required for induction of IL-8 in gastric epithelial cells (abstr). pylori 120 kda protein, peptic ulceration, and gastric pathology. Gastroenterology 1995;108:A246. Lancet 1991;338: Ohta U, Takagi A, Harasawa S, Mita T, Koga Y, Kamiya S. Flagellin 19. Blaser MJ, Perez-Perez GI, Kleanthous H, Cover TL, Peek RM, gene diversity among Helicobacter pylori strains and IL-8 secretion Chyou PH, Stemmermann GN, Nomura A. Infection with Helicobacter in vitro (abstr). Gastroenterology 1995;108:A182. pylori strains possessing caga is associated with an in- 34. Matsushima K, Oppenheim JJ. Interleukin 8 and MCAF: novel creased risk of developing adenocarcinoma of the stomach. Cancer inflammatory cytokines inducible by IL-1 and TNF. Cytokine 1989; Res 1995;55: : Crabtree JE, Farmery SM, Lindley IJ, Figura N, Peichl P, Tompkins 35. Baggiolini M, Watz A, Kunkel SL. Neutrophil-activating peptide DS. CagA/cytotoxic strains of Helicobacter pylori and interleukin- 1/interleukin 8, a novel cytokine that activates neutrophils. J 8 in gastric epithelial cell lines. J Clin Pathol 1994;47: Clin Invest 1989;84: Crabtree JE, Covacci A, Farmery SM, Xiang Z, Tompkins DS, Perry 36. Larsen CG, Anderson AO, Appella E, Oppenheim JJ, Matsushima S, Lindley IJ, Rappuoli R. Helicobacter pylori induced interleukin- K. The neutrophil-activating protein (NAP-1) is also chemotactic 8 expression in gastric epithelial cells is associated with CagA- for T lymphocytes. Science 1989;243: positive phenotype. J Clin Pathol 1995;48: Crowe SE, Alvarez L, Dytoc M, Hunt RH, Muller M, Sherman P, 22. Sharma SA, Tummuru MK, Miller GG, Blaser MJ. Interleukin-8 Patel J, Jin Y, Ernst PB. Expression of interleukin 8 and CD54 response of gastric epithelial cell lines to Helicobacter pylori by human gastric epithelium after Helicobacter pylori infection in stimulation in vitro. Infect Immun 1995;63: vitro. Gastroenterology 1995;108: Price AB. The Sydney system: histological division. J Gastroenterol 38. Crabtree JE, Wyatt JI, Trejdosiewicz LK, Peichl P, Nichols PH, Hepatol 1991;6: Ramsay N, Primrose JN, Lindley IJ. Interleukin-8 expression in 24. Chomczynski P, Sacchi N. Single-step method of RNA isolation by Helicobacter pylor infected, normal, and neoplastic gastroduodeacid guanidinium thiocyanate-phenol-chloroform extraction. Anal nal mucosa. J Clin Pathol 1994;47: Biochem 1987;162: Nakamura H, Yoshimura K, McElvaney NG, Crystal RG. Neutrophil 25. Kaashoek JGJ, Mout R, Falkenburg JHF, Willemze R, Fibbe WE, elastase in respiratory epithelial lining fluid of individuals with Landegent JE. Cytokine production by the bladder carcinoma cell cystic fibrosis induces interleukin-8 gene expression in a human line 5637: rapid analysis of mrna expression levels using a bronchial epithelial cell line. J Clin Invest 1992;89: cdna-pcr procedure. Lymphokine Cytokine Res 1991;10: Akira S, Hirano T, Taga T. Biology of multifunctional cytokines: 235. IL 6 and related molecules (IL 1 and TNF). FASEB J 1990;4: 26. Benjamin D, Knobloch TJ, Dayton MA. Human B-cell interleukin : B-cell lines derived from patients with acquired immunodefi- 41. de WMR, Abrams J, Bennett B, Figdor CG, de VJ. Interleukin ciency syndrome and Burkitt s lymphoma constitutively secrete 10 (IL-10) inhibits cytokine synthesis by human monocytes: an large quantities of interleukin-10. Blood 1992;80: autoregulatory role of IL-10 produced by monocytes. J Exp Med 27. Albino AP, Davis BM, Nanus DM. Induction of growth factor RNA 1991;174: expression in human malignant melanoma: markers of transfor- 42. Namen AE, Lupton S, Hjerrild K, Wignall J, Mochizuki DY, mation. Cancer Res 1991;51: Schmierer A, Mosley B, March CJ, Urdal D, Gillis S. Stimulation 28. Kita M, Hayashi T, Yamagishi H, Oka T, Imanishi J. Expression of B-cell progenitors by cloned murine interleukin-7. Nature 1988; de l ARN messager des cytokines dans la rate humaine. C R Soc 333: Biol 1994;188: Alderson MR, Tough TW, Ziegler SF, Grabstein KH. Interleukin Wang AM, Doyle MV, Mark DF. Quantitation of mrna by the induces cytokine secretion and tumoricidal activity by human polymerase chain reaction. Proc Natl Acad Sci USA 1989;86: peripheral blood monocytes. J Exp Med 1991;173: Uehara A, Okumura T, Sekiya C, Okumura K, Takasugi Y, Namiki 30. Clayton CL, Kleanthous H, Coates PJ, Morgan DD, Tabaqchali S. M. Interleukin-1 inhibits the secretion of gastric acid in rats: Sensitive detection of Helicobacter pylori by using polymerase possible involvement of prostaglandin. Biochem Biophys Res chain reaction. J Clin Microbiol 1992;30: Commun 1989;1: Xiang Z, Censini S, Bayeli PF, Telford JL, Figura N, Rappuoli R, Covacci A. Analysis of expression of CagA and VacA virulence factors in 43 strains of Helicobacter pylori reveals that clinical Received August 7, Accepted February 19, isolates can be divided into two major types and that CagA is Address requests for reprints to: Yoshio Yamaoka, M.D., Third not necessary for expression of the vacuolating cytotoxin. Infect Department of Internal Medicine, Kyoto Prefectural University of Medicine, Immun 1995;63: Kawaramachi-Hirokoji, Kamikyo-ku, Kyoto 602, Japan. 32. Tummuru MK, Sharma SA, Blaser MJ. Helicobacter pylori cagc, Fax: (81)