Assay Location Primer TaqMan probe Reference
|
|
- Karin Carr
- 5 years ago
- Views:
Transcription
1 Table S1. Primers and TaqMan probes for picoliter-ddpcr Assay Location Primer TaqMan probe Reference Exon 19 deletion assay a Exon 19 GCACCATCTCACAATTGCCAG VIC-CAGAAGGTGAGAAAGTT-MGB Reference probe Original CACAGCAAAGCAGAAACTCACA FAM-ATGTTGCTTCTCTTAATTCC-MGB L858R mutation assay Exon 21 ACTTTGCCTCCTTCTGCATGG VIC-AGTTTGGCCAGCCCAA-MGB Mutant probe 17 CTACTTGGAGGACCGTCGC FAM-AGTTTGGCCCGCCCAA-MGB T790M mutation assay Exon 21 CGCCTGCTGGGCATCTG VIC-ATGAGCTGCGTGATGAG-MGB Mutant probe 17 GTCTTTGTGTTCCCGGACATAGT FAM-ATGAGCTGCATGATGAG-MGB a This assay was designed to detect 34 representative exon 19 deletions covering >95% of deletion mutations in LADC: ΔK745_E749, K745_T751>K, ΔE746_A750, E746_R748>E, E746_A750>IP, E746_T751>IP, E746_T751>I, E746_T751>V, E746_T751>A, E746_T751>VA, E746_S752>I, E746_751T>E, E746_S752>A, E746_S752>V, E746_P753>VS, E746_A755>E, ΔE746_T751, ΔE746_S752, E746_S752>D, ΔE746_S753, ΔL747_E749, ΔL747_A750, L747_A750>P, ΔL747_T751, L747_T751>Q, L747_T751>P, L747_T751>S, ΔL747_S752, L747_S752>Q, ΔL747_P753, L747_P753>V, L747_P753>S, L747_P753>Q, and S752-I 759del.
2 Table S2. EGFR-TKI sensitive and T790M-mutant DNAs detected by picoliter-ddpcr TKI-sensitive mutation assay T790M mutation assay Patient no. Pre or post TKI therapy Number of times All EGFR-WT No. of drops 19DEL or L858R Judgment TKI-sensitive mutation fraction (%) No. of drops All EGFR-WT T790M Judgment T790M mutation fraction (%) Patients resistant to EGFR-TKI therapy 1 pre #1 5,499, Positive ,772,087 1,322 2 Negative - post #1 5,801, Positive ,060, Positive #2 5,206, Positive ,419, Positive #3 5,529, Positive ,915, Positive post #1 5,426, Positive ,119, Positive 9.21 #2 5,079, Positive ,213, Positive 9.92 #3 5,090, Positive ,335, Positive post #1 6,630,426 1, Positive ,477,646 2, Positive 0.89 #2 6,066,868 1, Positive ,764,432 2, Positive 0.87 #3 5,153, Positive ,933,533 2, Positive post #1 5,277, Positive ,933, Positive post #1 6,054, Positive ,698,203 1, Positive post #1 6,198, Negative - 5,300, Negative - 7 post #1 5,824, Positive 3.4 6,692, Negative - 8 pre #1 5,861, Negative - 6,050, Negative - post #1 6,195, Positive ,515, Negative - 9 post #1 5,091, Positive ,941, Negative - 10 pre #1 5,716, Negative - 2,784, Negative - post #1 5,651, Positive 9.3 6,126, Negative - 11 pre #1 5,129, Positive ,238, Negative - post #1 6,897, Positive ,698, Negative - 12 pre #1 5,376, Positive ,184, Negative - post #1 3,714, Positive ,346, Negative - 13 post #1 5,617,971 1, Positive ,035,421 1,405 6 Negative - #2 6,240,017 1, Positive ,674,924 1,120 5 Negative - #3 4,979, Negative - 2,628, Negative - 14 post #1 4,222, Positive 5.8 4,236,300 1, Positive post #1 5,472, Positive ,448,473 1, Positive post #1 5,324, Positive ,823, Negative - Patients not resistant to EGFR-TKI therapy 17 pre #1 5,311, Negative - 5,626, Negative - #2 4,973, Negative - 4,736, Negative - #3 4,680, Negative - 4,765, Negative - 18 pre #1 5,969, Negative - 5,254, Negative - 19 pre #1 5,599, Negative - 4,946, Negative - 20 pre #1 5,942, Negative - 5,400, Negative - 21 pre #1 5,463, Negative - 5,151, Negative - 22 pre #1 3,004, Positive ,557, Negative - 23 pre #1 4,945, Positive ,458, Negative - 24 pre #1 4,524, Negative - 5,166, Negative - 25 pre #1 5,262, Negative - 5,166, Negative - 26 pre #1 6,006, Positive ,727, Negative - 27 pre #1 5,135, Negative - 5,491, Negative - 28 pre #1 4,808, Negative - 5,258, Negative - 29 pre #1 5,655, Negative - 5,291, Negative - 30 pre #1 5,092, Negative - 2,554, Negative -
