Association of molecular status and organs with metastases at diagnosis in patients with non-small cell lung cancer (NSCLC)

Size: px
Start display at page:

Download "Association of molecular status and organs with metastases at diagnosis in patients with non-small cell lung cancer (NSCLC)"

Transcription

1 Association of molecular status and organs with metastases at diagnosis in patients with non-small cell lung cancer (NSCLC) Chantal Kuijpers* 1,2, Lizza Hendriks 3, Jules Derks 3, Anne-Marie Dingemans 3, Anne van Lindert 1, Michel van den Heuvel 5, Ronald Damhuis 6, Stefan Willems 1,2,7 1. Dept. of Pathology, University Medical Centre Utrecht, Utrecht 2. Foundation PALGA, Houten 3. Dept. of Pulmonary Diseases, GROW School for Oncology and Developmental Biology, Maastricht University Medical Centre, Maastricht 4. Dept. of Respiratory Medicine, University Medical Centre Utrecht, Utrecht 5. Dept. of Lung Disease, Radboudumc, Nijmegen 6. Netherlands Comprehensive Cancer Organisation (IKNL), Utrecht 7. Dept. of Pathology, Netherlands Cancer Institute - Antoni van Leeuwenhoek hospital, Amsterdam

2 Disclosure slide This study was partly funded by Roche and Pfizer.

3 Molecular alterations in NSCLC Adenocarcinoma and NSCLC-NOS KRAS mutation 20-25% EGFR mutation 10-15% ALK rearrangement 5% Targetable with TKI EGFR - activating mutations exon 19 del, exon 21 L858R, other uncommon act. mutation - resistance mutations mostly exon 20 mutations

4 Anatomic sites of metastases Most common: bone, brain, liver, adrenal gland, pleura, lung, lymph node 1 Biological predisposition for metastatic organs might differ between molecular subgroups: implications for screening and (prophylactic) treatment Incidence of brain and bone metastases may be higher in EGFR+ patients 2-5 Biological predisposition? What about the other alterations? 1. Hendriks et al. Eur J Cancer (2015) 2. Matsumoto et al. Int J Cancer (2006) 3. Li et al. Clin Exp Metastasis (2016) 4. Guan et al. Med Oncol (2016) 5. Sholl et al. J Thor Oncol (2015)

5 Objective To evaluate the association between molecular status and metastatic organs at diagnosis in a nationwide stage IV non-squamous NSCLC cohort

6 Approach Patient selection Netherlands Cancer Registry (NCR) Dutch Pathology Registry (PALGA) - Identify all stage IV adenoca and NSCLC-NOS (year: 2013) - Exclude: patients with a recent history of cancer ( 5 years) - Age, gender, morphology, TNM stage, metastasis locations ( 3) - Microscopy and conclusion fields - Data extraction on molecular status - Identification mol. subgroups: EGFR+ KRAS+ ALK+ Triple-negative* * Triple-tested or EGFR and KRAS tested

7 Approach - statistical analysis Per metastatic organ: Univariable logistic regression analyses to determine risk factors: - Age (continuous) - Gender - Morphology (adenocarcinoma vs. NSCLC-NOS) - Local disease status ( T2 and N1 vs. T3 or N2) If p-value <0.2: variables included in multivariable analysis Multivariable logistic regression analyses to assess association with: Molecular status: EGFR+, KRAS+ and ALK+ with triple-negative

8 Included patients

9 Organs with metastases - overview Organ N % Organ N % Bone Skin Pleura Spleen Lung Peritoneum Brain Kidney Adrenal gland Thorax Liver Pancreas Extrathoracic lymph nodes Breast Soft tissue Thyroid Heart Meninges Less common metastatic sites (n 6) are not included in the table

10 Association molecular subgroups and metastatic organs

11 Conclusions NSCLC molecular status is associated with organs of metastases. EGFR+ patients had more often bone and pleural metastases, and less often brain and adrenal gland metastases than triple-negative patients. 54% of EGFR+ patients had bone metastases at diagnosis. Screening all EGFR+ patients for bone metastases is worth considering, aiming to prevent skeletal-related events. In contrast to previous studies: EGFR+ less often brain mets at diagnosis probably no biological predisposition for the brain

12 Acknowledgements Funding Lizza Hendriks Ronald Damhuis Jules Derks Marianne van der Mark Anne-Marie Dingemans Stefan Willems Michel van den Heuvel All participating laboratories Anne van Lindert Koos Koole Felix Broekhuizen Ellen de Weger Lucy Overbeek Bert Siebers Rinus Voorham

Applying Genomics to Cancer 21 st September The Frequency of EGFR mutations in Lung Adenocarcinoma: The Cardiff Experience

Applying Genomics to Cancer 21 st September The Frequency of EGFR mutations in Lung Adenocarcinoma: The Cardiff Experience Applying Genomics to Cancer 21 st September 2015 The Frequency of EGFR mutations in Lung Adenocarcinoma: The Cardiff Experience Aled Daniels R Butler, R Attanoos, H Davies University Hospital of Wales

More information

Clinical features of large cell neuroendocrine carcinoma: a population-based overview

Clinical features of large cell neuroendocrine carcinoma: a population-based overview ORIGINAL ARTICLE LUNG CANCER Clinical features of large cell neuroendocrine carcinoma: a population-based overview Jules L. Derks 1, Lizza E. Hendriks 1, Wieneke A. Buikhuisen 2, Harry J.M. Groen 3, Erik

