Whole Genome Sequencing of Influenza C Virus. Karin Pachler and Reinhard Vlasak Department of Molecular Biology University Salzburg, Austria

Transcription

1 Whole Genome Sequencing of Influenza C Virus Karin Pachler and Reinhard Vlasak Department of Molecular Biology University Salzburg, Austria

2 1 Introduction Influenza C virus belongs to the Orthomyxoviridae, a virus family divided into five different genera. These genera are influenzaviruses A, B, and C, Thogotovirus, and Isavirus (see Table 1). Orthomyxoviruses are characterised by a segmented single-stranded RNA genome of negative polarity. The genome of influenza A and B viruses is distributed among eight segments, while influenza C viruses harbour only seven RNA segments. Thogotovirus and Isavirus bear six and eight genomic segments, respectively. The seven influenza C virus RNA segments have a total size of approximately 12.9 kb. Genus Members Hosts Influenza A virus Human influenza virus Avian influenza virus Equine influenza virus Porcine influenza virus Human, bird, horse, pig, seal Number of Surface Protein(s) Segments 8 HA, NA Influenza B Influenza B virus Human, seal 8 HA, NA virus Influenza C Influenza C virus Human, pig, dog 7 HEF virus Thogotovirus Thogoto virus, Dhori virus Tick, cow, sheep, 6 Glycoprotein (G) goat, rodents Isavirus Infectious salmon anaemia virus salmon 8 HE Table 1: Overview of the virus family Orthomyxoviridae Influenza A, B, and C viruses not only differ in the number of genomic segments, but also in viral antigens and host range. While influenza B viruses mainly circulate in humans, influenza A viruses infect humans, domestic animals like pigs and horses, and wild birds. Influenza C viruses were isolated from humans and pigs, and the presence of specific antibodies was demonstrated in the serum of dogs as well (Brown et al., 1995, Manuguerra & Hannoun 1992, Manuguerra et al., 1993, Ohwada et al., 1987, Yamaoka et al., 1991). In contrast to influenza A and B viruses, which encode two major surface glycoproteins, influenza C viruses display only one major glycoprotein on their surfaces. Influenza C viruses, which are distributed worldwide, are divided into six antigenic and genetic groups (Matsuzaki et al., 2003, Muraki et al., 1996), and reassortment between cocirculating viruses frequently occurs (Matsuzaki et al., 1994, 2003; Peng et al., 1994). Currently, more than 160 different influenza C virus isolates are known 1. Like all influenza viruses, the influenza C virus is transmitted via aerosol droplets, and it infects the epithelial cells of the upper respiratory tract (Taylor 1951). Infection normally results in mild upper respiratory disease and sometimes in lower respiratory illness in young children (Katagiri et al., 1983, Katagiri et al., 1987, Matsuzaki et al., 2006). Influenza C viruses can provoke seasonal epidemics 1

3 (Matsuzaki et al., 2004). Influenza A viruses are best known to cause influenza virus epidemics and pandemics. Influenza B viruses account for seasonal epidemics of respiratory infections. 2 Structure of Influenza Virus Particle According to electron microscopic analyses, influenza viruses are enveloped viruses occurring in spherical or filamentous forms with an average diameter of 80 to 120 nm (Noda et al., 2006). Their lipid membrane, which is derived from the host cell, carries virus-encoded surface proteins (spikes). These are HA and NA for influenza A and B viruses, and HEF (haemagglutinin-esterase-fusion protein) for influenza C virus. In fig. 1, an influenza C virus particle is schematically illustrated. The HEF protein, which is present as homotrimers, combines the functions of influenza A and B virus HA and NA proteins. In addition, few copies of the glycosylated CM2 protein are inserted into the lipid membrane. The matrix protein (M1) lies beneath the envelope giving rigidity to the virion. M1 is the most abundant protein in the virion. The core of the influenza C virus particle is comprised of viral ribonucleoprotein (RNP) complexes consisting of the viral RNA segments, the three polymerase proteins PB2, PB1, and P3, and the nucleoprotein (NP). The seven negative-sense single-stranded RNA segments, which probably form panhandle/corkscrew-like structures, are fully associated with NP and with the polymerase proteins at their base-paired ends. The RNPs are associated with M1 via electrostatic attraction (Zhirnov & Grigoriev, 1994). Some copies of NEP/NS2 (nuclear export protein/nonstructural protein 2) are incorporated into the virion as well. On the surface of infected cells, influenza C virus was found to form long (500 µm) cord-like structures, and M1 was demonstrated as determinant of these formations (Muraki et al., 2007, Muraki et al., 2004, Nishimura et al., 1990, Nishimura et al., 1994). Figure 1: Schematic representation of an influenza C virus particle. The influenza C virus is made of seven single-stranded RNA segments of negative polarity assembled to vrnp complexes, a lipid membrane derived from the host cell displaying HEF spikes and CM2. M1 lies beneath the envelope, and a small amount of NEP/NS2 proteins is present in the virion.

4 3 Genome Structure and Encoded Proteins of Influenza C Virus Influenza C viruses have a genome of seven single-stranded negative-sense RNA segments. Negativesense means that this RNA is complementary to mrna ( positive sense ). These seven RNA segments code for nine viral proteins. In fig. 2, an overview of the influenza C virus genome is depicted. The three largest influenza C virus segments code for the polymerase proteins PB2, PB1, and P3. The fourth RNA encodes the HEF glycoprotein. The nucleoprotein NP is encoded by the fifth RNA. The RNA segments six and seven are bicistronic genes. The spliced mrna of segment six encodes the matrix protein M1. The unspliced mrna of the segment encodes protein P42, which is cleaved by a signal peptidase to give M1 and CM2 (Hongo et al. 1999, Pekosz & Lamb, 1998). CM2 is a surface glycoprotein, possibly with ion channel activity (Betakova & Hay, 2007, Hongo et al., 2004). RNA seven codes for NS1 (nonstructural protein 1) and, via a spliced mrna, for NEP/NS2 protein. NS1 is an interferon antagonist (Pachler & Vlasak, 2011). NEP/NS2 possesses nuclear export activity (Paragas et al. 2001). It is thought to be engaged in the export of newly synthesised vrnps. The coding regions of the RNAs from all influenza viruses are flanked by 3 and 5 noncoding (nc) ends. The ultimate nucleotides of the nc ends are conserved among all segments of the respective influenza genus, and these conserved regions are followed by segment-specific nc regions. Figure 2: Genome structure of influenza C/JJ/50 virus. The seven RNA segments are shown in positive-sense orientation. Numbers indicate the nucleotide positions along the segments. The lines at the 3 and 5 ends represent the noncoding regions. The V-shaped lines in segments six and seven indicate introns. M1 is encoded by a spliced transcript of segment six, into which stop codon TGA is introduced as a result of splicing. P42 is encoded by a collinear transcript of segment six. It is cleaved by a signal peptidase at an internal cleavage site (black arrow) to generate M1 and CM2. RNA segment seven codes for NS1 and, from a spliced mrna, for NEP/NS2. In the C-terminal region of NEP/NS2 (grey area) the ORF is +1.

5 4 The Different RNA Species in Influenza Viruses and the Role of the Noncoding RNA Ends The influenza virions are packaged with segments of negative-sense vrna. Each of these genomic vrnas contains noncoding sequences at its 3 and 5 ends that flank the coding region. The sequence and length of the nc ends vary between the vrna segments. For influenza C virus strain C/JJ/50, the 5 nc region consists of 19 nucleotides (segment PB2) to 102 nucleotides (segment NP), and the 3 nc region has between 17 nucleotides (segment PB1) and 29 nucleotides (segment NP). But the ultimate nucleotides of the nc ends are conserved between all segments. Table 2 shows these conserved ends for an influenza C virus strain. In the course of the influenza virus life cycle, the vrnas are transcribed into mrnas. The mrnas are incomplete complementary copies of the vrnas and are capped and polyadenylated. For replication of the viral genome, full-length positive-sense copies of the vrnas are generated as intermediate products. These RNA species are termed complementary RNAs (crnas) and are complete complementary copies of the vrnas. The crnas in turn serve as templates to manifold the vrnas (reviewed in Neumann et al., 2004). Segment 3 nc end (ultimate 20 nucleotides) a 5 nc end (first 20 nucleotides) a PB2 b UCCAAUCCUCUGCUUCUGCU AGCAGUAGCAAGAGGAUUUU PB1 b CAUAAUCCUCUGCUUCUGCU AGCAGUAGCAAGAGGAUUUU P3 UCGGAUCCCCUGCUUCUGCU AGCAGUAGCAAGGGGAUUUU HEF AUUAAACCCCUGCUUCUGCU AGCAGUAGCAAGGGGAUUUU NP b CAAAAUCUCCUGCUUCUGCU AGCAGUAGCAAGGAGAUUUU M AGAAAUCCCCUGCUUCUGCU AGCAGUAGCAAGGGGAUUUU NS b AAAGUACCCCUGCUUCUGCU AGCAGGAGCAAGGGGUUUUU Table 2: Comparison of the conserved 3 and 5 noncoding ends of the vrna segments from influenza C/JJ/50 virus (from Pachler et al., 2010). a Underlined: Conserved sequences. b In bold: Variations at positions 12, 13, 6, 13 and 14 (5 nucleotides are marked with a prime). Note that sequences are shown in 5-3 orientation and numbering of nucleotides starts from both ends. For proper transcription and replication of the vrnas, the nc regions play a crucial role. Most studies to elucidate nature and function of the nc ends were carried out with influenza A viruses. The conserved 3 and 5 ends were found to be partially complementary to each other, which allows a basepaired double-stranded region of four to eight nucleotides between the 3 and 5 ends for influenza A virus strains. This partially double-stranded region was first described as a panhandle/fork structure (Fodor et al., 1994, Hsu et al., 1987). Later, the corkscrew model was introduced (Flick & Hobom 1999, Flick et al., 1996) suggesting that the base-paired region is flanked by local secondary structures at the ultimate nucleotides (see figure 3A). The conserved noncoding ends were found to be required for activity of vrna and crna promoters (Fodor et al., 1995, Fodor et al., 19945, Pritlove et al., 1995, Tiley et al., 1994), endonuclease activity of the viral polymerase complex (Cianci et al., 1995, Hagen et al., 1994), and mrna polyadenylation (Li & Palese, 1994, Luo et al., 1991, Pritlove et al., 1998).

6 The importance of the nc regions was also proved for influenza C viruses. Crescenzo-Chaigne et al. (Crescenco-Chaigne et al., 1999, Crescenco-Chaigne & van der Werf 2001) found that a model RNA flanked by the nc regions of segment NS from influenza C/JHB/1/66 virus was transcribed in COS-1 cells under the presence of the viral polymerase proteins (PB2, PB1, P3) and the nucleoprotein (NP). They could thus demonstrate that the nc regions of influenza C virus are involved in replication and transcription of the viral genome. In a study to generate recombinant influenza C viruses (Pachler et al. 2010), we found that a single mutation within the proposed double-stranded region of the nc ends of one segment prevented the rescue of recombinant influenza C viruses. The single mutation was at position 13 of the 5 -end of segment PB1 and abolished base-pairing of nucleotides 13 and 12 (see figure 3B, note that 5 nucleotides are marked with a prime). When this single mutation was complemented by a mutation at position 12 of the 3 -end of PB1, which restored base-pairing between nucleotides 13 and 12, a recombinant virus was gained. But this virus was impaired in growth. Therefore, not only the ability to form base-paired parts, but also the exact nucleotide sequence at the panhandle/corkscrew region of the nc ends is of major importance for a proper viral life cycle. Figure 3: Representation of the noncoding terminal sequences of a viral segment (segment PB1) of influenza C virus in the corkscrew model in A (Crescenzo-Chaigne et al., 2001, Flick et al., 1996). In B, single and base-pair mutations at positions 13 and 12 within the proposed six base pairs long double-stranded region of the nc end of PB1 from influenza C virus are depicted. Picture taken from Pachler et al., Strategy for Whole Genome Sequencing of Influenza C Virus As outlined in the previous chapter, the nucleotide sequences of the nc viral ends are extremely important for viral life cycle. Therefore, a thorough approach to determine the entire genome of an influenza virus must include the nc ends as well. In contrast to DNA, which can be sequenced directly and bears two complementary strands both applicable for sequencing, the influenza virus RNA must first be reverse-

7 transcribed and PCR-amplified. As a consequence, sequences beyond both ends are needed for primer annealing to produce PCR fragments, which may then be sequenced. And to obtain such sequences beyond the ends is the major challenge in sequencing an RNA virus. To identify the viral 5 - and 3 -ends of all seven RNA segments from influenza virus strain C/JJ/50, we applied the SMART-RACE technique. 5.1 Overview of SMART-RACE Method The SMART technology was developed by Clontech, Inc. SMART stands for switching mechanism at RNA termini and is a method for synthesis of first strand cdna from a 3 polyadenylated RNA template (see figure 4). The conversion of RNA to cdna is catalysed by M-MuLV-RT (Moloney Murine Leukemia Virus Reverse Transcriptase) mutated in the RNase H domain. M-MuLV-RT possesses not only reverse transcription activity, but also terminal deoxynucleotidyl transferase (TdT) activity. It has therefore the very useful feature to add a few nontemplate deoxycytosines (d(c)) to the 3 -end of a newly synthesised cdna strand. Reverse transcription of the RNA starts from an oligo-d(t) primer that anneals to the poly(a) tail of the RNA (primer TRsa in fig. 4). The oligo-d(t) primer additionally contains a defined sequence at the 5 -end, which serves as target site for the subsequent PCR amplification of the viral 3 -end. Figure 4: Schematic outline of cdna synthesis using the SMART method with oligo-(d)t primer TRsa and template-switching primer TS according to Matz (Matz 2003). A second primer is added to the RT reaction, the so-called template-switch (TS) primer. This primer harbours an oligo(rg) sequence at its 3 -end. Upon reaching the 5 -end of the RNA template, the M- MuLV-RT adds a few nontemplate d(c) residues to the 3 -end of the cdna due to its TdT activity. The oligo(rg) of the TS primer consequently anneals to the un-templated d(c) residues, and the M-MuLV-RT switches the templates and continues reverse transcription with the TS primer as template. The TS primer also contains a defined sequence at its 5 -end, which is then the target site for primer annealing in the subsequent PCR amplification of the viral 5 -end. With this technique, first strand cdna is generated

8 with defined 5 - and 3 -end sequences flanking the sequence of the starting RNA. Subsequently, the unknown 5 - and 3 -ends of the RNA can be amplified by RACE-PCR (rapid amplification of cdna ends- PCR). For RACE-PCR (see fig. 5), the 5 -end of the cdna (corresponding to the 3 -end of the vrna) is PCR-amplified with a primer annealing to the cdna internally together with the oligo-d(t) primer (TRsa). The 3 -end of the cdna (corresponding to the 5 -end of the vrna) is manifolded with a primer containing the defined sequence of the TS oligo (but lacking the oligo(rg), termed TS-PCR) along with an internal primer specific for the cdna. The PCR fragments can then be sequenced. Figure 5: Schematic outline of 5 - and 3 -RACE-PCR for amplification of viral noncoding regions (ncr) starting from cdna. 5.2 Protocol for Sequencing the Influenza C/JJ/50 Virus Genome We performed the SMART-RACE technique with modifications according to Matz (Matz 2003). As the starting material required is polyadenylated RNA, we first attached a poly(a) tail to the 3 end of isolated vrna with a commercially available poly(a) kit. For SMART, we added the oligos TRsa (5 -CGCAGTCGGTACTTTTTTTTTTTTTTTTTTCA- 3 ) and TS (5 -AAGCAGTGGTATCAACGCAGAGTACGCrGrGrG-3 ). At the end of the first strand cdna synthesis reaction, MnCl 2 was added to the reaction mix, as it increases the efficiency of nontemplate C addition to the cdna and thus results in higher yield following cdna amplification (Matz 2003). The exact protocol for cdna synthesis was the following: First strand cdna synthesis µl poly(a)-vrna, containing approximately 5 µg vrna - 1 µl primer TRsa (10 µm) - 1 µl primer TS (10 µm) incubated at 65 C for 5 minutes and at 4 C for 5 minutes, then addition of: - 4 µl 5x M-MuLV RT buffer - 2 µl dntps (10 mm) µl RNasin Plus RNase inhibitor (20 U), Promega incubated at 37 C for 5 minutes, then addition of: - 1 µl M-MuLV RT (200 U, RevertAid TM H Minus RT, Fermentas)

9 incubated at 42 C for 1 hour, then addition of: - 2 µl MnCl 2 (25 mm) incubated at 42 C for 15 minutes and at 70 C for 10 minutes, kept at 4 C This cdna was then used as template for amplification of the nc ends from all seven viral segments. For each influenza C virus segment, the 5 nc end was manifolded with an internal primer specific for the respective viral segment s coding region and primer TS-PCR (5 - AAGCAGTGGTATCAACGCAGAGT-3 ), while the 3 end was manifolded with primer TRsa together with a primer specific for the segment s coding region. (see fig. 5). Sequences for segment-specific internal forward and reverse primers were taken from published sequences of other influenza C viruses. In the course of determining the genomic sequences of the seven entire segments from strain C/JJ/50, the regions serving as internal primer binding sites for nc ends amplification were exactly sequenced as well. The exact protocol for RACE-PCR was the following: RACE-PCR reaction mix (25 µl): µl cdna µl primer TRsa or primer TS-PCR (both 10 µm) µl segment-specific reverse primer or segment-specific forward primer (both 10 µm) µl dntps (2 mm) - 5 µl 5x buffer µl DNA polymerase (Herculase II Fusion DNA polymerase, Stratagene) µl H 2 O PCR programme: Denaturation 95 C 20 sec. Denaturation 95 C 20 sec. Annealing 60 C 1 min. 30 cycles Elongation 72 C 1 min. Final elongation 72 C 4 min. Final hold 4 C After amplification of the ends from all seven segments, the ends could be sequenced by standard methods, employing internal segment-specific primers. Once the ends of the seven viral segments had been determined (see table 2 for sequences of the conserved viral ends), the full-length segments were PCR-amplified with primers complementary to the last 12 nucleotides of the 5 and 3 nc ends. The entire segments were then sequenced with overlapping internal primers. Again, the sequences of these internal primers were taken from published sequences of other influenza C virus strains, and the regions, where the internal sequencing primers had annealed to, were covered by sequencing of overlapping regions. The resulting partial sequences can then be compiled and aligned with the help alignment software. Crescenzo-Chaigne (Crescenco-Chaigne & van der Werf 2007) applied a different method to identify the nc ends of influenza C/JHB/1/66 virus. For sequencing of the 3 -ends, they first also polyadenylated the vrnas. cdna fragments complementary to the 3 -viral ends were then prepared with AMV-RT (Avian Myeloblastosis Virus Reverse Transcriptase) and an oligo-d(t) as primer. Amplification of the

10 fragments was performed with an anchored oligo-d(t) together with an internal primer specific for the coding sequence of each of the seven vrnas. For sequencing of the 5 -ends, they first reversetranscribed each of the seven vrnas with primers specific for the respective coding sequences. The cdnas were then elongated with a TdT in the presence of datp. Afterwards, the cdnas containing poly(a) were amplified in two steps with an anchored oligo-d(t) primer together with oligos specific for the coding region of each segment. This protocol is a bit more laborious than the SMART-RACE-PCR protocol we applied. With the SMART-RACE-PCR method, only a single reverse transcription reaction is required to obtain cdnas of all seven influenza C virus segments covering both viral ends at once. In contrast, with the protocol used by Crescenzo-Chaigne (Crescenco-Chaigne & van der Werf 2007), one reverse transcription reaction has to be performed to get cdnas of the seven viral 3 -ends, and seven separate reverse transcription reactions are necessary to obtain cdnas of every segment s 5 -end. Moreover, sequence analysis of the 5 -ends requires an additional polyadenylation step of the seven cdnas as well as two rounds of PCR amplification. In summary, this protocol is more time-consuming and also more vrna template-consuming. On the other hand, weak template switching during cdna synthesis according to the SMART method can lead to low PCR product yields for the viral 5 -ends. Yields may be higher with the more complicated protocol described by Crescenzo-Chaigne (Crescenco-Chaigne & van der Werf 2007), where cdnas of the seven 5 -ends are polyadenylated prior to PCR amplification. For larger vrnas, the SMART method may also require to synthesise cdnas corresponding to the viral 5 - and 3 -ends separately. However, the SMART-RACE-PCR is a simple and fast method for sequence analysis. With the sequence information obtained by the SMART-RACE-PCR method for influenza C virus strain C/JJ/50, we were able to rescue recombinant influenza C viruses and to study the effect of mutations within the nc ends (Pachler et al., 2010). SMART-PCR can be applied for sequence determination of other RNA viruses as well. Any RNA can be manifolded with this method, and gene hunters often use this technique to reverse-transcribe and amplify mrna pools from diverse tissues. 6 Comparison of the Genomic Sequences of Different Influenza C Virus Strains In the 1980s, the complete cdna sequences including the nc regions of segments PB2, PB1, P3, and M from influenza C/JJ/50 virus were published (Yamashita et al., 1989, Yamashita et al., 1988), as well as partial sequences from other influenza C virus strains (Clern-van Haaster, 1984, Desselberger et al, 1980). Applying the SMART-RACE technique, we could easily sequence the nc regions of all seven segments from influenza C/JJ/50 virus and afterwards elucidate the entire genomic sequence of this strain (see table 3). We identified some differences in comparison to the published sequences from the 1980s (Pachler et al. 2010). Only segment P3 from C/JJ/50 does not show any difference compared to the one sequenced by Yamashita et al. (Yamashita et al., 1989). Two other groups have also sequenced the entire genomes of other influenza C virus strains, namely influenza C/JHB/1/66 virus (Crescenzo-Chaigne & van der Werf 2007) and influenza C/Ann Arbor/1/50 virus (Muraki et al., 2007). With the aid of alignment programmes (like Multalin, or ClustalW2, the nucleotide sequences of different influenza

11 virus strains can be compared. In such an approach to compare the nucleotide sequences of the three fully sequenced influenza C virus strains, we found high sequence identities (97 to 99.15%) between the respective segments of these strains (see table 4). Notable differences were within segments NP and NS. The NP segments of strains C/JJ/50 and C/JHB/1/66 have both a size of 1802 nt, while the respective segment of strain C/Ann Arbor/1/50 is 5 nt longer. This difference lies within the open reading frame (ORF) of NP and leads to a later stop codon for strain C/Ann Arbor/1/50. Therefore, the NP of C/Ann Arbor/1/50 is 9 amino acids longer, while the 5 nc end is 22 nt shorter. vrna Segment Number of nucleotides Total 3 ncr Coding region 5 ncr Accession no. a PB FR PB FR P M28062 b HEF FR NP FR M FR NS FR Table 3: The whole genome of influenza C/JJ/50 virus. a GenBank/EMBL/DDJ accession numbers, b Sequence M28062 was deposited at the GenBank Database by Yamashita et al The NS segment of strain C/JJ/50 is 21 nt shorter than the NS segments of C/JHB/1/66 and C/Ann Arbor/1/50. This deletion is located within the ORF of NS1, which is therefore 7 amino acids shorter than the NS1 proteins of the two other strains. vrna Number of Sequence Difference in Difference in segment nucleotides identity 3 ncr 5 ncr Difference in cr a PB % nt PB % nt P % - 1 nt 41 nt HEF % 1 nt 7 nt 55 nt NP 1802/1807 b 98.4% 2 nt 12 nt 15 nt c M % 3 nt - 17 nt NS 914/935 d 98.9% 1 nt - 9 nt e Table 4: Comparison of nucleotide sequences of all viral segments from the influenza virus strains C/JJ/50, C/JHB/1/66, and C/Ann Arbor/1/50. a coding region, b NP from strain C/Ann Arbor/1/50 has a size of 1807 nt, c Besides this difference, NP from C/Ann Arbor/1/50 has additional 5 nt in the ORF leading to later stop codon, d NS from strain C/JJ/50 has a size of 914 nt, e In addition to this difference, NS from C/JJ/50 has 21 nt less within the cr, leading to a shorter NS1 protein. The differences in the nc regions between these three influenza C virus strains, as shown in table 4, do not affect the ultimate parts of the nc ends. The ultimate parts of the nc ends the regions conserved among the different segments are also conserved among the three virus strains (see Table 2). Regarding the 3 -ends, the first eleven nucleotides and nucleotide 14 are identical in all seven segments,

12 whereas nucleotides 12 and 13 show a slight variability. In the 5 -ends, the first twelve nucleotides as well as nucleotide 15 are conserved among the segments, with exception of segment NS, where nucleotide 6 differs from the others. In all segments from these three virus strains, nucleotides (3 -viral ends) are complementary to nucleotides (5 -viral ends), which would allow formation of a double-stranded structure of five base pairs at this region. For segments PB2, PB1, P3, NP, and M, even six base pairs would be possible. Besides the alignment of several sequences via Multalin or ClustalW2, it is also possible to search for sequence similarities between a sequence of interest and sequences deposited at the GenBank Database, for example with the Basic Local Alignment Search Tool (BLAST) from the National Center for Biotechnology Information, ncbi ( 7 Glossary AMV-RT BLAST cdna CM2 HEF M1 M-MuLV RT mrna nc ncbi ncr nt NEP (NS2) NP NS1 NS2 ORF P3 PB1 PB2 RACE-PCR RNP RT SMART TdT TS vrna Avian Myeloblastosis Virus Reverse Transcriptase Basic Local Alignment Search Tool complementary DNA surface glycoprotein from influenza C virus haemagglutinin-esterase-fusion protein from influenza C virus matrix protein from influenza C virus Moloney Murine Leukemia Virus Reverse Transcriptase messenger RNA noncoding National Center for Biotechnology Information noncoding region nucleotide nuclear export protein (nonstructural protein) from influenza virus nucleoprotein from influenza virus nonstructural protein 1 from influenza virus nonstructural protein 2 from influenza virus open reading frame polymerase protein from influenza C virus polymerase protein from influenza virus polymerase protein from influenza virus rapid amplification of cdna ends polymerase chain reaction ribonucleoprotein reverse transcription/ reverse transcriptase switching mechanism at RNA termini terminal deoxynucleotidyl transferase template switch viral RNA

13 References Betakova, T., and A. J. Hay Evidence that the CM2 protein of influenza C virus can modify the ph of the exocytic pathway of transfected cells. J Gen Virol 88: Brown, I. H., P. A. Harris, and D. J. Alexander Serological studies of influenza viruses in pigs in Great Britain Epidemiol Infect 114: Cianci, C., L. Tiley, and M. Krystal Differential activation of the influenza virus polymerase via template RNA binding. J Virol 69: Clern-van Haaster, C. M., and H. Meier-Ewert '-Terminal sequences of influenza C virion RNA. Brief report. Arch Virol 80: Crescenzo-Chaigne, B., N. Naffakh, and S. van der Werf Comparative analysis of the ability of the polymerase complexes of influenza viruses type A, B and C to assemble into functional RNPs that allow expression and replication of heterotypic model RNA templates in vivo. Virology 265: Crescenzo-Chaigne, B., and S. van der Werf Nucleotides at the extremities of the viral RNA of influenza C virus are involved in type-specific interactions with the polymerase complex. J Gen Virol 82: Crescenzo-Chaigne, B., and S. van der Werf Rescue of influenza C virus from recombinant DNA. J Virol 81: Desselberger, U., V. R. Racaniello, J. J. Zazra, and P. Palese The 3' and 5'-terminal sequences of influenza A, B and C virus RNA segments are highly conserved and show partial inverted complementarity. Gene 8: Flick, R., and G. Hobom Interaction of influenza virus polymerase with viral RNA in the 'corkscrew' conformation. J Gen Virol 80 ( Pt 10): Flick, R., G. Neumann, E. Hoffmann, E. Neumeier, and G. Hobom Promoter elements in the influenza vrna terminal structure. Rna 2: Fodor, E., D. C. Pritlove, and G. G. Brownlee Characterization of the RNA-fork model of virion RNA in the initiation of transcription in influenza A virus. J Virol 69: Fodor, E., D. C. Pritlove, and G. G. Brownlee The influenza virus panhandle is involved in the initiation of transcription. J Virol 68: Hagen, M., T. D. Chung, J. A. Butcher, and M. Krystal Recombinant influenza virus polymerase: requirement of both 5' and 3' viral ends for endonuclease activity. J Virol 68: Hongo, S., K. Ishii, K. Mori, E. Takashita, Y. Muraki, Y. Matsuzaki, and K. Sugawara Detection of ion channel activity in Xenopus laevis oocytes expressing Influenza C virus CM2 protein. Arch Virol 149: Hongo, S., K. Sugawara, Y. Muraki, Y. Matsuzaki, E. Takashita, F. Kitame, and K. Nakamura Influenza C virus CM2 protein is produced from a 374-amino-acid protein (P42) by signal peptidase cleavage. J Virol 73: Hsu, M. T., J. D. Parvin, S. Gupta, M. Krystal, and P. Palese Genomic RNAs of influenza viruses are held in a circular conformation in virions and in infected cells by a terminal panhandle. Proc Natl Acad Sci U S A 84: Katagiri, S., A. Ohizumi, and M. Homma An outbreak of type C influenza in children's home. J Infect Dis. 148: Katagiri, S., A. Ohizumi, S. Ohyama, and M. Homma Follow-up study of type C influenza outbreak in children's home. Microbiol Immunol. 31: Li, X., and P. Palese Characterization of the polyadenylation signal of influenza virus RNA. J Virol 68:

14 Luo, G. X., W. Luytjes, M. Enami, and P. Palese The polyadenylation signal of influenza virus RNA involves a stretch of uridines followed by the RNA duplex of the panhandle structure. J Virol 65: Manuguerra, J. C., and C. Hannoun Natural infection of dogs by influenza C virus. Res Virol 143: Manuguerra, J. C., C. Hannoun, F. Simon, E. Villar, and J. A. Cabezas Natural infection of dogs by influenza C virus: a serological survey in Spain. New Microbiol 16: Matsuzaki, Y., N. Katsushima, Y. Nagai, M. Shoji, T. Itagaki, M. Sakamoto, S. Kitaoka, K. Mizuta, and H. Nishimura Clinical Features of Influenza C Virus Infection in Children. J Infect Dis. 193: Matsuzaki, Y., K. Mizuta, K. Sugawara, E. Tsuchiya, Y. Muraki, S. Hongo, H. Suzuki, and H. Nishimura Frequent reassortment among influenza C viruses. J Virol 77: Matsuzaki, Y., Y. Muraki, K. Sugawara, S. Hongo, H. Nishimura, F. Kitame, N. Katsushima, Y. Numazaki, and K. Nakamura Cocirculation of two distinct groups of influenza C virus in Yamagata City, Japan. Virology 202: Matsuzaki, Y., S. Takao, S. Shimada, K. Mizuta, K. Sugawara, E. Takashita, Y. Muraki, S. Hongo, and H. Nishimura Characterization of antigenically and genetically similar influenza C viruses isolated in Japan during the season. Epidemiol Infect 132: Matz, M. V Amplification of representative cdna pools from microscopic amounts of animal tissue. Methods Mol Biol 221: Muraki, Y., S. Hongo, K. Sugawara, F. Kitame, and K. Nakamura Evolution of the haemagglutinin-esterase gene of influenza C virus. J Gen Virol 77 ( Pt 4): Muraki, Y., T. Murata, E. Takashita, Y. Matsuzaki, K. Sugawara, and S. Hongo A mutation on influenza C virus M1 protein affects virion morphology by altering the membrane affinity of the protein. J Virol 81: Muraki, Y., H. Washioka, K. Sugawara, Y. Matsuzaki, E. Takashita, and S. Hongo Identification of an amino acid residue on influenza C virus M1 protein responsible for formation of the cord-like structures of the virus. J Gen Virol 85: Neumann, G., G. G. Brownlee, E. Fodor, and Y. Kawaoka Orthomyxovirus replication, transcription, and polyadenylation. Curr Top Microbiol Immunol 283: Nishimura, H., M. Hara, K. Sugawara, F. Kitame, K. Takiguchi, Y. Umetsu, A. Tonosaki, and K. Nakamura Characterization of the cord-like structures emerging from the surface of influenza C virus-infected cells. Virology 179: Nishimura, H., S. Hongo, K. Sugawara, Y. Muraki, F. Kitame, H. Washioka, A. Tonosaki, and K. Nakamura The ability of influenza C virus to generate cord-like structures is influenced by the gene coding for M protein. Virology 200: Noda, T., H. Sagara, A. Yen, A. Takada, H. Kida, R. H. Cheng, and Y. Kawaoka Architecture of ribonucleoprotein complexes in influenza A virus particles. Nature 439: Ohwada, K., F. Kitame, K. Sugawara, H. Nishimura, M. Homma, and K. Nakamura Distribution of the antibody to influenza C virus in dogs and pigs in Yamagata Prefecture, Japan. Microbiol Immunol 31: Pachler, K., J. Mayr, and R. Vlasak A seven plasmid-based system for the rescue of influenza C virus. J Mol Genet Med 4: Pachler, K., and R. Vlasak Influenza C virus NS1 protein counteracts RIG-I-mediated IFN signalling. Virology Journal 8:48. Paragas, J., J. Talon, R. E. O'Neill, D. K. Anderson, A. Garcia-Sastre, and P. Palese Influenza B and C Virus NEP (NS2) Proteins Possess Nuclear Export Activities. J. Virol. 75:

15 Pekosz, A., and R. A. Lamb Influenza C virus CM2 integral membrane glycoprotein is produced from a polypeptide precursor by cleavage of an internal signal sequence. Proc Natl Acad Sci U S A 95: Peng, G., S. Hongo, Y. Muraki, K. Sugawara, H. Nishimura, F. Kitame, and K. Nakamura Genetic reassortment of influenza C viruses in man. J Gen Virol 75 ( Pt 12): Pritlove, D. C., E. Fodor, B. L. Seong, and G. G. Brownlee In vitro transcription and polymerase binding studies of the termini of influenza A virus crna: evidence for a crna panhandle. J Gen Virol 76 ( Pt 9): Pritlove, D. C., L. L. Poon, E. Fodor, J. Sharps, and G. G. Brownlee Polyadenylation of influenza virus mrna transcribed in vitro from model virion RNA templates: requirement for 5' conserved sequences. J Virol 72: Taylor, R. M A further note on 1233 influenza C virus. Arch Gesamte Virusforsch 4: Tiley, L. S., M. Hagen, J. T. Matthews, and M. Krystal Sequence-specific binding of the influenza virus RNA polymerase to sequences located at the 5' ends of the viral RNAs. J Virol 68: Yamaoka, M., H. Hotta, M. Itoh, and M. Homma Prevalence of antibody to influenza C virus among pigs in Hyogo Prefecture, Japan. J Gen Virol 72 ( Pt 3): Yamashita, M., M. Krystal, and P. Palese Comparison of the three large polymerase proteins of influenza A, B, and C viruses. Virology 171: Yamashita, M., M. Krystal, and P. Palese Evidence that the matrix protein of influenza C virus is coded for by a spliced mrna. J Virol 62: Zhirnov, O. P., and V. B. Grigoriev Disassembly of influenza C viruses, distinct from that of influenza A and B viruses requires neutral-alkaline ph. Virology 200: