Assay Location Primer TaqMan probe Reference

Size: px
Start display at page:

Download "Assay Location Primer TaqMan probe Reference"

Transcription

1 Table S1. Primers and TaqMan probes for picoliter-ddpcr Assay Location Primer TaqMan probe Reference Exon 19 deletion assay a Exon 19 GCACCATCTCACAATTGCCAG VIC-CAGAAGGTGAGAAAGTT-MGB Reference probe Original CACAGCAAAGCAGAAACTCACA FAM-ATGTTGCTTCTCTTAATTCC-MGB L858R mutation assay Exon 21 ACTTTGCCTCCTTCTGCATGG VIC-AGTTTGGCCAGCCCAA-MGB Mutant probe 17 CTACTTGGAGGACCGTCGC FAM-AGTTTGGCCCGCCCAA-MGB T790M mutation assay Exon 21 CGCCTGCTGGGCATCTG VIC-ATGAGCTGCGTGATGAG-MGB Mutant probe 17 GTCTTTGTGTTCCCGGACATAGT FAM-ATGAGCTGCATGATGAG-MGB a This assay was designed to detect 34 representative exon 19 deletions covering >95% of deletion mutations in LADC: ΔK745_E749, K745_T751>K, ΔE746_A750, E746_R748>E, E746_A750>IP, E746_T751>IP, E746_T751>I, E746_T751>V, E746_T751>A, E746_T751>VA, E746_S752>I, E746_751T>E, E746_S752>A, E746_S752>V, E746_P753>VS, E746_A755>E, ΔE746_T751, ΔE746_S752, E746_S752>D, ΔE746_S753, ΔL747_E749, ΔL747_A750, L747_A750>P, ΔL747_T751, L747_T751>Q, L747_T751>P, L747_T751>S, ΔL747_S752, L747_S752>Q, ΔL747_P753, L747_P753>V, L747_P753>S, L747_P753>Q, and S752-I 759del.

2 Table S2. EGFR-TKI sensitive and T790M-mutant DNAs detected by picoliter-ddpcr TKI-sensitive mutation assay T790M mutation assay Patient no. Pre or post TKI therapy Number of times All EGFR-WT No. of drops 19DEL or L858R Judgment TKI-sensitive mutation fraction (%) No. of drops All EGFR-WT T790M Judgment T790M mutation fraction (%) Patients resistant to EGFR-TKI therapy 1 pre #1 5,499, Positive ,772,087 1,322 2 Negative - post #1 5,801, Positive ,060, Positive #2 5,206, Positive ,419, Positive #3 5,529, Positive ,915, Positive post #1 5,426, Positive ,119, Positive 9.21 #2 5,079, Positive ,213, Positive 9.92 #3 5,090, Positive ,335, Positive post #1 6,630,426 1, Positive ,477,646 2, Positive 0.89 #2 6,066,868 1, Positive ,764,432 2, Positive 0.87 #3 5,153, Positive ,933,533 2, Positive post #1 5,277, Positive ,933, Positive post #1 6,054, Positive ,698,203 1, Positive post #1 6,198, Negative - 5,300, Negative - 7 post #1 5,824, Positive 3.4 6,692, Negative - 8 pre #1 5,861, Negative - 6,050, Negative - post #1 6,195, Positive ,515, Negative - 9 post #1 5,091, Positive ,941, Negative - 10 pre #1 5,716, Negative - 2,784, Negative - post #1 5,651, Positive 9.3 6,126, Negative - 11 pre #1 5,129, Positive ,238, Negative - post #1 6,897, Positive ,698, Negative - 12 pre #1 5,376, Positive ,184, Negative - post #1 3,714, Positive ,346, Negative - 13 post #1 5,617,971 1, Positive ,035,421 1,405 6 Negative - #2 6,240,017 1, Positive ,674,924 1,120 5 Negative - #3 4,979, Negative - 2,628, Negative - 14 post #1 4,222, Positive 5.8 4,236,300 1, Positive post #1 5,472, Positive ,448,473 1, Positive post #1 5,324, Positive ,823, Negative - Patients not resistant to EGFR-TKI therapy 17 pre #1 5,311, Negative - 5,626, Negative - #2 4,973, Negative - 4,736, Negative - #3 4,680, Negative - 4,765, Negative - 18 pre #1 5,969, Negative - 5,254, Negative - 19 pre #1 5,599, Negative - 4,946, Negative - 20 pre #1 5,942, Negative - 5,400, Negative - 21 pre #1 5,463, Negative - 5,151, Negative - 22 pre #1 3,004, Positive ,557, Negative - 23 pre #1 4,945, Positive ,458, Negative - 24 pre #1 4,524, Negative - 5,166, Negative - 25 pre #1 5,262, Negative - 5,166, Negative - 26 pre #1 6,006, Positive ,727, Negative - 27 pre #1 5,135, Negative - 5,491, Negative - 28 pre #1 4,808, Negative - 5,258, Negative - 29 pre #1 5,655, Negative - 5,291, Negative - 30 pre #1 5,092, Negative - 2,554, Negative -

3 31 pre #1 4,867, Negative - 1,244, Negative - 32 pre #2 3,858, Positive ,825, Negative - 33 pre #3 4,789, Negative - 4,789, Negative - 34 pre #4 6,058, Positive ,287, Negative - 35 pre #1 5,665, Positive ,143, Negative -

4 Table S3. Modes of disease progression and cfdna mutations Patient no. Modes of disease progression following EGFR-TKI therapy cfdna mutations Progression of tumors Appearance of new disease sites Sensitive mut (%) T790M mut (%) T790M fraction 1 Primary disease Malignant pericarditis Primary disease Brain metastasis Primary diseases and liver metastasis Malignant pleuritis, lymph node Brain metastasis Primary diseases and liver metastasis Liver metastasis Primary disease - Negative Negative - 7 Primary diseases Liver metastasis 3.4 Negative - 8 Malignant pleuritis Negative - 9 Primary diseases Malignant pleuritis 10.3 Negative - 10 Primary diseases and malignant pleuritis Negative - 11 Primary diseases Negative - 12 Primary diseases Brain metastases 69.3 Negative - 13 Malignant pleuritis Negative - 14 Liver and spinal metastases Primary diseases Bone metastases Primary diseases and spinal metastasis Negative -

5 Table S4. Pretreatment disease sites and cfdna mutations Patient no. cfdna mutations Pretreatment disease sites Sensitive mut (%) T790M mut (%) T790M fraction 1 Primary disease, pulmonary dissemination, and brain metastases 5.8 Negative - 8 Primary disease, lung metastasis, and malignant pleuritis Negative Negative - 10 Primary disease, malignant pleuritis and bone metastasis Negative Negative - 11 Primary disease, pulmonary dissemination, bone and brain metastases 3.2 Negative - 12 Primary disease, bone and liver metastases 60.6 Negative - 17 Malignant pleuritis Negative Negative - 18 Primary disease and malignant pleuritis Negative Negative - 19 Mediastinal lymph node metastases Negative Negative - 20 Mediastinal lymph node metastases Negative Negative - 21 Pulmonary dissemination Negative Negative - 22 Primary disease, malignant pleuritis and right breast metastasis 3.2 Negative - 23 Lung, liver, bone and lymph node metastases 21.4 Negative - 24 Brain metastasis Negative Negative - 25 Primary disease Negative Negative - 26 Mediastinal lymph node metastases 14.6 Negative - 27 Pulmonary dissemination and mediastinal lymph node metastases Negative Negative - 28 Brain, bone and lymph node metastases Negative Negative - 29 Mediastinal lymph node metastases Negative Negative - 30 Pulmonary dissemination and bone metastases Negative Negative - 31 Primary disease, bone and liver metastases Negative Negative - 32 Primary disease, malignant pleuritis, liver and brain metastases 17.8 Negative - 33 Mediastinal lymph node and adrenal metastases 1.3 Negative - 34 Primary disease, liver, bone and distant lymph node metastases 68.1 Negative - 35 Primary disease and brain metastases 0.8 Negative - -: not calculated due to lack of sensitive/resistant mutations.

Picoliter-Droplet Digital PCR-based Analysis of Cell-free Plasma DNA to Assess EGFR

Picoliter-Droplet Digital PCR-based Analysis of Cell-free Plasma DNA to Assess EGFR 東京慈恵会医科大学 1 Picoliter-Droplet Digital PCR-based Analysis of Cell-free Plasma DNA to Assess EGFR 2 Mutations in Lung Adenocarcinoma That Confer Resistance to Tyrosine Kinase 3 Inhibitors 4 5 Running Title:

More information

SuperARMS EGFR Mutation Detection Kit

SuperARMS EGFR Mutation Detection Kit SuperARMS EGFR Mutation Detection Kit Detection of 41 mutations in exons 18-21 Instruction for Use Instruction Version: P1.0 Revision Date: July 2016 Store at -20±5 Background For: ADx-EG14 Due to its

More information

design national external quality control instrument 4 distributions per year 3 unstained slides from 3 resection-specimen with or without EGFRmutation

design national external quality control instrument 4 distributions per year 3 unstained slides from 3 resection-specimen with or without EGFRmutation Ring Trial Molecular Diagnostics EGFR mutations in NSCLC Series II March 2012 results design national external quality control instrument 4 distributions per year 3 unstained slides from 3 resection-specimen

More information

MassARRAY System Lung Adenocarcinoma Somatic Mutation Profiling Darryl Irwin PhD Darryl Irwin PhD Director Applications and Technology September 2012

MassARRAY System Lung Adenocarcinoma Somatic Mutation Profiling Darryl Irwin PhD Darryl Irwin PhD Director Applications and Technology September 2012 MassARRAY System Lung Adenocarcinoma Somatic Mutation Profiling Darryl Irwin PhD Darryl Irwin PhD Director Applications and Technology September 2012 The MassARRAY System is for Research Use Only Not for

More information

Association of molecular status and organs with metastases at diagnosis in patients with non-small cell lung cancer (NSCLC)

Association of molecular status and organs with metastases at diagnosis in patients with non-small cell lung cancer (NSCLC) Association of molecular status and organs with metastases at diagnosis in patients with non-small cell lung cancer (NSCLC) Chantal Kuijpers* 1,2, Lizza Hendriks 3, Jules Derks 3, Anne-Marie Dingemans

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES PD 0332991, a selective cyclin D kinase 4/6 inhibitor, sensitizes lung cancer cells to treatment with epidermal growth factor receptor tyrosine kinase inhibitors SUPPLEMENTARY FIGURES AND TABLES Supplementary

More information

Cell-free tumor DNA for cancer monitoring

Cell-free tumor DNA for cancer monitoring Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the

More information

Biopsia Líquida: Oncología en Tiempo Real. Federico Rojo Fundación Jiménez Díaz

Biopsia Líquida: Oncología en Tiempo Real. Federico Rojo Fundación Jiménez Díaz Biopsia Líquida: Oncología en Tiempo Real Federico Rojo Fundación Jiménez Díaz Liquid Biopsy in Cancer Liquid Biopsy in Cancer Publication Date: April 5, 2016 Blood Tests replace Surgical Biopsies to create

More information

Molecular Pathobiology of Lung Cancer. William K. Funkhouser, MD PhD Department of Pathology and Lab Medicine University of North Carolina

Molecular Pathobiology of Lung Cancer. William K. Funkhouser, MD PhD Department of Pathology and Lab Medicine University of North Carolina Molecular Pathobiology of Lung Cancer William K. Funkhouser, MD PhD Department of Pathology and Lab Medicine University of North Carolina Outline Lung Anatomy Lung Carcinoma Classification & Morphology

More information

Updated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors

Updated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors Q: How is the strength of recommendation determined in the new molecular testing guideline? A: The strength of recommendation is determined by the strength of the available data (evidence). Strong Recommendation:

More information

Int J Clin Exp Pathol 2018;11(5): /ISSN: /IJCEP

Int J Clin Exp Pathol 2018;11(5): /ISSN: /IJCEP Int J Clin Exp Pathol 2018;11(5):2683-2690 www.ijcep.com /ISSN:1936-2625/IJCEP0072960 Original Article High concordance of EGFR mutation status between sputum and corresponding tissue specimens of late-stage

More information

The OncoBEAM Platform: The Use of a High Sensitive Technology for Liquid Biopsies in Clinical Practice

The OncoBEAM Platform: The Use of a High Sensitive Technology for Liquid Biopsies in Clinical Practice The OncoBEAM Platform: The Use of a High Sensitive Technology for Liquid Biopsies in Clinical Practice Sysmex Inostics Dr. Friederike Lehmann Head of CRO Marketing Sysmex Corporation Kobe 2 Sysmex Corporation

More information

Read, Interpret, and Communicate Test Results

Read, Interpret, and Communicate Test Results Read, Interpret, and Communicate Test Results Effective interpretation of epidermal growth factor receptor (EGFR) T790M mutation test results at progression will help physicians to set patient expectations

More information

Liquid biopsy in lung cancer: The EGFR paradigm

Liquid biopsy in lung cancer: The EGFR paradigm Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships

More information

Molly Boyd, MD Glenn Mills, MD Syed Jafri, MD 1/1/2010

Molly Boyd, MD Glenn Mills, MD Syed Jafri, MD 1/1/2010 LSU HEALTH SCIENCES CENTER NSCLC Guidelines Feist-Weiller Cancer Center Molly Boyd, MD Glenn Mills, MD Syed Jafri, MD 1/1/2010 Initial Evaluation/Intervention: 1. Pathology Review 2. History and Physical

More information

Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~

Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~ 16 th Dec. 2016. ESMO Preceptorship Program Non-Small-Cell Lung Cancer @Singapore Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~ Research Institute for Disease of

More information

MET skipping mutation, EGFR

MET skipping mutation, EGFR New NSCLC biomarkers in clinical research: detection of MET skipping mutation, EGFR T790M, and other important biomarkers Fernando López-Ríos Laboratorio de Dianas Terapéuticas Hospital Universitario HM

More information

Robert Beer

Robert Beer Robert Beer Robert.beer@wales.nhs.uk All Wales Medical Genetics Service Genetic Technologist Training Day 22 nd November 2017 Contents Stratified Medicine NHS EGFR Diagnostic Testing Services Cell free

More information

La biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro

La biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro La biopsia liquida Aldo Scarpa Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro Azienda Ospedaliera Universitaria Integrata di Verona Obstacles to precision oncology Genomic heterogeneity

More information

Diagnostic with alternative sample types (liquid biopsy)

Diagnostic with alternative sample types (liquid biopsy) MOLECULAR DIAGNOSTICS OF EGFR AND T790M MUTATIONS CHALLENGES AND SOLUTIONS Diagnostic with alternative sample types (liquid biopsy) James CH Yang, MD, PhD Director, Professor, Graduate Institute of Oncology

More information

Exon 19 L747P mutation presented as a primary resistance to EGFR-TKI: a case report

Exon 19 L747P mutation presented as a primary resistance to EGFR-TKI: a case report Case Report Exon 19 L747P mutation presented as a primary resistance to EGFR-TKI: a case report Yu-Ting Wang, Wei-Wei Ning, Jing Li, Jian-n Huang Department of Respiratory Medicine, the First ffiliated

More information

Pros and cons of liquid biopsy: Ready to replace tissue?