More information

HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY

HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY 7 TH Annual New York Lung Cancer Symposium Saturday, November 10, 2012 William D. Travis, M.D. Attending Thoracic Pathologist Memorial Sloan Kettering

More information

Disclosure of Relevant Financial Relationships NON-SMALL CELL LUNG CANCER: 70% PRESENT IN ADVANCED STAGE

Disclosure of Relevant Financial Relationships NON-SMALL CELL LUNG CANCER: 70% PRESENT IN ADVANCED STAGE MORPHOLOGY AND MOLECULAR TESTING IN NON-SMALL CELL OF LUNG NEW FRONTIEIRS IN CYTOPATHOLOGY PRACTICE American Society for Cytopathology San Antonio, Texas Sunday March 5, 2017 Disclosure of Relevant Financial

More information

LUNG CANCER. pathology & molecular biology. Izidor Kern University Clinic Golnik, Slovenia

LUNG CANCER. pathology & molecular biology. Izidor Kern University Clinic Golnik, Slovenia LUNG CANCER pathology & molecular biology Izidor Kern University Clinic Golnik, Slovenia 1 Pathology and epidemiology Small biopsy & cytology SCLC 14% NSCC NOS 4% 70% 60% 50% 63% 62% 61% 62% 59% 54% 51%

More information

Difficult Diagnoses and Controversial Entities in Neoplastic Lung

Difficult Diagnoses and Controversial Entities in Neoplastic Lung Difficult Diagnoses and Controversial Entities in Neoplastic Lung Lynette M. Sholl, M.D. Associate Pathologist, Brigham and Women s Hospital Chief, Pulmonary Pathology Service Associate Professor, Harvard

More information

Enterprise Interest. Pfizer, Roche, BMS, MSD, Novartis

Enterprise Interest. Pfizer, Roche, BMS, MSD, Novartis Enterprise Interest Pfizer, Roche, BMS, MSD, Novartis Beyond the WHO 2015 classification of lung neuroendocrine tumours Genomics of lung NETs & identification of biomarkers for prognosis and therapy Prof.

More information

K-Ras signalling in NSCLC

K-Ras signalling in NSCLC Targeting the Ras-Raf-Mek-Erk pathway Egbert F. Smit MD PhD Dept. Pulmonary Diseases Vrije Universiteit VU Medical Centre Amsterdam, The Netherlands K-Ras signalling in NSCLC Sun et al. Nature Rev. Cancer

More information

Molecular Pathobiology of Lung Cancer. William K. Funkhouser, MD PhD Department of Pathology and Lab Medicine University of North Carolina

Molecular Pathobiology of Lung Cancer. William K. Funkhouser, MD PhD Department of Pathology and Lab Medicine University of North Carolina Molecular Pathobiology of Lung Cancer William K. Funkhouser, MD PhD Department of Pathology and Lab Medicine University of North Carolina Outline Lung Anatomy Lung Carcinoma Classification & Morphology

More information

THE USE OF BIOMARKERS IN TREATMENT PATTERNS

THE USE OF BIOMARKERS IN TREATMENT PATTERNS European Network of Cancer Registries Scientific Meeting 2018 THE USE OF BIOMARKERS IN TREATMENT PATTERNS AND SURVIVAL OUTCOMES OF METASTATIC NON-SQUAMOUS NON-SMALL CELL LUNG CANCER RODRIGO MURTEIRA National

More information

Quality ID #395: Lung Cancer Reporting (Biopsy/Cytology Specimens) National Quality Strategy Domain: Communication and Care Coordination

Quality ID #395: Lung Cancer Reporting (Biopsy/Cytology Specimens) National Quality Strategy Domain: Communication and Care Coordination Quality ID #395: Lung Cancer Reporting (Biopsy/Cytology Specimens) National Quality Strategy Domain: Communication and Care Coordination 2018 OPTIONS FOR INDIVIDUAL MEASURES: REGISTRY ONLY MEASURE TYPE:

More information

Molecular Targets in Lung Cancer

Molecular Targets in Lung Cancer Molecular Targets in Lung Cancer Robert Ramirez, DO, FACP Thoracic and Neuroendocrine Oncology November 18 th, 2016 Disclosures Consulting and speaker fees for Ipsen Pharmaceuticals, AstraZeneca and Merck

More information

Management of advanced non small cell lung cancer

Management of advanced non small cell lung cancer Management of advanced non small cell lung cancer Jean-Paul Sculier Intensive Care & Thoracic Oncology Institut Jules Bordet Université Libre de Bruxelles (ULB) www.pneumocancero.com Declaration No conflict

More information

Assessing the lung and mediastinum in cancer-is tissue the issue? George Santis

Assessing the lung and mediastinum in cancer-is tissue the issue? George Santis 1 Assessing the lung and mediastinum in cancer-is tissue the issue? George Santis Optimal management of Cancer Histological diagnosis & accurate staging at presentation Molecular analysis of primary tumour

More information

Joachim Aerts Erasmus MC Rotterdam, Netherlands. Drawing the map: molecular characterization of NSCLC

Joachim Aerts Erasmus MC Rotterdam, Netherlands. Drawing the map: molecular characterization of NSCLC Joachim Aerts Erasmus MC Rotterdam, Netherlands Drawing the map: molecular characterization of NSCLC Disclosures Honoraria for advisory board/consultancy/speakers fee Eli Lilly Roche Boehringer Ingelheim

More information

Optimum Sequencing of EGFR targeted therapy in NSCLC. Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey

Optimum Sequencing of EGFR targeted therapy in NSCLC. Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey Optimum Sequencing of EGFR targeted therapy in NSCLC Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey Lung cancer NSCLC SCLC adeno squamous EGFR ALK ROS1 BRAF HER2 KRAS EGFR Transl Lung Cancer

More information

Presented at the European Society of Medical Oncology (ESMO), Munich, Germany, October 2018

Presented at the European Society of Medical Oncology (ESMO), Munich, Germany, October 2018 Effectiveness of afatinib in clinical practice first results of the GIDEON trial: a prospective non-interventional study in EGFR-mutated NSCLC in Germany Wolfgang M. Brueckl 1 *, Eckart Laack 2, Martin

More information

Treatment of oligometastatic NSCLC

Treatment of oligometastatic NSCLC Treatment of oligometastatic NSCLC Jarosław Kużdżał Department of Thoracic Surgery Jagiellonian University Collegium Medicum, John Paul II Hospital, Cracow New idea? 14 NSCLC patients with solitary extrathoracic

More information

Histopathology of NSCLC, IHC markers and ptnm classification

Histopathology of NSCLC, IHC markers and ptnm classification ESMO Preceptorship on Non-Small Cell Lung Cancer November 15 th & 16 th 2017 Singapore Histopathology of NSCLC, IHC markers and ptnm classification Prof Keith M Kerr Department of Pathology, Aberdeen University

More information

Targeted therapy in NSCLC: do we progress? Prof. Dr. V. Surmont. Masterclass 27 september 2018

Targeted therapy in NSCLC: do we progress? Prof. Dr. V. Surmont. Masterclass 27 september 2018 Targeted therapy in NSCLC: do we progress? Prof. Dr. V. Surmont Masterclass 27 september 2018 Outline Introduction EGFR TKI ALK TKI TKI for uncommon driver mutations Take home messages The promise of

More information

Changing demographics of smoking and its effects during therapy

Changing demographics of smoking and its effects during therapy Changing demographics of smoking and its effects during therapy Egbert F. Smit MD PhD. Dept. Pulmonary Diseases, Vrije Universiteit Medical Centre, Amsterdam, The Netherlands Smoking prevalence adults

More information

Lung Cancer. Current Therapy JEREMIAH MARTIN MBBCh FRCSI MSCRD

Lung Cancer. Current Therapy JEREMIAH MARTIN MBBCh FRCSI MSCRD Lung Cancer Current Therapy JEREMIAH MARTIN MBBCh FRCSI MSCRD Objectives Describe risk factors, early detection & work-up of lung cancer. Define the role of modern treatment options, minimally invasive

More information

Molly Boyd, MD Glenn Mills, MD Syed Jafri, MD 1/1/2010

Molly Boyd, MD Glenn Mills, MD Syed Jafri, MD 1/1/2010 LSU HEALTH SCIENCES CENTER NSCLC Guidelines Feist-Weiller Cancer Center Molly Boyd, MD Glenn Mills, MD Syed Jafri, MD 1/1/2010 Initial Evaluation/Intervention: 1. Pathology Review 2. History and Physical

More information

Lung Cancer: Overview and Updates

Lung Cancer: Overview and Updates Lung Cancer: Overview and Updates Peter H. Johnson, M.D. Medical Oncologist & Hematologist, Columbia St. Mary s Hospital February 1, 2018 Disclosures No financial interests to disclose No conflicts of

More information

Materials and methods. Histologic grading. Questionnaire among pathologists. Data source and study population

Materials and methods. Histologic grading. Questionnaire among pathologists. Data source and study population https://doi.org/10.1007/s10549-018-05082-y EPIDEMIOLOGY Significant inter- and intra-laboratory variation in grading of ductal carcinoma in situ of the breast: a nationwide study of 4901 patients in the

More information

This online (electronic) survey contains twenty four simple questions. Those marked with an asterisk (*) must be answered.

This online (electronic) survey contains twenty four simple questions. Those marked with an asterisk (*) must be answered. 1. Type of survey This is a retrospective survey that will NOT require the disclosure of any individual patient records or data only information about overall EGFR mutation testing practices and the outcomes

More information

SCOPE OF PRACTICE PGY-5

SCOPE OF PRACTICE PGY-5 Recognize normal cytomorphology of cells derived from the respiratory, gastrointestinal, and genitourinary tracts, and body fluid (Cerebrospinal fluid, pleural and peritoneal fluid) Recognize normal cytomorphology

More information

Reflex Testing Guidelines for Immunotherapy in Non-Small Cell Lung Cancer

Reflex Testing Guidelines for Immunotherapy in Non-Small Cell Lung Cancer Reflex Testing Guidelines for Immunotherapy in Non-Small Cell Lung Cancer Jimmy Ruiz, MD Assistant Professor Thoracic Oncology Program Wake Forest Comprehensive Cancer Center Disclosures I have no actual

More information

3/23/2017. Disclosure of Relevant Financial Relationships. Pathologic Staging Updates in Lung Cancer T STAGE OUTLINE SURVIVAL ACCORDING TO SIZE ONLY

3/23/2017. Disclosure of Relevant Financial Relationships. Pathologic Staging Updates in Lung Cancer T STAGE OUTLINE SURVIVAL ACCORDING TO SIZE ONLY Pathologic Staging Updates in Lung Cancer Disclosure of Relevant Financial Relationships USCAP requires that all planners (Education Committee) in a position to influence or control the content of CME

More information

A Nationwide Population-Based Study on the Survival of Patients with Pancreatic Neuroendocrine Tumors in The Netherlands

A Nationwide Population-Based Study on the Survival of Patients with Pancreatic Neuroendocrine Tumors in The Netherlands World J Surg (2018) 42:490 497 DOI 10.1007/s00268-017-4278-y ORIGINAL SCIENTIFIC REPORT A Nationwide Population-Based Study on the Survival of Patients with Pancreatic Neuroendocrine Tumors in The Netherlands

More information

Lung tumors & pleural lesions

Lung tumors & pleural lesions Lung tumors & pleural lesions A brief introduction 95% of lung tumors are carcinomas Among the remaining 5%, we will discuss: -Hamartoma the most common benign lung tumor spherical, coin lesion on x-rays

More information

Lung Cancer Case. Since the patient was symptomatic, a targeted panel was sent. ALK FISH returned in 2 days and was positive.

Lung Cancer Case. Since the patient was symptomatic, a targeted panel was sent. ALK FISH returned in 2 days and was positive. Lung Cancer Case Jonathan Riess, M.D. M.S. Assistant Professor of Medicine University of California Davis School of Medicine UC Davis Comprehensive Cancer Center 63 year-old woman, never smoker, presents

More information

Assay Location Primer TaqMan probe Reference

Assay Location Primer TaqMan probe Reference Table S1. Primers and TaqMan probes for picoliter-ddpcr Assay Location Primer TaqMan probe Reference Exon 19 deletion assay a Exon 19 GCACCATCTCACAATTGCCAG VIC-CAGAAGGTGAGAAAGTT-MGB Reference probe Original

More information

Clinical Study on Prognostic Factors and Nursing of Breast Cancer with Brain Metastases

Clinical Study on Prognostic Factors and Nursing of Breast Cancer with Brain Metastases Clinical Study on Prognostic Factors and Nursing of Breast Cancer with Brain Metastases Ying Zhou 1#, Kefang Zhong 1#, Fang Zhou* 2 ABSTRACT This paper aims to explore the clinical features and prognostic

More information

Quality ID #395: Lung Cancer Reporting (Biopsy/Cytology Specimens) National Quality Strategy Domain: Communication and Care Coordination

Quality ID #395: Lung Cancer Reporting (Biopsy/Cytology Specimens) National Quality Strategy Domain: Communication and Care Coordination Quality ID #395: Lung Cancer Reporting (Biopsy/Cytology Specimens) National Quality Strategy Domain: Communication and Care Coordination 2018 OPTIONS FOR INDIVIDUAL MEASURES: CLAIMS ONLY MEASURE TYPE:

More information

Might Adaptive Radiotherapy in NSCLC be feasible in clinical practice?

Might Adaptive Radiotherapy in NSCLC be feasible in clinical practice? Might Adaptive Radiotherapy in NSCLC be feasible in clinical practice? E.Molfese, P.Matteucci, A.Iurato, L.E.Trodella, A.Sicilia, B.Floreno, S.Ramella, L.Trodella Radioterapia Oncologica, Università Campus

More information

Case Studies. Ravi Salgia, MD, PhD

Case Studies. Ravi Salgia, MD, PhD Case Studies Ravi Salgia, MD, PhD Professor and Arthur & Rosalie Kaplan Chair Medical Oncology and Therapeutics Research Associate Director for Clinical Sciences Research City of Hope 04-21-2018 Objectives

More information

Management Guidelines and Targeted Therapies in Metastatic Non-Small Cell Lung Cancer: An Oncologist s Perspective

Management Guidelines and Targeted Therapies in Metastatic Non-Small Cell Lung Cancer: An Oncologist s Perspective Management Guidelines and Targeted Therapies in Metastatic Non-Small Cell Lung Cancer: An Oncologist s Perspective Julie R. Brahmer, M.D. Associate Professor of Oncology The Sidney Kimmel Comprehensive

More information

Slide 1. Slide 2. Slide 3. Disclosures. Personalized Medicine for Advanced NSCLC in East Asia. No conflicts related to this presentation

Slide 1. Slide 2. Slide 3. Disclosures. Personalized Medicine for Advanced NSCLC in East Asia. No conflicts related to this presentation Slide 1 12 th International Lung Cancer Conference Personalized Medicine for Advanced NSCLC in East Asia Masahiro Tsuboi, M.D., Ph.D. Group Chair, Lung Cancer Surgical Study Group in Japan Clinical Oncology

More information

Cytological Sub-classification of Lung Cancer: Morphologic and Molecular Characteristics. Mercè Jordà, University of Miami

Cytological Sub-classification of Lung Cancer: Morphologic and Molecular Characteristics. Mercè Jordà, University of Miami Cytological Sub-classification of Lung Cancer: Morphologic and Molecular Characteristics Mercè Jordà, University of Miami Mortality Lung cancer is the most frequent cause of cancer incidence and mortality

More information

Palliative radiotherapy near the end of life for brain metastases from lung cancer: a populationbased

Palliative radiotherapy near the end of life for brain metastases from lung cancer: a populationbased Palliative radiotherapy near the end of life for brain metastases from lung cancer: a populationbased analysis Roel Schlijper Fellow Radiation Oncology BC Cancer, Prince George Disclosures No conflicts

More information

Reparatory system 18 lectures Heyam Awad

Reparatory system 18 lectures Heyam Awad Reparatory system 18 lectures 8-10 Heyam Awad These lectures cover the following topics 1. Diffuse hemorrhagic syndromes 2. Lung tumors important: theses slides are your study source for these lectures.

