Avenaciolides: Potential MurA-Targeted Inhibitors Against. Peptidoglycan Biosynthesis in Methicillin-Resistant

Transcription

1 SUPPLEMENTARY INFORMATION FOR: Avenaciolides: Potential MurA-Targeted Inhibitors Against Peptidoglycan Biosynthesis in Methicillin-Resistant Staphylococcus aureus (MRSA) Ching-Ming Chang,,, Jeffy Chern,,, Ming-Yi Chen, Kai-Fa Huang, Yu-Liang Yang, and Shih-Hsiung Wu *,,,. Chein-Hung Chen, # Institute of Biological Chemistry, Chemical Biology and Molecular Biophysics Program, Taiwan International Graduate Program, # Genomics Research Center, Academia Sinica, and Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan Institute of Biochemical Sciences, Department of Chemistry, National Taiwan University, Taipei 10617, Taiwan General Education Center, National Taipei University of Nursing and Health Sciences, Taipei 112, Taiwan *To whom correspondence should be addressed: Shih-Hsiung Wu, PhD, Tel: , Ext. 7101; Fax: , shwu@gate.sinica.edu.tw S1

2 Supplementary Notes Supplemental Experiment 4-9 Structure elucidation of avenaciolides Reference 52 Supplemental Table TABLE OF CONTENTS Table S1 The comparison chemical shifts of positions 3, 4 and 7 in 1-3 and neosartolactone 19 Table S2 Physico-chemical properties of avenaciolides Table S3 1 H (500 MHz) and 13 C NMR (125 MHz) Data of 1 and 2 in CDCl 3 21 Table S4 1 H (500 MHz) and 13 C NMR (125 MHz) Data of 3 and 4 in CDCl 3 22 Table S5 Annotations of MS/MS spectrum for 1-modified peptide 35 Table S6 Annotations of MS/MS spectrum for 2-modified peptide 36 Table S7 Annotations of MS/MS spectrum for 3-modified peptide 37 Supplemental Scheme TABLE OF CONTENTS Page Scheme S1 Reaction of 1-3 towards L- cysteine and glutathione (GSH) 27 Supplemental Figures TABLE OF CONTENTS Page Figure S1 Key 1 H- 1 H COSY, HMBC, and NOSEY of 1 11 Figure S2 Key 1 H- 1 H COSY, HMBC, and NOSEY of 4 13 Figure S3 Key 1 H- 1 H COSY, HMBC, and NOSEY of 3 15 Figure S4 Key 1 H- 1 H COSY, HMBC, and NOSEY of 2 17 Figure S5 The structures of a) neosartolactone in 2010 and b) revised neosartolactone. 18 Figure S6 TEM without thin section of B. subtilis (a-e), and E. coli (f-j) 23 Figure S7 Characterization of MRSA MurA activity by 31 P NMR. 24 Figure S8 Inhibition zones of fosfomycin-resistant E. coli and vector-only control in disk diffusion assay 25 Figure S9 Sequence Aligment results of S. aureus ATCC33592 (MRSA) 26 Figure S10 MS (a) and MS/MS (b) analyses of 1-3 reaction with L-cysteine 28 S2

3 Figure S11 (a-c)the MS-MS fragmentation patterns and structures of products 1-3 in scheme S Figure S12 MS (a) and MS/MS (b) analyses of 1-3 reaction with GSH 31 Figure S13 (a-c) The MS-MS fragmentation patterns and structures of products 4-6 in scheme S Figure S14a The MS/MS spectrum of enzyme digested 1 modified peptide 35 Figure S14b The MS/MS spectrum of enzyme digested 2 modified peptide 36 Figure S14c The MS/MS spectrum of enzyme digested 3 modified peptide 37 Figure S15 The proposed mechanism of the MRSA MurA C119D and MurA WT. 38 Figure S16 The stereo figures of MurA WT -2 and MurA C119D -2 structures 39 Figure S17 1 H NMR (500 MHz, CDCl 3 ) of 1 40 Figure S18 13 C NMR (125 MHz, CDCl 3 ) of 1 40 Figure S19 1 H- 1 H COSY spectrum of 1 41 Figure S20 2D HSQC (500 MHz, CDCl 3 ) of 1 41 Figure S21 2D HMBC (500 MHz, CDCl 3 ) of 1 42 Figure S22 2D NOESY (500 MHz, CDCl 3 ) of 1 42 Figure S23 1 H NMR (500 MHz, CDCl 3 ) of 2 43 Figure S24 13 C NMR (125 MHz, CDCl 3 ) of 2 43 Figure S25 1 H- 1 H COSY spectrum of 2 44 Figure S26 2D HSQC (500 MHz, CDCl 3 ) of 2 44 Figure S27 2D HMBC (500 MHz, CDCl 3 ) of 2 45 Figure S28 2D NOESY (500 MHz, CDCl 3 ) of 2 45 Figure S29 1 H NMR (500 MHz, CDCl 3 ) of 3 46 Figure S30 13 C NMR (125 MHz, CDCl 3 ) of 3 46 Figure S31 1 H- 1 H COSY spectrum of 3 47 Figure S32 2D HSQC (500 MHz, CDCl 3 ) of 3 47 Figure S33 2D HMBC (500 MHz, CDCl 3 ) of 3 48 Figure S34 2D NOESY (500 MHz, CDCl 3 ) of 3 48 Figure S35 1 H NMR (500 MHz, CDCl 3 ) of 4 49 Figure S36 13 C NMR (125 MHz, CDCl 3 ) of 4 49 Figure S37 1 H- 1 H COSY spectrum of 4 50 Figure S38 2D HSQC (500 MHz, CDCl 3 ) of 4 50 Figure S39 2D HMBC (500 MHz, CDCl 3 ) of 4 51 Figure S40 2D NOESY (500 MHz, CDCl 3 ) of 4 51 S3

4 Supplemental Experiment General Methods Optical rotations were measured on a JASCO P2000 automatic polarimeter. UV data were measured with a Hewlett Packard 8452A diode array spectrophotometer. IR spectra were measured on a Thermo Nicolet is5 FT-IR spectrometer. NMR data were obtained on a Bruker LC-SPE-NMR AVII 500MHz spectrometer. Electrospray-ionization mass spectrometry data were collected on an Agilent 6538 high-mass-resolution Q-TOF mass spectrometer. The mass spectrometry data of bioactive fractions were collected on a Bruker autoflex speed MALDI TOF/TOF. Strain Information Neosartorya fischeri was isolated in Hualien, Taiwan. The Neosartorya fischeri, a common environmental fungus belonging to the Aspergillus subgenus Fumigati subgroup Fumigati, is one of the most frequently reported heat-resistant moulds causing spoilage in fruit products, which is also described as cause of human aspergillosis. 1,2 The isolated fungal was cultured on MEA (Malt Extract Agar DIFCO) supplemented with 100μg ml -1 chloramphenicol (Sigma) for 7 days at room temperature prior to DNA extraction. The DNA extraction and PCR Amplification of 18S rdna procedure was adopted from the method of Plaza et al. 3 The primers for the reactions were as follows: forward primer: NS1 (GTAGTCATATGCTTGTCTC) and reverse primer: ITS4 S4

5 (TCCTCCGCTTATTGATATGC). Localization of the primers to fungal rdna was presented as followed. MS1-18S-ITS4 gene sequence of Neosartorya fischeri GGGGATTTCGTAGTTCCTATCCGGTCTGTGATCCTGAAACTGCGAATGGCTCATTAAATC AGTTATCGTTTATTTGATAGTACCTTACTACATGGATACCTGTGGTAATTCTAGAGCTAATA CATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCT TCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATG GTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTGG CAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTAC CACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGT GACAATAAATACTGATACGGGGCTCTTTTGGGTCTCGTAATTGGAATGAGTACAATCTAA ATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCC AGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGT CTGGCTGGCCGGTCCGCCTCACCGCGAGTACTGGTCCGGCTGGACCTTTCCTTCTGGGG AACCTCATGGCCTTCACTGGCTGTGGGGGGAACCAGGACTTTTACTGTGAAAAAATTAG AGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTG CGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCG TCAGTATTCAGCTGTCAGAGGTGAAATTCTTGGATTTGCTGAAGACTAACTACTGCGAA AGCATTCGCCAAGGATGTTTTCATTAATCAGGGAACGAAAGTTAGGGGATCGAAGACGA TCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGGTGTTTCT ATGATGACCCGCTCGGCACCTTACGAGAAATCAAA S5

6 Isolation and Purification of avenaciolides 1-4 Extraction and isolation The fresh Neosartorya fischeri was grown on the medium of Potato Dextrose Agar (PDA) for 400 plates which was cultured under 25 C for 30 days. A total of 400 plates of fungi cultures were used for extraction. The solid medium was cut into small pieces and was further soaked in ethyl acetate (EtOAc) for one day at room temperature. The EtOAc extract was evaporated under reduced pressure to yield brown syrup. This procedure was repeated for twice. The combined EtOAc extract (3.2 g) was partitioned with MeOH and n-hexane to give the MeOH (2.5 g) and n-hexane layers (0.6 g). The MeOH layer was further separated into 11 fractions by column chromatography (Sephadex LH-20) eluted by MeOH. Fraction 11(1 g, active against S. aureus) was separated by silica gel column chromatography eluted with a gradient system of n-hexane, and EtOAc (n-hexane and EtOAc =20:1 to 4: 1) to give eight sub-fractions. Fr.2~4 was further purified by normal-phase high performance liquid chromatography (Hypersil-100 silica, mm; Thermo Electron Corporation) with n-hexane: EtOAc (3:1, v/v) to give 1 (70 mg, Rt 27 min), 2 (60 mg, Rt 24.4 min), 3 (70 mg, Rt 19.5 min), and 4 (35 mg, Rt 29 min). Mosher s esters of 2 and 3 The Mosher s esters of 2/3 were obtained by using a modification of the Mosher s method. 4 To a CH 2 Cl 2 solution of 2 (1.0 mg) was added 4-dimethylaminopyridine (100 µg), triethylamine S6

