Multiple genotypes of influenza B viruses co-circulated in Taiwan in ACCEPTED

Transcription

1 JCM Accepts, published online ahead of print on 28 February 2007 J. Clin. Microbiol. doi: /jcm Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. Multiple genotypes of influenza B viruses co-circulated in Taiwan in Guang-Wu Chen 1,2,*, Shin-Ru Shih 1,3,4,*, Mei-Ren Hsiao 3,4, Shih-Cheng Chang, 1,3,4, Shu-Hung Lin 2, Chien-Fen Sun 3,4 and Kuo-Chien Tsao 1,3,4, 1 Emerging Virus Research Center, Chang Gung University & Chang Gung Memorial Hospital 2 Department of Computer Science & Information Engineering, 3 Department of Medical Biotechnology & Laboratory Science, Chang Gung University 4 Clinical Virology Laboratory, Department of Clinical Pathology, Chang Gung Memorial Hospital, Taoyuan, Taiwan * First and second authors contributed equally to this work. Corresponding author: Kuo-Chien Tsao. Mailing address: Department Clinical Pathology, Chang Gung Memorial Hospital No. 5, Fu-Hsing Street, Kwei-Shan, Taoyuan, 333 Taiwan Phone: x 2523 Fax: kctsao@adm.cgmh.org.tw 1

2 Abstract An influenza B outbreak occurred in Taiwan in 2004 to 2005, during which both Victoria and Yamagata lineages co-circulated. This study examined 36 influenza B viral genomes isolated during the outbreak to reveal their reassortment patterns. According to the isolate groupings in phylogenetic analysis, we were able to categorize those 36 isolates as either of Victoria and Yamagata lineage for all 8 influenza B genomic segments, except for the NS gene, in which clade A and B existed. Based on these groupings, three genome patterns clearly emerged, namely, pattern I (Vic+Vic+Ya+Vic+Ya+Ya+Ya+A from segments 1 8), pattern II (Ya+Ya+Ya+Ya+Ya+Ya+Ya+B), and pattern III (Ya+Ya+Ya+Ya+Ya+Ya+Ya+A). According to the timeline of those isolates under investigation, it appears that patterns I and II viruses could have generated pattern III via reassortment of the NS gene. On the other hand, a genome-wide comparison of all six pattern III Taiwanese viruses with 37 international influenza B viral genomes showed that two international strains B/Oslo/71/04 and B/England/23/04, were consistently clustered with those pattern III viruses isolated in Taiwan in , suggesting that Taiwanese pattern III viruses might also have been possibly imported due to their matching genomic composition. 2

3 Keywords: influenza B virus, outbreak, reassortment 3

4 INTRODUCTION Belonging to the Orthomyxoviridae family, influenza B virus contains a single-stranded, negative sense, segmented genome. The eight gene segments code for 11 proteins are as follows: segment 1, 2, and 3 codes for the polymerase proteins PB2, PB1, and PA; segment 4 codes for hemagglutinin (HA); segment 5 codes for the nucleoprotein NP; segment 6 codes for the neuraminidase (NA) and an integral membrane protein NB; segment 7 codes for the matrix protein M1 and another BM2 protein with unclear function; and, segment 8 codes for the nonstructural protein NS1 and a nuclear export protein NS2 (also called NEP) (3). No antigenic shift has ever been detected in influenza B viruses, and no subtype divisions of surface antigens exist, as seen in influenza A viruses. The evolution of influenza B viruses has long been characterized by co-circulation of antigenically and genetically distinct lineages for extended periods of time. Two lineages, as defined by the phylogenetic relationship of the HA gene, have diverged since 1983 (2). One lineage, B/Victoria/2/87, is known as the Victoria lineage (Vic87), whereas the other, an antigenic variant B/Yamagata/16/88 that emerged in 1988, is known as the Yamagata lineage (Yam88) (9). Each of these two viruses achieve predominance at different times and in different geographical regions, as indicated by recommendations for inclusion in influenza vaccines (10). Since 1991, viruses of the Vic87 lineage have 4