Pros and cons of liquid biopsy: Ready to replace tissue? Pros and cons of liquid biopsy: Ready to replace tissue? 2-Day Molecular Biologists Symposium: Liquid biopsies Federico Rojo Enterprise Interest No disclosures. Biological limitations for molecular testing:

More information

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant

More information

Integrated platform for liquid biopsy-based personalized cancer medicine

Integrated platform for liquid biopsy-based personalized cancer medicine Integrated platform for liquid biopsy-based personalized cancer medicine Dr. Bernhard Polzer Fraunhofer ITEM-Regensburg Personalized Tumor Therapy Personalized cancer therapy Primary tumor single tumor

More information

CLIA Laboratory Testing of Urinary BRAF V600E DNA mutations: Application in the Management of Patients with Histiocytic Diseases

CLIA Laboratory Testing of Urinary BRAF V600E DNA mutations: Application in the Management of Patients with Histiocytic Diseases CLIA Laboratory Testing of Urinary BRAF V600E DNA mutations: Application in the Management of Patients with Histiocytic Diseases Adriana Muniz 1, Mariko Matsutani 1, Karena Kosco 1, John Spinosa 1, Cecile

More information

GROUP 1: Peripheral tumour with normal hilar and mediastinum on staging CT with no disant metastases. Including: Excluding:

GROUP 1: Peripheral tumour with normal hilar and mediastinum on staging CT with no disant metastases. Including: Excluding: GROUP 1: Including: Excluding: Peripheral tumour with normal hilar and mediastinum on staging CT with no disant metastases Solid pulmonary nodules 8mm diameter / 300mm3 volume and BROCK risk of malignancy

More information

T he utility of epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) in metastatic nonsmall

T he utility of epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) in metastatic nonsmall OPEN SUBJECT AREAS: NON-SMALL-CELL LUNG CANCER TARGETED THERAPIES Received 30 April 2014 Accepted 15 July 2014 Published 8 August 2014 Correspondence and requests for materials should be addressed to H.L.

More information

Breast Cancer. Excess Estrogen Exposure. Alcohol use + Pytoestrogens? Abortion. Infertility treatment?

Breast Cancer. Excess Estrogen Exposure. Alcohol use + Pytoestrogens? Abortion. Infertility treatment? Breast Cancer Breast Cancer Excess Estrogen Exposure Nulliparity or late pregnancy + Early menarche + Late menopause + Cystic ovarian disease + External estrogens exposure + Breast Cancer Excess Estrogen

More information

Targeted therapy in NSCLC: do we progress? Prof. Dr. V. Surmont. Masterclass 27 september 2018

Targeted therapy in NSCLC: do we progress? Prof. Dr. V. Surmont. Masterclass 27 september 2018 Targeted therapy in NSCLC: do we progress? Prof. Dr. V. Surmont Masterclass 27 september 2018 Outline Introduction EGFR TKI ALK TKI TKI for uncommon driver mutations Take home messages The promise of

More information

Plateform of Somatic Oncology INSERM LNC-UMR 1231 University Hospital of Dijon, France

Plateform of Somatic Oncology INSERM LNC-UMR 1231 University Hospital of Dijon, France Plateform of Somatic Oncology INSERM LNC-UMR 1231 University Hospital of Dijon, France The liquid biopsy in oncology Crowley E, Di Nicolantonio F, Loupakis F, Bardelli A. Nat Rev Clin Oncol. 2013 1. Setting

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/3/75/75ra26/dc1 Supplementary Materials for Genotypic and Histological Evolution of Lung Cancers Acquiring Resistance to EGFR Inhibitors Lecia V. Sequist,*

More information

Liquid biopsy: the experience of real life case studies

Liquid biopsy: the experience of real life case studies Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal

More information

Afatinib in patients with EGFR mutation-positive NSCLC harboring uncommon mutations: overview of clinical data

Afatinib in patients with EGFR mutation-positive NSCLC harboring uncommon mutations: overview of clinical data Afatinib in patients with EGFR mutation-positive NSCLC harboring uncommon mutations: overview of clinical data Oscar Arrieta, 1 Pedro De Marchi, 2 Nobuyuki Yamamoto, 3 Chong-Jen Yu, 4 Sai-Hong I Ou, 5

More information

Assessing the lung and mediastinum in cancer-is tissue the issue? George Santis

Assessing the lung and mediastinum in cancer-is tissue the issue? George Santis 1 Assessing the lung and mediastinum in cancer-is tissue the issue? George Santis Optimal management of Cancer Histological diagnosis & accurate staging at presentation Molecular analysis of primary tumour

More information

EGFR ctdna Testing. Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester

EGFR ctdna Testing. Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester EGFR ctdna Testing Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester ctdna & EGFR Testing in NSCLC EGFR ctdna testing Non-invasive - patients too sick/biopsy or cytology

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

Lukas Bubendorf Pathologie. Liquid biopsies

Lukas Bubendorf Pathologie. Liquid biopsies Lukas Bubendorf Pathologie Liquid biopsies Liquid biopsies 1. Circulating cell-free tumor-dna (ctdna) 2. Circulating tumor cells (CTC) Source: Sysmex CTCs ctdna ctrna exosomes Quantification Protein RNA

More information

Osimertinib Activity in Patients With Leptomeningeal Disease From Non-Small Cell Lung Cancer: Updated Results From the BLOOM Study

Osimertinib Activity in Patients With Leptomeningeal Disease From Non-Small Cell Lung Cancer: Updated Results From the BLOOM Study Osimertinib Activity in Patients With Leptomeningeal Disease From Non-Small Cell Lung Cancer: Updated Results From the BLOOM Study Abstract 9002 Yang JC, Kim DW, Kim SW, Cho BC, Lee JS, Ye X, Yin X, Yang

More information

A case of different EGFR mutations in surgically resected synchronous triple lung cancer

A case of different EGFR mutations in surgically resected synchronous triple lung cancer Case Report A case of different EGFR mutations in surgically resected synchronous triple lung cancer Naoki Haratake 1, Mitsuhiro Takenoyama 1, Makoto Edagawa 1, Shinichiro Shimamatsu 1, Ryo Toyozawa 1,

More information

See Important Reminder at the end of this policy for important regulatory and legal information.

See Important Reminder at the end of this policy for important regulatory and legal information. Clinical Policy: (Iressa) Reference Number: CP.PHAR.68 Effective Date: 11.16.16 Last Review Date: 11.18 Line of Business: Commercial, Medicaid Revision Log See Important Reminder at the end of this policy

More information

Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy

Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy 1 st st International Oncological Conference Wrocław, October 6 th, 2012 Dr. Frank Kischkel Individualized Cancer Therapy:

More information

Tumor Board Discussions: Case 1

Tumor Board Discussions: Case 1 Tumor Board Discussions: Case 1 David S. Ettinger, MD The Alex Grass Professor of Oncology Johns Hopkins University School of Medicine Baltimore, Maryland Case #1 50-year-old Asian female, never smoker

More information

Clinical Utility of Droplet ddpcr, moving to diagnostics. Koen De Gelas, PhD, CRIG ddpcr mini symposium, 15/05/2018

Clinical Utility of Droplet ddpcr, moving to diagnostics. Koen De Gelas, PhD, CRIG ddpcr mini symposium, 15/05/2018 1 Clinical Utility of Droplet ddpcr, moving to diagnostics 2 Koen De Gelas, PhD, CRIG ddpcr mini symposium, 15/05/2018 Disclaimer Disclaimer: all consumables, instruments, applications and software covered

More information

Treatment of EGFR mutant advanced NSCLC

Treatment of EGFR mutant advanced NSCLC Treatment of EGFR mutant advanced NSCLC Raffaele Califano Department of Medical Oncology The Christie and University Hospital of South Manchester, Manchester, UK Outline Data on first-line Overcoming T790M

More information

New options for old and new targets in NSCLC Rosario García Campelo Medical Oncology Unit University Hospital A Coruña

New options for old and new targets in NSCLC Rosario García Campelo Medical Oncology Unit University Hospital A Coruña New options for old and new targets in NSCLC Rosario García Campelo Medical Oncology Unit University Hospital A Coruña Phase II GOAL TRIAL DESIGN Key inclusion criteria Patients with locally advanced or

More information

Management of advanced non small cell lung cancer

Management of advanced non small cell lung cancer Management of advanced non small cell lung cancer Jean-Paul Sculier Intensive Care & Thoracic Oncology Institut Jules Bordet Université Libre de Bruxelles (ULB) www.pneumocancero.com Declaration No conflict

More information

The epidermal growth factor receptor (EGFR) gene encodes

The epidermal growth factor receptor (EGFR) gene encodes ORIGINAL ARTICLE Detection of EGFR Mutation Status in Lung Adenocarcinoma Specimens with Different Proportions of Tumor Cells Using Two Methods of Differential Sensitivity Hye-Suk Han, MD,* Sung-nam Lim,

More information

Joachim Aerts Erasmus MC Rotterdam, Netherlands. Drawing the map: molecular characterization of NSCLC

Joachim Aerts Erasmus MC Rotterdam, Netherlands. Drawing the map: molecular characterization of NSCLC Joachim Aerts Erasmus MC Rotterdam, Netherlands Drawing the map: molecular characterization of NSCLC Disclosures Honoraria for advisory board/consultancy/speakers fee Eli Lilly Roche Boehringer Ingelheim

More information

CheckMate 012: Safety and Efficacy of First Line Nivolumab and Ipilimumab in Advanced Non-Small Cell Lung Cancer

CheckMate 012: Safety and Efficacy of First Line Nivolumab and Ipilimumab in Advanced Non-Small Cell Lung Cancer CheckMate 12: Safety and Efficacy of First Line Nivolumab and Ipilimumab in Advanced Non-Small Cell Lung Cancer Abstract 31 Hellmann MD, Gettinger SN, Goldman J, Brahmer J, Borghaei H, Chow LQ, Ready NE,

More information

Biomarkers of Response to EGFR-TKIs EORTC-NCI-ASCO Meeting on Molecular Markers in Cancer November 17, 2007

Biomarkers of Response to EGFR-TKIs EORTC-NCI-ASCO Meeting on Molecular Markers in Cancer November 17, 2007 Biomarkers of Response to EGFR-TKIs EORTC-NCI-ASCO Meeting on Molecular Markers in Cancer November 17, 2007 Bruce E. Johnson, MD Dana-Farber Cancer Institute, Brigham and Women s Hospital, and Harvard

More information

Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital. NSW Health Pathology University of Sydney

Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital. NSW Health Pathology University of Sydney Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital NSW Health Pathology University of Sydney Thyroid Cancer TC incidence rates in NSW Several subtypes - Papillary

More information

Is advanced lung cancer becoming a chronic disease?

Is advanced lung cancer becoming a chronic disease? Is advanced lung cancer becoming a chronic disease? James Chung-Man HO ( 何重文 ) M.D. FRCP Associate Professor, The University of Hong Kong Honorary Consultant, Department of Medicine Specialist in Respiratory

More information

Transforming Oncology With Precision Medicine Solutions. Company Overview January 2017

Transforming Oncology With Precision Medicine Solutions. Company Overview January 2017 Transforming Oncology With Precision Medicine Solutions Company Overview January 2017 FORWARD-LOOKING STATEMENTS Statements in this presentation about the Company's expectations, applications of its technology,

More information

CASE REPORT. Abstract. Introduction. Case Report

CASE REPORT. Abstract. Introduction. Case Report SE REPORT n utopsy ase of Two Distinct, cquired Drug Resistance Mechanisms in Epidermal Growth Factor Receptor-mutant Lung denocarcinoma: Small ell arcinoma Transformation and Epidermal Growth Factor Receptor

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Introduction. Case Report

Introduction. Case Report Case Report Usefulness of circulating free DNA for monitoring epidermal growth factor receptor mutations in advanced non-small cell lung cancer patients: a case report Clara Mayo de las Casas 1, Maria

More information

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h) Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

More information

expectancy Cancer spread to bones life expectancy

expectancy Cancer spread to bones life expectancy Cancer spread to bones life expectancy The Borg System is 100 % Cancer spread to bones life expectancy Sep 27, 2016. About 80 percent of the time prostate cancer cells metastasize, or spread, they will

More information

Anatomic Molecular Pathology: An Emerging Field

Anatomic Molecular Pathology: An Emerging Field Anatomic Molecular Pathology: An Emerging Field Antonia R. Sepulveda M.D., Ph.D. University of Pennsylvania asepu@mail.med.upenn.edu 2008 ASIP Annual Meeting Anatomic pathology (U.S.) is a medical specialty

More information

Changing demographics of smoking and its effects during therapy

Changing demographics of smoking and its effects during therapy Changing demographics of smoking and its effects during therapy Egbert F. Smit MD PhD. Dept. Pulmonary Diseases, Vrije Universiteit Medical Centre, Amsterdam, The Netherlands Smoking prevalence adults

More information

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to

More information

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor

More information

Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs

Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs Indian Patent Application No. 1623/DEL/2014 Inventors: Prof. Kulbhushan Tikoo and Jasmine Kaur Department of Pharmacology

More information

Molecular Testing in Lung Cancer

Molecular Testing in Lung Cancer Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans

More information

EGFR TKI sequencing: does order matter?

EGFR TKI sequencing: does order matter? EGFR TKI sequencing: does order matter? Nicolas Girard Thorax Institut Curie-Montsouris, Paris, France In Switzerland, afatinib is approved as monotherapy for patients with non-small cell lung cancer (Stage

More information

Lung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD. Mount Carrigain 2/4/17

Lung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD. Mount Carrigain 2/4/17 Lung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD Mount Carrigain 2/4/17 Histology Adenocarcinoma: Mixed subtype, acinar, papillary, solid, micropapillary, lepidic

More information

Targeted Therapies for Advanced NSCLC

Targeted Therapies for Advanced NSCLC Targeted Therapies for Advanced NSCLC Current Clinical Developments Friday, June 3, 2016 Supported by an independent educational grant from AstraZeneca Not an official event of the 2016 ASCO Annual Meeting

More information

Reflex Testing Guidelines for Immunotherapy in Non-Small Cell Lung Cancer

Reflex Testing Guidelines for Immunotherapy in Non-Small Cell Lung Cancer Reflex Testing Guidelines for Immunotherapy in Non-Small Cell Lung Cancer Jimmy Ruiz, MD Assistant Professor Thoracic Oncology Program Wake Forest Comprehensive Cancer Center Disclosures I have no actual

More information

Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System

Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System Erwin Sablon, Head of R&D, Biocartis NV World CDx, Boston, September 10 th 2015 0 About Biocartis Innovative molecular