3 31 pre #1 4,867, Negative - 1,244, Negative - 32 pre #2 3,858, Positive ,825, Negative - 33 pre #3 4,789, Negative - 4,789, Negative - 34 pre #4 6,058, Positive ,287, Negative - 35 pre #1 5,665, Positive ,143, Negative -
4 Table S3. Modes of disease progression and cfdna mutations Patient no. Modes of disease progression following EGFR-TKI therapy cfdna mutations Progression of tumors Appearance of new disease sites Sensitive mut (%) T790M mut (%) T790M fraction 1 Primary disease Malignant pericarditis Primary disease Brain metastasis Primary diseases and liver metastasis Malignant pleuritis, lymph node Brain metastasis Primary diseases and liver metastasis Liver metastasis Primary disease - Negative Negative - 7 Primary diseases Liver metastasis 3.4 Negative - 8 Malignant pleuritis Negative - 9 Primary diseases Malignant pleuritis 10.3 Negative - 10 Primary diseases and malignant pleuritis Negative - 11 Primary diseases Negative - 12 Primary diseases Brain metastases 69.3 Negative - 13 Malignant pleuritis Negative - 14 Liver and spinal metastases Primary diseases Bone metastases Primary diseases and spinal metastasis Negative -
5 Table S4. Pretreatment disease sites and cfdna mutations Patient no. cfdna mutations Pretreatment disease sites Sensitive mut (%) T790M mut (%) T790M fraction 1 Primary disease, pulmonary dissemination, and brain metastases 5.8 Negative - 8 Primary disease, lung metastasis, and malignant pleuritis Negative Negative - 10 Primary disease, malignant pleuritis and bone metastasis Negative Negative - 11 Primary disease, pulmonary dissemination, bone and brain metastases 3.2 Negative - 12 Primary disease, bone and liver metastases 60.6 Negative - 17 Malignant pleuritis Negative Negative - 18 Primary disease and malignant pleuritis Negative Negative - 19 Mediastinal lymph node metastases Negative Negative - 20 Mediastinal lymph node metastases Negative Negative - 21 Pulmonary dissemination Negative Negative - 22 Primary disease, malignant pleuritis and right breast metastasis 3.2 Negative - 23 Lung, liver, bone and lymph node metastases 21.4 Negative - 24 Brain metastasis Negative Negative - 25 Primary disease Negative Negative - 26 Mediastinal lymph node metastases 14.6 Negative - 27 Pulmonary dissemination and mediastinal lymph node metastases Negative Negative - 28 Brain, bone and lymph node metastases Negative Negative - 29 Mediastinal lymph node metastases Negative Negative - 30 Pulmonary dissemination and bone metastases Negative Negative - 31 Primary disease, bone and liver metastases Negative Negative - 32 Primary disease, malignant pleuritis, liver and brain metastases 17.8 Negative - 33 Mediastinal lymph node and adrenal metastases 1.3 Negative - 34 Primary disease, liver, bone and distant lymph node metastases 68.1 Negative - 35 Primary disease and brain metastases 0.8 Negative - -: not calculated due to lack of sensitive/resistant mutations.
