The rapid increase in obesity prevalence is one of the

Transcription

1 Dual Metabolic Defects Are Required to Produce Hypertriglyceridemia in Obese Subjects Marja-Riitta Taskinen, Martin Adiels, Jukka Westerbacka, Sanni Söderlund, Juhani Kahri, Nina Lundbom, Jesper Lundbom, Antti Hakkarainen, Sven-Olof Olofsson, Marju Orho-Melander, Jan Borén Downloaded from by guest on July 1, 2018 Objective Obesity increases the risk of cardiovascular disease and premature death. However, not all obese subjects develop the metabolic abnormalities associated with obesity. The aim of this study was to clarify the mechanisms that induce dyslipidemia in obese subjects. Methods and Results Stable isotope tracers were used to elucidate the pathophysiology of the dyslipidemia in hypertriglyceridemic (n 14) and normotriglyceridemic (n 14) obese men (with comparable body mass index and visceral fat volume) and in normotriglyceridemic nonobese men (n 10). Liver fat was determined using proton magnetic resonance spectroscopy, and subcutaneous abdominal and visceral fat were measured by magnetic resonance imaging. Serum triglycerides in obese subjects were increased by the combination of increased secretion and severely impaired clearance of triglyceride-rich very-low-density lipoprotein 1 particles. Furthermore, increased liver and subcutaneous abdominal fat were linked to increased secretion of very-low-density lipoprotein 1 particles, whereas increased plasma levels of apolipoprotein C-III were associated with impaired clearance in obese hypertriglyceridemic subjects. Conclusion Dual metabolic defects are required to produce hypertriglyceridemia in obese subjects with similar levels of visceral adiposity. The results emphasize the clinical importance of assessing hypertriglyceridemic waist in obese subjects to identify subjects at high cardiometabolic risk. (Arterioscler Thromb Vasc Biol. 2011;31:00-00.) Key Words: apolipoproteins lipoproteins metabolism obesity The rapid increase in obesity prevalence is one of the major health problems in Western societies and a growing problem in developing countries. 1 Obesity is commonly associated with several metabolic complications, including insulin resistance, type 2 diabetes, dyslipidemia, hypertension, gout, and increased risk of cardiovascular disease. However, obesity is heterogeneous with respect to its adverse metabolic consequences and cardiovascular disease risk, and up to 20% to 30% of obese subjects seem to be metabolically normal. 2 In unhealthy obesity, the adipose tissue storage capacity is exceeded, which results in ectopic lipid accumulation in several tissues, including liver, skeletal muscle, pancreas, and heart. 3 Ectopic fat deposition is reported to associate with a plethora of cardiometabolic risk factors. 1,4 In particular, several epidemiological studies indicate that nonalcoholic fatty liver disease (NAFLD), especially in its more severe forms, is linked to an increased risk of cardiovascular disease, independently of underlying cardiometabolic risk factors. 5 7 This suggests that NAFLD is not merely a marker of cardiovascular disease but may also be actively involved in its pathogenesis. NAFLD is the most common cause of chronic liver disease, with a prevalence of approximately 20% to 30% in the general population and 70% to 80% in patients with type 2 diabetes. 8 We have recently shown that the deposition of fat in the liver is a stronger determinant of increased secretion of the largest triglyceride-rich lipoproteins, very low-density lipoproteins (VLDL 1 ), than body mass index (BMI), insulin resistance, and visceral fat volume. 9 Furthermore, the overproduction of VLDL 1 is linked to the development of an atherogenic dyslipidemia characterized by low high-density lipoprotein cholesterol, hypertriglyceridemia, and an accumulation of small, dense low-density lipoproteins. 10 The relation between liver fat volume and secretion of VLDLapolipoprotein B100 (apob100) has also recently been shown in obese subjects, 11 and the increased secretion of VLDL 1 - triglycerides in obese subjects with NAFLD has been considered to explain the hypertriglyceridemia in these subjects However, it should be recognized that serum triglyceride levels are dependent not only on the secretion capacity but also on the removal capacity of triglyceride-rich Received on: February 2, 2011; final version accepted on: June 1, From the Department of Medicine (M.-R.T., J.W., S.S., J.K.) and Helsinki Medical Imaging Center (N.L., J.L., A.H.), University of Helsinki, Helsinki, Finland; Department of Molecular and Clinical Medicine, University of Gothenburg, Gothenburg, Sweden (M.A., S.-O.O., J.B.); Department of Clinical Sciences, Lund University, Malmö, Sweden (M.O.-M.). Correspondence to Jan Borén, Wallenberg Laboratory, SE Gothenburg, Sweden. jan.boren@wlab.gu.se 2011 American Heart Association, Inc. Arterioscler Thromb Vasc Biol is available at DOI: /ATVBAHA

2 2 Arterioscler Thromb Vasc Biol September 2011 Downloaded from by guest on July 1, 2018 lipoproteins. The clearance of triglyceride-rich lipoproteins from the circulation is complex and includes both hydrolysis of triglycerides and the consequent removal of remnant particles by the liver. An important modulator of the metabolism of triglyceride-rich lipoproteins in humans is apolipoprotein C-III (apoc-iii) Total plasma apoc-iii levels have been identified as a major determinant of serum triglycerides, and epidemiological studies have demonstrated that atherogenic lipoproteins containing apoc-iii independently predict coronary heart disease. 19,20 Recent studies have also shown that genetic variants in apoc-iii are associated with NAFLD and insulin resistance. 21,22 In this study, we performed kinetic studies to determine the rate of secretion and turnover of triglycerides and apob100 in triglyceride-rich VLDL 1 and smaller VLDL 2 lipoproteins to further our understanding of why some, but not all, obese subjects develop dyslipidemia. Specifically, we tested whether hypertriglyceridemia in obese men with similar BMI and waist circumference is caused solely by increased hepatic secretion of VLDL 1 induced by increased liver fat. Our results show for the first time that the serum concentration of triglycerides in obese subjects is increased by dual metabolic defects, namely the combination of increased secretion (linked to increased liver and subcutaneous abdominal fat) and severely impaired clearance of triglyceride-rich VLDL 1 particles (associated with increased plasma levels of apoc- III). These results provide new insights into the pathophysiology of dyslipidemia in obesity. Materials and Methods Study Subjects Obese men were recruited by advertisements in local newspapers. Inclusion criteria included BMI 27 kg/m 2, waist circumference 96 cm, and no known diagnoses other than hepatic steatosis. The obese subjects were divided into 2 groups according to their level of serum triglycerides and matched, as well as possible, for BMI and waist circumference. In total, we recruited 14 obese normotriglyceridemic (NTG) men (serum triglycerides 1.7 mmol/l) and 14 obese hypertriglyceridemic (HTG) men (serum triglycerides 1.7 mmol/l). In addition, we selected 10 nonobese NTG men (BMI 27 kg/m 2, waist circumference 96 cm, serum triglycerides 1.7 mmol/l) from our database of performed kinetic studies. 9,13,23,24 None of the subjects were taking lipid-lowering treatment or any other drug modifying lipid measures. The study design was approved by the local ethics committee, and each subject gave written informed consent before participation in the study. All samples were collected in accordance with the Helsinki Declaration. Kinetic Protocol, Isolation of Lipoproteins, and Biochemical Analyses The subjects were admitted at 7:30 AM, and baseline blood samples were taken. At 8:00 AM, a bolus injection of [1,1,2,3,3-2 H 5 ]glycerol (500 mg) and [5,5,5-2 H 3 ]leucine (7 mg/kg) was given and blood was drawn as previously described. 24 Isolation of VLDL 1 and VLDL 2 and measurements of enrichment of leucine in apob100 and glycerol in triglycerides were performed as described. 24 Total apob100 and triglyceride content in VLDL 1 and VLDL 2 were determined at 0, 4, and 8 hours after tracer injection. Biochemical analyses were performed, and low-density lipoprotein peak size was measured as described. 13 Table 1. Subject Characteristics Nonobese NTG (n 10) Obese NTG (n 14) Obese HTG (n 14) Waist, cm * * BMI, kg/m * * Age, y Weight, kg * Serum TG, mmol/l * Cholesterol, mmol/l HDL cholesterol, mmol/l * LDL peak size, nm * ApoB, mg/dl Plasma glucose, mmol/l Insulin, mu/l HOMA-IR LPL mass, ng/ml NA Data are mean SEM. The groups were compared using 1-way ANOVA followed by a post hoc test with Bonferroni correction of P values. NTG indicates normotriglyceridemic; HTG, hypertriglyceridemic; BMI, body mass index; TG, triglycerides; HDL, high-density lipoproteins; LDL, low-density lipoproteins; apo, apolipoprotein; HOMA-IR, homeostasis model assessment of insulin resistance; LPL, lipoprotein lipase. *P vs nonobese NTG. P 0.05 vs nonobese NTG. P vs obese NTG. P 0.01 vs obese NTG. P 0.01 vs nonobese NTG. Kinetic Modeling Times series data from enrichments of plasma leucine, leucine in apob100 from VLDL 1 and VLDL 2, and glycerol from triglycerides from VLDL 1 and VLDL 2 were used as inputs to the kinetic model together with pool size measurements to simultaneously determine the kinetics of VLDL-triglycerides and apob Determination of Liver, Subcutaneous, and Visceral Fat Liver fat was determined using proton magnetic resonance spectroscopy, and subcutaneous abdominal and visceral fat were measured by magnetic resonance imaging as described. 25 Genetic Studies The single-nucleotide polymorphisms rs (455T C) and rs (482C T) in apoc-iii were analyzed in 7 of the nonobese NTG subjects, 12 of the obese NTG subjects, and 14 of the obese HTG subjects as described. 21 Statistical Analysis The 3 groups were compared with 1-way ANOVA with subsequent Bonferroni corrected post hoc test. Bivariate correlations were performed using linear correlations (Pearson). Multivariate correlation analyses were performed as stepwise linear regression analysis, with an a priori exclusion of parameters using a bivariate correlation with a significance level above For all analyses, a 2-tailed significance level below 0.05 was considered significant. Results Basic Characteristics The basic characteristics of the study subjects are presented in Table 1. The obese HTG subjects showed all features of an atherogenic dyslipidemia with hypertriglyceridemia, low

3 Taskinen et al Mechanism for Dyslipidemia in Obese Subjects 3 Downloaded from by guest on July 1, 2018 Figure 1. A, Visceral fat; B, subcutaneous abdominal fat; C, liver fat content; D, very-low-density lipoprotein 1 -triglyceride (VLDL 1 -TG) secretion rate (SR); E, VLDL 1 -TG fractional catabolic rate (FCR); F, plasma apoc-iii concentration in nonobese (n 10) and obese (n 14) normotriglyceridemic (NTG) and obese (n 14) hypertriglyceridemic (HTG) men. NS indicates nonsignificant. *P 0.05, **P 0.01, ***P high-density lipoprotein cholesterol, smaller low-density lipoprotein peak diameter, and a high concentration of apob. The obese HTG subjects had elevated insulin levels and higher homeostasis model assessment of insulin resistance compared with both the nonobese and obese NTG subjects, but plasma glucose levels were comparable between the groups. The serum triglycerides and apob were comparable in the nonobese and obese NTG subjects. The visceral fat content was comparable in the obese NTG and HTG subjects but significantly higher in these 2 groups than in the nonobese NTG subjects (Figure 1A). In contrast, there was a stepwise increase in the subcutaneous abdominal (Figure 1B) and liver fat content between the nonobese NTG, obese NTG, and obese HTG subjects (Figure 1C). Further subdivision of visceral and subcutaneous fat into subcompartments revealed that in the 2 obese cohorts, the intraperitoneal and retroperitoneal fat depots were comparable, indicating that total visceral fat volume is a good marker. There was a trend toward a difference in superficial subcutaneous fat (Supplemental Figure I, available online at Liver and Subcutaneous Abdominal Fat as Predictors of Serum Triglycerides and VLDL 1 Secretion Liver fat correlated with serum triglycerides (all: r 0.46, P 0.01; obese: r 0.36, P 0.06). Likewise, subcutaneous abdominal fat correlated with serum triglycerides (all: r 0.55, P 0.001; obese: r 0.41, P 0.05). Kinetic studies showed that obese HTG subjects displayed a significantly increased secretion of VLDL 1 -triglycerides and apob100 compared with nonobese NTG subjects and that obese NTG subjects showed a clear trend for increased secretion of VLDL 1 -triglycerides and apob100 (Figure 1D and Table 2). The VLDL 1 -triglyceride and apob100 secretion rates in both the total cohort and the obese subjects correlated with liver fat and subcutaneous abdominal fat (Figure 2A and 2B and Supplemental Tables I and II). In contrast, visceral fat correlated positively with VLDL 1 -triglyceride and apob100 secretion only in the total cohort and not in the obese subjects (Figure 2C and Supplemental Tables I and II). Correlation analysis further revealed that deep subcutaneous fat correlated with VLDL 1 -triglyceride (r 0.47, P 0.05) and apob100 (r 0.46, P 0.05) secretion rates, whereas superficial subcutaneous fat did not. A multivariate regression analysis with fat compartments as independent variables and VLDL 1 -triglyceride or apob100 secretion rates as dependent variables showed that liver fat and subcutaneous abdominal fat were independent predictors of VLDL 1 -triglyceride and apob100 secretion in the total cohort (triglyceride and apob100: P 0.05 for both liver fat and subcutaneous abdominal fat, adjusted r ) but that liver fat was the only independent predictor in the obese subjects (triglyceride and apob100: P 0.01 for liver fat, adjusted r ). In line with our previous results, 13 BMI, waist circumference, insulin, and homeostasis model assessment of insulin resistance also correlated univariately with VLDL 1 -triglyceride and apob100 secretion (Supplemental Tables I and II) but did not remain significant predictors in multivariate analyses (data not shown). Taken together, these data show that liver and subcutaneous abdominal fat are significant predictors for the secretion of VLDL 1 -triglycerides and apob100. However, the variation in VLDL 1 -triglyceride secretion could explain only 27% of the variation in plasma triglycerides in the total cohort and only 17% of the variation in the obese cohort (square of

4 4 Arterioscler Thromb Vasc Biol September 2011 Table 2. Kinetic Parameters Downloaded from by guest on July 1, 2018 Kinetic Parameter Nonobese NTG (n 10) Obese NTG (n 14) Obese HTG (n 14) Triglycerides VLDL 1 SR, mg/kg per d * VLDL 1 FCR, pools/d * VLDL 1 FDCR, pools/d VLDL 1 FTR, pools/d * VLDL 1 pool size, mg/kg VLDL 2 DSR, mg/kg per d VLDL 2 FCR, pools/d VLDL 2 pool size, mg/kg apob100 VLDL 1 SR, mg/kg per d VLDL 1 FCR, pools/d VLDL 1 FDCR, pools/d VLDL 1 FTR, pools/d VLDL 1 pool size, mg/kg VLDL 2 DSR, mg/kg per d VLDL 2 FCR, pools/d VLDL 2 pool size, mg/kg Data are mean SEM. The groups were compared using one-way ANOVA followed by a post hoc test with Bonferroni correction of P values. NTG indicates normotriglyceridemic; HTG, hypertriglyceridemic; VLDL, very-lowdensity lipoprotein; SR, secretion rate; FCR, fractional catabolic rate; FDCR, fractional direct catabolic rate; FTR, fractional transfer rate (FCR FDCR FTR); DSR, direct secretion rate; apo, apolipoprotein. *P 0.01 vs nonobese NTG. P 0.01 vs obese NTG. P 0.05 vs obese NTG. P vs obese HTG. P vs nonobese NTG. P 0.05 vs Non-obese NTG. r-values from univariate regression analysis in Supplemental Tables I and II). Role of the Clearance Capacity of VLDL 1 Particles as a Predictor of Hypertriglyceridemia in Obese Subjects Turnover (measured as fractional catabolic rate [FCR]) of VLDL 1 -triglycerides and apob100 was similar in nonobese and obese NTG subjects and approximately 50% lower in obese HTG subjects (Figure 1E and Table 2). The FCR of VLDL 1 -triglycerides correlated negatively with serum triglycerides in both the obese and the total cohorts (all: r 0.64; P 0.001; obese: r 0.60, P 0.001). Further analysis showed that the decreased turnover of VLDL 1 -triglycerides in the obese HTG subjects was caused by both decreased lipolytic conversion of VLDL 1 to smaller VLDL 2 particles (measured as the fractional transfer rate of VLDL 1 - triglycerides) and decreased direct FCR of VLDL 1, indicating impaired cellular uptake (Table 2). The fractional transfer rate of VLDL 1 -apob100 was also significantly decreased in the obese HTG subjects (Table 2). Interestingly, the decreased lipolytic clearance (measured as the fractional transfer rate) of VLDL 1 particles could explain 46% of the variation in Figure 2. Correlations between very-low-density lipoprotein 1 triglyceride secretion rate (VLDL 1 TG SR) and liver fat (all: r 0.56; P ; obese: r 0.49, P 0.008) (A), subcutaneous abdominal fat (all: r 0.55; P ; obese: r 0.47, P 0.001) (B), and visceral fat (all: r 0.39; P 0.02; obese: r 0.18, NS) (C) and correlations between VLDL 1 TG fractional catabolic rate (VLDL 1 TG FCR) and plasma apoc-iii concentration (all: r 0.57; P ; obese: r 0.56, P 0.002) (D) in both the total cohorts (n 38) and the combined group of normo- and hypertriglyceridemic obese subjects (n 28). Data indicate nonobese normotriglyceridemic subjects (E) and obese normo- and hypertriglyceridemic subjects (F). Linear correlations are shown for the total cohort (solid lines) and for the obese group (dashed lines). plasma triglycerides in the total cohort and 48% in the obese subjects (square of r-values in Supplemental Tables I and II). These data indicate that the combination of increased secretion and delayed clearance of VLDL 1 -triglycerides accounts for the elevation of triglycerides in the obese subjects. Indeed, a multivariate analysis showed that the combination of increased secretion and impaired clearance of triglyceriderich VLDL 1 particles explained approximately 74% of the variation of plasma triglycerides in the total cohort and 69% in the obese cohort (Supplemental Table III). The increased hepatic secretion of lipoproteins was selective for VLDL 1 particles, as there were no significant differences in the secretion or turnover of VLDL 2 -triglycerides or apob100 between any of the groups (except for a small increase in VLDL 2 -triglyceride secretion in the obese HTG subjects) (Table 2). ApoC-III Associates With the Turnover of VLDL 1 and VLDL 2 Particles and Is a Determinant of the Elevation of Serum Triglycerides in Obesity The plasma concentration of apoc-iii showed a stepwise increase between nonobese NTG, obese NTG, and obese HTG subjects (Figure 1F). As expected, apoc-iii levels correlated with serum triglycerides levels in both the obese and total cohorts (all: r 0.53; P 0.001; obese: r 0.42, P 0.05). ApoC-III also correlated with liver fat content (all: r 0.45; P 0.01; obese: r 0.34, P 0.08) but did not correlate with VLDL 1 or VLDL 2 secretion rates (Supplemental Tables I and II). However, apoc-iii strongly correlated with both the fractional catabolic rates and the fractional transfer

5 Taskinen et al Mechanism for Dyslipidemia in Obese Subjects 5 Downloaded from by guest on July 1, 2018 rates of VLDL 1 - and VLDL 2 -triglycerides and apob100 in both the total cohort and the obese subjects (Figure 2D and Supplemental Tables I and II). No measure other than the plasma concentration of apoc-iii correlated with the FCR of VLDL 1 - and VLDL 2 -triglycerides or apob100 (Supplemental Tables I and II). Thus, apoc-iii seems to explain the marked difference in FCR between the 2 obese groups. Importantly, lipoprotein lipase mass concentration in serum was comparable in the 2 obese groups, reinforcing the role of apoc-iii as the inhibitor of lipolysis (Table 1). To assess whether differences in liver fat and apoc-iii levels were associated with the known single-nucleotide polymorphisms rs (455T C) and rs (482C T) in apoc-iii, 21 we analyzed genotype in most of the study subjects (7 nonobese NTG, 12 obese NTG, and 14 obese HTG subjects). The frequency of the risk alleles (at least 1 risk allele/wild-type) were not significantly different between the obese NTG (7/5) and the obese HTG (10/4) subjects. Likewise, there were no differences in liver fat, apoc-iii, serum triglycerides, or any kinetic measure between the noncarriers and the carriers of at least 1 risk allele (Supplemental Tables IV and V). Discussion In this study, we tested the hypothesis that hypertriglyceridemia in obese men with similar BMI and waist circumference is caused by increased hepatic secretion of VLDL (induced by increased liver fat). Unexpectedly, our results show that the hypertriglyceridemia is explained by the combination of increased secretion and severely impaired clearance of triglyceride-rich VLDL 1 particles. The increased liver and subcutaneous abdominal fat are linked to increased secretion of VLDL 1 particles, whereas increased plasma levels of apoc-iii are associated with impaired clearance in obese HTG subjects. These results provide new insights into the pathophysiology of dyslipidemia in obesity. The distribution of fat depots can be highly variable despite equal BMIs. Individuals with increased waist circumference (ie, a surrogate marker of visceral adipose depot) show metabolic dysfunctions and a cardiovascular risk profile, and excess visceral fat is considered to be the culprit of unhealthy obesity. 1,2,4 As visceral fat correlates with liver fat content, it has been difficult to differentiate the adverse metabolic effects of these ectopic fat depots. 13,26,27 Therefore, we designed our study to include 2 obese groups with comparable BMIs and visceral fat volumes. However, the obese HTG subjects had more abdominal subcutaneous fat than the obese NTG subjects. It has been previously shown that the crosssectional area of subcutaneous abdominal fat measured by computed tomography (or magnetic resonance imaging) is closely correlated with total body fat. 28 Therefore, we cannot exclude the possibility that obese HTG subjects, despite not showing difference in BMI, had a greater total body fat content than obese NTG subjects. The secretion rate of large VLDL 1 particles was markedly elevated in the obese HTG group compared with nonobese subjects, and this increased secretion was associated with higher liver fat content. Analysis of how liver, subcutaneous abdominal, and visceral fat volumes correlated with VLDL 1 - triglyceride and apob secretion rates showed that liver fat came out as the strongest predictor, but abdominal fat also remained significant in multiple regression analyses in both the total cohort and in the obese groups. However, it is uncertain whether these relationships are also valid at the population level. Our results reinforce our previous results showing that liver fat content is a driving force for the overproduction of VLDL 1 -triglycerides and apob. 13 The data are supported by recent results showing that increased visceral adipose tissue is not associated with increased secretion of VLDL or insulin resistance without concomitant increase of liver fat. 29 Indeed, substantial evidence has accumulated to indicate the coexistence of hypertriglyceridemia, hepatic steatosis, and insulin resistance independently of visceral adiposity. 2,12,30 The hepatic uptake of fatty acids is not regulated, and as a result, the plasma nonesterified fatty acid (NEFA) concentration is directly related to the influx of fatty acids to the liver. 31 Release of fatty acids from the adipose tissue contributes approximately 80% of fatty acid content to the plasma NEFA. 31 Interestingly, only 20% of NEFA in portal vein plasma NEFA originates from visceral adipose tissue in obese people even in viscerally obese people. 14,32,33 Thus, the contribution of excess NEFA release from visceral fat depots to VLDL-triglyceride secretion remains limited compared with that from other fat depots. 32,34 Our results showed that visceral fat correlated univariately with the secretion rates of VLDL-triglycerides and apob100 in the total cohort but not in the obese group. A tentative explanation for this is that the lipolytic activity in visceral adipose tissue (a function of adipose tissue volume and lipolytic rates) is small compared with subcutaneous adipose tissue lipolytic activity. 32 Thus, the visceral fat is an important regulator of VLDL secretion in moderately, but not in severely, obese subjects. The importance of the subcutaneous abdominal fat volume as a source for plasma NEFA is highlighted by our finding that subcutaneous abdominal fat volume strongly associated with VLDL 1 -triglycerides and apob100 secretion rates in univariate analyses in both the total cohort and the obese group and in multivariate analyses in the total cohort. Our results show that the increased secretion of VLDL 1 - triglycerides explains only a minor part (approximately 17%) of the increased serum triglycerides in the obese subjects. Because it is known that serum triglyceride levels are dependent not only on the secretion capacity but also on the rate of clearance of VLDL 1 -triglycerides, we hypothesized that the elevation of serum triglycerides in obese HTG subjects may also involve a defect in clearance. Indeed, the turnover of VLDL 1 -triglycerides in obese HTG subjects was markedly impaired compared with obese and nonobese NTG subjects. Furthermore, we observed strong inverse correlations between serum triglycerides and the fractional catabolic rate of VLDL 1 -triglycerides and apob in all subjects, as well as in obese subjects, highlighting the importance of VLDL 1 clearance as a determinant of serum triglycerides. A great variability of clearance capacity in obese subjects has been reported by Grundy et al, 35 who recognized an obese group with robust overproduction but normal serum triglyceride levels. However in the majority of obese subjects, both

6 6 Arterioscler Thromb Vasc Biol September 2011 Downloaded from by guest on July 1, 2018 overproduction and impaired clearance of VLDL-triglycerides contributed to the elevation of serum triglyceride levels. Based on our results, we hypothesize that the clearance capacity of VLDL 1 in obese NTG subjects is able to compensate for some increase of VLDL 1 secretion and maintain a normal serum triglyceride concentration. In contrast, the combination of impaired clearance and excess VLDL 1 secretion results in hypertriglyceridemia. Importantly, the impaired clearance explained 48% of the increased serum triglycerides in the obese subjects. Collectively, our data suggest that dual defects are required to produce the elevation of serum triglycerides in obese subjects. Combination of VLDL production and defective clearance has been reported to coexist in familial hypertriglyceridemias also, highlighting the issue that the catabolic rate of VLDL-triglyceride is under genetic control. 36,37 To further elucidate the mechanism for the impaired turnover of triglyceride-rich lipoproteins, we focused on apoc-iii because this apolipoprotein is a determinant of serum total and VLDL-triglycerides, as well as of the VLDL catabolic rate. 16,18 Obese HTG subjects had clearly higher apoc-iii levels than either control subjects or obese NTG subjects. The data are in line with the results of Chan et al, who reported elevation of serum apoc-iii in centrally obese men. 17 As expected, plasma apoc-iii levels correlated negatively with FCR of VLDL 1 -triglycerides and apob as well as fractional transfer rates of VLDL 1 -triglycerides and apob within the obese subjects and the total cohort. Likewise, the FCR of VLDL 2 -triglycerides and apob correlated negatively with plasma apoc-iii levels. Overall, these data highlight the critical importance of apoc-iii in the metabolism of triglyceride-rich lipoproteins as a determinant of the hydrolytic capacity, in accordance with previous studies. 38 Emerging results indicate that apoc-iii is linked not only to the turnover of triglyceride-rich lipoproteins but also to the biosynthesis of VLDL particles. 16,18,39 Interestingly, the transcription factor Forkhead box (Fox) 01 has been shown to regulate the expression of both apoc-iii and the microsomal triglyceride transfer protein, which is involved in hepatic assembly of VLDL. 40 Thus, the expression of apoc-iii is closely linked to the biosynthesis of VLDL particles. Furthermore, recent kinetic data by Pavlic et al suggest that triglyceride-rich lipoprotein-associated apoc-iii production is stimulated by plasma free fatty acids in humans. 41 The authors suggest that fatty acids may increase apoc-iii at the posttranslational level. Collectively, these data indicate that apoc-iii may indeed enhance the production of large VLDL particles in the setting of excess triglyceride availability in the liver as seen in NAFLD. This mechanism would also explain why carriers of apoc-iii variants (482C T and 455T C) have elevated serum triglycerides and apoc-iii and also an increased prevalence of NAFLD. 21 In our study, we could not confirm these results, and larger replication studies are needed to verify the suggested association between these single-nucleotide polymorphisms and liver fat content. However, we did observe a small but significant correlation between serum apoc-iii levels and liver fat content. It would have been interesting to measure apoc-iii kinetics concomitantly with VLDL-triglyceride and apob kinetics. However, we were unable to do this because we did not have enough samples of VLDL subspecies, and therefore we cannot address the role of apoc-iii as a potential stimulator of VLDL production. Likewise, we did not evaluate the lipoprotein lipase activity, which would have given more direct information on the impact of apoc-iii in the lipolytic process. However, lipoprotein lipase mass concentration in serum was comparable in the 2 obese groups, reinforcing the role of apoc-iii as the inhibitor of lipolysis. Furthermore, it is not possible to address molecular mechanisms at the level of the liver in an in vivo human study, and thus we cannot rule out the option that the relationship between apoc-iii and liver fat is secondary. It would also have been interesting to characterize the VLDL 1 and VLDL 2 particles in terms of apoc-iii content, as recent results show that there may be distinct pools of VLDL with different apoc-iii composition. 42 However, as apoc-iii are loosely attached to the lipoproteins, they may be detached from the lipoproteins during the ultracentrifugation procedure. 43 In conclusion, our study provides novel evidence that dual metabolic defects are associated with hypertriglyceridemia in obese subjects with similar levels of visceral adiposity. Thus, an increased liver fat content represents a dietary- and lifestyle-modifiable metabolic component of hypertriglyceridemia. The results emphasize the clinical importance of assessing HTG waist to identify obese subjects at high cardiometabolic risk. 44 Acknowledgments We are grateful to Hannele Hilden, Helinä Perttunen-Nio, Anne Salo, Virve Naatti, Thomas Larsson, and Eva Hedman-Sabler for excellent laboratory work; Pentti Pölönen for the imaging measures; and Dr Rosie Perkins for scientific editing. Sources of Funding This study was supported by grants from the Swedish Research Council, the Swedish Heart-Lung Foundation, the Swedish Foundation for Strategic Research, Sigrid Juselius Foundation, Clinical Research institute HUCH Ltd, Novo-Nordisk Foundation, and the European Union-funded projects HEPADIP (ESHM-CT ) and ETHERPATHS (FP7-KBBE ). None. Disclosures References 1. Van Gaal LF, Mertens IL, De Block CE. Mechanisms linking obesity with cardiovascular disease. Nature. 2006;444: Stefan N, Kantartzis K, Machann J, Schick F, Thamer C, Rittig K, Balletshofer B, Machicao F, Fritsche A, Haring HU. Identification and characterization of metabolically benign obesity in humans. Arch Intern Med. 2008;168: Tan CY, Vidal-Puig A. Adipose tissue expandability: the metabolic problems of obesity may arise from the inability to become more obese. Biochem Soc Trans. 2008;36: Despres JP, Lemieux I, Bergeron J, Pibarot P, Mathieu P, Larose E, Rodes-Cabau J, Bertrand OF, Poirier P. Abdominal obesity and the metabolic syndrome: contribution to global cardiometabolic risk. Arterioscler Thromb Vasc Biol. 2008;28: Stefan N, Kantartzis K, Haring HU. Causes and metabolic consequences of fatty liver. Endocr Rev. 2008;29: Gastaldelli A, Kozakova M, Hojlund K, Flyvbjerg A, Favuzzi A, Mitrakou A, Balkau B. Fatty liver is associated with insulin resistance, risk of coronary heart disease, and early atherosclerosis in a large European population. Hepatology. 2009;49:

7 Taskinen et al Mechanism for Dyslipidemia in Obese Subjects 7 Downloaded from by guest on July 1, Speliotes EK, Massaro JM, Hoffmann U, Vasan RS, Meigs JB, Sahani DV, Hirschhorn JN, O Donnell CJ, Fox CS. Fatty liver is associated with dyslipidemia and dysglycemia independent of visceral fat: the Framingham Heart Study. Hepatology. 2010;51: Ratziu V, Bellentani S, Cortez-Pinto H, Day C, Marchesini G. A position statement on NAFLD/NASH based on the EASL 2009 special conference. J Hepatol. 2010;53: Adiels M, Westerbacka J, Soro-Paavonen A, Hakkinen AM, Vehkavaara S, Caslake MJ, Packard C, Olofsson SO, Yki-Jarvinen H, Taskinen MR, Boren J. Acute suppression of VLDL1 secretion rate by insulin is associated with hepatic fat content and insulin resistance. Diabetologia. 2007; 50: Adiels M, Olofsson SO, Taskinen MR, Boren J. Overproduction of very low-density lipoproteins is the hallmark of the dyslipidemia in the metabolic syndrome. Arterioscler Thromb Vasc Biol. 2008;28: Chan DC, Watts GF, Gan S, Wong AT, Ooi EM, Barrett PH. Nonalcoholic fatty liver disease as the transducer of hepatic oversecretion of very-low-density lipoprotein-apolipoprotein B-100 in obesity. Arterioscler Thromb Vasc Biol. 2010;30: Fabbrini E, Magkos F, Mohammed BS, Pietka T, Abumrad NA, Patterson BW, Okunade A, Klein S. Intrahepatic fat, not visceral fat, is linked with metabolic complications of obesity. Proc Natl Acad Sci U S A. 2009;106: Adiels M, Taskinen MR, Packard C, Caslake MJ, Soro-Paavonen A, Westerbacka J, Vehkavaara S, Hakkinen A, Olofsson SO, Yki-Jarvinen H, Boren J. Overproduction of large VLDL particles is driven by increased liver fat content in man. Diabetologia. 2006;49: Fabbrini E, Mohammed BS, Magkos F, Korenblat KM, Patterson BW, Klein S. Alterations in adipose tissue and hepatic lipid kinetics in obese men and women with nonalcoholic fatty liver disease. Gastroenterology. 2008;134: Le NA, Gibson JC, Ginsberg HN. Independent regulation of plasma apolipoprotein C-II and C-III concentrations in very low density and high density lipoproteins: implications for the regulation of the catabolism of these lipoproteins. J Lipid Res. 1988;29: Cohn JS, Patterson BW, Uffelman KD, Davignon J, Steiner G. Rate of production of plasma and very-low-density lipoprotein (VLDL) apolipoprotein C-III is strongly related to the concentration and level of production of VLDL triglyceride in male subjects with different body weights and levels of insulin sensitivity. J Clin Endocrinol Metab. 2004;89: Chan DC, Nguyen MN, Watts GF, Barrett PH. Plasma apolipoprotein C-III transport in centrally obese men: associations with very low-density lipoprotein apolipoprotein B and high-density lipoprotein apolipoprotein A-I metabolism. J Clin Endocrinol Metab. 2008;93: Zheng C, Khoo C, Furtado J, Sacks FM. Apolipoprotein C-III and the metabolic basis for hypertriglyceridemia and the dense low-density lipoprotein phenotype. Circulation. 2010;121: Sacks FM, Alaupovic P, Moye LA, Cole TG, Sussex B, Stampfer MJ, Pfeffer MA, Braunwald E. VLDL, apolipoproteins B, CIII, and E, and risk of recurrent coronary events in the Cholesterol and Recurrent Events (CARE) trial. Circulation. 2000;102: Lee SJ, Campos H, Moye LA, Sacks FM. LDL containing apolipoprotein CIII is an independent risk factor for coronary events in diabetic patients. Arterioscler Thromb Vasc Biol. 2003;23: Petersen KF, Dufour S, Hariri A, Nelson-Williams C, Foo JN, Zhang XM, Dziura J, Lifton RP, Shulman GI. Apolipoprotein C3 gene variants in nonalcoholic fatty liver disease. N Engl J Med. 2010;362: Tsai MY, Ordovas JM. APOC3 mutation, serum triglyceride concentrations, and coronary heart disease. Clin Chem. 2009;55: Adiels M, Boren J, Caslake MJ, Stewart P, Soro A, Westerbacka J, Wennberg B, Olofsson SO, Packard C, Taskinen MR. Overproduction of VLDL1 driven by hyperglycemia is a dominant feature of diabetic dyslipidemia. Arterioscler Thromb Vasc Biol. 2005;25: Adiels M, Packard C, Caslake MJ, Stewart P, Soro A, Westerbacka J, Wennberg B, Olofsson SO, Taskinen MR, Boren J. A new combined multicompartmental model for apolipoprotein B-100 and triglyceride metabolism in VLDL subfractions. J Lipid Res. 2005;46: Lundbom J, Hakkarainen A, Fielding B, Soderlund S, Westerbacka J, Taskinen MR, Lundbom N. Characterizing human adipose tissue lipids by long echo time 1H-MRS in vivo at 1.5 tesla: validation by gas chromatography. NMR Biomed. 2010;23: Korenblat KM, Fabbrini E, Mohammed BS, Klein S. Liver, muscle, and adipose tissue insulin action is directly related to intrahepatic triglyceride content in obese subjects. Gastroenterology. 2008;134: Kantartzis K, Machann J, Schick F, Fritsche A, Haring HU, Stefan N. The impact of liver fat vs visceral fat in determining categories of prediabetes. Diabetologia. 2010;53: Klein S, Allison DB, Heymsfield SB, Kelley DE, Leibel RL, Nonas C, Kahn R. Waist circumference and cardiometabolic risk: a consensus statement from Shaping America s Health: Association for Weight Management and Obesity Prevention; NAASO, the Obesity Society; the American Society for Nutrition; and the American Diabetes Association. Diabetes Care. 2007;30: Magkos F, Fabbrini E, Mohammed BS, Patterson BW, Klein S. Increased whole-body adiposity without a concomitant increase in liver fat is not associated with augmented metabolic dysfunction. Obesity (Silver Spring). 2010;18: Fabbrini E, Sullivan S, Klein S. Obesity and nonalcoholic fatty liver disease: biochemical, metabolic, and clinical implications. Hepatology. 2010;51: Tamura S, Shimomura I. Contribution of adipose tissue and de novo lipogenesis to nonalcoholic fatty liver disease. J Clin Invest. 2005;115: Nielsen S, Guo Z, Johnson CM, Hensrud DD, Jensen MD. Splanchnic lipolysis in human obesity. J Clin Invest. 2004;113: Mittendorfer B, Magkos F, Fabbrini E, Mohammed BS, Klein S. Relationship between body fat mass and free fatty acid kinetics in men and women. Obesity (Silver Spring). 2009;17: Gormsen LC, Nellemann B, Sorensen LP, Jensen MD, Christiansen JS, Nielsen S. Impact of body composition on very-low-density lipoproteintriglycerides kinetics. Am J Physiol Endocrinol Metab. 2009;296: E165 E Grundy SM, Mok HYI, Zech L, Steinberg D, Berman M. Transport of very low density lipoprotein triglycerides in varying degrees of obesity and hypertriglyceridemia. J Clin Invest. 1979;63: Sane T, Nikkila EA. Very low density lipoprotein triglyceride metabolism in relatives of hypertriglyceridemic probands: evidence for genetic control of triglyceride removal. Arteriosclerosis. 1988;8: Kesaniemi YA, Grundy SM. Dual defect in metabolism of very-lowdensity lipoprotein triglycerides: patients with type 5 hyperlipoproteinemia. JAMA. 1984;251: Ooi EM, Barrett PH, Chan DC, Watts GF. Apolipoprotein C-III: understanding an emerging cardiovascular risk factor. Clin Sci (Lond). 2008; 114: Sundaram M, Zhong S, Bou Khalil M, Links PH, Zhao Y, Iqbal J, Hussain MM, Parks RJ, Wang Y, Yao Z. Expression of apolipoprotein C-III in McA-RH7777 cells enhances VLDL assembly and secretion under lipid-rich conditions. J Lipid Res. 2010;51: Sparks JD, Dong HH. Foxo1 and hepatic lipid metabolism. Curr Opin Lipidol. 2009;20: Pavlic M, Valero R, Duez H, Xiao C, Szeto L, Patterson BW, Lewis GF. Triglyceride-rich lipoprotein-associated apolipoprotein C-III production is stimulated by plasma free fatty acids in humans. Arterioscler Thromb Vasc Biol. 2008;28: Sacks FM, Zheng C, Cohn JS. Complexities of plasma apolipoprotein C-III metabolism. J Lipid Res. 2011;52: Hiukka A, Fruchart-Najib J, Leinonen E, Hilden H, Fruchart JC, Taskinen MR. Alterations of lipids and apolipoprotein CIII in very low density lipoprotein subspecies in type 2 diabetes. Diabetologia. 2005;48: Arsenault BJ, Lemieux I, Despres JP, Wareham NJ, Kastelein JJ, Khaw KT, Boekholdt SM. The hypertriglyceridemic-waist phenotype and the risk of coronary artery disease: results from the Epic-Norfolk prospective population study. CMAJ. 2010;182:

8 Downloaded from by guest on July 1, 2018 Dual Metabolic Defects Are Required to Produce Hypertriglyceridemia in Obese Subjects Marja-Riitta Taskinen, Martin Adiels, Jukka Westerbacka, Sanni Söderlund, Juhani Kahri, Nina Lundbom, Jesper Lundbom, Antti Hakkarainen, Sven-Olof Olofsson, Marju Orho-Melander and Jan Borén Arterioscler Thromb Vasc Biol. published online July 21, 2011; Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX Copyright 2011 American Heart Association, Inc. All rights reserved. Print ISSN: Online ISSN: The online version of this article, along with updated information and services, is located on the World Wide Web at: Data Supplement (unedited) at: Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online at:

9 Supplement Material Dual metabolic defects underlying the dyslipidemia in abdominal obesity are induced by increased liver fat and apolipoprotein C-III Marja-Riitta Taskinen, Martin Adiels, Jukka Westerbacka, Sanni Söderlund, Juhani Kahri, Nina Lundbom, Jesper Lundbom, Antti Hakkarainen, Sven-Olof Olofsson, Marju Orho-Melander, and Jan Borén Expanded Method Section Supplemental Figure I Supplemental Tables I V

10 Expanded Methods Section: Study subjects. Subject underwent a physical examination and laboratory tests to exclude hepatic diseases (other than hepatic steatosis) and renal, thyroid and hematological abnormalities. Subjects with clinical coronary heart disease, microalbuminuria, total cholesterol >6.2 mmol/l, serum triglycerides >5.0 mmol/l, BMI >40 kg/m 2, or regular daily alcohol consumption over 2 doses (i.e. 5 g pure alcohol) were excluded from the study. The participants abstained from alcohol and physical exercise at leisure time for two days before each examination. Kinetic protocol, isolation of lipoproteins and biochemical analyses All subjects were admitted at 7:30 a.m. to the metabolic ward of the Helsinki University Central Hospital after a 12-h overnight fast. An indwelling cannula was inserted into an antecubital vein for infusions. A second cannula was inserted retrogradely into a heated hand vein to obtain arterialized venous blood for sampling. A saline infusion was started. Thirty minutes later, leucine (5,5,5-D3), 7 mg/kg body weight (bw), and glycerol (1,1,2,3,3-D5), 500 mg (Isotec, Miamisburg, OH), were injected as a bolus. For measurement of free 2 H 3 -leucine concentration in plasma, blood samples were taken before the tracer injection and at 2, 4, 6, 8, 10, 12, 15, 20, 30, and 45 min and 1, 2, 3, 4, 6, and 8 h. For measurement of 2 H 3 -leucine and 2 H 5 -glycerol in VLDL 1 and VLDL 2, blood samples were taken before the injection of tracers and at 15, 30, 45, 60, 75, 90, 120, and 150 min and 3, 4, 5, 6, 7, and 8 h. The particle composition and apob mass of the VLDL 1 and VLDL 2 fractions were determined 30 min before and 0, 4, and 8 h after the injection. The subjects continued to fast until 5 p.m., when the last blood sample was taken. Biochemical analyses TG and cholesterol concentrations in total plasma and in all lipoprotein fractions were determined by automated enzymatic methods (Cobas Mira analyzer, Hoffman-La Roche, Basel, Switzerland). ApoB was analyzed in the plasma lipoprotein fractions. LDL peak particle diameter (LDL size) was measured with 2-10% gradient polyacrylamide gel electrophoresis. Kinetic modeling The measurements of enrichment of free leucine in plasma, VLDL 1 and VLDL 2, enrichment of glycerol in VLDL 1 and VLDL 2, the pool sizes of leucine and glycerol (i.e., derived from apob and TG) in VLDL 1 and VLDL 2, and the known injected amounts of labeled leucine and glycerol were used to determine kinetic parameters using the modeling software SAAMII (SAAM Institute, Seattle, WA) and Matlab. The data were analyzed with two linear compartmental models. Basically, the model consists of four parts; plasma leucine, plasma glycerol, the assembly of lipoprotein and lipoprotein plasma kinetics. The model estimates the fractional direct catabolic rate 2

11 and the fractional transfer rate of VLDL 1 (the sum of these are denoted as the fractional catabolic rate), the fractional catabolic rate of VLDL 2, the secretion rate of VLDL 1 and the direct secretion rate of VLDL 2. For triglycerides, the fractional transfer rate of VLDL 1 represents the fraction of triglycerides being transported to the VLDL 2 fraction and the fractional direct catabolic rate represents removal of whole lipoprotein particles and removal of triglycerides due to hydrolysis. For apob100, the fractional transfer rate of VLDL 1 represents the fraction of lipoprotein particles being transported to the VLDL 2 fraction and the fractional direct catabolic rate represents only removal of whole lipoprotein particles. Genetic Screening Genomic DNA was extracted from whole blood, and participants were genotyped for the SNPs rs and rs in APOC3. Genotypes at SNP s flanking the transcription start site of Apo C3 (position -455, rs , and position -482, rs ) were determined by amplifying the region encompassing the polymorphic sites followed by direct sequencing. The segment of Apo C3 was amplified by polymerase chain reaction using the following primers: 5 GAAGGTGAACGAGAATCAGTCCTG3 and 5 GCCTCGGGCCCATCTCAGCCTTTC-ACACTG 3 ). Compartmentalization of visceral and subcutaneous fat In 13 Obese HTG and 10 Obese NTG subjects we further subdivided visceral and subcutaneous fat. Visceral fat was divided into retroperitonal and intraperitonal visceral fat and subcutaneous fat was divided into superficial and deep subcutaneous fat. Analysis for each patient has been done from one transaxial slice 8 cm above the L4-L5 disc and reported in cm 2, Supplemental figure I. 3

12 Supplementary figure I Superficial SAT (cm 2 ) Retroperitoneal VAT (cm 2 ) A C Obese NTG Obese NTG NS Obese HTG P=0.08 Obese HTG intraperitoneal VAT (cm 2 ) Deep SAT (cm 2 ) B 300 NS D Obese NTG Obese NTG Obese HTG NS Obese HTG Supplemental Figure I. Visceral fat was further subdivided into (A) retro- and (B) intra-peritoneal visceral fat and subcutaneous fat was further subdivided into (C) superficial and (D) deep subcutaneous fat. The analysis was performed on 13 obese HTG and 10 obese NTG subjects. There was trend (P=0.08) for higher superficial subcutaneous fat the obese HTG group. 4