5 been infrequently isolated in Africa, America and Europe, but have continued to circulate in Asia and have been the predominant influenza B virus in certain Asian countries for years. The segmented genome of influenza viruses allows genetic exchange to occur via a process called reassortment. Reassortment occurs frequently among influenza B viruses and likely allows unrestricted lineage mixing (4). An influenza B outbreak occurred in Taiwan during the influenza season, in which both Vic87 and Yam88 lineages co-circulated (12). In addition to analyzing 36 influenza B viral genomes isolated during the outbreak to identify their reassortment patterns, this study examines their genetic characteristics when both Vic87 and Yam88 lineages were co-circulating. MATERIALS AND METHODS Specimen collection and transportation. Clinical isolates from patients with symptoms of respiratory tract infections, including coughing, sore throat, tonsillitis, pharyngitis, pneumonia and bronchiolitis, were obtained from Chang Gung Memorial Hospital (CGMH). Throat or nasopharyngeal swabs were collected and placed in transport medium containing 2 ml Eagle s minimum essential medium (EMEM) (ph 7.2) with gelatin (5 mg/l), penicillin (400 U/L), streptomycin (400 µg/l), gentamicin (50 µg/l) and amphotericin B (Fungizone) (1.25 µg/l). Specimens were placed on ice 5

6 and transported to the Clinical Virology Laboratory at CGMH within 24 hours after collection. Virus isolation and identification. Respiratory specimens were inoculated into Madin-Darby canine kidney cells. Influenza viruses were typed using an immunofluorescent assay (IFA) by type-specific monoclonal antibodies (Chemicon International, Inc., Temecula, CA, USA and Canada). RNA extraction and RT-PCR. Viral RNA was extracted using Viral RNA Extraction Miniprep System kit (Viogene, Sunnyvale, CA, USA). Briefly, 300 µl culture medium were mixed with 700 µl RXV buffer. After sitting at room temperature for 10 min, 700 µl 100% ethanol was added to the mixture. Whole mixture was then applied to the spin column, followed by addition of 650 µl WS buffer. The RNA was eluted in 50 µl RNA-free H 2 O, from which 6 µl RNA was used as the template. The Reverse it TM one-step RT-PCR kit (Abgene, Epsom, Surrey, UK) was used with 25 µl reaction mixture under the following conditions: 0.5 µl of kit-supplied enzyme mixture, 1 µl of 10 µm of each primer, 12.5 µl of 2 RT-PCR Master Mix, and 6 µl RNA template. The following RT-PCR program was used for PB2, HA, NP, M and NS genes: 42 C for 1 hour, 94 C for 4 min, followed by 40 cycles of 94 C for 30 sec, 58 C for 30 sec, 72 C for 5 min and a final elongation step of 72 C for 10 min. The same RT-PCR condition was used for NA and PA genes, 6

7 except that annealing temperature was reduced to 55 C. Also, the same RT-PCR condition was utilized for the PB1 gene, except that the annealing temperature was decreased to 50 C. Final products were stored at 4 C and analyzed by gel electrophoresis on 1% agarose gel containing 2 µg/ml ethidium bromide. The DNA bands were visualized and photographed via UV trans-illumination. Table 1 lists the primer sets used for specific target gene amplification by RT-PCR. Nucleotide sequence analysis. The nucleotide sequence of the purified fragments was determined using an automated ABI 3730 DNA sequencer (PE-Applied Biosystems, Foster City, CA, USA). Sequence assembly was performed using EditSeq in Lasergene software version 3.18 (DNASTAR, Madison, WI, USA) (1). Pairwise sequence identities were computed by the needle program in the EMBOSS software package (8). Multiple sequence alignment was conducted using Clustal W version 1.83 (11). Phylogenetic analysis was performed using PHYLIP (6, 7) version 3.63, with a Kimura 2-parameter distance matrix (program dnadist) and the neighbor joining method (program neighbor). Support for tree topology was determined via bootstrap analysis with 1000 pseudo-replicate data sets generated using the seqboot program in PHYLIP. A consensus tree was obtained utilizing the consense program in PHYLIP, and the topology was viewed with TreeView version (5). Partial nucleotide sequences under investigation were PB2:49 693, 7

8 PB1: , PA: , HA: , NP: , NA: , M: and NS:73 843, according to coding sequences of B/Hong Kong/330/01. Nucleotide sequence accession number. The nucleotide sequence data reported in this work were deposited in the GenBank nucleotide sequence database with accession numbers EF to EF RESULTS and DISCUSSION In total, 121 influenza B viruses were isolated in Clinical Virology Laboratory during the outbreak of December 2004 to April 2005, including 74 Victoria-like and 47 Yamagata-like strains according to their HA nucleotide sequences. As both lineages were co-circulating, the question arose as to whether a genetic reassortment occurred during that outbreak. Partial nucleotide sequences from all eight genomic segments of 20 randomly selected Taiwanese isolates were obtained and analyzed during the outbreak (December 2004 to April 2005). Furthermore, six isolates that represent the first monthly isolate in the preceding six months (May 2004 to November 2004) were included in analysis, in addition to 10 isolates that represent the first monthly isolate in the previous four influenza seasons (May 2000 to February 2004). Phylogenetic analysis of eight gene segments of those 36 Taiwanese isolates (listed in Table 2), together with B/Lee/40 (used as an outgroup node for phylogenetic inference), 8