Picoliter-Droplet Digital PCR-based Analysis of Cell-free Plasma DNA to Assess EGFR
東京慈恵会医科大学 1 Picoliter-Droplet Digital PCR-based Analysis of Cell-free Plasma DNA to Assess EGFR 2 Mutations in Lung Adenocarcinoma That Confer Resistance to Tyrosine Kinase 3 Inhibitors 4 5 Running Title:
More informationSuperARMS EGFR Mutation Detection Kit
SuperARMS EGFR Mutation Detection Kit Detection of 41 mutations in exons 18-21 Instruction for Use Instruction Version: P1.0 Revision Date: July 2016 Store at -20±5 Background For: ADx-EG14 Due to its
More informationdesign national external quality control instrument 4 distributions per year 3 unstained slides from 3 resection-specimen with or without EGFRmutation
Ring Trial Molecular Diagnostics EGFR mutations in NSCLC Series II March 2012 results design national external quality control instrument 4 distributions per year 3 unstained slides from 3 resection-specimen
More informationMassARRAY System Lung Adenocarcinoma Somatic Mutation Profiling Darryl Irwin PhD Darryl Irwin PhD Director Applications and Technology September 2012
MassARRAY System Lung Adenocarcinoma Somatic Mutation Profiling Darryl Irwin PhD Darryl Irwin PhD Director Applications and Technology September 2012 The MassARRAY System is for Research Use Only Not for
More informationAssociation of molecular status and organs with metastases at diagnosis in patients with non-small cell lung cancer (NSCLC)
Association of molecular status and organs with metastases at diagnosis in patients with non-small cell lung cancer (NSCLC) Chantal Kuijpers* 1,2, Lizza Hendriks 3, Jules Derks 3, Anne-Marie Dingemans
More informationSUPPLEMENTARY FIGURES AND TABLES
PD 0332991, a selective cyclin D kinase 4/6 inhibitor, sensitizes lung cancer cells to treatment with epidermal growth factor receptor tyrosine kinase inhibitors SUPPLEMENTARY FIGURES AND TABLES Supplementary
More informationCell-free tumor DNA for cancer monitoring
Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the
More informationBiopsia Líquida: Oncología en Tiempo Real. Federico Rojo Fundación Jiménez Díaz
Biopsia Líquida: Oncología en Tiempo Real Federico Rojo Fundación Jiménez Díaz Liquid Biopsy in Cancer Liquid Biopsy in Cancer Publication Date: April 5, 2016 Blood Tests replace Surgical Biopsies to create
More informationMolecular Pathobiology of Lung Cancer. William K. Funkhouser, MD PhD Department of Pathology and Lab Medicine University of North Carolina
Molecular Pathobiology of Lung Cancer William K. Funkhouser, MD PhD Department of Pathology and Lab Medicine University of North Carolina Outline Lung Anatomy Lung Carcinoma Classification & Morphology
More informationUpdated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors
Q: How is the strength of recommendation determined in the new molecular testing guideline? A: The strength of recommendation is determined by the strength of the available data (evidence). Strong Recommendation:
More informationInt J Clin Exp Pathol 2018;11(5): /ISSN: /IJCEP
Int J Clin Exp Pathol 2018;11(5):2683-2690 www.ijcep.com /ISSN:1936-2625/IJCEP0072960 Original Article High concordance of EGFR mutation status between sputum and corresponding tissue specimens of late-stage
More informationThe OncoBEAM Platform: The Use of a High Sensitive Technology for Liquid Biopsies in Clinical Practice
The OncoBEAM Platform: The Use of a High Sensitive Technology for Liquid Biopsies in Clinical Practice Sysmex Inostics Dr. Friederike Lehmann Head of CRO Marketing Sysmex Corporation Kobe 2 Sysmex Corporation
More informationRead, Interpret, and Communicate Test Results
Read, Interpret, and Communicate Test Results Effective interpretation of epidermal growth factor receptor (EGFR) T790M mutation test results at progression will help physicians to set patient expectations
More informationLiquid biopsy in lung cancer: The EGFR paradigm
Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships
More informationMolly Boyd, MD Glenn Mills, MD Syed Jafri, MD 1/1/2010
LSU HEALTH SCIENCES CENTER NSCLC Guidelines Feist-Weiller Cancer Center Molly Boyd, MD Glenn Mills, MD Syed Jafri, MD 1/1/2010 Initial Evaluation/Intervention: 1. Pathology Review 2. History and Physical
More informationTissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~
16 th Dec. 2016. ESMO Preceptorship Program Non-Small-Cell Lung Cancer @Singapore Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~ Research Institute for Disease of
More informationMET skipping mutation, EGFR
New NSCLC biomarkers in clinical research: detection of MET skipping mutation, EGFR T790M, and other important biomarkers Fernando López-Ríos Laboratorio de Dianas Terapéuticas Hospital Universitario HM
More informationRobert Beer
Robert Beer Robert.beer@wales.nhs.uk All Wales Medical Genetics Service Genetic Technologist Training Day 22 nd November 2017 Contents Stratified Medicine NHS EGFR Diagnostic Testing Services Cell free
More informationLa biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro
La biopsia liquida Aldo Scarpa Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro Azienda Ospedaliera Universitaria Integrata di Verona Obstacles to precision oncology Genomic heterogeneity
More informationDiagnostic with alternative sample types (liquid biopsy)
MOLECULAR DIAGNOSTICS OF EGFR AND T790M MUTATIONS CHALLENGES AND SOLUTIONS Diagnostic with alternative sample types (liquid biopsy) James CH Yang, MD, PhD Director, Professor, Graduate Institute of Oncology
More informationExon 19 L747P mutation presented as a primary resistance to EGFR-TKI: a case report
Case Report Exon 19 L747P mutation presented as a primary resistance to EGFR-TKI: a case report Yu-Ting Wang, Wei-Wei Ning, Jing Li, Jian-n Huang Department of Respiratory Medicine, the First ffiliated
More informationPros and cons of liquid biopsy: Ready to replace tissue?
Pros and cons of liquid biopsy: Ready to replace tissue? 2-Day Molecular Biologists Symposium: Liquid biopsies Federico Rojo Enterprise Interest No disclosures. Biological limitations for molecular testing:
More informationDisclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath
Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant
More informationIntegrated platform for liquid biopsy-based personalized cancer medicine
Integrated platform for liquid biopsy-based personalized cancer medicine Dr. Bernhard Polzer Fraunhofer ITEM-Regensburg Personalized Tumor Therapy Personalized cancer therapy Primary tumor single tumor
More informationCLIA Laboratory Testing of Urinary BRAF V600E DNA mutations: Application in the Management of Patients with Histiocytic Diseases
CLIA Laboratory Testing of Urinary BRAF V600E DNA mutations: Application in the Management of Patients with Histiocytic Diseases Adriana Muniz 1, Mariko Matsutani 1, Karena Kosco 1, John Spinosa 1, Cecile
More informationGROUP 1: Peripheral tumour with normal hilar and mediastinum on staging CT with no disant metastases. Including: Excluding:
GROUP 1: Including: Excluding: Peripheral tumour with normal hilar and mediastinum on staging CT with no disant metastases Solid pulmonary nodules 8mm diameter / 300mm3 volume and BROCK risk of malignancy
More informationT he utility of epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) in metastatic nonsmall
OPEN SUBJECT AREAS: NON-SMALL-CELL LUNG CANCER TARGETED THERAPIES Received 30 April 2014 Accepted 15 July 2014 Published 8 August 2014 Correspondence and requests for materials should be addressed to H.L.
More informationBreast Cancer. Excess Estrogen Exposure. Alcohol use + Pytoestrogens? Abortion. Infertility treatment?
Breast Cancer Breast Cancer Excess Estrogen Exposure Nulliparity or late pregnancy + Early menarche + Late menopause + Cystic ovarian disease + External estrogens exposure + Breast Cancer Excess Estrogen
More informationTargeted therapy in NSCLC: do we progress? Prof. Dr. V. Surmont. Masterclass 27 september 2018
Targeted therapy in NSCLC: do we progress? Prof. Dr. V. Surmont Masterclass 27 september 2018 Outline Introduction EGFR TKI ALK TKI TKI for uncommon driver mutations Take home messages The promise of
More informationPlateform of Somatic Oncology INSERM LNC-UMR 1231 University Hospital of Dijon, France
Plateform of Somatic Oncology INSERM LNC-UMR 1231 University Hospital of Dijon, France The liquid biopsy in oncology Crowley E, Di Nicolantonio F, Loupakis F, Bardelli A. Nat Rev Clin Oncol. 2013 1. Setting
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/3/75/75ra26/dc1 Supplementary Materials for Genotypic and Histological Evolution of Lung Cancers Acquiring Resistance to EGFR Inhibitors Lecia V. Sequist,*
More informationLiquid biopsy: the experience of real life case studies
Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal
More informationAfatinib in patients with EGFR mutation-positive NSCLC harboring uncommon mutations: overview of clinical data
Afatinib in patients with EGFR mutation-positive NSCLC harboring uncommon mutations: overview of clinical data Oscar Arrieta, 1 Pedro De Marchi, 2 Nobuyuki Yamamoto, 3 Chong-Jen Yu, 4 Sai-Hong I Ou, 5
More informationAssessing the lung and mediastinum in cancer-is tissue the issue? George Santis
1 Assessing the lung and mediastinum in cancer-is tissue the issue? George Santis Optimal management of Cancer Histological diagnosis & accurate staging at presentation Molecular analysis of primary tumour
More informationEGFR ctdna Testing. Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester
EGFR ctdna Testing Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester ctdna & EGFR Testing in NSCLC EGFR ctdna testing Non-invasive - patients too sick/biopsy or cytology
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationLukas Bubendorf Pathologie. Liquid biopsies
Lukas Bubendorf Pathologie Liquid biopsies Liquid biopsies 1. Circulating cell-free tumor-dna (ctdna) 2. Circulating tumor cells (CTC) Source: Sysmex CTCs ctdna ctrna exosomes Quantification Protein RNA
More informationOsimertinib Activity in Patients With Leptomeningeal Disease From Non-Small Cell Lung Cancer: Updated Results From the BLOOM Study
Osimertinib Activity in Patients With Leptomeningeal Disease From Non-Small Cell Lung Cancer: Updated Results From the BLOOM Study Abstract 9002 Yang JC, Kim DW, Kim SW, Cho BC, Lee JS, Ye X, Yin X, Yang
More informationA case of different EGFR mutations in surgically resected synchronous triple lung cancer
Case Report A case of different EGFR mutations in surgically resected synchronous triple lung cancer Naoki Haratake 1, Mitsuhiro Takenoyama 1, Makoto Edagawa 1, Shinichiro Shimamatsu 1, Ryo Toyozawa 1,
More informationSee Important Reminder at the end of this policy for important regulatory and legal information.
Clinical Policy: (Iressa) Reference Number: CP.PHAR.68 Effective Date: 11.16.16 Last Review Date: 11.18 Line of Business: Commercial, Medicaid Revision Log See Important Reminder at the end of this policy
More informationIndividualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy
Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy 1 st st International Oncological Conference Wrocław, October 6 th, 2012 Dr. Frank Kischkel Individualized Cancer Therapy:
More informationTumor Board Discussions: Case 1
Tumor Board Discussions: Case 1 David S. Ettinger, MD The Alex Grass Professor of Oncology Johns Hopkins University School of Medicine Baltimore, Maryland Case #1 50-year-old Asian female, never smoker
More informationClinical Utility of Droplet ddpcr, moving to diagnostics. Koen De Gelas, PhD, CRIG ddpcr mini symposium, 15/05/2018
1 Clinical Utility of Droplet ddpcr, moving to diagnostics 2 Koen De Gelas, PhD, CRIG ddpcr mini symposium, 15/05/2018 Disclaimer Disclaimer: all consumables, instruments, applications and software covered
More informationTreatment of EGFR mutant advanced NSCLC
Treatment of EGFR mutant advanced NSCLC Raffaele Califano Department of Medical Oncology The Christie and University Hospital of South Manchester, Manchester, UK Outline Data on first-line Overcoming T790M
More informationNew options for old and new targets in NSCLC Rosario García Campelo Medical Oncology Unit University Hospital A Coruña
New options for old and new targets in NSCLC Rosario García Campelo Medical Oncology Unit University Hospital A Coruña Phase II GOAL TRIAL DESIGN Key inclusion criteria Patients with locally advanced or
More informationManagement of advanced non small cell lung cancer
Management of advanced non small cell lung cancer Jean-Paul Sculier Intensive Care & Thoracic Oncology Institut Jules Bordet Université Libre de Bruxelles (ULB) www.pneumocancero.com Declaration No conflict
More informationThe epidermal growth factor receptor (EGFR) gene encodes
ORIGINAL ARTICLE Detection of EGFR Mutation Status in Lung Adenocarcinoma Specimens with Different Proportions of Tumor Cells Using Two Methods of Differential Sensitivity Hye-Suk Han, MD,* Sung-nam Lim,
More informationJoachim Aerts Erasmus MC Rotterdam, Netherlands. Drawing the map: molecular characterization of NSCLC
Joachim Aerts Erasmus MC Rotterdam, Netherlands Drawing the map: molecular characterization of NSCLC Disclosures Honoraria for advisory board/consultancy/speakers fee Eli Lilly Roche Boehringer Ingelheim
More informationCheckMate 012: Safety and Efficacy of First Line Nivolumab and Ipilimumab in Advanced Non-Small Cell Lung Cancer
CheckMate 12: Safety and Efficacy of First Line Nivolumab and Ipilimumab in Advanced Non-Small Cell Lung Cancer Abstract 31 Hellmann MD, Gettinger SN, Goldman J, Brahmer J, Borghaei H, Chow LQ, Ready NE,
More informationBiomarkers of Response to EGFR-TKIs EORTC-NCI-ASCO Meeting on Molecular Markers in Cancer November 17, 2007
Biomarkers of Response to EGFR-TKIs EORTC-NCI-ASCO Meeting on Molecular Markers in Cancer November 17, 2007 Bruce E. Johnson, MD Dana-Farber Cancer Institute, Brigham and Women s Hospital, and Harvard
More informationDr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital. NSW Health Pathology University of Sydney
Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital NSW Health Pathology University of Sydney Thyroid Cancer TC incidence rates in NSW Several subtypes - Papillary
More informationIs advanced lung cancer becoming a chronic disease?
