Interleukin-6 polymorphism and Helicobacter pylori infection in Brazilian adult patients with chronic gastritis

Transcription

1 Clin Exp Med (2005) 5: DOI /s ORIGINAL L. Lobo Gatti M. Zambaldi Tunes R.W. de Lábio L.C. Silva M. de Arruda Cardoso Smith S.L. Marques Payão Interleukin-6 polymorphism and Helicobacter pylori infection in Brazilian adult patients with chronic gastritis Received: 5 March 2005 / Accepted in revised form: 22 June 2005 Abstract Helicobacter pylori is recognised as the most common cause of chronic active gastritis and this bacterium is also an important pathogenic factor in peptic ulcer disease. The biological factors that influence clinical outcome in H. pylori infection have been extensively studied. In addition to immunological factors in the host, bacterial L. Lobo Gatti ( ) Hemocentro, Faculdade de Medicina de Marília, Disciplina de Genética e Biologia Molecular, Rua Lourival Freire 240, CEP Bairro Fragata, Marília, lobogatti@yahoo.com.br Tel.: Fax: L. Lobo Gatti R.W. de Lábio S.L. Marques Payão Laboratório de Citogenética e Biologia Molecular, Faculdade de Medicina de Marília, L. Lobo Gatti M. de Arruda Cardoso Smith S.L. Marques Payão Disciplina de Genética, Universidade Federal de São Paulo, UNIFESP, M. Zambaldi Tunes Aluno do Curso Médico da Faculdade de Medicina de Marília L.C. Silva Disciplina de Patologia, Faculdade de Medicina de Marília, S.L. Marques Payão Mestrado em Biologia Oral, Universidade do Sagrado Coração USC-Bauru virulence determinants in H. pylori strains are likely to play a crucial role in gastric cancer development. Singlenucleotide polymorphisms at the 5 flanking region of the interleukin (IL)-6 gene promoter (G or C at -174 base) have been identified and individuals with the G allele at position -174 have been shown to produce higher levels of IL-6 than those with the C/C genotype. The mucosal levels of IL-6 were reported to be increased in H. pylori-associated gastritis. The present study was conducted to examine any relationship between inflammatory cytokine polymorphisms and the inflammatory process in mucosa infected by H. pylori. In our study we did not find any association between the C and G alleles in adult patients with chronic gastritis and inflammatory process in gastric mucosa. Key words Helicobacter pylori Interleukin-6 polymorphism Gastritis Introduction Helicobacter pylori is recognised as the most common cause of chronic active gastritis [1] and this bacterium is also an important pathogenic factor in peptic ulcer disease [2]. The outcome of an individual infection is thought to be related to severity and distribution of H. pylori-related inflammation [3]. The biological factors that influence clinical outcome in H. pylori infection have been extensively studied. In addition to immunological factors in the host, bacterial virulence determinants in H. pylori strains are likely to play a crucial role in gastric cancer development [4]. H. pylori infection first induces neutrophilic gastritis, which progresses to active chronic gastritis in most people [5]. Persistent inflammation, possibly intensified via the inflammatory cytokine cascade and the generation of H. pylori-specific T and B cell immune responses [4], even-

2 L. Lobo Gatti et al.: Interleukin-6, H. pylori chronic gastritis 113 tually leads to gastric atrophy, hypochlorhydria and increased risk of gastric carcinoma [6 8]. The host s ability to regulate cytokine production has been shown to be influenced by the presence of polymorphisms in the coding and promoter regions. Genetic polymorphisms in these cytokines may be a host factor that regulates the immune and inflammatory response. Interleukin-1β (IL-1β) is a potential proinflammatory cytokine that is up-regulated in the presence of H. pylori and is important for initiating and amplifying the inflammatory response to this infection [9, 10]. IL-6 is a multifunctional cytokine produced by immune and many nonimmune cells, and has functions both as an inflammatory mediator and endocrine and metabolic function regulator [11]. The IL-6 gene (Il-6) is located on chromosome 7p21 [12]. Single-nucleotide polymorphisms at the 5 flanking region of the IL-6 gene promoter (G or C at -174 base) have been identified [13]. Individuals with the G allele at position -174 have been shown to produce higher levels of IL-6 [14] than those with the C/C genotype. The mucosal levels of IL-6 were reported to be increased in H. pylori-associated gastritis [15]. Individuals with the G allele at position -174 have been shown to produce higher