More information

Targeted therapy in lung cancer : experience of NIO-RABAT

Targeted therapy in lung cancer : experience of NIO-RABAT Targeted therapy in lung cancer : experience of NIO-RABAT I.ELGHISSASSI, H.ERRIHANI Medical oncology department, NIO- RABAT 02-05- 2012, FEZ In Morocco, lung cancer is the most common tumor among men At

More information

ACRIN NLST 6654 Primary Lung Cancer. F1/F2 Interval: to (mm-dd-yyyy) 1. Date of diagnosis: (mm-dd-yyyy)

ACRIN NLST 6654 Primary Lung Cancer. F1/F2 Interval: to (mm-dd-yyyy) 1. Date of diagnosis: (mm-dd-yyyy) No. F1/F2 Interval: - - 20 to - - 20 (mm-dd-yyyy) 1. Date of diagnosis: - - 20 (mm-dd-yyyy) 2. Samples recorded: ZP Number S-Number 1) 2) 3) 4) (Refer to Form PX, Column 1. In the rare instance of a diagnosis

More information

HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY

HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY 7 TH Annual New York Lung Cancer Symposium Saturday, November 10, 2012 William D. Travis, M.D. Attending Thoracic Pathologist Memorial Sloan Kettering

More information

PET/CT in lung cancer

PET/CT in lung cancer PET/CT in lung cancer Andrei Šamarin North Estonia Medical Centre 3 rd Baltic Congress of Radiology 08.10.2010 Imaging in lung cancer Why do we need PET/CT? CT is routine imaging modality for staging of

More information

Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine

Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine The most common non-skin malignancy of women 2 nd most common cause of cancer deaths in women, following

More information

Part I. An Introduction to Cancer

Part I. An Introduction to Cancer Part I An Introduction to Cancer 2 Chapter 1 Cancer: Descriptive Overview Cancer is a disease in which cells propagate uncontrollably. These cells can come from many different parts of the body and the

More information

Ultrasound-Guided Fine-Needle Aspiration of Thyroid Nodules: New events

Ultrasound-Guided Fine-Needle Aspiration of Thyroid Nodules: New events Ultrasound-Guided Fine-Needle Aspiration of Thyroid Nodules: New events Sandrine Rorive, M.D., PhD. Erasme Hospital - Université Libre de Bruxelles (ULB) INTRODUCTION The assessment of thyroid nodules

More information

Treatment of EGFR mutant advanced NSCLC

Treatment of EGFR mutant advanced NSCLC Treatment of EGFR mutant advanced NSCLC Raffaele Califano Department of Medical Oncology The Christie and Manchester University Hospital Manchester, UK Outline Data on first-line Overcoming T790M mutation

More information

Applying Genomics to Cancer 21 st September The Frequency of EGFR mutations in Lung Adenocarcinoma: The Cardiff Experience

Applying Genomics to Cancer 21 st September The Frequency of EGFR mutations in Lung Adenocarcinoma: The Cardiff Experience Applying Genomics to Cancer 21 st September 2015 The Frequency of EGFR mutations in Lung Adenocarcinoma: The Cardiff Experience Aled Daniels R Butler, R Attanoos, H Davies University Hospital of Wales

More information

EGFR EGFR-TKI CSPOR LC-2

EGFR EGFR-TKI CSPOR LC-2 EGFR EGFR-TKI CSPOR LC-2 Background Although NSCLC with activating EGFR mutation is generally sensitive to EGFR-TKI, such as gefitinib or erlotinib, acquired resistance is eventually seen. In the prospective

More information

Overview of Cancer. Mylene Freires Advanced Nurse Practitioner, Haematology

Overview of Cancer. Mylene Freires Advanced Nurse Practitioner, Haematology Overview of Cancer Mylene Freires Advanced Nurse Practitioner, Haematology Aim of the Presentation Review basic concepts of cancer Gain some understanding of the socio-economic impact of cancer Order of

More information

Citation Acta Medica Nagasakiensia. 1992, 37

Citation Acta Medica Nagasakiensia. 1992, 37 NAOSITE: Nagasaki University's Ac Title Author(s) A Study on the Expression of EGFR a Content in the Stomach Cancer Tissu Nakazaki Takayuki Citation Acta Medica Nagasakiensia. 1992 37 Issue Date 1992-12-25

More information

Stage 4 breast cancer life expectancy

Stage 4 breast cancer life expectancy P ford residence southampton, ny Stage 4 breast cancer life expectancy Breast cancer life expectancy depends on the stage of breast cancer, presence of metastasis, immune system of a person and the preferred

More information

Association of mutant EGFR L858R and exon 19 concentration in circulating cell-free DNA using droplet digital PCR with response to EGFR-TKIs in NSCLC

Association of mutant EGFR L858R and exon 19 concentration in circulating cell-free DNA using droplet digital PCR with response to EGFR-TKIs in NSCLC ONCOLOGY LETTERS 14: 2573-2579, 2017 Association of mutant EGFR L858R and exon 19 concentration in circulating cell-free DNA using droplet digital PCR with response to EGFR-TKIs in NSCLC YAN JUAN ZHU 1,

More information

Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin

Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification

More information

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

Tumor DNA circulating in the plasma might play a role in metastasis. The hypothesis of the genometastasis

Tumor DNA circulating in the plasma might play a role in metastasis. The hypothesis of the genometastasis Histol Histopathol (1 999) 14: 1 159-1 164 http://www.ehu.es/histol-histopathol Histology and Histopathology Tumor DNA circulating in the plasma might play a role in metastasis. The hypothesis of the genometastasis

More information

Spectrum Pharmaceuticals

Spectrum Pharmaceuticals Spectrum Pharmaceuticals Joe Turgeon President and CEO June 2018 Investor Presentation 1 Safe Harbor Statement This presentation contains forward looking statements regarding future events and the future

More information

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy

More information

ECMC cfdna consensus meeting

ECMC cfdna consensus meeting ECMC cfdna consensus meeting State of the art for cfdna technologies 24 th November 2014 Applications of ctdna analysis for drug development Potential of ctdna analysis to: Identify the right patients

More information

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication

More information

Renal Cell Cancer. Clinical case study 1 & 2. Petri Bono MD PhD Helsinki University Hospital Helsinki, Finland

Renal Cell Cancer. Clinical case study 1 & 2. Petri Bono MD PhD Helsinki University Hospital Helsinki, Finland Renal Cell Cancer Clinical case study 1 & 2 Petri Bono MD PhD Helsinki University Hospital Helsinki, Finland 1 Case study 1 - RCC and Lung Metastases Case study 1: Patient History Male, 63 years old Mild

More information

Mengxi Ge 1, Qiong Zhan 1, Zhenzhen Zhang 2, Xiaoyu Ji 1, Xinli Zhou 1, Ruofan Huang 1* and Xiaohua Liang 1*

Mengxi Ge 1, Qiong Zhan 1, Zhenzhen Zhang 2, Xiaoyu Ji 1, Xinli Zhou 1, Ruofan Huang 1* and Xiaohua Liang 1* Ge et al. BMC Cancer (2019) 19:143 https://doi.org/10.1186/s12885-019-5348-3 RESEARCH ARTICLE Different next-generation sequencing pipelines based detection of tumor DNA in cerebrospinal fluid of lung

More information

Emerging Algorithm for Optimal Sequencing of EGFR TKIs in EGFR Mutation Positive NSCLC

Emerging Algorithm for Optimal Sequencing of EGFR TKIs in EGFR Mutation Positive NSCLC Emerging Algorithm for Optimal Sequencing of EGFR TKIs in EGFR Mutation Positive NSCLC Keunchil Park, MD, PhD Samsung Medical Center, Sungkyunkwan University School of Medicine Faculty Disclosure Consulting

More information

Management of carcinomatous meningitis in a patient with advanced lung adenocarcinoma

Management of carcinomatous meningitis in a patient with advanced lung adenocarcinoma Management of carcinomatous meningitis in a patient with advanced lung adenocarcinoma Clinical Case Presentation Emilie Le Rhun Centre Hospitalier Régional et Universitaire (CHRU) de Lille Neurochirurgie

More information

MammaPrint, the story of the 70-gene profile

MammaPrint, the story of the 70-gene profile MammaPrint, the story of the 70-gene profile René Bernards Professor of Molecular Carcinogenesis The Netherlands Cancer Institute Amsterdam Chief Scientific Officer Agendia Amsterdam The breast cancer

More information

PROGRESSION AFTER THIRD GENERATION TKI

PROGRESSION AFTER THIRD GENERATION TKI PROGRESSION AFTER THIRD GENERATION TKI What next? National Cancer Center Hospital Yuichiro Ohe, MD Name of lead presenter Yuichiro Ohe employee of company and/or profit-making organization adviser of company

More information

Optimum Sequencing of EGFR targeted therapy in NSCLC. Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey

Optimum Sequencing of EGFR targeted therapy in NSCLC. Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey Optimum Sequencing of EGFR targeted therapy in NSCLC Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey Lung cancer NSCLC SCLC adeno squamous EGFR ALK ROS1 BRAF HER2 KRAS EGFR Transl Lung Cancer

More information

Sleeve lobectomy for lung adenocarcinoma treated with neoadjuvant afatinib

Sleeve lobectomy for lung adenocarcinoma treated with neoadjuvant afatinib Case Report Sleeve lobectomy for lung adenocarcinoma treated with neoadjuvant afatinib Ichiro Sakanoue 1, Hiroshi Hamakawa 1, Reiko Kaji 2, Yukihiro Imai 3, Nobuyuki Katakami 2, Yutaka Takahashi 1 1 Department

More information

La biopsia liquida dei tumori: il viaggio. Paola Gazzaniga Liquid Biopsy Unit Dept. Molecular Medicine Sapienza University of Rome

La biopsia liquida dei tumori: il viaggio. Paola Gazzaniga Liquid Biopsy Unit Dept. Molecular Medicine Sapienza University of Rome La biopsia liquida dei tumori: il viaggio Paola Gazzaniga Liquid Biopsy Unit Dept. Molecular Medicine Sapienza University of Rome Must Know Necessary Travel Tips There is lack of drugs to treat all the

More information