7 (10 µl) and (S)-(+)-MTPACl (10 µl)/(r)-( )-MTPACl (10 µl) (Sigma-Aldrich Chemical Co.) at room temperature, and stirring was continued overnight. After addition of N,N-dimethyl-1,3-propanediamine (5 µl) and evaporation of the solvent, the residue was passed through a silica gel column (n-hexane/etoac, 4: 1) to afford the (R)- (2a, 0.9 mg) and (S)-MTPA (2b, 0.5 mg) esters of 2, respectively. Expression MRSA MurA WT and MRSA MurA C119D of Staphylococcus aureus strain ATCC and E. coli K12 BW MRSA (S. aureus ATCC33592) MurA and E. coli K12 MurA were expressed as the fusion proteins to the amino terminus of hexahistidine (His 6 ) as follows. The DNA fragments were amplified from S. aureus (MRSA) using Phusion (NEB, Woburn, MA) and primers of S. aureus (5 -CGGAATTCATGGATAAATAGTAATCAA-3,5 -CCGCTCGAGTTAATCGTTAATACGT TCAA-3 ) and E.coli K12 (5 -GGAATTCCATATGATGGATAAATTTCGTGTTCA-3, 5 - CCGCTCGAGTTA TTCGCCTTTCACACG -3 ). The resultant PCR fragments of S. aureus and E. coli mura were flanked by EcoRI and XhoI sites or NdeI and XhoI sites, respectively, which allowed their cloning in frame into the corresponding restriction sites of the pet28-a(+) (Novagen). Plasmids of mura and murb were transformed into BL21 (DE3). By using site-directed, ligase-independent mutagenesis (SLIM) 5, MRSA MurA C119D was S7

8 constructed using a plasmid containing the MRSA MurA WT as template in a multiplex PCR reaction using phusion DNA polymerase (Thermo). Designed forward and reverse primers are shown as follow: (Forward primers: CTGGTGGTGATGCAATTGGAAGTAGACCG and -GAAGTAGACCGATTGAGCAACAC; reverse primers: CAATTGCATCACCAC CAGGCAATGCAAC and GCAATGCAACAATAGCATGTCC (mutated residues were underlined)). The products of this reaction were first treated with DpnI (NEB) at 37 for 1 hr to eliminate template DNA and then heat-denatured, re-annealed and transformed into JM109. Plasmids from the resulting transformants were isolated and sequenced. A 100 ml overnight culture from a single colony supplemented by 25 g ml -1 kanamycin was used to inoculate 1 L LB (in a 2 L Hinton flask) with 25 g ml -1 kanamycin. Cultures were grown at 37 C to OD 600 of 0.5 and induction with 1 mm IPTG. Cultures were allowed to grow for additional 4 hours at 37 C. Cells were harvested by centrifugation at 9,000 g for 30 min at 4 C. Pellets were resuspended in 40 ml resuspension buffer (20 mm Tris-HCl ph 8, 500 mm NaCl, 20 mm imidazole). After freeze-thaw, all lysis were performed by ultrasonication on ice. Cell debris was removed by centrifugation at 20,000 g for 30 min at 4 C. The His-tagged proteins were then applied to 5 ml nickel-nitrilotriacetic acid (Ni 2+ -NTA) column (Sepharose 6 Fast Flow resin, GE Healthcare, USA; Econo-Pac column, BioRad, USA), and washed with 30 volumes resuspension buffer. Proteins were eluted with 5 volumes of the same buffer with 200 mm imidazole. Given S8

9 proteins were collected and concentrated using Amicon Ultra-15 (Millipore, USA). Disk diffusion assay for detecting resistance to fosfomycin and 2 Antimicrobial susceptibility was tested by the agar disk diffusion method on Luria broth agar (Becton Dickonson, Germany). The fosfomycin and 2 were tested in E. coli BL21 (DE3) harboring pet28a::murac115d plasmid and E. coli BL21 (DE3) (pet28a only). Disks were incubated for 12 h at 37 C. Inhibition zone for fosfomycin and 2 were noted then MICs were determined. Structure interpretation of avenaciolides 1-4 Using bioactivity-guided fractionation and isolation strategy, four avenaciolide derivatives (1-4; Figure 2) were determined and purified in this study. The physicochemical properties of 1-4 are summarized in Table S1-3, and Figure S1-4. In 1963, 1 was reported from Aspergillus avenaceus and had been identified as an anti-fungal lactone. 6 In 2010, 2 was reported as an anti-inflammatory inhibitor from Neosartorya sp. 7 Although 4 was obtained via the chemical modification of 1 from A. avenaceus, this is the first report to describe 4 from a natural resource with detailed spectroscopic interpretation. Furthermore, we found that the structure interpretation of 3 was different from that of neosartolactone reported by Sien-Sing Yang et al in Therefore, we have revised the structure of neosartolactone as 3 (Table S4), and the structure of neosartolactone were revised in Table S1. In summary, this is the first time that four avenaciolides 1-4 were discovered from Neosartorya sp. S9

10 The molecular formula of 1 was determined to be C 15 H 22 O 4 with five double bond equivalents (DBE) by HRESIMS ([M-H] - : m/z ). The strong UV absorption at 209 nm implied that 1 was functionalized with a -unsaturated carbonyl group. Its IR spectrum showed absorptions of two lactone carbonyls at 1787 and 1765 cm 1. The absorptions at 2925, 2855, and 1664 cm 1 were attributed to the olefinic group. In 1 H NMR, two olefinic protons were observed together with one allylic methine group, one secondary methyl group, two carbinol methine groups, and one aliphatic alkyl group. Analysis of the 1 H-, 13 C-NMR and HSQC spectra of 1 revealed one terminal methyl [δ H 0.89 (3H, t, J = 6.9 Hz, H 3-15) and δ C 14.1 (C-15)], alkyl chain signals [δ H (14H, m, CH 2-8 ~ CH 2-14) and δ C (C-8 ~ C-14)], the allylic methine [δ H 3.55 (1H, m, H-3) and δ C 44.2 (C-3)], two carbinol protons [δ H 4.43 (1H, m, H-6) and δ C 85.1 (C-6); δ H 5.05 (1H, d, J = 8.6 Hz, H-4) and δ C 74.3 (C-4)] and one exomethylene [δ H 5.87 (1H, d, J = 2.2 Hz, H-7a), 6.48 (1H, d, J = 2.5 Hz, H-7b) and δ C (C-7)] (Table S3). The COSY spectrum of 1 indicated the following spin systems: the proton at δ H 4.43 (1H, m, H-6) was coupled to the alkyl chain methylene at δ H 1.81 (2H, m, H 2-8). The resonance at δ H 4.43 (H-6) was also coupled to the methine at δ H 3.55 (1H, m, H-3), which was in turn coupled to the carbinol methine at δ H 5.05 (1H, d, J = 8.6 Hz, H-4). According to the HMBC spectrum of 1 (Figure S1), it suggested that acrolein group was attached at C-3 based on the correlations including: one exomethylene proton at δ H 5.87 (H-7a) correlated with C-1 (δ C 167.4), C-3 (δ C 44.2) and C-6 (δ C 85.1); the other exomethylene S10

11 proton δ H 6.48 (H-7b) correlated with C-1 (δ C 167.4), C-2 (δ C 134.6), and C-3 (δ C 44.2); and the carbinol proton at δ H 5.05 (H-4) correlated with C-1 (δ C 167.4) and C-6 (δ C 82.8). In addition, another carbinol proton at δ H 4.43 (H-6) correlated with C-2 (δ C 134.6), C-5 (δ C 169.7) indicated that a γ-lactone moiety bearing an aliphatic substituent was attached at C-4. All above assignments were consistent with a γ-lactone moiety bearing an aliphatic substituent, and a -unsaturated carbonyl group (C-4, C-3 and C6), respectively. In the NOESY spectrum of 1, key correlations were detected as follows: H-3/H-7a, H-3/H-7b, H-3/H-4, H-3/H-8 and H-4/H-8 (Figure S1), which suggested the relative configurations of the alkyl chain attached at C-6, the acrolein attached at C-3 and the carbinol proton attached at C-4 were, respectively, at β, α and α orientations. Accordingly, c 1 was characterized as shown (Figure S1) and named as avenaciolide 1. a) b) Figure S1 Key 1 H- 1 H COSY, HMBC, and NOSEY of 1. a) 1 H- 1 H COSY (bold line) and Key HMBC (red arrow) Correlation of 1 b) Key NOSEY correlation of 1 S11

12 The molecular formula of 4 was elucidated to be C 15 H 24 O 4 with four double bond equivalents (DBE) by HRESIMS ([M] + : m/z ). The 4 possessed spectroscopic data closely comparable to those of 1 except that no unsaturated olefinic protons were observed in 1 H NMR. Furthermore, the IR spectrum showed no absorptions at 2925, 2855, and 1664 firmly confirming no unsaturated olefinic proton was in 4. In the 1 H NMR, two carbinol methine groups were observed together with one tertiary methyl group, two methine groups, and one alphatic alkyl group (Table S4). The COSY spectrum of 4 indicated the following spin systems: the proton at δ H 5.06 (1H, d, J = 8.2 Hz, H-4) was coupled to the methine proton at δ H 2.76 (1H, m, H-3), which was in turn coupled to the second methine proton at δ H 2.62 (1H, m, H-2). The resonance at δ H 2.62 (1H, m, H-2) was coupled with the tertiary methyl group δ H 1.42 (3H, d, J = 7.3 Hz, H 3-7). In addition, the proton at δ H 4.43 (1H, m, H-6) was also coupled to the methine proton at δ H 2.76 (1H, m, H-3) and alkyl chain methylene at δ H (2H, m, H 2-8) (Figure S2). According to the HMBC spectrum of 4 (Figure S2, Table S4), the methine group at δ H 2.62 (1H, m, H-2) correlated with C-1 (δ C 176.4), C-3 (δ C 48.0), C-6 (δ C 83.6), and C-7 (δ C 15.3). The other methine group at δ H 2.76 (1H, m, H-3) correlated with C-2 (δ C 39.2), C-5 (δ C 170.2) and C-2 (δ C 39.2) suggest that -methylated lactone was attached to C-3. In addition, the carbinol proton at δ H 5.06 (H-4) correlated with C-1 (δ C 76.4), C-2 (δ C 39.2), and C-6 (δ C 83.6), and another carbinol proton at δ H 4.43 (H-6) correlated with C-2 (δ C 39.2), and C-5 (δ C 170.2) indicated that one γ-lactone moiety bearing an aliphatic substituent S12

13 was attached at C-4. All above assignments were consistent with a γ-lactone moiety bearing an aliphatic substituent, and a -methyl carbonyl group (C-4, C-6 and C3), respectively. In the NOESY spectrum of 4, key correlations were detected as follows: H-3/H-7, H-3/H-4, H-3/H-6, H-3/H-8 and H-4/H-8 (Figure S2b), indicating that the relative configurations of the alkyl chain attached at C-6, the methyl group attached at C-2, the carbinoyl proton attached at C-4, and the methine proton at C-3 were, respectively, at β, α, α, and α orientations. Accordingly, 4 was characterized as shown (Figure S2) and named as reduced avenaciolide 4. a) b) Figure S2 Key 1 H- 1 H COSY, HMBC, and NOSEY of 4. a) 1 H- 1 H COSY (bold line) and Key HMBC (red arrow) Correlation of 4. b) Key NOSEY correlation of 4. The molecular formula of 3 was determined to be C 15 H 24 O 5 with four double bond equivalents (DBE) by HRESIMS ([M+Na] + : m/z ). The strong UV absorption at 203 nm implied that 3 was functionalized with a -unsaturated carbonyl group. Its IR spectrum showed absorptions of S13

14 two carbonyls at 1774 and 1705 cm 1, indicating the presence of a γ-lactone carbonyl moiety and an acid carbonyl functionality, respectively. The absorptions at 3348, 2926, 2855, and 1628 cm 1 attributed to the respective the hydroxyl group of acrylic acid and olefinic groups were also observed. Analysis of the 1 H-, 13 C-NMR and HSQC spectra of 3 revealed one terminal methyl [δ H 0.86 (3H, t, J = 6.9 Hz, H 3-15) and δ C 14.1 (C-15)], an alkyl chain signal [δ H (14H, m, H 2-8 ~ H 2 -H14) and δ C (C-8 ~ C-14)], one methine group [δ H 3.37 (1H, m, H-3) and δ C 46.8 (C-3)], two carbinol protons [δ H 4.56 (1H, m, H-6) and δ C 82.8 (C-6); δ H 4.66 (1H, d, J = 8.3 Hz, H-4) and δ C 68.9 (C-4)], and one exomethylene [δ H 5.79 (1H, s, H-7a), 6.51 (1H, s, H-7b) and δ C (C-7)] (Table S4). The COSY spectrum of 3 indicated the following spin systems: the proton at δ H 4.56 (1H, m, H-6) was coupled to the alkyl chain methylene at δ H 1.69 (2H, m, H 2-8). The resonance at δ H 4.56 (H-6) was also coupled to the methine at δ H 3.37 (1H, m, H-3), which was in turn coupled to the carbinol methine at δ H 4.66 (1H, d, J = 8.3 Hz, H-4). According to the HMBC spectrum of 3 (Figure S3a), the exomethylene protons at δ H 5.79 and 6.51 (H 2-7) correlated with C-1 (δ C 170.4), C-2 (δ C 135.1), C-3 (δ C 46.8) and C-4 (δ C 68.9), and the carbinol proton at δ H 4.66 (H-4) correlated with C-2 (δ C 135.1), C-3 (δ C 46.8), C-6 (δ C 82.8) and C-5 (δ C 176.9) indicated that -unsaturated carbonyl group was attached at C-3. In addition, the other carbinol proton at δ H 4.56 (H-6) correlated with C-2 (δ C 135.1), C-3 (δ C 46.8), C-4 (δ C 68.9), and C-5 (δ C 176.9) indicated that an acrylic acid residue was attached at C-3 because of the 3 J correlation between H-6 S14

15 with C-5. All above assignments were consistent with a γ-lactone moiety bearing an aliphatic substituent, an acrylic acid, and a hydroxy group at C-6, C-3 and C-4, respectively. In the NOESY spectrum of 3, key correlations were detected as follows: H-6/H-7a, H-3/H-8 and H-4/H-8 (Figure S3b), indicating that the relative configurations of the alkyl chain attached at C-6, the acrylic acid attached at C-3 and the hydroxy group attached at C-4 were, respectively, at β, α and α orientations. Accordingly, 3 was characterized as shown (Figure S3) and named as avenaciolide 3. a) b) Figure S3 Key 1 H- 1 H COSY, HMBC, and NOSEY of 3. a) 1 H- 1 H COSY (bold line) and Key HMBC (red arrow) Correlation of 3. b) Key NOSEY correlation of 3 The molecular formula of 2 was determined to be C 16 H 26 O 5 with four double bond equivalents (DBE) by HRESIMS ([M+Na] + : m/z ). The strong UV absorption at 213 nm implied that 2 was functionalized with a -unsaturated carbonyl group. Its IR spectrum showed absorptions of two carbonyls at 1779 and 1720 cm 1, indicating the presence of a γ-lactone carbonyl moiety and an acid carbonyl functionality, respectively. The absorptions at 3476, 2955, 2920, and 1632 cm 1 S15

16 attributed to the respective hydroxyl and olefinic groups were also observed. The 2 possessed spectroscopic data closely comparable to those of 3 except that the OH-1 functionality in 3 was replaced by a methoxyl group in 2. Its 1 H-NMR (Table S3) exhibited one signal for the methoxyl singlet at δ H 3.79 (3H, s, H 3-16) when compared with that of compound 3. In the HMBC spectrum of 2 (Figure S4), the methoxyl protons at δ H 3.79 (3H, s, H 3-16) correlated with C-1 (δ C 167.7), indicating the location of the methoxy group was at C-1. Accordingly, compound 2 was characterized as shown (Scheme 1) and named as avenaciolide ester. The absolute configurations at C-6, C-3 and C-4 of 2 were elucidated using a modified Mosher s method. Compound 2 was treated with (S)-(+)- and (R)-( )-MTPACl to afford the (R)- and (S)-MTPA esters. The Δδ values obtained from the 1 H chemical shifts of both Mosher s esters and shown in Figure S4c. The Δδ values of the H 2-8, H-6, H-3, Ha-7 and Hb-7 are all positive in sign. Thus, the absolute configurations of C-6, C-3 and C-4 were determined to be R, S and R, respectively. S16

17 a) b) c) Figure S4 Key 1 H- 1 H COSY, HMBC, and NOSEY of compound 2. a) 1 H- 1 H COSY (bold line) and Key HMBC (red arrow) correlation of compound 2. b) Key NOSEY correlation of compound 2. c) values (ppm) recorded for the MTPA ester of compound 2. The structure of neosartolactone 7 was revised to an another structure (Figure S5). The neosartolactone possessed spectroscopic data closely similar to those of 3; however there were some different characteristics of the 1 H and 13 C NMR spectra indicating they are two distinct structures. There were three spin systems which revealed the two structures might have different skeleton of -unsaturated -lactone ring for 3 and neosartolactone. First, the methine group [δ H 3.55 (1H, m, H-3) and δ C 44 (C-3)] of the neosartolactone and 1 had the same chemical shift (Table S4). Second, the chemical shifts of carbinol methine groups [δ H 5.05 (1H, d, J = 8.5~8.6 Hz, H-4) and δ C 74 (C-4)] of these two compounds were also similar to each other. Third, the exomethylene S17

18 protons of these two compounds are all doublet. Moreover, the three spin systems (methine group, carbinol methine group, and exomethylene group) of the 2 and 3 represented another kind of skeleton for opening ring of -unsaturated -lactone due to their similar chemical shifts of 1 H and 13 C NMR spectra (Table S1). According to the chemical shifts of positions 3, 4, and 7 in 1-3 and neosartolactone (Table S1), the structure of neosartolactone was revised as shown in Figure S5. a) b) Figure S5 The structures of a) neosartolactone 7 in 2010 and b) revised neosartolactone. S18

19 position δ C δ H δ C δ H δ C δ H (1H, d, J=2.5 Hz) 44.2 d 3.55 (1H, m) d (1H, d, J=8.6Hz ) d 5.87 (1H, d, J=2.2 Hz) (1H, d, J=2.0 Hz) 44.1 d 3.55 (1H, m) 74.3 d (1H, d, J=8.5 Hz) t 6.46 (1H, d, J=2.0 Hz) neosartolactone (1H, s) 47.1 d 3.39 (1H, m) 68.9 d (1H, d, J=8.3 Hz) d 5.74 (1H, s) (1H, s) 46.8 d 3.37 (1H, m) 68.9 d (1H, d, J=8.3 Hz) q 6.51 (1H, s) 3 Table S1 The comparison chemical shifts of positions 3, 4 and 7 in compounds 1-3 and neosartolactone S19

20 Avenaciolide 1 Avenaciolide 2 Avenaciolide 3 Avenaciolide 4 Appearance white sold white sold pale yellow sold pale oil [ ] 22 D (CHCl 3 ) (c =0.77 mg ml -1 ) (c =0.88 mg (c =0.69 mg (c= 1 mg ml -1 ) ml -1 ) ml -1 ) Molecular formula C 15 H 22 O 4 C 16 H 26 O 5 C 15 H 24 O 5 C 15 H 24 O 4 HR-ESI MS (m/z ) - C 15 H 21 O 4 C 16 H 26 O 5 Na + C 15 H 24 O 5 Na + + C 15 H 25 O 4 m/z (observed) Calcld IR , , (br) , , , , , , , , , , UV max nm ( ) (CHCl 3 ) Table S2. Physico-chemical properties of avenaciolides NO S20

21 Avenaciolide 1 Avenaciolide 2 position 1 2 δ C δ H (J in Hz) HMBC (H C) δ C δ H (J in Hz) HMBC (H C) s s s s d 3.55 (1H, m) 47.1 d 3.39 (1H, m) 1,3,4,5,6,7, d 5.05 (1H, d, J=8.6) 1, d 4.59 (1H, d, J=8.3) 2,5, s s d 4.43(1H, m) 2, d 4.52 (1H, m) 2,3,5, d 6.48 (1H, d, J=2.5) 1,2, d 6.42 (1H, s) 1,2, (1H, d, J=2.2) 1,3, (1H, s) 1,2, t 1.81 (2H, m) 3,6,9 35 t 1.68 (2H, m) 3,6,9, t 1.49 (2H, m) t 1.45 (1H, m) (1H, m) t 1.25~1.37 (2H, m) a 29.3 t 1.26~1.38 (2H, m) a t 1.25~1.37 (2H, m) a 29.2 t 1.26~1.38 (2H, m) a t 1.25~1.37 (2H, m) a 29.1 t 1.26~1.38 (2H, m) a t 1.25~1.37 (2H, m) a 31.8 t 1.26~1.38 (2H, m) a t 1.25~1.37 (2H, m) a 22.6 t 1.26~1.38 (2H, m) a q 0.89 (3H, t, J=6.9) 13, q 0.89 (3H, t, J=7.0) 13, q 3.79 (3H, t) 1 Table S3. 1 H (500 MHz) and 13 C NMR (125 MHz) Data of 1 and 2 in CDCl 3 [a] Signal overlapped S21

22 Avenaciolide 3 Avenaciolide 4 position 3 4 δ C δ H (J in Hz) HMBC (H C) δ C δ H (J in Hz) HMBC (H C) s s s 39.2 d 2.62 (1H, m) 1,3,6, d 3.37 (1H, m) 1,2,4,5,6,7,8 48 d 2.76 (1H, m) 2,5,7, d 4.66 (1H, d, J=8.3) 2,3,6, d 5.06 (1H, d, J=8.2) 1,2, s s d 4.56 (1H, m) 2,3,4,5, d 4.43 (1H, m) 2, q 5.79 (1H, s) 6.51 (1H, s) 1,2,3,4 1,2,3,4, 15.3 q 1.42 (3H, d, J=7.3 ) 1,2, t 1.69 (2H, m) 3,6,9, t 1.76 (1H, m) 3,6,9, t 1.47 (1H, m) 1.38 (1H, m) 1.69 (1H, m) t 1.48 (1H, m) 1.37 (1H, m) 2,3, t 1.26~1.38 (2H, m) a 29.2 t 1.29~1.41 (2H, m) a t 1.26~1.38 (2H, m) a 29.1 t 1.29~1.41 (2H, m) a t 1.26~1.38 (2H, m) a 29.1 t 1.29~1.41 (2H, m) a t 1.26~1.38 (2H, m) a 31.7 t 1.29~1.41 (2H, m) a t 1.26~1.38 (2H, m) a 22.6 t 1.29~1.41 (2H, m) a q 0.86 (3H, t, J=6.9) 13, q 0.92 (3H, t, J=6.9) 13, 14 Table S4. 1 H (500 MHz) and 13 C NMR (125 MHz) Data of 3 and 4 in CDCl 3 [a] Signal overlapped S22

23 Figure S6 TEM without thin section of B. subtilis (a-e), and E. coli (f-j). (a and f) TEM micrographs of untreated B. subtilis, and E. Coli. The healthh cells are round and intact, with a well-defined cell walls (CW) and cell membranes (CM) for B. subtilis and visible and smooth as continuous structures of inner membranes (IM), cell walls (CW) and outer membranes (OM) for E. coli. After incubation with a 128 g ml -1 of 1 (b and g) and 2 (c and h) ), cell wall breakage and variability in wall thickness were observed after one hour. (d) strong cell wall breakage were also observed after treating 128 gg ml -1 3 for one hour in B. subtilis but not in E. coli i). (e and j) 4 showed no effect on cell morphology. S23

24 Figure S7 Characterization of MRSA MurA activity by 31 P NMR. The MRSA MurA (3.68 M) was incubated with UNAG (600 M) and PEP (800 M) in 50 mm HEPES PH 7.5 at 37 C for 48 hrs. a-c) After 1, 24, and 48 hours, the Pi signals increased in a time-dependent manner. d) The signals of two substrates (UNAG and PEP) without adding MRSA MurA as reference in 31 P NMR spectrum S24

25 Figure S8 Inhibition zones of fosfomycin-resistant E. coli and vector-only control in disk diffusion assay. a) Inhibition zones of fosfomycin-resistant mimic strain (BL21 (DE3) containing pet28a:mura C115D ). The MICs for 2 is about 2 g and for fosfomycin is much larger than 128 g. b) Inhibition zone of vector only controls. The MIC for 2 is about 16 g and for fosfomycin is much larger than 2 g. S25

26 Figure S9 a) Sequence Aligment results of S. aureus ATCC Amino acid sequence comparison. Multiple sequence alignment of highly conserved residues (from CLUSTALW output) is highlighted in dark gray color. Essential active site residues are highlighted in red circle. b) Identities of aligment results. The sequence identities of S. aureus (MRSA) with all the other species are about 45~49 %. S26

27 1. Scheme S1 Reaction of 1-3 towards cysteine and glutathione (GSH) All compounds were attacked by thiol group in both L-cysteine and GSH through 1,4 Michael addition to form the final product 1-6 in 5 min. The crude reaction solution was then directly analyzed in MS spectrometry analysis (Figure S8 and S10). S27

28 a) b) Figure S10. MS (a) and MS/MS (b) analyses of 1-3 reaction with L-cysteine. a) ESI-MS spectra. b) CID spectra of indicated parent ions. The MS-MS fragmentation patterns and structures were elucidated in Figure S11 (a-c). S28

29 a) b) Figure S11 a) The MS-MS fragmentation patterns and structures of product 1 in Scheme S1 Figure S11 b) The MS-MS fragmentation patterns and structures of product 2 in Scheme S1 S29

30 c) Figure S11 c) The MS-MS fragmentation patterns and structures of product 3 in scheme S1 S30

31 a) b) Figure S12 MS (a) and MS/MS (b) analyses of 1-3 reaction with GSH. a) ESI-MS spectra. b) CID spectra of MS/MS indicated parent ions. The MS-MS fragmentation patterns and structures were elucidated in Figure S13 (a-c). S31

32 a) Figure S13 a)the MS-MS fragmentation patterns and structures of product 4 in Scheme S1 S32

33 b) Figure S13 b)the MS-MS fragmentation patterns and structures of product 5 in Scheme S1 S33

34 c) Figure S13 c) The MS-MS fragmentation patterns and structures of product 6 in scheme S1. S34

35 a) Figure S14a The MS/MS spectrum of enzyme digested 1 modified peptide. ion Calc. mass Obs.Ion Obs.Mass Error (ppm) ion Calc. mass Obs.Ion Obs.Mass Error (ppm) b y b y b y b y b y b y b y b y y y y y y Table S5. Annotations of MS/MS spectrum for 1-modified peptide. S35

36 b) Figure S14b The MS/MS spectrum of enzyme digested 2 modified peptide. ion Calc. mass Obs.Ion Obs.Mass Error (ppm) ion Calc. mass Obs.Ion Obs.Mass Error (ppm) b y b y b y b y b y b y b y b y b y y y y y y Table S6. Annotations of MS/MS spectrum for 2-modified peptide. S36

37 c) Figure S14c The MS/MS spectrum of enzyme digested 3 modified peptide. ion Calc. mass Obs.Ion Obs.Mass Error (ppm) ion Calc. mass Obs.Ion Obs.Mass Error (ppm) b y b y b y b y b y b y y y Table S7. Annotations of MS/MS spectrum for 3-modified peptide. S37

38 Figure S15 The proposed mechanism of the MRSA MurA C119D and MurA WT. S38

39 Figure S16 The stereo figures of MurA WT -2 and MurA C119D -2 structures. S39

40 Figure S17 1 H NMR (500 MHz, CDCl 3 ) of 1 Figure S18 13 C NMR (125 MHz, CDCl 3 ) of 1 S40

41 Figure S19 1 H- 1 H COSY spectrum of 1 Figure S20 2D HSQC (500 MHz, CDCl 3 ) of 1 S41

42 Figure S21 2D HMBC (500 MHz, CDCl 3 ) of 1 Figure S22 2D NOESY (500 MHz, CDCl 3 ) of 1 S42

43 Figure S23 1 H NMR (500 MHz, CDCl 3 ) of 2 Figure S24 13 C NMR (125 MHz, CDCl 3 ) of 2 S43

44 Figure S25 1 H- 1 H COSY spectrum of 2 Figure S26 2D HSQC (500 MHz, CDCl 3 ) of 2 S44

45 Figure S27 2D HMBC (500 MHz, CDCl 3 ) of 2 Figure S28 2D NOESY (500 MHz, CDCl 3 ) of 2 S45

46 Figure S29 1 H NMR (500 MHz, CDCl 3 ) of 3 Figure S30 13 C NMR (125 MHz, CDCl 3 ) of 3 S46

47 Figure S31 1 H- 1 H COSY spectrum of 3 Figure S32 2D HSQC (500 MHz, CDCl 3 ) of 3 S47

48 Figure S33 2D HMBC (500 MHz, CDCl 3 ) of 3 Figure S34 2D NOESY (500 MHz, CDCl 3 ) of 3 S48

49 Figure S35 1 H NMR (500 MHz, CDCl 3 ) of 4 Figure S36 13 C NMR (125 MHz, CDCl 3 ) of 4 S49

50 Figure S37 1 H- 1 H COSY spectrum of 4 Figure S38 2D HSQC (500 MHz, CDCl 3 ) of 4 S50

51 Figure S39 2D HMBC (500 MHz, CDCl 3 ) of 4 Figure S40 2D NOESY (500 MHz, CDCl 3 ) of 4 S51

52 (1) Girardin, H.; Monod, M.; Latgé, J. P. Appl. Environ. Microbiol. 1995, 61, (2) Samson, R. A.; Hong, S.; Peterson, S. W.; Frisvad, J. C.; Varga, J. Stud. Mycol. 2007, 59, 147. (3) Cox, J.; Mann, M. Nat. Biotech. 2008, 26, (4) Kubota, T.; Tsuda, M.; Kobayashi, J. i. Org. Lett. 2001, 3, (5) Chiu, J.; March, P. E.; Lee, R.; Tillett, D. Nucleic Acids Res. 2004, 32, e174. (6) Brookes, D.; Tidd, B. K.; Turner, W. B. J. Chem. Soc. (Resumed) 1963, 0, (7) Yang, S.-S.; Wang, G.-J.; Cheng, K.-F.; Chen, C.-H.; Ju, Y.-M.; Tsau, Y.-J.; Lee, T.-H. Planta. Med. 2010, 76, S52