Is advanced lung cancer becoming a chronic disease? James Chung-Man HO ( 何重文 ) M.D. FRCP Associate Professor, The University of Hong Kong Honorary Consultant, Department of Medicine Specialist in Respiratory
More informationTransforming Oncology With Precision Medicine Solutions. Company Overview January 2017
Transforming Oncology With Precision Medicine Solutions Company Overview January 2017 FORWARD-LOOKING STATEMENTS Statements in this presentation about the Company's expectations, applications of its technology,
More informationCASE REPORT. Abstract. Introduction. Case Report
SE REPORT n utopsy ase of Two Distinct, cquired Drug Resistance Mechanisms in Epidermal Growth Factor Receptor-mutant Lung denocarcinoma: Small ell arcinoma Transformation and Epidermal Growth Factor Receptor
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationIntroduction. Case Report
Case Report Usefulness of circulating free DNA for monitoring epidermal growth factor receptor mutations in advanced non-small cell lung cancer patients: a case report Clara Mayo de las Casas 1, Maria
More informationPredictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
More informationexpectancy Cancer spread to bones life expectancy
Cancer spread to bones life expectancy The Borg System is 100 % Cancer spread to bones life expectancy Sep 27, 2016. About 80 percent of the time prostate cancer cells metastasize, or spread, they will
More informationAnatomic Molecular Pathology: An Emerging Field
Anatomic Molecular Pathology: An Emerging Field Antonia R. Sepulveda M.D., Ph.D. University of Pennsylvania asepu@mail.med.upenn.edu 2008 ASIP Annual Meeting Anatomic pathology (U.S.) is a medical specialty
More informationChanging demographics of smoking and its effects during therapy
Changing demographics of smoking and its effects during therapy Egbert F. Smit MD PhD. Dept. Pulmonary Diseases, Vrije Universiteit Medical Centre, Amsterdam, The Netherlands Smoking prevalence adults
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationThe clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors
Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor
More informationEts-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs
Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs Indian Patent Application No. 1623/DEL/2014 Inventors: Prof. Kulbhushan Tikoo and Jasmine Kaur Department of Pharmacology
More informationMolecular Testing in Lung Cancer
Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans
More informationEGFR TKI sequencing: does order matter?
EGFR TKI sequencing: does order matter? Nicolas Girard Thorax Institut Curie-Montsouris, Paris, France In Switzerland, afatinib is approved as monotherapy for patients with non-small cell lung cancer (Stage
More informationLung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD. Mount Carrigain 2/4/17
Lung Cancer Genetics: Common Mutations and How to Treat Them David J. Kwiatkowski, MD, PhD Mount Carrigain 2/4/17 Histology Adenocarcinoma: Mixed subtype, acinar, papillary, solid, micropapillary, lepidic
More informationTargeted Therapies for Advanced NSCLC
Targeted Therapies for Advanced NSCLC Current Clinical Developments Friday, June 3, 2016 Supported by an independent educational grant from AstraZeneca Not an official event of the 2016 ASCO Annual Meeting
More informationReflex Testing Guidelines for Immunotherapy in Non-Small Cell Lung Cancer
Reflex Testing Guidelines for Immunotherapy in Non-Small Cell Lung Cancer Jimmy Ruiz, MD Assistant Professor Thoracic Oncology Program Wake Forest Comprehensive Cancer Center Disclosures I have no actual
More informationLiquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System
Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System Erwin Sablon, Head of R&D, Biocartis NV World CDx, Boston, September 10 th 2015 0 About Biocartis Innovative molecular
More informationTargeted therapy in lung cancer : experience of NIO-RABAT
Targeted therapy in lung cancer : experience of NIO-RABAT I.ELGHISSASSI, H.ERRIHANI Medical oncology department, NIO- RABAT 02-05- 2012, FEZ In Morocco, lung cancer is the most common tumor among men At
More informationACRIN NLST 6654 Primary Lung Cancer. F1/F2 Interval: to (mm-dd-yyyy) 1. Date of diagnosis: (mm-dd-yyyy)
No. F1/F2 Interval: - - 20 to - - 20 (mm-dd-yyyy) 1. Date of diagnosis: - - 20 (mm-dd-yyyy) 2. Samples recorded: ZP Number S-Number 1) 2) 3) 4) (Refer to Form PX, Column 1. In the rare instance of a diagnosis
More informationHOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY
HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY 7 TH Annual New York Lung Cancer Symposium Saturday, November 10, 2012 William D. Travis, M.D. Attending Thoracic Pathologist Memorial Sloan Kettering
More informationPET/CT in lung cancer
PET/CT in lung cancer Andrei Šamarin North Estonia Medical Centre 3 rd Baltic Congress of Radiology 08.10.2010 Imaging in lung cancer Why do we need PET/CT? CT is routine imaging modality for staging of
More informationMaram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine
Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine The most common non-skin malignancy of women 2 nd most common cause of cancer deaths in women, following
More informationPart I. An Introduction to Cancer
Part I An Introduction to Cancer 2 Chapter 1 Cancer: Descriptive Overview Cancer is a disease in which cells propagate uncontrollably. These cells can come from many different parts of the body and the
More informationUltrasound-Guided Fine-Needle Aspiration of Thyroid Nodules: New events
Ultrasound-Guided Fine-Needle Aspiration of Thyroid Nodules: New events Sandrine Rorive, M.D., PhD. Erasme Hospital - Université Libre de Bruxelles (ULB) INTRODUCTION The assessment of thyroid nodules
More informationTreatment of EGFR mutant advanced NSCLC
Treatment of EGFR mutant advanced NSCLC Raffaele Califano Department of Medical Oncology The Christie and Manchester University Hospital Manchester, UK Outline Data on first-line Overcoming T790M mutation
More informationApplying Genomics to Cancer 21 st September The Frequency of EGFR mutations in Lung Adenocarcinoma: The Cardiff Experience
Applying Genomics to Cancer 21 st September 2015 The Frequency of EGFR mutations in Lung Adenocarcinoma: The Cardiff Experience Aled Daniels R Butler, R Attanoos, H Davies University Hospital of Wales
More informationEGFR EGFR-TKI CSPOR LC-2
EGFR EGFR-TKI CSPOR LC-2 Background Although NSCLC with activating EGFR mutation is generally sensitive to EGFR-TKI, such as gefitinib or erlotinib, acquired resistance is eventually seen. In the prospective
More informationOverview of Cancer. Mylene Freires Advanced Nurse Practitioner, Haematology
Overview of Cancer Mylene Freires Advanced Nurse Practitioner, Haematology Aim of the Presentation Review basic concepts of cancer Gain some understanding of the socio-economic impact of cancer Order of
More informationCitation Acta Medica Nagasakiensia. 1992, 37
NAOSITE: Nagasaki University's Ac Title Author(s) A Study on the Expression of EGFR a Content in the Stomach Cancer Tissu Nakazaki Takayuki Citation Acta Medica Nagasakiensia. 1992 37 Issue Date 1992-12-25
More informationStage 4 breast cancer life expectancy
P ford residence southampton, ny Stage 4 breast cancer life expectancy Breast cancer life expectancy depends on the stage of breast cancer, presence of metastasis, immune system of a person and the preferred
More informationAssociation of mutant EGFR L858R and exon 19 concentration in circulating cell-free DNA using droplet digital PCR with response to EGFR-TKIs in NSCLC
ONCOLOGY LETTERS 14: 2573-2579, 2017 Association of mutant EGFR L858R and exon 19 concentration in circulating cell-free DNA using droplet digital PCR with response to EGFR-TKIs in NSCLC YAN JUAN ZHU 1,
More informationApplications of IHC. Determination of the primary site in metastatic tumors of unknown origin
Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification
More informationCDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationTumor DNA circulating in the plasma might play a role in metastasis. The hypothesis of the genometastasis
Histol Histopathol (1 999) 14: 1 159-1 164 http://www.ehu.es/histol-histopathol Histology and Histopathology Tumor DNA circulating in the plasma might play a role in metastasis. The hypothesis of the genometastasis
More informationSpectrum Pharmaceuticals
Spectrum Pharmaceuticals Joe Turgeon President and CEO June 2018 Investor Presentation 1 Safe Harbor Statement This presentation contains forward looking statements regarding future events and the future
More informationQIAGEN Complete Solutions for Liquid Biopsy Molecular Testing
QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy
More informationECMC cfdna consensus meeting
ECMC cfdna consensus meeting State of the art for cfdna technologies 24 th November 2014 Applications of ctdna analysis for drug development Potential of ctdna analysis to: Identify the right patients
More informationA Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications
A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication
More informationRenal Cell Cancer. Clinical case study 1 & 2. Petri Bono MD PhD Helsinki University Hospital Helsinki, Finland
Renal Cell Cancer Clinical case study 1 & 2 Petri Bono MD PhD Helsinki University Hospital Helsinki, Finland 1 Case study 1 - RCC and Lung Metastases Case study 1: Patient History Male, 63 years old Mild
More informationMengxi Ge 1, Qiong Zhan 1, Zhenzhen Zhang 2, Xiaoyu Ji 1, Xinli Zhou 1, Ruofan Huang 1* and Xiaohua Liang 1*
Ge et al. BMC Cancer (2019) 19:143 https://doi.org/10.1186/s12885-019-5348-3 RESEARCH ARTICLE Different next-generation sequencing pipelines based detection of tumor DNA in cerebrospinal fluid of lung
More informationEmerging Algorithm for Optimal Sequencing of EGFR TKIs in EGFR Mutation Positive NSCLC
Emerging Algorithm for Optimal Sequencing of EGFR TKIs in EGFR Mutation Positive NSCLC Keunchil Park, MD, PhD Samsung Medical Center, Sungkyunkwan University School of Medicine Faculty Disclosure Consulting
More informationManagement of carcinomatous meningitis in a patient with advanced lung adenocarcinoma
Management of carcinomatous meningitis in a patient with advanced lung adenocarcinoma Clinical Case Presentation Emilie Le Rhun Centre Hospitalier Régional et Universitaire (CHRU) de Lille Neurochirurgie
More informationMammaPrint, the story of the 70-gene profile
MammaPrint, the story of the 70-gene profile René Bernards Professor of Molecular Carcinogenesis The Netherlands Cancer Institute Amsterdam Chief Scientific Officer Agendia Amsterdam The breast cancer
More informationPROGRESSION AFTER THIRD GENERATION TKI
PROGRESSION AFTER THIRD GENERATION TKI What next? National Cancer Center Hospital Yuichiro Ohe, MD Name of lead presenter Yuichiro Ohe employee of company and/or profit-making organization adviser of company
More informationOptimum Sequencing of EGFR targeted therapy in NSCLC. Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey
Optimum Sequencing of EGFR targeted therapy in NSCLC Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey Lung cancer NSCLC SCLC adeno squamous EGFR ALK ROS1 BRAF HER2 KRAS EGFR Transl Lung Cancer
More informationSleeve lobectomy for lung adenocarcinoma treated with neoadjuvant afatinib
Case Report Sleeve lobectomy for lung adenocarcinoma treated with neoadjuvant afatinib Ichiro Sakanoue 1, Hiroshi Hamakawa 1, Reiko Kaji 2, Yukihiro Imai 3, Nobuyuki Katakami 2, Yutaka Takahashi 1 1 Department
More informationLa biopsia liquida dei tumori: il viaggio. Paola Gazzaniga Liquid Biopsy Unit Dept. Molecular Medicine Sapienza University of Rome
La biopsia liquida dei tumori: il viaggio Paola Gazzaniga Liquid Biopsy Unit Dept. Molecular Medicine Sapienza University of Rome Must Know Necessary Travel Tips There is lack of drugs to treat all the
More information