Association of molecular status and organs with metastases at diagnosis in patients with non-small cell lung cancer (NSCLC)
|
|
- Franklin Skinner
- 5 years ago
- Views:
Transcription
1 Association of molecular status and organs with metastases at diagnosis in patients with non-small cell lung cancer (NSCLC) Chantal Kuijpers* 1,2, Lizza Hendriks 3, Jules Derks 3, Anne-Marie Dingemans 3, Anne van Lindert 1, Michel van den Heuvel 5, Ronald Damhuis 6, Stefan Willems 1,2,7 1. Dept. of Pathology, University Medical Centre Utrecht, Utrecht 2. Foundation PALGA, Houten 3. Dept. of Pulmonary Diseases, GROW School for Oncology and Developmental Biology, Maastricht University Medical Centre, Maastricht 4. Dept. of Respiratory Medicine, University Medical Centre Utrecht, Utrecht 5. Dept. of Lung Disease, Radboudumc, Nijmegen 6. Netherlands Comprehensive Cancer Organisation (IKNL), Utrecht 7. Dept. of Pathology, Netherlands Cancer Institute - Antoni van Leeuwenhoek hospital, Amsterdam
2 Disclosure slide This study was partly funded by Roche and Pfizer.
3 Molecular alterations in NSCLC Adenocarcinoma and NSCLC-NOS KRAS mutation 20-25% EGFR mutation 10-15% ALK rearrangement 5% Targetable with TKI EGFR - activating mutations exon 19 del, exon 21 L858R, other uncommon act. mutation - resistance mutations mostly exon 20 mutations
4 Anatomic sites of metastases Most common: bone, brain, liver, adrenal gland, pleura, lung, lymph node 1 Biological predisposition for metastatic organs might differ between molecular subgroups: implications for screening and (prophylactic) treatment Incidence of brain and bone metastases may be higher in EGFR+ patients 2-5 Biological predisposition? What about the other alterations? 1. Hendriks et al. Eur J Cancer (2015) 2. Matsumoto et al. Int J Cancer (2006) 3. Li et al. Clin Exp Metastasis (2016) 4. Guan et al. Med Oncol (2016) 5. Sholl et al. J Thor Oncol (2015)
5 Objective To evaluate the association between molecular status and metastatic organs at diagnosis in a nationwide stage IV non-squamous NSCLC cohort
6 Approach Patient selection Netherlands Cancer Registry (NCR) Dutch Pathology Registry (PALGA) - Identify all stage IV adenoca and NSCLC-NOS (year: 2013) - Exclude: patients with a recent history of cancer ( 5 years) - Age, gender, morphology, TNM stage, metastasis locations ( 3) - Microscopy and conclusion fields - Data extraction on molecular status - Identification mol. subgroups: EGFR+ KRAS+ ALK+ Triple-negative* * Triple-tested or EGFR and KRAS tested
7 Approach - statistical analysis Per metastatic organ: Univariable logistic regression analyses to determine risk factors: - Age (continuous) - Gender - Morphology (adenocarcinoma vs. NSCLC-NOS) - Local disease status ( T2 and N1 vs. T3 or N2) If p-value <0.2: variables included in multivariable analysis Multivariable logistic regression analyses to assess association with: Molecular status: EGFR+, KRAS+ and ALK+ with triple-negative
8 Included patients
9 Organs with metastases - overview Organ N % Organ N % Bone Skin Pleura Spleen Lung Peritoneum Brain Kidney Adrenal gland Thorax Liver Pancreas Extrathoracic lymph nodes Breast Soft tissue Thyroid Heart Meninges Less common metastatic sites (n 6) are not included in the table
10 Association molecular subgroups and metastatic organs
11 Conclusions NSCLC molecular status is associated with organs of metastases. EGFR+ patients had more often bone and pleural metastases, and less often brain and adrenal gland metastases than triple-negative patients. 54% of EGFR+ patients had bone metastases at diagnosis. Screening all EGFR+ patients for bone metastases is worth considering, aiming to prevent skeletal-related events. In contrast to previous studies: EGFR+ less often brain mets at diagnosis probably no biological predisposition for the brain
12 Acknowledgements Funding Lizza Hendriks Ronald Damhuis Jules Derks Marianne van der Mark Anne-Marie Dingemans Stefan Willems Michel van den Heuvel All participating laboratories Anne van Lindert Koos Koole Felix Broekhuizen Ellen de Weger Lucy Overbeek Bert Siebers Rinus Voorham
Applying Genomics to Cancer 21 st September The Frequency of EGFR mutations in Lung Adenocarcinoma: The Cardiff Experience
Applying Genomics to Cancer 21 st September 2015 The Frequency of EGFR mutations in Lung Adenocarcinoma: The Cardiff Experience Aled Daniels R Butler, R Attanoos, H Davies University Hospital of Wales
More informationClinical features of large cell neuroendocrine carcinoma: a population-based overview
ORIGINAL ARTICLE LUNG CANCER Clinical features of large cell neuroendocrine carcinoma: a population-based overview Jules L. Derks 1, Lizza E. Hendriks 1, Wieneke A. Buikhuisen 2, Harry J.M. Groen 3, Erik
More informationHOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY
HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY 7 TH Annual New York Lung Cancer Symposium Saturday, November 10, 2012 William D. Travis, M.D. Attending Thoracic Pathologist Memorial Sloan Kettering
More informationDisclosure of Relevant Financial Relationships NON-SMALL CELL LUNG CANCER: 70% PRESENT IN ADVANCED STAGE
MORPHOLOGY AND MOLECULAR TESTING IN NON-SMALL CELL OF LUNG NEW FRONTIEIRS IN CYTOPATHOLOGY PRACTICE American Society for Cytopathology San Antonio, Texas Sunday March 5, 2017 Disclosure of Relevant Financial
More informationLUNG CANCER. pathology & molecular biology. Izidor Kern University Clinic Golnik, Slovenia
LUNG CANCER pathology & molecular biology Izidor Kern University Clinic Golnik, Slovenia 1 Pathology and epidemiology Small biopsy & cytology SCLC 14% NSCC NOS 4% 70% 60% 50% 63% 62% 61% 62% 59% 54% 51%
More informationDifficult Diagnoses and Controversial Entities in Neoplastic Lung
Difficult Diagnoses and Controversial Entities in Neoplastic Lung Lynette M. Sholl, M.D. Associate Pathologist, Brigham and Women s Hospital Chief, Pulmonary Pathology Service Associate Professor, Harvard
More informationEnterprise Interest. Pfizer, Roche, BMS, MSD, Novartis
Enterprise Interest Pfizer, Roche, BMS, MSD, Novartis Beyond the WHO 2015 classification of lung neuroendocrine tumours Genomics of lung NETs & identification of biomarkers for prognosis and therapy Prof.
More informationK-Ras signalling in NSCLC
Targeting the Ras-Raf-Mek-Erk pathway Egbert F. Smit MD PhD Dept. Pulmonary Diseases Vrije Universiteit VU Medical Centre Amsterdam, The Netherlands K-Ras signalling in NSCLC Sun et al. Nature Rev. Cancer
More informationMolecular Pathobiology of Lung Cancer. William K. Funkhouser, MD PhD Department of Pathology and Lab Medicine University of North Carolina
Molecular Pathobiology of Lung Cancer William K. Funkhouser, MD PhD Department of Pathology and Lab Medicine University of North Carolina Outline Lung Anatomy Lung Carcinoma Classification & Morphology
More informationTHE USE OF BIOMARKERS IN TREATMENT PATTERNS
European Network of Cancer Registries Scientific Meeting 2018 THE USE OF BIOMARKERS IN TREATMENT PATTERNS AND SURVIVAL OUTCOMES OF METASTATIC NON-SQUAMOUS NON-SMALL CELL LUNG CANCER RODRIGO MURTEIRA National
More informationQuality ID #395: Lung Cancer Reporting (Biopsy/Cytology Specimens) National Quality Strategy Domain: Communication and Care Coordination
Quality ID #395: Lung Cancer Reporting (Biopsy/Cytology Specimens) National Quality Strategy Domain: Communication and Care Coordination 2018 OPTIONS FOR INDIVIDUAL MEASURES: REGISTRY ONLY MEASURE TYPE:
More informationMolecular Targets in Lung Cancer
Molecular Targets in Lung Cancer Robert Ramirez, DO, FACP Thoracic and Neuroendocrine Oncology November 18 th, 2016 Disclosures Consulting and speaker fees for Ipsen Pharmaceuticals, AstraZeneca and Merck
More informationManagement of advanced non small cell lung cancer
Management of advanced non small cell lung cancer Jean-Paul Sculier Intensive Care & Thoracic Oncology Institut Jules Bordet Université Libre de Bruxelles (ULB) www.pneumocancero.com Declaration No conflict
More informationAssessing the lung and mediastinum in cancer-is tissue the issue? George Santis
1 Assessing the lung and mediastinum in cancer-is tissue the issue? George Santis Optimal management of Cancer Histological diagnosis & accurate staging at presentation Molecular analysis of primary tumour
More informationJoachim Aerts Erasmus MC Rotterdam, Netherlands. Drawing the map: molecular characterization of NSCLC
Joachim Aerts Erasmus MC Rotterdam, Netherlands Drawing the map: molecular characterization of NSCLC Disclosures Honoraria for advisory board/consultancy/speakers fee Eli Lilly Roche Boehringer Ingelheim
More informationOptimum Sequencing of EGFR targeted therapy in NSCLC. Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey
Optimum Sequencing of EGFR targeted therapy in NSCLC Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey Lung cancer NSCLC SCLC adeno squamous EGFR ALK ROS1 BRAF HER2 KRAS EGFR Transl Lung Cancer
More informationPresented at the European Society of Medical Oncology (ESMO), Munich, Germany, October 2018
Effectiveness of afatinib in clinical practice first results of the GIDEON trial: a prospective non-interventional study in EGFR-mutated NSCLC in Germany Wolfgang M. Brueckl 1 *, Eckart Laack 2, Martin
More informationTreatment of oligometastatic NSCLC
Treatment of oligometastatic NSCLC Jarosław Kużdżał Department of Thoracic Surgery Jagiellonian University Collegium Medicum, John Paul II Hospital, Cracow New idea? 14 NSCLC patients with solitary extrathoracic
More informationHistopathology of NSCLC, IHC markers and ptnm classification
ESMO Preceptorship on Non-Small Cell Lung Cancer November 15 th & 16 th 2017 Singapore Histopathology of NSCLC, IHC markers and ptnm classification Prof Keith M Kerr Department of Pathology, Aberdeen University
More informationTargeted therapy in NSCLC: do we progress? Prof. Dr. V. Surmont. Masterclass 27 september 2018
Targeted therapy in NSCLC: do we progress? Prof. Dr. V. Surmont Masterclass 27 september 2018 Outline Introduction EGFR TKI ALK TKI TKI for uncommon driver mutations Take home messages The promise of
More informationChanging demographics of smoking and its effects during therapy
Changing demographics of smoking and its effects during therapy Egbert F. Smit MD PhD. Dept. Pulmonary Diseases, Vrije Universiteit Medical Centre, Amsterdam, The Netherlands Smoking prevalence adults
More informationLung Cancer. Current Therapy JEREMIAH MARTIN MBBCh FRCSI MSCRD
Lung Cancer Current Therapy JEREMIAH MARTIN MBBCh FRCSI MSCRD Objectives Describe risk factors, early detection & work-up of lung cancer. Define the role of modern treatment options, minimally invasive
More informationMolly Boyd, MD Glenn Mills, MD Syed Jafri, MD 1/1/2010
LSU HEALTH SCIENCES CENTER NSCLC Guidelines Feist-Weiller Cancer Center Molly Boyd, MD Glenn Mills, MD Syed Jafri, MD 1/1/2010 Initial Evaluation/Intervention: 1. Pathology Review 2. History and Physical
More informationLung Cancer: Overview and Updates
Lung Cancer: Overview and Updates Peter H. Johnson, M.D. Medical Oncologist & Hematologist, Columbia St. Mary s Hospital February 1, 2018 Disclosures No financial interests to disclose No conflicts of
More informationMaterials and methods. Histologic grading. Questionnaire among pathologists. Data source and study population
https://doi.org/10.1007/s10549-018-05082-y EPIDEMIOLOGY Significant inter- and intra-laboratory variation in grading of ductal carcinoma in situ of the breast: a nationwide study of 4901 patients in the
More informationThis online (electronic) survey contains twenty four simple questions. Those marked with an asterisk (*) must be answered.
1. Type of survey This is a retrospective survey that will NOT require the disclosure of any individual patient records or data only information about overall EGFR mutation testing practices and the outcomes
More informationSCOPE OF PRACTICE PGY-5
Recognize normal cytomorphology of cells derived from the respiratory, gastrointestinal, and genitourinary tracts, and body fluid (Cerebrospinal fluid, pleural and peritoneal fluid) Recognize normal cytomorphology
More informationReflex Testing Guidelines for Immunotherapy in Non-Small Cell Lung Cancer
Reflex Testing Guidelines for Immunotherapy in Non-Small Cell Lung Cancer Jimmy Ruiz, MD Assistant Professor Thoracic Oncology Program Wake Forest Comprehensive Cancer Center Disclosures I have no actual
More information3/23/2017. Disclosure of Relevant Financial Relationships. Pathologic Staging Updates in Lung Cancer T STAGE OUTLINE SURVIVAL ACCORDING TO SIZE ONLY
Pathologic Staging Updates in Lung Cancer Disclosure of Relevant Financial Relationships USCAP requires that all planners (Education Committee) in a position to influence or control the content of CME
More informationA Nationwide Population-Based Study on the Survival of Patients with Pancreatic Neuroendocrine Tumors in The Netherlands
World J Surg (2018) 42:490 497 DOI 10.1007/s00268-017-4278-y ORIGINAL SCIENTIFIC REPORT A Nationwide Population-Based Study on the Survival of Patients with Pancreatic Neuroendocrine Tumors in The Netherlands
More informationLung tumors & pleural lesions
Lung tumors & pleural lesions A brief introduction 95% of lung tumors are carcinomas Among the remaining 5%, we will discuss: -Hamartoma the most common benign lung tumor spherical, coin lesion on x-rays
More informationLung Cancer Case. Since the patient was symptomatic, a targeted panel was sent. ALK FISH returned in 2 days and was positive.
Lung Cancer Case Jonathan Riess, M.D. M.S. Assistant Professor of Medicine University of California Davis School of Medicine UC Davis Comprehensive Cancer Center 63 year-old woman, never smoker, presents
More informationAssay Location Primer TaqMan probe Reference
Table S1. Primers and TaqMan probes for picoliter-ddpcr Assay Location Primer TaqMan probe Reference Exon 19 deletion assay a Exon 19 GCACCATCTCACAATTGCCAG VIC-CAGAAGGTGAGAAAGTT-MGB Reference probe Original
More informationClinical Study on Prognostic Factors and Nursing of Breast Cancer with Brain Metastases
Clinical Study on Prognostic Factors and Nursing of Breast Cancer with Brain Metastases Ying Zhou 1#, Kefang Zhong 1#, Fang Zhou* 2 ABSTRACT This paper aims to explore the clinical features and prognostic
More informationQuality ID #395: Lung Cancer Reporting (Biopsy/Cytology Specimens) National Quality Strategy Domain: Communication and Care Coordination
Quality ID #395: Lung Cancer Reporting (Biopsy/Cytology Specimens) National Quality Strategy Domain: Communication and Care Coordination 2018 OPTIONS FOR INDIVIDUAL MEASURES: CLAIMS ONLY MEASURE TYPE:
More informationMight Adaptive Radiotherapy in NSCLC be feasible in clinical practice?
Might Adaptive Radiotherapy in NSCLC be feasible in clinical practice? E.Molfese, P.Matteucci, A.Iurato, L.E.Trodella, A.Sicilia, B.Floreno, S.Ramella, L.Trodella Radioterapia Oncologica, Università Campus
More informationCase Studies. Ravi Salgia, MD, PhD
Case Studies Ravi Salgia, MD, PhD Professor and Arthur & Rosalie Kaplan Chair Medical Oncology and Therapeutics Research Associate Director for Clinical Sciences Research City of Hope 04-21-2018 Objectives
More informationManagement Guidelines and Targeted Therapies in Metastatic Non-Small Cell Lung Cancer: An Oncologist s Perspective
Management Guidelines and Targeted Therapies in Metastatic Non-Small Cell Lung Cancer: An Oncologist s Perspective Julie R. Brahmer, M.D. Associate Professor of Oncology The Sidney Kimmel Comprehensive
More informationSlide 1. Slide 2. Slide 3. Disclosures. Personalized Medicine for Advanced NSCLC in East Asia. No conflicts related to this presentation
Slide 1 12 th International Lung Cancer Conference Personalized Medicine for Advanced NSCLC in East Asia Masahiro Tsuboi, M.D., Ph.D. Group Chair, Lung Cancer Surgical Study Group in Japan Clinical Oncology
More informationCytological Sub-classification of Lung Cancer: Morphologic and Molecular Characteristics. Mercè Jordà, University of Miami
Cytological Sub-classification of Lung Cancer: Morphologic and Molecular Characteristics Mercè Jordà, University of Miami Mortality Lung cancer is the most frequent cause of cancer incidence and mortality
More informationPalliative radiotherapy near the end of life for brain metastases from lung cancer: a populationbased
Palliative radiotherapy near the end of life for brain metastases from lung cancer: a populationbased analysis Roel Schlijper Fellow Radiation Oncology BC Cancer, Prince George Disclosures No conflicts
More informationReparatory system 18 lectures Heyam Awad
Reparatory system 18 lectures 8-10 Heyam Awad These lectures cover the following topics 1. Diffuse hemorrhagic syndromes 2. Lung tumors important: theses slides are your study source for these lectures.
More informationEndobronchial Ultrasound in the Diagnosis & Staging of Lung Cancer
Endobronchial Ultrasound in the Diagnosis & Staging of Lung Cancer Dr Richard Booton PhD FRCP Lead Lung Cancer Clinician, Consultant Respiratory Physician & Speciality Director Manchester University NHS
More informationEl contexto molecular de la sobreexpresión de PD-L1 Esther Conde Gallego, MD, PhD
El contexto molecular de la sobreexpresión de PD-L1 Esther Conde Gallego, MD, PhD Laboratorio de Dianas Terapéuticas Hospital Universitario HM Sanchinarro Madrid, Spain Contents Background PD-L1 expression
More informationLung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD. Mount Carrigain 2/4/17
Lung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD Mount Carrigain 2/4/17 Histology Adenocarcinoma: Mixed subtype, acinar, papillary, solid, micropapillary, lepidic
More informationMolecular Testing in Lung Cancer
Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans
More informationReparatory system lectures Heyam Awad
Reparatory system lectures 8-10 Heyam Awad note These lectures cover the following topics 1. Diffuse hemorrhagic syndromes 2. Lung tumors important: theses slides are your study source for these lectures.
More informationPET CT for Staging Lung Cancer
PET CT for Staging Lung Cancer Rohit Kochhar Consultant Radiologist Disclosures Neither I nor my immediate family members have financial relationships with commercial organizations that may have a direct
More informationand management of lung cancer Maureen F. Zakowski, M.D. Memorial Sloan-Kettering Cancer Center
The new role of cytology in the diagnosis and management of lung cancer Maureen F. Zakowski, M.D. Memorial Sloan-Kettering Cancer Center Outline Role of cytology in the diagnosis of lung cancer Non-small
More informationGROUP 1: Peripheral tumour with normal hilar and mediastinum on staging CT with no disant metastases. Including: Excluding:
GROUP 1: Including: Excluding: Peripheral tumour with normal hilar and mediastinum on staging CT with no disant metastases Solid pulmonary nodules 8mm diameter / 300mm3 volume and BROCK risk of malignancy
More informationFast Facts: Non-Small-Cell Lung Cancer
Fast Facts Fast Facts: Non-Small-Cell Lung Cancer Mary O Brien MD FRCP Consultant Medical Oncologist The Royal Marsden NHS Foundation Trust London, UK Benjamin Besse MD PhD Thoracic Cancer Unit, Head Department
More informationA case of different EGFR mutations in surgically resected synchronous triple lung cancer
Case Report A case of different EGFR mutations in surgically resected synchronous triple lung cancer Naoki Haratake 1, Mitsuhiro Takenoyama 1, Makoto Edagawa 1, Shinichiro Shimamatsu 1, Ryo Toyozawa 1,
More informationImpact of immunostaining of pulmonary and mediastinal cytology
Impact of immunostaining of pulmonary and mediastinal cytology Harman Sekhon MD, PhD Director of Cytopathology Head of Ottawa-site Ontario Tumour Bank June 20, 2014 Disclaimer Pfizer: Honorarium-Advisory
More informationImproving outcomes for NSCLC patients with brain metastases
Improving outcomes for NSCLC patients with brain metastases Martin Schuler West German Cancer Center, Essen, Germany In Switzerland, afatinib is approved as monotherapy for patients with non-small cell
More informationexpectancy Cancer spread to bones life expectancy
Cancer spread to bones life expectancy The Borg System is 100 % Cancer spread to bones life expectancy Sep 27, 2016. About 80 percent of the time prostate cancer cells metastasize, or spread, they will
More informationCurrent outcomes of postrecurrence survival in patients after resection of non-small cell lung cancer
Original Article Current outcomes of postrecurrence survival in patients after resection of non-small cell lung cancer Tetsuya Mizuno 1, Takaaki Arimura 1, Hiroaki Kuroda 1, Noriaki Sakakura 1, Yasushi
More informationNext generation diagnostics Bringing high-throughput sequencing into clinical application
Next generation diagnostics Bringing high-throughput sequencing into clinical application Leonardo A. Meza-Zepeda, PhD Translational Genomics Group Institute for Cancer Research Leonardo.Meza-Zepeda@rr-research.no
More informationBiomedical Research 2017; 28 (14): ISSN X
Biomedical Research 2017; 28 (14): ISSN 0970-938X www.biomedres.info Study of the relationship between EGFR mutation status and bone metastasis in advanced lung adenocarcinoma. Xiaoye Ai, Adalati Yasheng,
More informationState of the Art Treatment of Lung Cancer Ravi Salgia, MD, PhD
State of the Art Treatment of Lung Cancer Ravi Salgia, MD, PhD Professor and Chair Arthur & Rosalie Kaplan Chair Medical Oncology and Therapeutics Research Nothing to disclose DISCLOSURE Objectives Lung
More informationLung cancer spread to bones life expectancy
Lung cancer spread to bones life expectancy The Borg System is 100 % Lung cancer spread to bones life expectancy 12-4-2018 According to Orthobullets, the life expectancy for someone with metastatic bone
More informationSupplemental Table 1.1: Prostate cancer prognostic tools
Supplemental Table 1.1: Prostate cancer prognostic tools Features ANN^ BioChemical Capra^ CSQS EBRT Han Outcomes Cancer Specific - - +* + - - Non-Cancer Specific - - - + - - DFS/PFS +* +* +* - +* +* Clinical
More informationALK Fusion Oncogenes in Lung Adenocarcinoma
ALK Fusion Oncogenes in Lung Adenocarcinoma Vincent A Miller, MD Associate Attending Physician, Thoracic Oncology Service Memorial Sloan-Kettering Cancer Center New York, New York The identification of
More informationThe right middle lobe is the smallest lobe in the lung, and
ORIGINAL ARTICLE The Impact of Superior Mediastinal Lymph Node Metastases on Prognosis in Non-small Cell Lung Cancer Located in the Right Middle Lobe Yukinori Sakao, MD, PhD,* Sakae Okumura, MD,* Mun Mingyon,
More informationTraditional Approaches to Treating NSCLC, Part 2: Neoadjuvant Combined Modality, Locally Advanced, and Metastatic NSCLC
Transcript Details This is a transcript of a continuing medical education (CME) activity accessible on the ReachMD network. Additional media formats for the activity and full activity details (including
More informationAdvances in Pathology and molecular biology of lung cancer. Lukas Bubendorf Pathologie
Advances in Pathology and molecular biology of lung cancer Lukas Bubendorf Pathologie Agenda The revolution of predictive markers Liquid biopsies PD-L1 Molecular subtypes (non-squamous NSCLC) Tsao AS et
More informationEarly-stage locally advanced non-small cell lung cancer (NSCLC) Clinical Case Discussion
Early-stage locally advanced non-small cell lung cancer (NSCLC) Clinical Case Discussion Pieter Postmus The Clatterbridge Cancer Centre Liverpool Heart and Chest Hospital Liverpool, United Kingdom 1 2
More informationMolecular Diagnostics in Lung Cancer
Molecular Diagnostics in Lung Cancer Mutations in lung carcinomas and their impact on diagnosis and treatment With special thanks to: Barbara Chaitin, MD Medical Director, Esoteric Services AmeriPath Orlando,
More informationDisclosures Genomic testing in lung cancer
Disclosures Genomic testing in lung cancer No disclosures Objectives Understand how FISH and NGS provide complementary data for the evaluation of lung cancer Recognize the challenges of performing testing
More informationOutline. The Lung Cancer Patient in 2011 Not the Marlboro Man. Lung Cancer
Outline The Lung Cancer Patient in 2011 Not the Marlboro Man Jeanne Griffin Vaughn, APN-BC, AOCN Epidemiology Staging and Patterns of Spread Clinical Presentation Treatments March 26, 2011 Lung Cancer
More informationFrequent EGFR mutations in nonsmall cell lung cancer presenting with miliary intrapulmonary carcinomatosis
Eur Respir J 2013; 41: 417 424 DOI: 10.1183/09031936.00006912 CopyrightßERS 2013 Frequent EGFR mutations in nonsmall cell lung cancer presenting with miliary intrapulmonary carcinomatosis Shang-Gin Wu*,
More informationUpdated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors
Q: How is the strength of recommendation determined in the new molecular testing guideline? A: The strength of recommendation is determined by the strength of the available data (evidence). Strong Recommendation:
More informationTumor Board Discussions: Case 1
Tumor Board Discussions: Case 1 David S. Ettinger, MD The Alex Grass Professor of Oncology Johns Hopkins University School of Medicine Baltimore, Maryland Case #1 50-year-old Asian female, never smoker
More informationWat is de potentiële waarde van ctdna? PLCRC - MEDOCC
Wat is de potentiële waarde van ctdna? PLCRC - MEDOCC Translational Gastrointestinal Oncology Remond Fijneman r.fijneman@nki.nl Department of Pathology, Amsterdam, NL Wat is de potentiële waarde van ctdna?
More informationPlotting the course: optimizing treatment strategies in patients with advanced adenocarcinoma
Pieter E. Postmus University of Liverpool Liverpool, UK Plotting the course: optimizing treatment strategies in patients with advanced adenocarcinoma Disclosures Advisor Bristol-Myers Squibb AstraZeneca
More informationSupplementary Online Content
Supplementary Online Content Mezquita L, Auclin E, Ferrara R, et al. Association of the Lung Immune Prognostic Index with immune checkpoint inhibitor outcomes in patients with advanced non small cell lung
More informationBiomarcatori per la immunoterapia: cosa e come cercare Paolo Graziano
Biomarcatori per la immunoterapia: cosa e come cercare Paolo Graziano Unit of Pathology Fondazione IRCCS Casa Sollievo della Sofferenza San Giovanni Rotondo, Foggia,Italy p.graziano@operapadrepio.it Disclosure
More informationAJCC 7th Edition Handbook Errata as of 9/21/10
5 81 Larynx ICD-O-3 Topography Codes Delete C32.3 Laryngeal cartilage 5 81 Larynx ICD-O-3 Topography Codes Add an asterisk after C32.8 5 81 Larynx ICD-O-3 Topography Codes Add an asterisk after C32.9 5
More informationKirsten rat sarcoma viral oncogene homolog (KRAS) mutation
ORIGINAL ARTICLE KRAS Mutations in Advanced Nonsquamous Non Small- Cell Lung Cancer Patients Treated with First-Line Platinum- Based Chemotherapy Have No Predictive Value Wouter W. Mellema, MD,* Anne-Marie
More informationSerum Carcinoembryonic Antigen Levels and the Risk of Whole-body Metastatic Potential in Advanced Nonsmall Cell Lung Cancer
Ivyspring International Publisher Research Paper 663 Journal of Cancer 2014; 5(8): 663-669. doi: 10.7150/jca.9871 Serum Carcinoembryonic Antigen Levels and the Risk of Whole-body Metastatic Potential in
More informationNon Small Cell Lung Cancer Histopathology ד"ר יהודית זנדבנק
Non Small Cell Lung Cancer Histopathology ד"ר יהודית זנדבנק 26.06.09 Lecture outlines WHO histological classification Macro/Micro assessment Early diagnosis Minimal pathology Main subtypes SCC, AdCa, LCLC
More informationResearch Article Prognostic Implication of Predominant Histologic Subtypes of Lymph Node Metastases in Surgically Resected Lung Adenocarcinoma
BioMed Research International, Article ID 64568, 6 pages http://dx.doi.org/.55/24/64568 Research Article Prognostic Implication of Predominant Histologic Subtypes of Lymph Node Metastases in Surgically
More informationTHE ISSUE OF STAGE AT DIAGNOSIS
THE ISSUE OF STAGE AT DIAGNOSIS IN SURVIVAL ANALYSIS Pamela Minicozzi Analytical Epidemiology and Health Impact Unit Department of Preventive and Predictive Medicine, Fodazione IRCCS Istituto Nazionale
More informationMetabolic Phenotype of Stage IV Lung Adenocarcinoma: relationship with epidermal growth factor receptor mutation
Title Metabolic Phenotype of Stage IV Lung Adenocarcinoma: relationship with epidermal growth factor receptor mutation Author(s) Lee, EYP; Khong, PL; Lee, VHF; Qian, W; Yu, X; Wong, MP Citation Clinical
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/3/75/75ra26/dc1 Supplementary Materials for Genotypic and Histological Evolution of Lung Cancers Acquiring Resistance to EGFR Inhibitors Lecia V. Sequist,*
More informationMICROSCOPY PREDICTIVE PROFILING
Immunomodulatory therapy in NSCLC: a year into clinical practice Professor J R Gosney Consultant Thoracic Pathologist Royal Liverpool University Hospital Disclosure JRG is a paid advisor to and speaker
More informationLUNG CANCER. Agnieszka Słowik, MD. Department of Oncology, University Hospital in Cracow Jagiellonian University
LUNG CANCER Agnieszka Słowik, MD Department of Oncology, University Hospital in Cracow Jagiellonian University Epidemiology Most common malignancy worldwide Place of lung cancer among other malignancies
More informationEvolution of Pathology
1 Traditional pathology Molecular pathology 2 Evolution of Pathology Gross Pathology Cellular Pathology Morphologic Pathology Molecular/Predictive Pathology Antonio Benivieni (1443-1502): First autopsy
More informationRead, Interpret, and Communicate Test Results
Read, Interpret, and Communicate Test Results Effective interpretation of epidermal growth factor receptor (EGFR) T790M mutation test results at progression will help physicians to set patient expectations
More informationSurvival of patients with advanced lung adenocarcinoma before and after approved use of gefitinib in China
Thoracic Cancer ISSN 1759-7706 ORIGINAL ARTICLE Survival of patients with advanced lung adenocarcinoma before and after approved use of gefitinib in China Yu-Tao Liu, Xue-Zhi Hao, Jun-Ling Li, Xing-Sheng
More informationExtent of visceral pleural invasion and the prognosis of surgically resected node-negative non-small cell lung cancer
Thoracic Cancer ISSN 1759-7706 ORIGINAL ARTICLE Extent of visceral pleural invasion and the prognosis of surgically resected node-negative non-small cell lung cancer Yangki Seok 1, Ji Yun Jeong 2 & Eungbae
More informationMEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site
POLICY: PG0364 ORIGINAL EFFECTIVE: 04/22/16 LAST REVIEW: 07/26/18 MEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site GUIDELINES This policy does not certify benefits or authorization
More informationFerrozzi. Garlaschi. Bova CT of Metastases
Ferrozzi. Garlaschi. Bova CT of Metastases Springer Berlin Heidelberg New York Barcelona Hong Kong London Milan Paris Singapore Tokyo F. Ferrozzi. G. Garlaschi. D. Bova CT of Metastases With a Foreword
More informationSurveillance following treatment of primary ocular melanoma
Surveillance following treatment of primary ocular melanoma Introduction 50% of UM patients relapse with predominantly liver metastases Risk of metastatic disease can be predicted relatively accurately
More informationOncology 101. Cancer Basics
Oncology 101 Cancer Basics What Will You Learn? What is Cancer and How Does It Develop? Cancer Diagnosis and Staging Cancer Treatment What is Cancer? Cancer is a group of more than 100 different diseases
More informationEpidermal growth factor receptor mutation and pattern of brain metastasis in patients with nonsmall cell lung cancer
ORIGINAL ARTICLE Korean J Intern Med 218;33:168-175 https://doi.org/1.394/kjim.215.158 Epidermal growth factor receptor mutation and pattern of brain metastasis in patients with nonsmall cell lung cancer
More informationThe 8th Edition Lung Cancer Stage Classification
The 8th Edition Lung Cancer Stage Classification Elwyn Cabebe, M.D. Medical Oncology, Hematology, and Hospice and Palliative Care Valley Medical Oncology Consultants Director of Quality, Medical Oncology
More informationTake home message. Emilio Bria. II SESSIONE: Immunoterapia nel tumore del polmone
II SESSIONE: Immunoterapia nel tumore del polmone Take home message Emilio Bria Oncologia, Dipart. di Medicina, Università di Verona, Az. Osp. Univ. Int., Verona emilio.bria@univr.it Roma, 28 Marzo 2017
More informationRelevance of an extensive follow-up after surgery for nonsmall cell lung cancer
ORIGINAL ARTICLE LUNG CANCER Relevance of an extensive follow-up after surgery for nonsmall cell lung cancer Delphine Gourcerol 1,2, Arnaud Scherpereel 1,2, Stephane Debeugny 3, Henri Porte 2,4, Alexis
More informationThe Egyptian Journal of Hospital Medicine (July 2018) Vol. 72 (9), Page
The Egyptian Journal of Hospital Medicine (July 2018) Vol. 72 (9), Page 5298-5303 Prognostic Value of Platelet to Lymphocyte Ratio in Patients with Non-Small Cell Lung Cancer Mohammad Sabry Elkady, Ghada
More informationSpecial Situation: Brain metastases
ESMO Advanced Course on Unsolved Questions in Immuno-Oncology February 16-17 2018, Amsterdam, Netherlands Special Situation: Brain metastases Matthias Preusser, MD Associate Professor of Medicine Department
More information