9 B/Victoria/2/87 and B/Yamagata/16/88, was shown in Figure 1. According to the grouping of isolates to either Victoria-like or Yamagata-like clusters, the isolated were labeled Vic or Ya (Table 2). For the NS gene, 36 Taiwanese isolates were neither grouped to Victoria-like or Yamagata-like clusters, and were assigned to clade A or B based on the tree topology (Fig. 1). Table 2 presents the three patterns of genome composition that clearly emerged. In the 2004/05 winter outbreak (strains superscripted with * in Table 2), 11 of 20 isolates belonged to pattern I (Vic+Vic+Ya+Vic+Ya+Ya+Ya+A from segments 1 8); six belonged to pattern II (Ya+Ya+Ya+Ya+Ya+Ya+Ya+B); and three belonged to pattern III (Ya+Ya+Ya+Ya+Ya+Ya+Ya+A). In those six isolates from the six months (06/2004 to 11/2004) immediately preceding the 2004/05 outbreak, one isolate belonged to pattern I, two belonged to pattern II and three belonged to pattern III. In the 10 isolates from the four previous influenza seasons ( ), two had pattern I in 2003 and eight had pattern II; no isolate had pattern III. According to this analysis, pattern III viruses first appeared in the summer of 2004 (B/Taiwan/71024/04, B/Taiwan/71426/04 and B/Taiwan/71540/04), and continued to be active in the subsequent winter influenza outbreak (February and March, 2005). The two major patterns (I and II) of influenza B viruses that were circulating in the 04/05 season originated in previous years. For example, pattern II 9

10 viruses have been observed since mid-2000, and pattern I viruses emerged in early Thus, we speculate that pattern III viruses either likely originated from a local reassortment of pattern I and II viruses as early as in the summer of 2004, or were imported from other countries. To test this hypothesis, we performed a genome-wide comparison of the six Taiwanese pattern III viruses with 37 international influenza B viral genomes available from the Influenza Virus Resource of NCBI. The phylogenetic trees of each of the eight genomic segments were constructed (Fig. 2). Two international strains B/Oslo/71/04 and B/England/23/04 were consistently clustered together with those six putative reassortants isolated in Taiwan in , suggesting that the Taiwanese reassortants may not have completely originated from a mixing of local Taiwanese strains. In this study we performed phylogenetic analysis on all eight genomic segments of Taiwanese influenza B isolates from 2002 to Our results displayed consistent observation with Tsai et. al. (12) that locally circulated influenza B strains in 2005 were dominated by reassortants with Victoria lineage of hemaglutinin and Yamagata lineage of neuraminidase. We additionally analyzed Vic- and Yama-lineage groupings of the six internal genes and noted that only the NS genes could neither be assigned to Vic- or Yama-lineage. In particular the grouping of NS genes have come across the boundary as depicted by the other seven genes (Table 2). Accordingly we have labeled 10

11 them clade A and B. Based on these groupings of the eight influenza B segments, we have revealed three distinct phylogenetic patterns on those Taiwanese strains under consideration, namely pattern I, II and III. From the timeline of these isolates, it was speculated that pattern III viruses might have been originated from a local mixing of pattern I and II viruses. On the other hand, we cannot completely rule out the possibility that pattern III viruses might have been imported, as shown in Fig. 2 that all six Taiwanese pattern III viruses consistently cluster together with B/Oslo/71/04 and B/England/23/04, and are well separated from the rest of the other international reference strains. NS gene can encode NS1 and NS2 proteins, in which NS1 protein is a multifunctional protein for influenza virus replication. It would be important for further investigation on the impact of observed NS genetic diversity on influenza B virus infection. ACKNOWLEDGEMENTS The authors would like to thank Chang Gung Memorial Hospital (Grant No. CMRPD250031, and CMRPD150161) and the National Science Council of the Republic of China, Taiwan (Grant No. NSC E ) for financially supporting this research. 11

12 REFERENCE 1. Burland, T. G DNASTAR's Lasergene sequence analysis software. Methods Mol Biol 132: Hay, A. J., V. Gregory, A. R. Douglas, and Y. P. Lin The evolution of human influenza viruses. Philos Trans R Soc Lond B Biol Sci 356: Lamb, R. A., and P. W. Choppin The gene structure and replication of influenza virus. Annu Rev Biochem 52: McCullers, J. A., T. Saito, and A. R. Iverson Multiple genotypes of influenza B virus circulated between 1979 and J Virol 78: Page, R. D TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12: Persson, B Bioinformatics in protein analysis. Exs 88: Retief, J. D Phylogenetic analysis using PHYLIP. Methods Mol Biol 132: Rice, P., I. Longden, and A. Bleasby EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet 16: Rota, P. A., T. R. Wallis, M. W. Harmon, J. S. Rota, A. P. Kendal, and K. Nerome Cocirculation of two distinct evolutionary lineages of influenza type B virus since Virology 175: Shaw, M. W., X. Xu, Y. Li, S. Normand, R. T. Ueki, G. Y. Kunimoto, H. Hall, A. Klimov, N. J. Cox, and K. Subbarao Reappearance and global spread of variants of influenza B/Victoria/2/87 lineage viruses in the and seasons. Virology 303: Thompson, J. D., D. G. Higgins, and T. J. Gibson CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: Tsai, H. P., H. C. Wang, D. Kiang, S. W. Huang, P. H. Kuo, C. C. Liu, I. J. Su, and J. R. Wang Increasing appearance of reassortant influenza B virus in taiwan from 2002 to J Clin Microbiol 44:

13 Table 1. Primer sets used in specific gene amplification by RT-PCR Gene Name Sequence (5 to 3 ) Location a Size PB2 PB2-F-34 AGCAGAAGCAGAGCATCTTC PB2-R-709 CGATGCARTTGCAGGCACTT PB1 PB1-F-31 ATCCWTATTTTCTYTTCATAGATGT PB1-R-1228 GATGCHGTTCCTTCTTCATTGAAG PA PA-F-289 CAAGAGCATGGAATAGAGACTCC PA-R-1324 AGTATTTYCTTCTTTCACTCCCT HA HA-F-97 ATAACATCGTCAAACTCACC HA-R-1321 CACCRCTTAGTCTTTGAAG NP NP-F-544 ACCATCTACTTCAGCCCTATAA NP-R-1711 CTGTGTCCCTCCCAAAGAAGAAA M M-F-26 TGTCGCTGTTTGGAGACACAA M-R-1157 CYGACATTGAKTACAATTTGCTT NS NS-F-64 ACACAAATYGAGGTGGGTCC NS-R-1050 CTGTACACTTCAACCACATC NA NA1-F-1 AGCAGAAGCAGAGCATCTTC NA1-R-750 CGATGCARTTGCAGGCACTT NA2-F-621 TATATCGGAGTTGATGG NA2-R-1049 GCTTCCATCATYTGGTCTGG NA3-F-910 CCATAGAATGTGCCTGTAGAG NA3-R-1557 AGTAGTAACAAGAGCATTTTTC a Based on nucleotide position of coding sequences from B/Lee/40. Key to degenerated nucleotides : R = A+G; W = A+T; K = G+T; Y = C+T; H = A+T+C; 13

14 Table 2. Influenza B viruses used for genome analysis. Strain Time of Genome composition isolation PB2 PB1 PA HA NP NA M NS B/Taiwan/00076/ /01 B/Taiwan/00937/ /03 B/Taiwan/71207/ /07 B/Taiwan/72266/04 * 2004/12 B/Taiwan/70007/05 * 2005/01/04 B/Taiwan/70122/05 * 2005/01/11 B/Taiwan/70149/05 * 2005/01/13 Clade B/Taiwan/70299/05 * Vic Vic Ya Vic Ya Ya Ya 2005/01/22 A B/Taiwan/70325/05 * 2005/01/25 B/Taiwan/70555/05 * 2005/02/16 B/Taiwan/00710/05 * 2005/03/16 B/Taiwan/70878/05 * 2005/03/22 B/Taiwan/90680/05 * 2005/03/28 B/Taiwan/70949/05 * 2005/04/07 B/Taiwan/71024/ /06 B/Taiwan/71426/ /08 B/Taiwan/71540/ /09 Clade B/Taiwan/70513/05 * Ya Ya Ya Ya Ya Ya Ya 2005/02/04 A B/Taiwan/90584/05 * 2005/03/11 B/Taiwan/70864/05 * 2005/03/19 B/Taiwan/01742/ /05 B/Taiwan/02091/ /05 B/Taiwan/03852/ /09 B/Taiwan/00013/ /01 B/Taiwan/02112/ /05 B/Taiwan/00979/ /02 B/Taiwan/01709/ /04 B/Taiwan/70125/ /02 Clade Ya Ya Ya Ya Ya Ya Ya B/Taiwan/71718/ /10 B B/Taiwan/71891/ /11 B/Taiwan/03395/04 * 2004/12 B/Taiwan/70131/05 * 2005/01/12 B/Taiwan/70146/05 * 2005/01/13 B/Taiwan/00202/05 * 2005/01/21 B/Taiwan/70539/05 * 2005/02/07 B/Taiwan/01026/05 * 2005/04/18 Vic: Strains grouped with B/Victoria/2/87; Ya: Strains grouped with Phy. group B/Yamagata/16/88. Asterisk: Strains isolated from the winter peak season of 2004/05. I III II 14