levels of IL-6 and are more prone to systemic juvenile onset chronic arthritis [16], lipid abnormalities [17] and insulin resistance [18]. The present study was conducted to examine any relationship between inflammatory cytokine polymorphisms and the inflammatory process in mucosa infected by H. pylori. The samples for the urease test were placed in a tube containing Christensen s 2% urea agar and examined within 24 h of incubation at 37ºC for urea hydrolysis and used for histopathologic examination including H. pylori detection, according to the updated Sydney System [19]. DNA extraction, polymerase chain reaction (PCR) for H. pylori diagnostic and Southern blotting DNA for PCR was extracted using the QIAamp tissue (Qiagen, Hilden, Germany). PCR assays were performed with approximately 100 ng of total DNA using three different sets of oligonucleotides; the first one amplifies a 411-bp fragment corresponding to the urease gene, the second one amplifies a 298-bp corresponding to a gene encoding a 26-kDa antigenic protein specific for H. pylori [20, 21] and the third one amplifies a 150-bp fragment corresponding to 16S-rRNA from H. pylori [22] (Fig. 1). In each experiment positive (strain 26695) and negative controls (water) were included. After separation in 2% agarose gels, PCR products were blotted to hybond N+ membrane and hybridised with the specific PCR fragments labelled by the chemiluminescent method (Amersham Pharmacia). The assay was considered positive when one of the PCR products was present. Primer sequence and PCR conditions are described in Table 1. Genetic analysis of IL-6 polymorphism (-174 base) by PCRrestriction length polymorphism (RFLP) The polymorphic region containing the NlaIII restriction site at position -174 base was amplified using primers IL6-F and IL6-R (Table1). After PCR, the products obtained were digested with 1 U Material and methods Patients, endoscopy and biopsies The patients included in this study were 120 consecutive adults positive to H. pylori infection, presenting recurrent abdominal pain (mean age 40 years) from the Ambulatório de Endoscopia of the Faculdade de Medicina de Marília,. This population was composed of Europeans and those of mixed and/or other origins. Similar numbers of females and males constituted our sample. From each patient, four biopsies were obtained from both gastric antrum and corpus. One corpus and one antrum specimen were used for each rapid urease test and DNA extraction and two specimens of each were used for histology. The endoscopic forceps were sterilised in 2% glutaraldehyde solution for a minimum of 20 min between each experiment. This study was approved by the local ethics committee and written informed consent was obtained from all patients. Rapid urease test and histology Fig. 1 2% agarose gel after PCR amplification of Helicobacter pylori DNA detection using H3H4 primers (298 bp) (lane 1); HP1.1/HPX2 primers (150 bp) (lane 2) and h5/h6 primers (411 bp) (lane 3); M, 100-bp DNA Marker

3 114 L. Lobo Gatti et al.: Interleukin-6, H. pylori chronic gastritis Table 1 Oligonucleotides and PCR conditions for H. pylori detection by PCR Primer Sequence (5 3 ) PCR condition H3 TGGCGTGTCTATTGACAGCGAGC H4 CCTGCTGGGCATACTTCACCATG 94ºC 5, 40 cycles 94ºC 1 /60ºC 1 /72ºC 1, 72ºC 7 H5 GCCAATGGTAAATTAGTT H6 CTCCTTAATTGTTTTTAC 94ºC 5, 40 cycles 94ºC 1 /60ºC 1 /72ºC 1, 72ºC 7 Hp1.1 CTGGAGARACTAAGYCCTCC Hpx2 GAGGAATACTCATTGCGAAGGCGA 94ºC 5, 40 cycles 94ºC 1 /59ºC 1 /72ºC 1, 72ºC 7 Il-6F TTGTCAAGACATGCCAAAGTG Il-6R TCAGACATCTCCAGTCCTATA 94ºC 5, 30 cycles 94ºC 30 /55ºC 45 /72ºC 45,72ºC, 7 a b Fig. 2a, b Detection of IL-6 (Il-6) C to G transition at -174 base by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). a PCR product of Il-6 gene (300 bp). Lanes 1 6 different samples; lane 7, negative control and M, marker ladder, 100-bp (Gibco). b GTG 4% agarose gel by detection of Il-6 polymorphism after NlaIII digestion. Lane 1, homozygote allele G/G (233, 54 and 13 bp); lanes 2, 3, 5 and 6, heterozygote allele G/C (233, 122, 111, 54 and 13 bp); and lane 4, homozygote allele C/C (122, 111, 54 and 13 bp) of NlaIII at 37ºC overnight and run on an ethidium bromidestained 4% GTG gel. G/G alleles were observed at bands 233, 54 and 13 bp and C/C alleles were observed at bands 122, 111, 54 and 13 bp (Fig. 2). Genotypes distribution This population sample was tested concerning the Hardy Weinberg equilibrium and allele frequencies were determined. Statistical analysis Statistical analysis involved Fisher s exact test and the chisquared test. Results One hundred and twenty adult patients were studied, all with chronic gastritis diagnosed by antrum histopathological analysis. The genotypes of the polymorphism at the promoter region (-174 base) of the Il-6 gene are shown in Table 2 and no significant statistical difference was observed. Allele frequencies obtained were: C=0.3 and G=0.7. This population was within the Hardy-Weinberg equilibrium. According to the Sydney system [19], an increase in lymphocytes and plasma cell in the lamina propria categorises the gastritis as chronic and the chronic activity refers to the density of neutrophils in the lamina propria. We assessed inflammation (mononuclear cell infiltration)

4 L. Lobo Gatti et al.: Interleukin-6, H. pylori chronic gastritis 115 Table 2 Genotype distribution of single nucleotide polymorphisms of Il-6 base -174 in Brazilian adult patients according to inflammation score by PCR-RFLP analysis Neutrophilic infiltrate genotype Mononuclear infiltrate genotype C/C C/G G/G C/C C/G G/G Score Score Score Score Total No statistical difference was observed and activity (neutrophil infiltration) on a scale of four grades: 0, 1, 2, 3 (corresponding to none, mild, moderate and severe, respectively, in the Sydney system). Intestinal metaplasia and gastric atrophy were not observed in our sample. Discussion H. pylori infection causes a series of complicated host reactions [23]. IL-1β, IL-6 and IL-8 have been described to have higher levels in the gastric mucosa when compared with noninfected persons [24]. These findings point to the association between these cytokine levels and H. pylori infection status. A high degree of polymorphonuclear infiltration for long periods of time may be a risk factor for carcinogenesis, as the oxidative burst produced by the disintegration of cells in the gastric mucosa liberates substances with mutagenic potential [25]. Cytokines are potential immunomodulator molecules that mediate the inflammation and immune response, which influence cellular activation, differentiation and function. There are many reports that a number of cytokine genes are polymorphic and their polymorphisms in the cytokine gene regulatory regions correlate with their cytokine secretion [26]. Several groups have investigated the roles of cytokines as modulators of the immune response, as well as their effects on various immunologic disorders. There are many reports suggesting that the collective influences of several cytokines could make the immune responses as complex as those underlying allograft rejection or autoimmune diseases [27, 28]. In our study we have investigated the prevalence of polymorphisms in the Il-6 gene among Brazilian patients with chronic gastritis and inflammatory process. We have identified a correlation between IL-1β and gastric cancer [29]. The individual s genotype at polymorphic sites in IL- 6 (especially the -174 site) is thought to determine the IL- 6 response to stimuli and predisposes to development of diseases where IL-6 has been implicated. It has been proposed that the C allele at position -174 compared with the G allele was associated with lower levels of plasma IL-6 in normal subjects. In our study we did not find any association between the C and G alleles in adult patients with chronic gastritis and inflammatory process in gastric mucosa. Hwang et al. [30] did not support the hypothesis that the -174G allele carrier is associated with a high level of Il-6 production and suggest that these polymorphisms are ethnic. The contribution of the gastric epithelium to the cytokine responses may be considerable, which may be relevant regarding to the pathogenic mechanisms of H. pylori-associated disease. Further studies will be necessary to clarify whether ethnicity influences the allelic frequencies at this polymorphic site and other interleukin polymorphisms. Acknowledgements This work was supported by the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP, BRAZIL) grant numbers: 1998/ , 2000/ and to the post-graduate student fellowship LLG number 2002/ and by Faculdade de Medicina de Marília (FAMEMA) and Escola Paulista de Medicina (UNIFESP). References 1. Blaser MJ (1992) Hypotheses on the pathogenesis and natural history of Helicobacter pylori induced inflammation. Gastroenterology 102: Marshall BJ, Warren JR, Blincow ED, Philips M, Goodwin CS, Murray R, Clackbourn SJ, Watres TE, Sanderson CE (1988) Prospective double blind trial of duodenal ulcer relapse after eradication of Campylobacter pylori. Lancet ii: Graham DY (1997) Helicobacter pylori infection in the pathogenesis of duodenal ulcer and gastric cancer: a model. Gastroenterology 113:

5 116 L. Lobo Gatti et al.: Interleukin-6, H. pylori chronic gastritis 4. Shimoyama T, Crabtree JE (1998) Bacterial factors and immune pathogenesis in Helicobacter pylori infection. Gut 43[Suppl 1]:S2 S5 5. IARC (1994) Schistosomes, liver flukes and Helicobacter pylori. IARC, Lyon, France 6. Correa P (1992) Human gastric carcinogenesis: a multistep and multifactorial process First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention. Cancer Res 52: Sipponen P. Gastric cancer: a long-term consequence of Helicobacter pylori infection? Scand J Gastroenterol [Suppl 201]: Carneiro F, Seixas M, Sobrinho-Simões M (1995) New elements for an updated classification of the carcinomas of the stomach. Pathol Res Pract 191: Noach LA, Bosma NB, Jansen J, Hoek FJ, van Deventer SJ, Tytgat GN (1994) Mucosal tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-8 production inpatients with Helicobacter pylori infection. Scand J Gastroenterol 29: Basso D, Scrigner M, Toma A, Navaglia F, Di Mario F, Rugge M, Plebani M (1996) Helicobacter pylori infection enhances mucosal interleukin-1 beta, interleukin-6, and the soluble receptor of interleukin-2. Int J Clin Lab Res 26: Lauta VM (2001) Interleukin-6 and net work of several cytokines in multiple myeloma. An overview of clinical and experimental data. Cytokine 16: Sehgal PB, Zilberstein A, Ruggieri RM et al (1986) Human chromosome 7 carries the beta-2 interferon gene. Proc Natl Acad Sci 83: Terry CF, Loukaci V, Green FR (2000) Cooperative influence of genetic polymorphisms on interleukin 6 transcriptional regulation. J Biol Chem 275: Fernandes-Real JM, Broch M, Vendrell J, Richart C, Ricart W (2000) Interleukin-6 polymorphisms and lipid abnormalities in healthy subjects. J Clin Endocrinol Metab 85: Yamaoka Y, Kita M, Kodama Y, Sawai N, Imanishi J (1996) Helicobacter pylori caga gene and expression of cytokine messenger RNA in gastric mucosa. Gastroenterology 110: Fisman D, Faulds G, Jeffery R et al (2000) Cooperative influence of genetic polymorphisms on interleukin-6 transcriptional regulation. J Biol Chem 275: Fernandez-Real JM, Broch M, Vendrell J, Richart C, Ricart W (2000) Interleukin-6 gene polymorphism and lipid abnormalities in healthy subjects. J Clin Endocrinol Metab 85: Fernandez-Real J-M, Broch M, Vendrell J et al (2000) Interleukin-6 gene polymorphism and insulin sensitivity. Diabetes 49: Dixon MF, Yardley JH, Correa P (1996) Classification and grading of gastritis: the updated Sydney System. Am J Surg Pathol 20: Clayton CL, Kleanthous H, Coates PJ, Morgan DD, Tabaqchali S (1992) Sensitive detection of Helicobacter pylori by using polymerase chain reaction. J Clin Microbiol 30: Hammar M, Tyszkiewicz T, Wadström T, O Toole PW (1992) Rapid detection of Helicobacter pylori in gastric biopsy material by polymerase chain reaction. J Clin Microbiol 30: Scholte GH, vandoorn LJ, Quint WG, Lindeman J (1997) Polymerase chain reaction the detection of Helicobacter pylori in formaldehyde-sublimate fixed, paraffin-embedded gastric biopsies. Diagn Mol Pathol 6: Montecucco C, Rappuoli R (2001) Living dangerously: how Helicobacter pylori survives in the human stomach. Nature Rev Mol Cell Biol 2: Yamaoka Y, Kodama T, Kita M, Imanishi J, Kashima K, Graham DY (2001) Relation between cytokines and Helicobacter pylori in gastric cancer. Helicobacter 6: Chul-Woo P, Seong-Suk H, Yang-Kym K, Hee-Baeg C, Young-Sun H, Dong-Wook K, Chun-Choo K, Hack-Ki K, Tai- Gyu K (2003) Polymorphisms pf Il-1B, Il-1RN, Il-2, Il-4, Il- 10 and IFN-V genes in Korean population. Hum Immunol 64: Turner D, Grant SC, Yonan N, Sheldon S, Dyer PA, Sinnott PJ, Hutchinson IV (1997) Cytokine gene polymorphism and heart transplant rejection. Transplantation 64: Vinasco J, Beraun Y, Nieto A, Fraile A, Mataran L, Pareja E, Martin J (1997) Polymorphisms at the TNF loci in rheumatoid arthritis. Tissue Antigens 49: Gatti LL, Burbano RR, Assumpção PP, Smith MAC, Payão SLM (2004) Interleukin-1B polymorphisms, Helicobacter pylori infection in individuals from Northern Brazil with gastric adenocarcinoma. Clin Exp Med 4: Hwang IR, Hsu P, Peterson LE, Gutierrez O, Kim JG, Graham DY, Yamaoka Y (2003) Interleukin-6 genetic polymorphisms are not related to Helicobacter pylori-associated gastroduodenal diseases. Helicobacter 8: Hwang IR, Hsu Ping-I, Peterson LE, Gutierrez O, Kim GJ, Graham DY, Yamaoka Y (2003) Interleukin-6 genetic polymorphisms are not related to Helicobacter pylori-associated gastroduodenal diseases. Helicobacter 8: