The Genetic, Molecular and Biochemical Basis of Fungal Tropolone Biosynthesis

Transcription

1 The Genetic, Molecular and Biochemical Basis of Fungal Tropolone Biosynthesis Jack Davison, a Ahmed al-fahad, a Menghao Cai, c Zhongshu Song, a Samar Yehia, d Colin Lazarus, b Andrew M. Bailey, b Thomas J. Simpson a and Russell J. Cox. a * a University of Bristol, School of Chemistry, Cantock's Close, Bristol, BS8 1TS, UK. b University of Bristol, School of Biological Sciences, Woodland Road, Bristol, BS8 1UG. c State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Meilong Road 130, Shanghai , China d Future University in Egypt, FUE, Faculty of Pharmaceutical Sciences & Pharmaceutical industries, New Cairo, Egypt, Identification of the candidate tropolone gene cluster by Bioinformatic analysis of PKS genes in T. stipitatus. 2. Gene analysis of the tropa-d genes - alignments etc. 3. Knockout procedures for tropa-d - annotated LCMS traces vs controls. 3.1 KO procedures 3.2 LCMS chromatograms for T. stipitatus ΔtropB. 3.3 LCMS chromatograms for T. stipitatus ΔtropC. 3.4 LCMS chromatograms for T. stipitatus ΔtropD. 4. Expression of tropa. 4.1 Construction of Tspks1 expression vectors. 4.2 Yeast recombination. 4.3 Fungal transformation, fermentation of transformants and extraction Transformation into Aspergillus oryzae Fermentation of transformants and extraction. 4.4 LCMS analysis of transformants. 4.5 Media and Solutions Fluorescence and products from the transformants LC-MS chromatograms of extract of A. oryzae ptaex3gs-tspks1-egfp. 5. Isolation and full characterisation for compounds 3, 8, 9, 10, 11, 12, 13, 14, 15, Mass-directed purification. 5.2 Compound Characterization. 6. cif files for 3, 12, Cloning procedures for tropb-d. Expression, protein purification, assay conditions, annotated LCMS traces of assays vs controls. 7.1 Cloning and protein purification 7.2 In vitro assays of TropB (tsl1) 7.3 In vitro assays of TropC (tsr5) 8. Bioinformatic Discussion and Analysis of CtnB. 9. Absolute Stereochemistry of Leptosphaerone A. 10. References.

2 1. Identification of the candidate tropolone gene cluster by Bioinformatic analysis of PKS genes in T. stipitatus. The translated amino acid sequence of aspks1 from Acremonium strictum (CAN ) was used as the query in a BlastP search against the NCBI database of non-redundant protein sequences from Talaromyces stipitatus ATCC Domain structure of all hits was determined by searching against the conserved domain database hosted at NCBI (1). Figure S1.1 Distance tree of PKS genes found in T. stipitatus genome, annotated with domain structure and gene locus. Domains in parentheses are only present in some members of the clade.

3 In total 39 PKS genes were identified in the T. stipitatus genome, which separated into two clades reducing (22 genes, including 3 which were predicted to encode pks-nrps fusion proteins containing an N-terminal C-A-T-R domain motif) and non-reducing (17 genes). Within the non-reducing clade a sub-clade was identified, of which MOS was a member, with the domain structure KS-AT-ACP- CMeT-R. T. stipitatus genes TSTA_001920, TSTA_061710, TSTA_ and TSTA_ comprised this subclade. Of these, TSTA_ and TSTA_ were found clustered near to another pks (TSTA_ and TSTA_ respectively), while TSTA_ was clustered with a putative fatty acid synthase (TSTA_061440). Biosynthesis of stipitatic acid was not expected to involve incorporation of multiple PKS products or fatty acid products, so TSTA_ was the most likely candidate to control biosynthesis of stipitatic acid and was named tspks1 (= tropa). 2. Gene analysis of the tropa-d genes. TropA Domain Predicted Boundaries Conserved Active Site Motif ref SAT V 13 V 270 G 142 XCXG 146 active site cysteine 2 KS G 380 Q 796 T 543 (A/G)CXX(G/S) 548 active site cysteine 3 MAT F 903 A 1218 G 986 HSXG 990 active site serine 4 PT A P 1641 H 1318 X 9 (T/P) 1334 / D 1509 X 3 (H/Q)X 6 N 1520 active site residues ACP-1 L L 1723 G 1688 XDSL 1692 phosphopantetheine attachment site ACP-2 L L 1833 G 1798 XDSL 1802 phosphopantetheine attachment site CMeT L G 2225 G 2077 XGXG 2081 S-adenosylmethionine binding 7 R T V 2588 G 2294 XXGXXG 2300 Rossmann fold [NAD(P) binding] Y 2458 XXXK 2462 active site residues 8 Table S2.1. Domain analysis of the TropA amino acid sequence. Domain boundaries were predicted by alignment with type II enzymes or with excised & characterised type I domains, except R domain where no such characterised enzymes exist. In this case, alignment was made with the N-terminal sequence of enzymes known to release aldehyde products from enzyme-bound thiolesters.

4

5 Analysis of Tailoring Enzymes Protein TropB Closest Characterised Homologue (% sim / % id) Pseudomonas putida NahG Salicylate hydroxylase 8 (47.3 / 31.6) Best Conserved Domain Database Hits (E-Value) Adenine Dinucleotide binding Rossmann-Fold Superfamily cl09931 ( ) Active site motif (V/I) 18 GXGXXGXXX(A/G) 28 Rossmann fold dflvg 175 adgihsxvr 184 conserved among flavoprotein hydroxylases ref 9, 10, 11 TropC TropD Arabidopsis thaliana GA2ox1 Gibberellin 2-hydroxylase (43.2 / 28.3) Nectria haematococca CYP57A1 Pisatin demethylase (50.4 / 31.5) 2OG-Fe(II) Oxygenase Superfamily pfam03171 ( ) P450 Superfamily cl12078 ( ) H 210 XD H 269 iron-binding facial triad R 278 XS 280 carboxylate (2-OG) binding E 369 XXR 372 conserved structural motif F 447 XXGXXXCXG 456 iron-binding cysteine 12, 13 14, 15 Table S2.2. Bioinformatic analysis of T. stipitatus TropB-D amino acid sequences.

6 3 Knockout procedures for tropa-d. 3.1 KO procedures. Genomic DNA of T. stipitatus was isolated using a GenElute Plant Genomic DNA Miniprep kit (SIGMA) and prepared for PCR-amplification. The split-marker strategy relies on three rounds of PCR for construction of the gene-knockout cassettes (16). In the first round of PCR the left and the right flanking regions, which were needed for homologous recombination (HR), were generated. Around 2 kb of the homologous DNA sequence of each flanking regions was sufficient for gene targeting. The left flanking sequence was amplified using unmodified forward primers and reverse primers which have a marker tail, whereas the right flanking regions were generated with forward primers having a marker tail and unmodified reverse primers. The oligonucleotides used for the amplification of all homologous areas are listed in table S3.1. For splitting a resistance marker, a plasmid pbleamygsa2 containing the P gpda promoter, bleomycin gene and T trpc terminator was used as a template for amplification two pieces of DNA named 5 Ble and 3 Ble. The two fragments have a 462 bp overlap area at the bleomycin-resistance gene. The amplification of 5 Ble was done using a primer upstream 5 ble-f and a primer downstream 5 ble-r. The 3 Ble fragment was also generated using primers 3 ble-f and 3Ble-R (table S3.1). The next round of PCR was for constructing the gene-disruption cassettes using fusion PCR. The left homologous regions was linked to 5 Ble by mixing about 15 ng of each fragment in a 50 µl PCR reaction with the left homologous region forward primer and 5 ble-r. Similarly, the right homologous region was joined to 3 Ble using its reverse primer and 3 Ble-F. Then the products were gel-purified (Invitrogen) for the final PCR round. Finally, the third round of PCR was for amplification the bi-partite gene disruption cassettes using the previous primers in a total of 100 µl PCR reaction for each fragment. Before transformation, the constructed fragments were cleaned and concentrated via gel purification kit and µg of DNA was used for transformation. The transformation was performed using polyethylene glycol method (PEG) as described before (17). After 4 days, clones were picked using sterilised toothpicks form selectable Czapek Dox agar plates containing 20 µg/ml of bleomycin antibiotic. For obtaining stable mutants, the clones were transferred onto other plates which had higher concentration of bleomycin 60 µg/ml. 20 to 30 clones from every gene deletion experiment were grown for 6 days in 500 ml Erlenmeyer flasks containing 100 ml of malt extract medium (MEM). The cultures were acidified to ph 3 with HCl and filtered. The culture filtrate was extracted with 100 ml of EtOAc three times. Then the organic layer was dried using anhydrous MgSO 4 and evaporated under vacuum. The remaining crude extract was dissolved in ml Me and subjected for LCMS analysis.

7 The genomic DNA of one or more mutants from each knockout experiment was extracted and used for PCR to determine the disruption of gene. The diagnostic primers were picked from outside the homologous flanking regions as well as the bleomycin marker to detect the integration of the antibiotic cassette on the targeted gene. PCR products were analysed by restriction digest and/or sequencing as appropriate. Name 5 ble-f 5 ble-r 3 ble-f 3 ble-r 5 tropa-f 5 tropa-r 3 tropa-f 3 tropa-r Check-tropA-F Check-tropA-R 5 tropb-f 5 tropb-r 3 tropb-f 3 tropb-r Check-tropB-F Check-tropB-R 5 tropc-f 5 tropc-r 3 tropc-f 3 tropc-r Check-tropC-F Check-tropC-R 5 tropd-f 5 tropd-r 3 tropd-f 3 tropd-r Check-tropD-F Check-tropD-R Sequence GGCGATTAAGTTGGGTAACGC CGATCTCGGTCATGGCC CTTCAGTATATTCATCTTCCCATCC CCACCACCCGCCATATAA ACTGCTTGTTCCTCCTCAGC gcgttacccaacttaatcgccatccaaccctttgtctgtcg ttatatggcgggtggtggaaccttatcgacgctactatgagc TAAAGGATGTCCCGTTCGTC AGGGAATTTCACAGCACAAG ATCTGGTGCCTTGTCTGTTC TATGGATAGAGGCTGGGTCAC gcgttacccaacttaatcgccgccgacggtacatttgct ttatatggcgggtggtggaaattccaaggtcactttttcag GAGCAAAGTATCGTCCTGATAATC TCGTTTACCCAGAATGCACA GCTGCTTGATACCGCTAAGG GTATGAACTTTACTTGGGCTGG gcgttacccaacttaatcgcccttgatgcttgatcttgtcagc tatatggcgggtggtgggctcgatattccatcactgg GTGTTAGGACTTTGTTCGACTCC CACTTGGTTCGATCAGTCG GAAGACTGGATACAGCGTGAGG CCTGACAAGGTTCAATACAATAAG gcgttacccaacttaatcgcccctggaccatctcaaacgtc tatatggcgggtggtggcggtgacgaacctacaatgac GTGTTAGGACTTTGTTCGACTCC GCAGTGGCGTTCAACCTG CCAGTTCCTACCTAGCTTGTTG Table S3.1. Oligonucleotide primers used in tropb, tropc and tropd knockout. Sequences used for fusion PCR in lower case.

8 3.2 LCMS chromatograms for T. stipitatus ΔtropB. A B C 10 % D 3 % time / min Figure S A, UV chromatogram of extract from WT T. stipitatus (260 nm) B, UV Chromatogram of T. stipitatus ΔtropB (260 nm) C, SIM trace of 183 (ES+) corresponding to 5-hydroxy-3-methyl orcinaldehyde 10 ([M]H + ) D, SIM trace of 167 (ES+) corresponding to 3-methylorcinaldehyde 3 ([M]H + ).

9 3.3 LCMS chromatograms for T. stipitatus ΔtropC. A B C 14 D 11 E 12 time / min Figure S A, UV chromatogram of extract from WT T. stipitatus (260 nm) B, UV chromatogram of T. stipitatus ΔtropC (260 nm) C, SIM trace of 177 (ES+) corresponding to leptosphaerdione 14 ([M]Na + ) D, SIM trace of 183 (ES+) corresponding to 11 ([M]H + ) E, SIM trace of 302 (ES+) corresponding to talaroenamine 12 ([M]H + ).

10 3.4 LCMS chromatograms for T. stipitatus ΔtropD. A B C 16 D 15 E 12 time / min Figure S A, UV chromatogram of extract from WT T. stipitatus (260 nm) B, UV chromatogram of T. stipitatus ΔtropD (260 nm) C, SIM trace of 169 (ES+) corresponding to 16 ([M]H + ) D, SIM trace of 181 (ES+) corresponding to stipitaldehyde 15 ([M]H + ) E, SIM trace of 302 (ES+) corresponding to talaroenamine 12 ([M]H + ).

11 4. Expression of tropa. 4.1 Construction of Tspks1 expression vectors Primers used in this work are listed as follows, TspksP1: 5 -CACCATGGATCCCTTGGCATCGAATTTTC-3 TspksP1c: 5 -GGAATAGTCGTAGTAGCTCGTGGAG-3 TspksP2: 5 -ATTGAAATCTCACGGCAACTAACCG-3 TspksP2c: 5 -AAGGCTGACAAGATGGTCTCAACAGG-3 TspksP3: 5 -CACCGACAATCAACGACCTTCGCCAGAC-3 TspksP3c: 5 -TCAGGCAACAAAAGAGATACTCCTCCAG-3 TspksP4c: 5 -GCAATAAACCCACGCAGATGGCTAG-3 M13F: 5 -GTAAAACGACGGCCAG-3 M13R: 5 -CAGGAAACAGCTATGAC-3 Intron-up: 5 -AATAAACTGAGATATATGCCTCTGGATTTGCTGCTAGAATTTCC-3 Intron-down: 5 -TTCTAGCAGCAAATCCAGAGGCATATATCTCAGTTTATTATGACCAG-3 Tspks-egfp: 5 -CTTACTGGAGGAGTATCTCTTTTGTTGCCATGGTGAGCAAGGGCGAG-3 Genomic DNA (gdna) from Talaromyces stipitatus was prepared using a GenElute Plant Genomic DNA Miniprep kit (SIGMA) according to the manufacturer's instructions. The whole encoding region of Tspks1 was divided into three fragments and amplified from gdna using three pairs of primers: P1 from TspksP1 + TspksP1c P2 from TspksP2 + TspksP2c and P3 from TspksP3 + TspksP3c, respectively. KOD Hot Start DNA Polymerase (Novagen) was used, PCR contents and program performed according to the manufacturer's instructions and the following: 95 C 2 min 95 C 20 s 60 C 20 s 72 C 1 kb/min (number of cycles 35) 72 C 5 min 4 C to the end. The resulting PCR fragments P1, P2 and P3 were then cloned into pentr/d-topo using a pentr Directional TOPO Cloning Kit (Invitrogen) and transformed into TOP10 E. coli chemical competent cells (Invitrogen). Sequencing (Beckman Coulter Genomics) confirmed that no errors had been introduced. PCR was then used to amplify the 5' and 3' ends of the PKS from the TOPO vectors including the att recombination sites. Thus PCR fragments P4 and P5 were obtained from P1- PENTR/D-TOPO and P3-PENTR/D-TOPO respectively using primer pairs M13F + TspksP1c and TspksP3 + M13R respectively. KOD Hot Start DNA Polymerase (Novagen) was used, PCR contents and program performed according to the manufacturer's instructions and the following: 95 C 2 min 95 C 20 s 50 C 20 s 72 C 1 kb/min (number of cycles 35) 72 C 5 min 4 C to the end. The yeast plasmid of peya1 was linearized by the enzyme NotI. PCR fragments P4, P2, P5 and the linear peya1 vector were transformed into Saccharomyces cerevisiae BMA 64 to form a new integrated yeast plasmid peya1-tspks1 by yeast recombination. Gateway LR in vitro

12 recombination (Invitrogen) was then applied to transfer the truncated Tspks1 into the fungal expression vector ptaex3gs giving a fungal expression plasmid ptaex3gs- Tspks1. A Tspks1-egfp fusion was created in the following way. PCR fragment P6 consisting of the egfp gene flanked by the 3' sequence of Tspks1 (lacking its stop codon) at its 5' end and an att recombination site at its 3' end was generated using primers Tspks-egfp + M13R from plasmid D-TOPO-egfp (previously constructed in our lab). The vector peya1-tspks1 was linearized using AscI, and P6 was introduced by yeast recombination to form peya1-tspks-egfp. The single intron (74 bp) of Tspks1 was then removed. Two DNA fragments containing a 39 bp overlap region were first prepared using ptaex3gs-tspks1-egfp as the template. Thus primers TspksP1 + Intron-up and primers Introndown + TspksP4c yielded PCR fragments P7 and P8 respectively. KOD Hot Start DNA Polymerase (Novagen) was used, PCR contents and program performed according to the manufacturer's instructions and the following: 95 C 2 min 95 C 20 s 60 C 20 s 72 C 1 kb/min (number of cycles 35) 72 C 5 min 4 C to the end. The vector peya1-tspks1-egfp was digested using NotI + EcoRI and the large vector-containing fragment purified to give fragment F1. Then F1, P7 and P8 were integrated together by yeast recombination. Finally, in vitro LR recombination was used to create the intron-deleted Tspks1 fungal expression plasmid ptaex3gs-tspks1-egfp-ind. Sequencing (Beckman Coulter Genomics) confirmed that the intron had been correctly removed. 4.2 Yeast recombination. A single colony of S. cerevisiae BMA 64 was inoculated into YPAD (50 ml) in a 500 ml shake flask and cultivated at 30 C, 200 rpm overnight to OD 600 = 2. The broth was centrifuged (3000 g, 5 min) and the supernatant was poured off. The cells were resuspended in a final volume of 25 ml sterile water, centrifuged again (3000 g, 5 min) and the supernatant poured off. The cell pellet was resuspended in 1 ml LiOAc (0.1 M), transferred to a 1.5 ml Eppendof tube and centrifuged (13000 g, 15 s), and the supernatant removed. The cells were resuspended in 500 µl LiOAc (0.1 M) and aliquotted (50 µl) into new 1.5 ml Eppendof tubes, centrifuged (13000 g, 15 s) and the supernatant was removed. Then 1 ml ssdna was boiled for 5 min and chilled quickly in ice water. Adding 240 µl sterile PEG 4000 (50%, v/v), 36 µl LiOAc (1 mol/l), 50 µl ssdna and 34 µl DNA mixture (equal molar concentration) into the cells and vortexed the tube vigorously. Then the tube was incubated at 30 C for 30 min and 42 C for further 30 min. The liquid was centrifuged (13000 g, 15 s) and the supernatant was removed. Then 150 µl sterile water was added, the cells were resuspended and spread on SM-ura plates. The plates were incubated at 30 C for 5-6 days. The yeast colonies were mixed by sterile toothpick, 10 µl cells were then used for plasmid extraction following the manufacturer's instructions (Zymoprep Yeast Plasmid Miniprep II). Then 2 µl plasmids were used for transformation of E. coli TOP 10 using chloramphenicol (34 µg/ml) as

13 selected antibiotics. The plasmids were then confirmed correctly by enzyme digestion and sequencing. 4.3 Fungal transformation, fermentation of transformants and extraction Transformation into Aspergillus oryzae. A 150 μl spore suspension of A. oryzae strain M-2-3 was spread onto DPY agar plates incubated at 30 C for 3-5 days. Sterile water (5 ml) was added and the spores scraped off with a sterile loop. The liquid was collected and inoculated into DPY growth medium (100 ml) which was then incubated at 30 C with shaking (200 rpm, 24 h). Mycelia were collected by filtration through sterile Miracloth, washed with 0.9 M sodium chloride, centrifuged ( g, 10 min) and the supernatant was discarded. Filter-sterilized protoplasting solution (20 ml) was added to the biomass which was resuspended thoroughly by vortexing. The tube was incubated at room temperature, with gentle mixing on a rotator. Sufficient protoplast formation was checked by microscope every 30 min. The protoplasts were released from hyphal strands by gentle pipetting with a large wide-bore pipette (5 ml) and filtered through sterile Miracloth to remove the hyphae. The filtrate was gently centrifuged (700 g, 5 min) and the supernatant was removed. The obtained protoplasts were washed with 0.9 M NaCl and with Solution I gently and centrifuged (700 g, 5 min). The concentration of protoplasts was determined by using a haemocytometer (Fisher). The protoplasts were resuspended in Solution I to give protoplasts/ml and stored on ice. Then Solution II (about 1/5 volume of the protoplast solution) was added and mixed gently. Then 0.2 ml of the obtained mixture was added into 10 ml sterile tubes. DNA (5-10 μg, 20 μl maximum) to be transformed into the fungus was added to the 0.2 ml protoplast suspension and incubated on ice (30 min). Solution II (1 ml) was added and mixed gently, then incubated at room temperature (20 min). Czapek-Dox agar (Oxoid) in sorbitol (1 M 8 ml lower than 45 C) was added to the transformation mixture and overlaid onto Czapek-Dox agar with sorbitol (1 M 5 ml) plates. The plates were incubated at 30 C for about 4-6 days. The transformants were picked using a sterile toothpick and transferred to Czapek-Dox agar plates. Two rounds of selection on Czapek- Dox media were further performed. The genuine argb transformants were then grown on DPY agar for 4 days for spore production. These transformants were then stored at 4 C and selected for chemical analysis.

14 4.3.2 Fermentation of transformants and extraction Sterile water (5 ml) was added to the transformant plate and the spores scraped off with a sterile loop. The suspensions (200 μl) obtained from transformants were inoculated into starch medium (100 ml). The flasks were incubated at 30 C with shaking at 200 rpm for 6-7 days. The culture broth was acidified using 2 M hydrochloric acid until the solution reached ph 4.0. The mycelia were homogenised using a hand-held kitchen blender. The obtained broth was extracted three times with 2 volumes of ethyl acetate. Then the organic layer was dried over anhydrous MgSO 4 and the liquid was evaporated at reduced pressure. Afterwards, the dried compounds were dissolved in 3 ml methanol, diluted and used for LC-MS analysis. 4.4 LCMS analysis of transformants Samples were dissolved in Me to 1 mg ml -1, centrifuged for 5 min at rpm, and the supernatant was analysed by LCMS using a Waters 2795HT HPLC system. Detection was achieved by uv between 200 and 400 nm using a Waters 2998 diode array detector, and by simultaneous electrospray (ES) mass spectrometry using a Waters ZQ spectrometer detecting between 150 and 600 m/z units. Chromatography (flow rate 1 ml min -1 ) was achieved using either Phenomenex LUNA column (5 μ, C 18, 100 Å, mm) equipped with a Phenomenex Security Guard precolumn (Luna C Å) or a Phenomenex Kinetex column (2.6 μ, C 18, 100 Å, mm) equipped with a Phenomenex Security Guard precolumn (Luna C Å). Solvents were: A, HPLC grade H 2 O containing 0.05% formic acid B, HPLC grade Me containing 0.045% formic acid and C, HPLC grade CH 3 CN containing 0.045% formic acid). Gradients were as follows. Method 1. Luna/Me: 0 min, 25% B 5 min, 25% B 51 min, 95% B 53min, 95% B 55 min, 25% B 59 min, 25% B 60 min, 25% B. Method 2. Luna/CH 3 CN: 0 min, 5% C 5 min, 5% C 45 min, 75% C 46 min, 95% C 50 min, 95% C 55 min, 5% C 60 min, 5% C. Method 3. Kinetex/Me: 0 min, 10% B 10 min, 90% B 12 min, 90% B 13min, 10% B 15 min, 10% B. Method 4. Kinetex/CH 3 CN: 0 min, 10% C 10 min, 90% C 12 min, 90% C 13min, 10% C 15 min, 10% C.

15 4.5 Media and Solutions. Medium YPAD SM-Ura agar DPY Agar DPY liquid medium Malt Extract Medium Recipe Yeast extract 10 g/l, Trptone 20 g/l, glucose 20 g/l, adenine sulphate 0.04 g/l. Yeast nitrogen base 1.7 g/l, NH 4 SO 4 5 g/l, glucose 20 g/l, Nutritional supplements minus uracil 0.77 g/l, agar 20 g/l. Dextrin 20 g/l, polypeptone 10 g/l, yeast extract 5 g/l, KH 2 PO 4 5 g/l, MgSO 4 7H 2 O 0.5 g/l, agar 15 g/l. Dextrin 20 g/l, polypeptone 10 g/l, yeast extract 5 g/l, KH 2 PO 4 5 g/l, MgSO 4 7H 2 O 0.5 g/l. D-maltose 20 g/l and polypeptone 10 g/l with the addition of trace elements, 50 ml of solution A and solution B. Protoplasting Solution Lysing enzyme 20 g/l (Sigma-Aldrich) plus Driselase 10 g/l (Interspex Products) in 0.8 M NaCl. Solution I 0.9 M NaCl, 10 mm CaCl 2, 50 mm Tris-HCl ph 7.5. Solution II 60 % PEG 3350 (Sigma), 10 mm CaCl 2, 50 mm Tris-HCl ph 7.5. Starch medium Starch 20 g, polypeptone 10 g, distilled water 900 ml, solution A 50 ml, solution B 50 ml. Glucose medium Glucose 20 g, polypeptone 10 g, distilled water 900 ml, solution A 50mL, solution B 50 ml. Solution A Solution B NaNO 3 40 g/l, KCl 40 g/l, MgSO 4 7H 2 O 10 g/l, FeSO 4 7H 2 O 0.2 g/l. K 2 HPO 4 20 g/l Fluorescence and products from the transformants. For all the analyzed ptaex3gs-tspks1 transformants (more than 40), none of them produced new compounds as judged by LCMS analysis. The intron was then removed from Tspks1 in the expression vector and egfp was fused in-frame at the 3' terminus. All of the new intron deleted ptaex3gs-tspks1-egfp-ind transformants displayed green fluorescence. Fig. S4.6.1 Sequence alignment of Tspks1 with (bottom sequence) and without (top 2 sequences) introns.

16 A Fig. S4.6.2 Fluorescence from transformants of A. oryzae. (A) Wild type (B) ptaex3gs-tspks1-egfp-ind B 4.7. LC-MS chromatograms of extract of A. oryzae ptaex3gs-tspks1-egfp LCMS analysis was achieved using method 3 (see section 4.4). uv data is given in Figure 1 in the main paper. A B C D Figure S LCMS analysis of A. oryzae expressing intronless tspks1-egfp: A, SIM trace at 139 m/z ES- B, SIM trace 141 m/z ES+ C, SIM trace at 167 m/z ES+ D. SIM trace at 165 m/z ES-.

17 A B C D Figure S LCMS analysis of WT A. oryzae: A, SIM trace at 139 m/z ES- B, SIM trace 141 m/z ES+ C, SIM trace at 167 m/z ES+ D. SIM trace at 165 m/z ES-. 5. Isolation and full characterisation for compounds 3, 8, 9, 10, 11, 12, 13, 14, 15, Mass-directed purification. Purification of compounds was generally achieved using a Waters mass-directed autopurification system comprising of a Waters 2767 autosampler, Waters 2545 pump system, a Phenomenex LUNA column (5μ, C 18, 100 Å, mm) equipped with a Phenomenex Security Guard precolumn (Luna C Å) eluted at 4 ml/min. Solvent A, HPLC grade H 2 O % formic acid Solvent B, HPLC grade CH 3 CN % formic acid. The post-column flow was split (100:1) and the minority flow was made up with Me % formic acid to 1 ml min -1 for simultaneous analysis by diode array (Waters 2998), evaporative light scattering (Waters 2424) and ESI mass spectrometry in positive and negative modes (Waters Quatro Micro). Detected peaks were collected into glass test tubes. Combined tubes were evaporated under a flow of dry N 2 gas, weighed, and residues dissolved directly in NMR solvent for NMR analysis.

18 5.2 Compound Characterization. 3-Methylorcinaldehyde 3 (18). The ΔtropB strain was fermented at large scale (2 L) and extracted to give almost 2 g of crude material. Purification was achieved by flash chromatography using CH 2 Cl 2 as the mobile phase. This eluted relatively pure 3-methyl orcinaldehyde which was then recrystallised. δ H (500 MHz, CD 3 CN) (1H, s, 2-), (1H, s, CHO), 6.29 (1H, s, 5-H), 2.49 (3H, s, 6-CH 3 ), 1.97 (3H, s, 3-CH 3 ) m/z (ES+) 167 ([M]H +, 100%) m/z (ES-) 165 ([M-H] -, 100%). Methyl stipitate 8 (19). Two flasks of WT T. stipitatus (100 ml of malt extract medium in 500 ml Erlenmeyer flasks) were grown for 5 days at 28 C on an orbital shaker at 200 rpm. The cultures were vacuum filtered, acidified to ph 3 (aq HCl) and the filtrate was extracted with ethyl acetate. The organic extract was dried (MgSO 4 ) and evaporated in vacuo to give a crude extract (405 mg) which was dissolved in methanol (20 ml). After two weeks, yellow crystals precipitated which were separated and washed with 1:1 diethylether : methanol. m.p. 260 C (lit. (19) mp C) IR (neat): ν max 3244, 2586, 1716, 1609, 1574, 1389 cm -1 1 H-NMR (400 MHz, DMSO-d6) δ = 3.87 (s, 3H, H-9) 6.83 (d, J = 2.6 Hz, 1H, H-7), 7.29 (d, J = 1.4 Hz, 1H, H-3), 7.41 (dd, J = 2.6, 1.4 Hz, 1H, H-5) 13 C-NMR (101 MHz, DMSO-d 6 ) δ = 53.4 (C-9), (C-3), (C-7), (C-5), (C-4), (C- 6), (C-2), (C-8), (C-1) HRMS for C 9 H 9 O 5 : calcd, found: [M]H +. X-ray diffraction was performed at 100 K using a Bruker Apex II kappa CCD area detector (λ = Å). Formula C 9 H 8 O 5, M = , monoclinic, space group P2 1, a = (12) Å, b = 6.730(2) Å, c = (5) Å, α = 90.00, β (5), γ = 90.00, V = 424.5(2) Å 3, Z = 2, ρ calc = gcm -3, R1 = ( 1135), wr2 = ( 1272).

19 4-hydroxy-3,6-dimethyl-2H-pyran-2-one 9 (20) O 1 O 5 6 Purified by mass-directed LC from either WT T. stipitatus or A. oryzae ptropa as a colourless solid. 1 H NMR (500 MHz, CD 3 CN) δ = 5.87 (1H, s), 2.11 (3H, s), 1.77 (3H, s) 13 C NMR (125 MHz, CD 3 CN) δ = (C-1), (C-3), (C-5), 99.8 (C-4), 97.7 (C-2), 19.1 (C-6), 7.3 (C- 7) m/z (ES+) 141 ([M]H +, 100%) m/z (ES-) 139 ([M-H] -, 100%). 5-hydroxy-3-methyl orcinaldehyde 10 (21). T. stipitatus ΔTropB was fermented in large scale 2 L and then extracted to give almost 2 g of crude extract. A flash column was performed using first CH 2 Cl 2 100% as a mobile phase. This eliminates 3-methyl orcinaldehyde 3. Next, the addition of 10% of ethyl acetate eluted 10 which then repurified using mass-directed autopurification. Red crystals mp 193 C (lit C) IR (neat): ν max 3360, 2932, 1727, 1619 and 1245 cm -1 1 H-NMR (500 MHz, CD 3 CN) δ = 2.03 (s, 3H, H-8), 2.40 (s, 3H, H-9), (s, 1H, H-7), (s, 1H, -2) 13 C-NMR (125 MHz, CD 3 CN) δ = 7.7 (C-8), 10.5 (C-9), (C-3), (C-1), (C-6), (C-5), (C-4), (C-2), (C-7) HRMS for C 9 H 9 O 4 : calc, found, for [M-H]. 2-hydroxy-6-(hydroxymethylene)-2,5-dimethylcyclohex-4-ene-1,3-dione O O 9 Isolated as a dark orange oil by mass directed purification. Structure determined by HSQC, HMBC and noe experiments. 1 H NMR (500 MHz, DMSO-d 6 ) δ = 8.14 (1H, s, H-7) δ = 5.63 (1H, s, H-4), 2.21 (3H, s, H-8), 1.29 (3H, s, H-9) 13 C NMR (125 MHz, DMSO-d 6 ) δ = (C-1), (C-3), (C-7), (C-6), (C-4), (C-5), 81.1 (C-2), 27.9 (C-8), 21.7 (C-9). HRMS for

20 C 9 H 10 O 3 Na 1 : calc, found, , [M]Na +. IR (neat): ν max 3306, 2983, 2928, 1627, 1596 cm -1. Specific rotation [α] D 20 = (Me). Talaroenamine 12. This compound was obtained from 3-day old fermentations of T. stipitatus ΔTropC. The crude extract was dissolved in methanol and purified using mass-directed autopurification. Orange crystals mp 216 C [α] 20 D (c , Me) IR (neat): ν max 3343, 1695, 1656, 1605, 1547, 1391, 1341 and 1251 cm -1 1 H NMR (500 MHz, DMSO-d 6 ) δ = 1.31 (s, 3H, H-7), 2.26 (s, 3H, H-8), 5.66 (s, 1H, H-3), 7.21 (t, J=7.5 Hz, 1H, H-14), 7.61 (t, J=7.5 Hz, 1H, H-15), 7.79 (d, J = 7.5 Hz, 1H, H-16), 8.00 (d, J = 7.5 Hz, 1H, H-13), 8.01 (d, J = 13.0, 1H, H-9),13.65 (d, J = 13.0 Hz, 1H, H- 10) 13 C NMR (126 MHz, DMSO-d6) δ = 20.1 (C-8), 28.3 (C-7), 81.0 (C-1), (C-5), (C- 3), (C-16), (C-14), (C-13), (C-15), (C-11), (C-9), (C-4), (C-17), (C-6), (C-2) HRMS for C 16 H 16 NO 5 : calcd, found: [M]H +. HRMS for C 16 H 16 NO 5 Na: calcd, found, , [M]Na +. For crystallising talaroenamine, 70 mg of the compound was dissolved in 50% aqueous methanol and the solvent was left to evaporate slowly. A single crystal was submitted to a Bruker Microstar rotating anode diffractometer using Cu-Kα radiation (λ = Å) at 100 K. Formula C 16 H 15 NO 5 H 2 O, M = , orthorhombic, space group P2 1, a = (12) Å, b = (13) Å, c = (4) Å, α = 90.00, β 90.00, γ = 90.00, V = (7) Å 3, Z = 8, ρ calc = g cm -3, R1 = ( 5038), wr2 = ( 5305), Flack parameter 0.03(12).

21 Leptosphaerone A 13. A crude extract of T. stipitatus ΔTropC (2 g) was fractionated using a SiO 2 column (pore size 60 Å, mesh particle size, μm) and eluted with 100% CH 2 Cl 2 to afford impure 13 and was further purified by mass-directed LC. Colourless oil, [α] 20 D (c 0.475, CHCl 3 ) 1 H NMR (500 MHz, CDCl 3 ) δ = 1.26 (s, 3H, H-7), 2.02 (s, 3H, H-8), 2.41 (ddq, 2 J = 18.6, 3 J = 10.5, 4 J = 1.3, 1H, H-4a), 2.63 (dd, 2 J = 18.6, 3 J = 5.7, 1H, H-4b), 4.01 (dd, 3 J = 10.5, 3 J = 5.7, 1H, H-3), 5.93 (s, 1H, H-6) 13 C NMR (125 MHz, CDCl 3 ) δ = 17.8 (C-7), 24.6 (C-8), 37.7 (C-4), 72.9 (C-3), 77.7 (C- 2), (C-6), (C-5), (C-1) HRMS for C 8 H 13 O 3 : calcd, found, [M]H +. Leptosphaerdione 14. A crude extract of T. stipitatus ΔTropC (2 g) was fractionated using a SiO 2 column (pore size 60 Å, mesh particle size, μm) and eluted with 100% CH 2 Cl 2 to afford impure 13 and was further purified by mass-directed LC. Yellow oil, 1 H NMR (500 MHz, CDCl 3 ) δ = 1.48 (s, 3H, H-7), 2.04 (s, 3H, H-8), 3.13 (d, J = 21, 1H, H-5a), 3.67 (d, J = 21, 1H, H-5b), 6.05 (s, 1H, H- 3) 13 C NMR (125 MHz, CDCl 3 ) δ = 19.4 (C-8), 26.6 (C-7), 45.1 (C-5), 84.9 (C-1), (C-3), (C-4), (C-2), (C-6) HRMS for C 8 H 11 O 3 : calcd, found, [M]H +.

22 Stipitaldehyde 15. T. stipitatus ΔtropD was grown for 9 days at 28 C shaken at 200 rpm ( ml Erlenmeyer flasks, 100 ml of malt extract medium). The cultures were filtered and acidified to ph 3 with HCl before extraction with ethyl acetate which was dried (MgSO 4 ) and evaporated to yield a residue (2g). This extract then was subjected to silica gel chromatography (pore size 60 Å, mesh particle size, μm particle size). A fraction eluted with 90:10 CH 2 Cl 2 : ethyl acetate was enriched in stipitaldehyde 15 as well as 3-hydroxy orcinaldehyde 16. Slow evaporation of this fraction crystallised stipitaldehyde 15 which then used for structural elucidation. Orange crystals, mp 168 C IR (neat): ν max 3163, 1717, 1632, 1554 and 1284 cm -1 1 H-NMR (500 MHz, DMSO-d6) δ = 2.57 (s, 3H, H-8), 6.69 (s, 1H, H-7), 6.75 (s, 1H, H-3), (s, 1H, H-9) 13 C-NMR (125 MHz, DMSO-d6) δ = 25.4 (C-8), (C-3), (C-5), (C-7), (C-4), (C-6), (C-1), (C-9), (C-2) HRMS for C 9 H 9 O 4 : calcd, found, [M]H +. The X-ray diffraction experiment was carried out at 100 K using a Bruker Apex II kappa CCD area detector (λ = Å). Formula C 9 H 8 O 4, M = , monoclinic, space group P2 1, a = (4) Å, b = (4) Å, c = (5) Å, α = 90.00, β (3), γ = 90.00, V = (6) Å 3, Z = 4, ρ calc = g cm -3, R1 = ( 1814), wr2 = ( 1925), Flack parameter -0.1(14). 3-hydroxy orcinaldehyde 16 (22). Isolated from the crude extract of T. stipitatus ΔtropD cultures using the same column fraction used previously in the isolation of 15. Purified by mass-directed LCMS. 1 H-NMR (500 MHz, CDCl 3 ) δ = 2.48 (s, 3H, H-8), 6.34 (s, 1H, H-5), (s, 1H, H-7) 13 C-NMR (125 MHz, DMSO-d6) δ = 17.7 (C-8), (C-5), (C-1), (C-3), (C-6), (C-4), (C-2), (C-7).

23 6. cif files for 8, 12 and Compound 8. data_twin5 _audit_creation_method SHELXL-97 _chemical_name_systematic? _chemical_name_common? _chemical_melting_point? _chemical_formula_moiety 'C9 H8 O5' _chemical_formula_sum 'C9 H8 O5' _chemical_formula_weight _chemical_absolute_configuration uk loop atom_type_symbol _atom_type_description _atom_type_scat_dispersion_real _atom_type_scat_dispersion_imag _atom_type_scat_source 'C' 'C' 'International Tables Vol C Tables and ' 'H' 'H' 'International Tables Vol C Tables and ' 'O' 'O' 'International Tables Vol C Tables and ' _symmetry_cell_setting _symmetry_space_group_name_h-m _symmetry_space_gourp-name_hall loop symmetry_equiv_pos_as_xyz 'x, y, z' '-x, y+1/2, -z' monoclinic 'P21' 'P 2yb' _cell_length_a (12) _cell_length_b 6.730(2) _cell_length_c (5) _cell_angle_alpha _cell_angle_beta (5) _cell_angle_gamma _cell_volume 424.5(2) _cell_formula_units_z 2 _cell_measurement_temperature 100(2) _cell_measurement_reflns_used 528 _cell_measurement_theta_min 2.50 _cell_measurement_theta_max _exptl_crystal_description plate _exptl_crystal_colour colourless _exptl_crystal_size_max 0.34 _exptl_crystal_size_mid 0.12 _exptl_crystal_size_min 0.02 _exptl_crystal_density_meas? _exptl_crystal_density_diffrn _exptl_crystal_density_method 'not measured' _exptl_crystal_f_ _exptl_absorpt_coefficient_mu _exptl_absorpt_correction_type multi-scan _exptl_absorpt_correction_t_min _exptl_absorpt_correction_t_max _exptl_absorpt_process_details 'TWINABS V2008/2' _exptl_special_details? _diffrn_ambient_temperature 100(2) _diffrn_radiation_wavelength _diffrn_radiation_type MoK\a _diffrn_radiation_source 'fine-focus sealed tube' _diffrn_radiation_monochromator graphite _diffrn_measurement_device_type 'Bruker Apex II kappa CCD area detector' _diffrn_measurement_method 'omega scans' _diffrn_detector_area_resol_mean? _diffrn_reflns_number 1272 _diffrn_reflns_av_r_equivalents _diffrn_reflns_av_sigmai/neti _diffrn_reflns_limit_h_min -5 _diffrn_reflns_limit_h_max 5 _diffrn_reflns_limit_k_min 0 _diffrn_reflns_limit_k_max 8 _diffrn_reflns_limit_l_min 0 _diffrn_reflns_limit_l_max 23 _diffrn_reflns_theta_min 1.25 _diffrn_reflns_theta_max _reflns_number_total 1272 _reflns_number_gt 1135 _reflns_threshold_expression >2sigma(I) _computing_data_collection II' _computing_cell_refinement II' _computing_data_reduction SAINT' _computing_structure_solution (Sheldrick, 2008)' _computing_structure_refinement (Sheldrick, 2008)' _computing_molecular_graphics ShelXTL' _computing_publication_material ShelXTL' 'Bruker Apex 'Bruker Apex 'Bruker 'SHELXS-97 'SHELXL-97 'Bruker 'Bruker _refine_special_details Refinement of F^2^ against ALL reflections. The weighted R-factor wr and goodness of fit S are based on F^2^, conventional R-factors R are based on F, with F set to zero for negative F^2^. The threshold expression of F^2^ > 2sigma(F^2^) is used only for calculating R-factors(gt) etc. and is not relevant to the choice of reflections for refinement. R-factors based on F^2^ are statistically about twice as large as those based on F, and R- factors based on ALL data will be even larger. _refine_ls_structure_factor_coef Fsqd _refine_ls_matrix_type full _refine_ls_weighting_scheme calc _refine_ls_weighting_details 'calc w=1/[\s^2^(fo^2^)+(0.0836p)^2^ p] where P=(Fo^2^+2Fc^2^)/3' _atom_sites_solution_primary direct _atom_sites_solution_secondary difmap _atom_sites_solution_hydrogens geom _refine_ls_hydrogen_treatment constr _refine_ls_extinction_method none _refine_ls_extinction_coef? _refine_ls_number_reflns 1272 _refine_ls_number_parameters 131 _refine_ls_number_restraints 1 _refine_ls_r_factor_all _refine_ls_r_factor_gt _refine_ls_wr_factor_ref _refine_ls_wr_factor_gt _refine_ls_goodness_of_fit_ref _refine_ls_restrained_s_all _refine_ls_shift/su_max _refine_ls_shift/su_mean 0.000

24 loop atom_site_label _atom_site_type_symbol _atom_site_fract_x _atom_site_fract_y _atom_site_fract_z _atom_site_u_iso_or_equiv _atom_site_adp_type _atom_site_occupancy _atom_site_symmetry_multiplicity _atom_site_calc_flag _atom_site_refinement_flags _atom_site_disorder_assembly _atom_site_disorder_group C1 C (10) (7) (2) (8) C2 C (10) (6) (2) (7) H2 H Uiso 1 1 calc C3 C (10) (6) (2) (8) C4 C (10) (6) (2) (8) H4 H Uiso 1 1 calc C5 C (10) (6) (2) (8) C6 C (11) (6) (2) (8) C7 C (11) (6) (2) (8) H7 H Uiso 1 1 calc C8 C (12) (7) (2) (9) C9 C (15) (8) (3) (11) H9A H Uiso 1 1 calc H9B H Uiso 1 1 calc H9C H Uiso 1 1 calc O5 O (8) (5) (17) (6) H5 H Uiso 1 1 calc O6 O (7) (5) (16) (6) O7 O (7) (5) (15) (6) H7A H Uiso 1 1 calc O8 O (11) (6) (19) (10) O9 O (9) (5) (17) (7) loop atom_site_aniso_label _atom_site_aniso_u_11 _atom_site_aniso_u_22 _atom_site_aniso_u_33 _atom_site_aniso_u_23 _atom_site_aniso_u_13 _atom_site_aniso_u_12 C (2) 0.015(2) (15) (15) (12) (17) C (19) (18) (16) (14) (13) (16) C (18) 0.017(2) (16) (13) (12) (14) C (19) 0.018(2) (15) (14) (13) (15) C (18) (19) (15) (13) (12) (14) C (2) (18) (16) (14) (13) (17) C (2) 0.017(2) (16) (15) (13) (17) C (2) 0.016(2) (16) (14) (14) (17) C (3) 0.031(3) 0.024(2) (19) (18) (2) O (16) (15) (12) (11) (11) (14) O (15) (14) (12) (11) (10) (13) O (14) (14) (11) (10) (10) (13) O (3) 0.037(2) (14) (15) (15) 0.023(2) O (19) (17) (14) (12) (11) (15) _geom_special_details All esds (except the esd in the dihedral angle between two l.s. planes) are estimated using the full covariance matrix. The cell esds are taken into account individually in the estimation of esds in distances, angles and torsion angles correlations between esds in cell parameters are only used when they are defined by crystal symmetry. An approximate (isotropic) treatment of cell esds is used for estimating esds involving l.s. planes. loop geom_bond_atom_site_label_1 _geom_bond_atom_site_label_2 _geom_bond_distance _geom_bond_site_symmetry_2 _geom_bond_publ_flag C1 C (5).? C1 C (6).? C1 C (5).? C2 C (5).? C2 H ? C3 O (5).? C3 C (6).? C4 C (6).? C4 H ? C5 O (5).? C5 C (5).? C6 C (5).? C6 O (5).? C7 H ? C8 O (5).? C8 O (6).? C9 O (5).? C9 H9A ? C9 H9B ? C9 H9C ? O5 H ? O7 H7A ? loop geom_angle_atom_site_label_1 _geom_angle_atom_site_label_2 _geom_angle_atom_site_label_3 _geom_angle _geom_angle_site_symmetry_1 _geom_angle_site_symmetry_3 _geom_angle_publ_flag C2 C1 C (4)..? C2 C1 C (4)..? C7 C1 C (3)..? C1 C2 C (4)..? C1 C2 H ? C3 C2 H ? O7 C3 C (3)..? O7 C3 C (3)..? C4 C3 C (4)..? C3 C4 C (3)..? C3 C4 H ? C5 C4 H ? O6 C5 C (3)..? O6 C5 C (3)..?

25 C4 C5 C (3)..? C7 C6 O (3)..? C7 C6 C (4)..? O5 C6 C (3)..? C6 C7 C (4)..? C6 C7 H ? C1 C7 H ? O8 C8 O (4)..? O8 C8 C (4)..? O9 C8 C (3)..? O9 C9 H9A ? O9 C9 H9B ? H9A C9 H9B ? O9 C9 H9C ? H9A C9 H9C ? H9B C9 H9C ? C6 O5 H ? C3 O7 H7A ? C8 O9 C (4)..? loop geom_torsion_atom_site_label_1 _geom_torsion_atom_site_label_2 _geom_torsion_atom_site_label_3 _geom_torsion_atom_site_label_4 _geom_torsion _geom_torsion_site_symmetry_1 _geom_torsion_site_symmetry_2 _geom_torsion_site_symmetry_3 _geom_torsion_site_symmetry_4 _geom_torsion_publ_flag C7 C1 C2 C3 1.0(7)....? C8 C1 C2 C (4)....? C1 C2 C3 O (4)....? C1 C2 C3 C4 6.2(7)....? O7 C3 C4 C (4)....? C2 C3 C4 C5-2.6(7)....? C3 C4 C5 O (4)....? C3 C4 C5 C6-5.9(7)....? O6 C5 C6 C (4)....? C4 C5 C6 C7 6.2(7)....? O6 C5 C6 O5 4.9(5)....? C4 C5 C6 O (3)....? O5 C6 C7 C (4)....? C5 C6 C7 C1 2.5(8)....? C2 C1 C7 C6-7.4(7)....? C8 C1 C7 C (4)....? C2 C1 C8 O (5)....? C7 C1 C8 O8 1.9(6)....? C2 C1 C8 O9 1.1(5)....? C7 C1 C8 O (4)....? O8 C8 O9 C9-4.0(7)....? C1 C8 O9 C (4)....? _diffrn_measured_fraction_theta_max _diffrn_reflns_theta_full _diffrn_measured_fraction_theta_full _refine_diff_density_max _refine_diff_density_min _refine_diff_density_rms Compound 12 data_talaroenamine_0m _audit_creation_method SHELXL-97 _chemical_name_systematic? _chemical_name_common? _chemical_melting_point? _chemical_formula_moiety 'C16 H15 N O5, H2 O' _chemical_formula_sum 'C16 H17 N O6' _chemical_formula_weight _chemical_absolute_configuration ad loop atom_type_symbol _atom_type_description _atom_type_scat_dispersion_real _atom_type_scat_dispersion_imag _atom_type_scat_source 'C' 'C' 'International Tables Vol C Tables and ' 'H' 'H' 'International Tables Vol C Tables and ' 'N' 'N' 'International Tables Vol C Tables and ' 'O' 'O' 'International Tables Vol C Tables and ' _symmetry_cell_setting _symmetry_space_group_name_h-m _symmetry_space_group_name_hall loop symmetry_equiv_pos_as_xyz 'x, y, z' '-x+1/2, -y, z+1/2' '-x, y+1/2, -z+1/2' 'x+1/2, -y+1/2, -z' orthorhombic 'P212121' 'P 2ac 2ab' _cell_length_a (12) _cell_length_b (13) _cell_length_c (4) _cell_angle_alpha _cell_angle_beta _cell_angle_gamma _cell_volume (7) _cell_formula_units_z 8 _cell_measurement_temperature 100(2) _cell_measurement_reflns_used 9838 _cell_measurement_theta_min 4.55 _cell_measurement_theta_max _exptl_crystal_description plate _exptl_crystal_colour orange _exptl_crystal_size_min 0.03 _exptl_crystal_size_mid 0.06 _exptl_crystal_size_max 0.36 _exptl_crystal_density_meas? _exptl_crystal_density_diffrn _exptl_crystal_density_method 'not measured' _exptl_crystal_f_ _exptl_absorpt_coefficient_mu _exptl_absorpt_correction_type multi-scan _exptl_absorpt_correction_t_min _exptl_absorpt_correction_t_max _exptl_absorpt_process_details 'SADABS V2008/1' _exptl_special_details? _diffrn_ambient_temperature 100(2) _diffrn_radiation_wavelength _diffrn_radiation_type CuK\a _diffrn_radiation_source 'fine-focus sealed tube' _diffrn_radiation_monochromator graphite _diffrn_measurement_device_type 'Bruker Microstar CCD area detector' _diffrn_measurement_method 'phi and omega scans' _diffrn_detector_area_resol_mean? _diffrn_reflns_number _diffrn_reflns_av_r_equivalents _diffrn_reflns_av_sigmai/neti _diffrn_reflns_limit_h_min -10 _diffrn_reflns_limit_h_max 10 _diffrn_reflns_limit_k_min -11 _diffrn_reflns_limit_k_max 12 _diffrn_reflns_limit_l_min -39

26 _diffrn_reflns_limit_l_max 29 _diffrn_reflns_theta_min 4.55 _diffrn_reflns_theta_max _reflns_number_total 5305 _reflns_number_gt 5038 _reflns_threshold_expression >2sigma(I) _computing_data_collection PROTEUM' _computing_cell_refinement PROTEUM' _computing_data_reduction SAINT' _computing_structure_solution (Sheldrick, 2008)' _computing_structure_refinement (Sheldrick, 2008)' _computing_molecular_graphics ShelXTL' _computing_publication_material ShelXTL' 'Bruker 'Bruker 'Bruker 'SHELXS-97 'SHELXL-97 'Bruker 'Bruker _refine_special_details Refinement of F^2^ against ALL reflections. The weighted R-factor wr and goodness of fit S are based on F^2^, conventional R-factors R are based on F, with F set to zero for negative F^2^. The threshold expression of F^2^ > 2sigma(F^2^) is used only for calculating R-factors(gt) etc. and is not relevant to the choice of reflections for refinement. R-factors based on F^2^ are statistically about twice as large as those based on F, and R- factors based on ALL data will be even larger. _refine_ls_structure_factor_coef Fsqd _refine_ls_matrix_type full _refine_ls_weighting_scheme calc _refine_ls_weighting_details 'calc w=1/[\s^2^(fo^2^)+(0.0382p)^2^ p] where P=(Fo^2^+2Fc^2^)/3' _atom_sites_solution_primary direct _atom_sites_solution_secondary difmap _atom_sites_solution_hydrogens geom _refine_ls_hydrogen_treatment mixed _refine_ls_extinction_method none _refine_ls_extinction_coef? _refine_ls_abs_structure_details 'Flack H D (1983), Acta Cryst. A39, ' _refine_ls_abs_structure_flack 0.03(12) _refine_ls_number_reflns 5305 _refine_ls_number_parameters 442 _refine_ls_number_restraints 6 _refine_ls_r_factor_all _refine_ls_r_factor_gt _refine_ls_wr_factor_ref _refine_ls_wr_factor_gt _refine_ls_goodness_of_fit_ref _refine_ls_restrained_s_all _refine_ls_shift/su_max _refine_ls_shift/su_mean loop atom_site_label _atom_site_type_symbol _atom_site_fract_x _atom_site_fract_y _atom_site_fract_z _atom_site_u_iso_or_equiv _atom_site_adp_type _atom_site_occupancy _atom_site_symmetry_multiplicity _atom_site_calc_flag _atom_site_refinement_flags _atom_site_disorder_assembly _atom_site_disorder_group O1 O (15) (12) (3) (3) H1 H Uiso 1 1 calc O2 O (19) (13) (4) (4) O3 O (16) (11) (3) (3) O4 O (14) (11) (3) (3) H4 H Uiso 1 1 calc O5 O (13) (11) (3) (3) N1 N (17) (13) (4) (3) H1N H 0.250(2) (18) (6) Uiso 1 1 d... C1 C (18) (15) (5) (3) C2 C (19) (16) (5) (3) C3 C (19) (16) (5) (3) H3 H Uiso 1 1 calc C4 C (19) (16) (5) (4) H4A H Uiso 1 1 calc C5 C (19) (17) (5) (4) H5 H Uiso 1 1 calc C6 C (19) (16) (5) (4) H6 H Uiso 1 1 calc C7 C (2) (16) (5) (4) C8 C (18) (15) (5) (3) H8 H Uiso 1 1 calc C9 C (19) (16) (5) (3) C10 C (19) (15) (5) (3) C11 C (18) (16) (5) (3) C12 C (18) (15) (5) (3) C13 C (19) (16) (5) (3) H13 H Uiso 1 1 calc C14 C (19) (16) (5) (3) C15 C (2) (18) (5) (4) H15A H Uiso 1 1 calc H15B H Uiso 1 1 calc H15C H Uiso 1 1 calc C16 C (2) (17) (5) (4) H16A H Uiso 1 1 calc H16B H Uiso 1 1 calc H16C H Uiso 1 1 calc N2 N (16) (13) (4) (3) H2N H 0.565(2) (18) (6) Uiso 1 1 d... O6 O (15) (12) (3) (3) H6A H Uiso 1 1 calc

27 O7 O (15) (12) (3) (3) O8 O (14) (13) (3) (3) O9 O (14) (12) (3) (3) H9 H Uiso 1 1 calc O10 O (14) (12) (3) (3) C17 C (19) (15) (5) (3) C18 C (19) (15) (5) (3) C19 C (2) (16) (5) (4) H19 H Uiso 1 1 calc C20 C (2) (16) (5) (4) H20 H Uiso 1 1 calc C21 C (2) (16) (5) (4) H21 H Uiso 1 1 calc C22 C (2) (16) (5) (4) H22 H Uiso 1 1 calc C23 C (19) (16) (5) (3) C24 C (19) (15) (5) (3) H24 H Uiso 1 1 calc C25 C (19) (15) (5) (3) C26 C (19) (16) (5) (3) C27 C (19) (16) (5) (3) C28 C (19) (16) (5) (3) C29 C (19) (16) (5) (4) H29 H Uiso 1 1 calc C30 C (19) (15) (5) (3) C31 C (2) (18) (5) (4) H31A H Uiso 1 1 calc H31B H Uiso 1 1 calc H31C H Uiso 1 1 calc C32 C (2) (18) (5) (4) H32A H Uiso 1 1 calc H32B H Uiso 1 1 calc H32C H Uiso 1 1 calc O11 O (2) (19) (4) (5) Uani 1 1 d D.. H1O H 0.606(3) 0.942(3) (9) Uiso 1 1 d D.. H2O H 0.478(3) 1.024(3) (8) Uiso 1 1 d D.. O12 O (2) (14) (4) (4) Uani 1 1 d D.. H3O H 0.329(3) 0.228(2) (7) Uiso 1 1 d D.. H4O H 0.240(3) 0.348(2) (7) Uiso 1 1 d D.. loop atom_site_aniso_label _atom_site_aniso_u_11 _atom_site_aniso_u_22 _atom_site_aniso_u_33 _atom_site_aniso_u_23 _atom_site_aniso_u_13 _atom_site_aniso_u_12 O (7) (6) (6) (5) (5) (5) O (10) (7) (6) (6) (7) (7) O (8) (6) (6) (5) (6) (6) O (7) (6) (5) (5) (5) (5) O (6) (6) (6) (5) (5) (5) N (7) (7) (7) (6) (6) (6) C (8) (8) (8) (6) (7) (6) C (8) (8) (8) (6) (6) (7) C (8) (7) (8) (7) (7) (7) C (9) (8) (8) (7) (7) (7) C (8) (9) (8) (7) (7) (7) C (8) (8) (8) (7) (7) (7) C (8) (8) (8) (7) (7) (7) C (8) (8) (7) (6) (6) (7) C (8) (8) (8) (6) (6) (6) C (8) (8) (8) (7) (7) (7) C (8) (8) (8) (6) (7) (7) C (8) (8) (8) (7) (7) (7) C (8) (7) (8) (6) (7) (7) C (8) (8) (8) (7) (7) (7) C (9) (9) (9) (7) (7) (8) C (10) (8) (8) (7) (8) (8) N (7) (7) (7) (6) (6) (6) O (7) (6) (5) (5) (6) (6) O (7) (7) (6) (5) (5) (6) O (6) (8) (6) (6) (5) (6) O (6) (7) (6) (5) (5) (6) O (6) (6) (6) (5) (5) (5) C (8) (8) (8) (6) (7) (6) C (8) (7) (8) (6) (7) (6) C (8) (8) (8) (7) (7) (7) C (9) (8) (8) (7) (7) (7) C (10) (8) (8) (7) (7) (8) C (9) (8) (8) (6) (7) (7) C (8) (8) (8) (7) (7) (7) C (8) (7) (8) (6) (7) (6) C (8) (7) (8) (6) (7) (7) C (8) (8) (8) (7) (7) (7)