More information

Endobronchial Ultrasound in the Diagnosis & Staging of Lung Cancer

Endobronchial Ultrasound in the Diagnosis & Staging of Lung Cancer Endobronchial Ultrasound in the Diagnosis & Staging of Lung Cancer Dr Richard Booton PhD FRCP Lead Lung Cancer Clinician, Consultant Respiratory Physician & Speciality Director Manchester University NHS

More information

El contexto molecular de la sobreexpresión de PD-L1 Esther Conde Gallego, MD, PhD

El contexto molecular de la sobreexpresión de PD-L1 Esther Conde Gallego, MD, PhD El contexto molecular de la sobreexpresión de PD-L1 Esther Conde Gallego, MD, PhD Laboratorio de Dianas Terapéuticas Hospital Universitario HM Sanchinarro Madrid, Spain Contents Background PD-L1 expression

More information

Lung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD. Mount Carrigain 2/4/17

Lung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD. Mount Carrigain 2/4/17 Lung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD Mount Carrigain 2/4/17 Histology Adenocarcinoma: Mixed subtype, acinar, papillary, solid, micropapillary, lepidic

More information

Molecular Testing in Lung Cancer

Molecular Testing in Lung Cancer Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans

More information

Reparatory system lectures Heyam Awad

Reparatory system lectures Heyam Awad Reparatory system lectures 8-10 Heyam Awad note These lectures cover the following topics 1. Diffuse hemorrhagic syndromes 2. Lung tumors important: theses slides are your study source for these lectures.

More information

PET CT for Staging Lung Cancer

PET CT for Staging Lung Cancer PET CT for Staging Lung Cancer Rohit Kochhar Consultant Radiologist Disclosures Neither I nor my immediate family members have financial relationships with commercial organizations that may have a direct

More information

and management of lung cancer Maureen F. Zakowski, M.D. Memorial Sloan-Kettering Cancer Center

and management of lung cancer Maureen F. Zakowski, M.D. Memorial Sloan-Kettering Cancer Center The new role of cytology in the diagnosis and management of lung cancer Maureen F. Zakowski, M.D. Memorial Sloan-Kettering Cancer Center Outline Role of cytology in the diagnosis of lung cancer Non-small

More information

GROUP 1: Peripheral tumour with normal hilar and mediastinum on staging CT with no disant metastases. Including: Excluding:

GROUP 1: Peripheral tumour with normal hilar and mediastinum on staging CT with no disant metastases. Including: Excluding: GROUP 1: Including: Excluding: Peripheral tumour with normal hilar and mediastinum on staging CT with no disant metastases Solid pulmonary nodules 8mm diameter / 300mm3 volume and BROCK risk of malignancy

More information

Fast Facts: Non-Small-Cell Lung Cancer

Fast Facts: Non-Small-Cell Lung Cancer Fast Facts Fast Facts: Non-Small-Cell Lung Cancer Mary O Brien MD FRCP Consultant Medical Oncologist The Royal Marsden NHS Foundation Trust London, UK Benjamin Besse MD PhD Thoracic Cancer Unit, Head Department

More information

A case of different EGFR mutations in surgically resected synchronous triple lung cancer

A case of different EGFR mutations in surgically resected synchronous triple lung cancer Case Report A case of different EGFR mutations in surgically resected synchronous triple lung cancer Naoki Haratake 1, Mitsuhiro Takenoyama 1, Makoto Edagawa 1, Shinichiro Shimamatsu 1, Ryo Toyozawa 1,

More information

Impact of immunostaining of pulmonary and mediastinal cytology

Impact of immunostaining of pulmonary and mediastinal cytology Impact of immunostaining of pulmonary and mediastinal cytology Harman Sekhon MD, PhD Director of Cytopathology Head of Ottawa-site Ontario Tumour Bank June 20, 2014 Disclaimer Pfizer: Honorarium-Advisory

More information

Improving outcomes for NSCLC patients with brain metastases

Improving outcomes for NSCLC patients with brain metastases Improving outcomes for NSCLC patients with brain metastases Martin Schuler West German Cancer Center, Essen, Germany In Switzerland, afatinib is approved as monotherapy for patients with non-small cell

More information

expectancy Cancer spread to bones life expectancy

expectancy Cancer spread to bones life expectancy Cancer spread to bones life expectancy The Borg System is 100 % Cancer spread to bones life expectancy Sep 27, 2016. About 80 percent of the time prostate cancer cells metastasize, or spread, they will

More information

Current outcomes of postrecurrence survival in patients after resection of non-small cell lung cancer

Current outcomes of postrecurrence survival in patients after resection of non-small cell lung cancer Original Article Current outcomes of postrecurrence survival in patients after resection of non-small cell lung cancer Tetsuya Mizuno 1, Takaaki Arimura 1, Hiroaki Kuroda 1, Noriaki Sakakura 1, Yasushi

More information

Next generation diagnostics Bringing high-throughput sequencing into clinical application

Next generation diagnostics Bringing high-throughput sequencing into clinical application Next generation diagnostics Bringing high-throughput sequencing into clinical application Leonardo A. Meza-Zepeda, PhD Translational Genomics Group Institute for Cancer Research Leonardo.Meza-Zepeda@rr-research.no

More information

Biomedical Research 2017; 28 (14): ISSN X

Biomedical Research 2017; 28 (14): ISSN X Biomedical Research 2017; 28 (14): ISSN 0970-938X www.biomedres.info Study of the relationship between EGFR mutation status and bone metastasis in advanced lung adenocarcinoma. Xiaoye Ai, Adalati Yasheng,

More information

State of the Art Treatment of Lung Cancer Ravi Salgia, MD, PhD

State of the Art Treatment of Lung Cancer Ravi Salgia, MD, PhD State of the Art Treatment of Lung Cancer Ravi Salgia, MD, PhD Professor and Chair Arthur & Rosalie Kaplan Chair Medical Oncology and Therapeutics Research Nothing to disclose DISCLOSURE Objectives Lung

More information

Lung cancer spread to bones life expectancy

Lung cancer spread to bones life expectancy Lung cancer spread to bones life expectancy The Borg System is 100 % Lung cancer spread to bones life expectancy 12-4-2018 According to Orthobullets, the life expectancy for someone with metastatic bone

More information

Supplemental Table 1.1: Prostate cancer prognostic tools

Supplemental Table 1.1: Prostate cancer prognostic tools Supplemental Table 1.1: Prostate cancer prognostic tools Features ANN^ BioChemical Capra^ CSQS EBRT Han Outcomes Cancer Specific - - +* + - - Non-Cancer Specific - - - + - - DFS/PFS +* +* +* - +* +* Clinical

More information

ALK Fusion Oncogenes in Lung Adenocarcinoma

ALK Fusion Oncogenes in Lung Adenocarcinoma ALK Fusion Oncogenes in Lung Adenocarcinoma Vincent A Miller, MD Associate Attending Physician, Thoracic Oncology Service Memorial Sloan-Kettering Cancer Center New York, New York The identification of

More information

The right middle lobe is the smallest lobe in the lung, and

The right middle lobe is the smallest lobe in the lung, and ORIGINAL ARTICLE The Impact of Superior Mediastinal Lymph Node Metastases on Prognosis in Non-small Cell Lung Cancer Located in the Right Middle Lobe Yukinori Sakao, MD, PhD,* Sakae Okumura, MD,* Mun Mingyon,

More information

Traditional Approaches to Treating NSCLC, Part 2: Neoadjuvant Combined Modality, Locally Advanced, and Metastatic NSCLC

Traditional Approaches to Treating NSCLC, Part 2: Neoadjuvant Combined Modality, Locally Advanced, and Metastatic NSCLC Transcript Details This is a transcript of a continuing medical education (CME) activity accessible on the ReachMD network. Additional media formats for the activity and full activity details (including

More information

Advances in Pathology and molecular biology of lung cancer. Lukas Bubendorf Pathologie

Advances in Pathology and molecular biology of lung cancer. Lukas Bubendorf Pathologie Advances in Pathology and molecular biology of lung cancer Lukas Bubendorf Pathologie Agenda The revolution of predictive markers Liquid biopsies PD-L1 Molecular subtypes (non-squamous NSCLC) Tsao AS et

More information

Early-stage locally advanced non-small cell lung cancer (NSCLC) Clinical Case Discussion

Early-stage locally advanced non-small cell lung cancer (NSCLC) Clinical Case Discussion Early-stage locally advanced non-small cell lung cancer (NSCLC) Clinical Case Discussion Pieter Postmus The Clatterbridge Cancer Centre Liverpool Heart and Chest Hospital Liverpool, United Kingdom 1 2

More information

Molecular Diagnostics in Lung Cancer

Molecular Diagnostics in Lung Cancer Molecular Diagnostics in Lung Cancer Mutations in lung carcinomas and their impact on diagnosis and treatment With special thanks to: Barbara Chaitin, MD Medical Director, Esoteric Services AmeriPath Orlando,

More information

Disclosures Genomic testing in lung cancer

Disclosures Genomic testing in lung cancer Disclosures Genomic testing in lung cancer No disclosures Objectives Understand how FISH and NGS provide complementary data for the evaluation of lung cancer Recognize the challenges of performing testing

More information

Outline. The Lung Cancer Patient in 2011 Not the Marlboro Man. Lung Cancer

Outline. The Lung Cancer Patient in 2011 Not the Marlboro Man. Lung Cancer Outline The Lung Cancer Patient in 2011 Not the Marlboro Man Jeanne Griffin Vaughn, APN-BC, AOCN Epidemiology Staging and Patterns of Spread Clinical Presentation Treatments March 26, 2011 Lung Cancer

More information

Frequent EGFR mutations in nonsmall cell lung cancer presenting with miliary intrapulmonary carcinomatosis

Frequent EGFR mutations in nonsmall cell lung cancer presenting with miliary intrapulmonary carcinomatosis Eur Respir J 2013; 41: 417 424 DOI: 10.1183/09031936.00006912 CopyrightßERS 2013 Frequent EGFR mutations in nonsmall cell lung cancer presenting with miliary intrapulmonary carcinomatosis Shang-Gin Wu*,

More information

Updated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors

Updated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors Q: How is the strength of recommendation determined in the new molecular testing guideline? A: The strength of recommendation is determined by the strength of the available data (evidence). Strong Recommendation:

More information

Tumor Board Discussions: Case 1

Tumor Board Discussions: Case 1 Tumor Board Discussions: Case 1 David S. Ettinger, MD The Alex Grass Professor of Oncology Johns Hopkins University School of Medicine Baltimore, Maryland Case #1 50-year-old Asian female, never smoker

More information

Wat is de potentiële waarde van ctdna? PLCRC - MEDOCC

Wat is de potentiële waarde van ctdna? PLCRC - MEDOCC Wat is de potentiële waarde van ctdna? PLCRC - MEDOCC Translational Gastrointestinal Oncology Remond Fijneman r.fijneman@nki.nl Department of Pathology, Amsterdam, NL Wat is de potentiële waarde van ctdna?

More information

Plotting the course: optimizing treatment strategies in patients with advanced adenocarcinoma

Plotting the course: optimizing treatment strategies in patients with advanced adenocarcinoma Pieter E. Postmus University of Liverpool Liverpool, UK Plotting the course: optimizing treatment strategies in patients with advanced adenocarcinoma Disclosures Advisor Bristol-Myers Squibb AstraZeneca

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Mezquita L, Auclin E, Ferrara R, et al. Association of the Lung Immune Prognostic Index with immune checkpoint inhibitor outcomes in patients with advanced non small cell lung

More information

Biomarcatori per la immunoterapia: cosa e come cercare Paolo Graziano

Biomarcatori per la immunoterapia: cosa e come cercare Paolo Graziano Biomarcatori per la immunoterapia: cosa e come cercare Paolo Graziano Unit of Pathology Fondazione IRCCS Casa Sollievo della Sofferenza San Giovanni Rotondo, Foggia,Italy p.graziano@operapadrepio.it Disclosure

More information

AJCC 7th Edition Handbook Errata as of 9/21/10

AJCC 7th Edition Handbook Errata as of 9/21/10 5 81 Larynx ICD-O-3 Topography Codes Delete C32.3 Laryngeal cartilage 5 81 Larynx ICD-O-3 Topography Codes Add an asterisk after C32.8 5 81 Larynx ICD-O-3 Topography Codes Add an asterisk after C32.9 5

More information

Kirsten rat sarcoma viral oncogene homolog (KRAS) mutation

Kirsten rat sarcoma viral oncogene homolog (KRAS) mutation ORIGINAL ARTICLE KRAS Mutations in Advanced Nonsquamous Non Small- Cell Lung Cancer Patients Treated with First-Line Platinum- Based Chemotherapy Have No Predictive Value Wouter W. Mellema, MD,* Anne-Marie

More information

Serum Carcinoembryonic Antigen Levels and the Risk of Whole-body Metastatic Potential in Advanced Nonsmall Cell Lung Cancer

Serum Carcinoembryonic Antigen Levels and the Risk of Whole-body Metastatic Potential in Advanced Nonsmall Cell Lung Cancer Ivyspring International Publisher Research Paper 663 Journal of Cancer 2014; 5(8): 663-669. doi: 10.7150/jca.9871 Serum Carcinoembryonic Antigen Levels and the Risk of Whole-body Metastatic Potential in

More information

Non Small Cell Lung Cancer Histopathology ד"ר יהודית זנדבנק

Non Small Cell Lung Cancer Histopathology דר יהודית זנדבנק Non Small Cell Lung Cancer Histopathology ד"ר יהודית זנדבנק 26.06.09 Lecture outlines WHO histological classification Macro/Micro assessment Early diagnosis Minimal pathology Main subtypes SCC, AdCa, LCLC

More information

Research Article Prognostic Implication of Predominant Histologic Subtypes of Lymph Node Metastases in Surgically Resected Lung Adenocarcinoma

Research Article Prognostic Implication of Predominant Histologic Subtypes of Lymph Node Metastases in Surgically Resected Lung Adenocarcinoma BioMed Research International, Article ID 64568, 6 pages http://dx.doi.org/.55/24/64568 Research Article Prognostic Implication of Predominant Histologic Subtypes of Lymph Node Metastases in Surgically

More information

THE ISSUE OF STAGE AT DIAGNOSIS

THE ISSUE OF STAGE AT DIAGNOSIS THE ISSUE OF STAGE AT DIAGNOSIS IN SURVIVAL ANALYSIS Pamela Minicozzi Analytical Epidemiology and Health Impact Unit Department of Preventive and Predictive Medicine, Fodazione IRCCS Istituto Nazionale

More information

Metabolic Phenotype of Stage IV Lung Adenocarcinoma: relationship with epidermal growth factor receptor mutation

Metabolic Phenotype of Stage IV Lung Adenocarcinoma: relationship with epidermal growth factor receptor mutation Title Metabolic Phenotype of Stage IV Lung Adenocarcinoma: relationship with epidermal growth factor receptor mutation Author(s) Lee, EYP; Khong, PL; Lee, VHF; Qian, W; Yu, X; Wong, MP Citation Clinical

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/3/75/75ra26/dc1 Supplementary Materials for Genotypic and Histological Evolution of Lung Cancers Acquiring Resistance to EGFR Inhibitors Lecia V. Sequist,*

More information

MICROSCOPY PREDICTIVE PROFILING

MICROSCOPY PREDICTIVE PROFILING Immunomodulatory therapy in NSCLC: a year into clinical practice Professor J R Gosney Consultant Thoracic Pathologist Royal Liverpool University Hospital Disclosure JRG is a paid advisor to and speaker

More information

LUNG CANCER. Agnieszka Słowik, MD. Department of Oncology, University Hospital in Cracow Jagiellonian University

LUNG CANCER. Agnieszka Słowik, MD. Department of Oncology, University Hospital in Cracow Jagiellonian University LUNG CANCER Agnieszka Słowik, MD Department of Oncology, University Hospital in Cracow Jagiellonian University Epidemiology Most common malignancy worldwide Place of lung cancer among other malignancies

More information

Evolution of Pathology

Evolution of Pathology 1 Traditional pathology Molecular pathology 2 Evolution of Pathology Gross Pathology Cellular Pathology Morphologic Pathology Molecular/Predictive Pathology Antonio Benivieni (1443-1502): First autopsy

More information

Read, Interpret, and Communicate Test Results

Read, Interpret, and Communicate Test Results Read, Interpret, and Communicate Test Results Effective interpretation of epidermal growth factor receptor (EGFR) T790M mutation test results at progression will help physicians to set patient expectations

More information

Survival of patients with advanced lung adenocarcinoma before and after approved use of gefitinib in China

Survival of patients with advanced lung adenocarcinoma before and after approved use of gefitinib in China Thoracic Cancer ISSN 1759-7706 ORIGINAL ARTICLE Survival of patients with advanced lung adenocarcinoma before and after approved use of gefitinib in China Yu-Tao Liu, Xue-Zhi Hao, Jun-Ling Li, Xing-Sheng

More information

Extent of visceral pleural invasion and the prognosis of surgically resected node-negative non-small cell lung cancer

Extent of visceral pleural invasion and the prognosis of surgically resected node-negative non-small cell lung cancer Thoracic Cancer ISSN 1759-7706 ORIGINAL ARTICLE Extent of visceral pleural invasion and the prognosis of surgically resected node-negative non-small cell lung cancer Yangki Seok 1, Ji Yun Jeong 2 & Eungbae

More information

MEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site

MEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site POLICY: PG0364 ORIGINAL EFFECTIVE: 04/22/16 LAST REVIEW: 07/26/18 MEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site GUIDELINES This policy does not certify benefits or authorization

More information

Ferrozzi. Garlaschi. Bova CT of Metastases

Ferrozzi. Garlaschi. Bova CT of Metastases Ferrozzi. Garlaschi. Bova CT of Metastases Springer Berlin Heidelberg New York Barcelona Hong Kong London Milan Paris Singapore Tokyo F. Ferrozzi. G. Garlaschi. D. Bova CT of Metastases With a Foreword

More information

Surveillance following treatment of primary ocular melanoma

Surveillance following treatment of primary ocular melanoma Surveillance following treatment of primary ocular melanoma Introduction 50% of UM patients relapse with predominantly liver metastases Risk of metastatic disease can be predicted relatively accurately

More information

Oncology 101. Cancer Basics

Oncology 101. Cancer Basics Oncology 101 Cancer Basics What Will You Learn? What is Cancer and How Does It Develop? Cancer Diagnosis and Staging Cancer Treatment What is Cancer? Cancer is a group of more than 100 different diseases

More information

Epidermal growth factor receptor mutation and pattern of brain metastasis in patients with nonsmall cell lung cancer

Epidermal growth factor receptor mutation and pattern of brain metastasis in patients with nonsmall cell lung cancer ORIGINAL ARTICLE Korean J Intern Med 218;33:168-175 https://doi.org/1.394/kjim.215.158 Epidermal growth factor receptor mutation and pattern of brain metastasis in patients with nonsmall cell lung cancer

More information

The 8th Edition Lung Cancer Stage Classification

The 8th Edition Lung Cancer Stage Classification The 8th Edition Lung Cancer Stage Classification Elwyn Cabebe, M.D. Medical Oncology, Hematology, and Hospice and Palliative Care Valley Medical Oncology Consultants Director of Quality, Medical Oncology

More information

Take home message. Emilio Bria. II SESSIONE: Immunoterapia nel tumore del polmone

Take home message. Emilio Bria. II SESSIONE: Immunoterapia nel tumore del polmone II SESSIONE: Immunoterapia nel tumore del polmone Take home message Emilio Bria Oncologia, Dipart. di Medicina, Università di Verona, Az. Osp. Univ. Int., Verona emilio.bria@univr.it Roma, 28 Marzo 2017

More information

Relevance of an extensive follow-up after surgery for nonsmall cell lung cancer

Relevance of an extensive follow-up after surgery for nonsmall cell lung cancer ORIGINAL ARTICLE LUNG CANCER Relevance of an extensive follow-up after surgery for nonsmall cell lung cancer Delphine Gourcerol 1,2, Arnaud Scherpereel 1,2, Stephane Debeugny 3, Henri Porte 2,4, Alexis

More information

The Egyptian Journal of Hospital Medicine (July 2018) Vol. 72 (9), Page

The Egyptian Journal of Hospital Medicine (July 2018) Vol. 72 (9), Page The Egyptian Journal of Hospital Medicine (July 2018) Vol. 72 (9), Page 5298-5303 Prognostic Value of Platelet to Lymphocyte Ratio in Patients with Non-Small Cell Lung Cancer Mohammad Sabry Elkady, Ghada

More information

Special Situation: Brain metastases

Special Situation: Brain metastases ESMO Advanced Course on Unsolved Questions in Immuno-Oncology February 16-17 2018, Amsterdam, Netherlands Special Situation: Brain metastases Matthias Preusser, MD Associate Professor of Medicine Department

More information