15 FIGURE LEGENDS Figure 1. Phylogenetic relationship of 36 Taiwanese influenza B isolates for all 8 genomic segments. According to the grouping in each subplot, isolates were labeled either of Yamagata or Victoria lineage. One exception is that for the NS gene, for which no Taiwanese isolates were grouped to Yamagata or Victoria lineage, clade A and B was used. Also labeled were the three phylogenetic group numbers (Table 2). Some bootstrap values based on the percentage of 1,000 pseudo-replicates are included for reference. Figure 2. Phylogenetic relationship of 6 Taiwanese pattern III influenza B strains versus 37 international influenza B viral genomes. Both B/England/23/04 and B.Oslo/71/04 were consistently grouped together with group III Taiwanese isolates in all 8 subplots. Some bootstrap values based on the percentage of 1,000 pseudo-replicates are included for reference. 15

16 Figure 1 Phylogenetic relationship of 36 Taiwanese influenza B strains for 8 genomic segments.

17 99.9 Yama-lineage 97.5 B/Lee/40-PB2 B/Yamagata/16/88-PB2 B/Taiwan/70125/04-PB2 B/Taiwan/70131/05-PB2 B/Taiwan/3395/04-PB2 B/Taiwan/1026/05-PB2 B/Taiwan/70146/05-PB2 B/Taiwan/202/05-PB2 B/Taiwan/70539/05-PB2 B/Taiwan/71718/04-PB2 B/Taiwan/71891/04-PB2 B/Taiwan/2112/01-PB2 B/Taiwan/0013/01-PB2 B/Taiwan/2091/00-PB2 B/Taiwan/1742/00-PB2 B/Taiwan/3852/00-PB2 B/Taiwan/1709/02-PB2 B/Taiwan/0979/02-PB2 B/Taiwan/70864/05-PB2 B/Taiwan/71426/04-PB2 B/Taiwan/71024/04-PB2 B/Taiwan/71540/04-PB2 B/Taiwan/90584/05-PB2 B/Taiwan/70513/05-PB2 B/Victoria/2/87-PB2 B/Taiwan/71207/04-PB2 B/Taiwan/0937/03-PB2 B/Taiwan/0076/03-PB2 B/Taiwan/70878/05-PB2 B/Taiwan/70007/05-PB2 B/Taiwan/70555/05-PB2 B/Taiwan/70325/05-PB2 B/Taiwan/70122/05-PB2 B/Taiwan/70299/05-PB2 B/Taiwan/710/05-PB2 B/Taiwan/90680/05-PB2 B/Taiwan/70149/05-PB2 B/Taiwan/70949/05-PB2 B/Taiwan/72266/04-PB2 Vic-lineage II III I

18 94.9 Yama-lineage 97.1 Vic-lineage B/Lee/40-PB1 B/Yamagata/16/86 B/Taiwan/01742/00-PB1 B/Taiwan/71024/04-PB1 B/Taiwan/71540/04-PB1 B/Taiwan/71426/04-PB1 B/Taiwan/90584/05-PB1 B/Taiwan/70864/05-PB1 B/Taiwan/70513/05-PB1 B/Taiwan/00202/05-PB1 B/Taiwan/70539/05-PB1 B/Taiwan/71891/04-PB1 B/Taiwan/71718/04-PB1 B/Taiwan/03395/04-PB1 B/Taiwan/70131/05-PB1 B/Taiwan/70146/05-PB1 B/Taiwan/70125/04-PB1 B/Taiwan/01026/05-PB1 B/Taiwan/02112/01-PB1 B/Taiwan/00013/01-PB1 B/Taiwan/01709/02-PB1 B/Taiwan/00979/02-PB1 B/Taiwan/02091/00-PB1 B/Taiwan/03852/00-PB1 B/Victoria/2/87-PB1 B/Taiwan/71207/04-PB1 B/Taiwan/00937/03-PB1 B/Taiwan/00076/03-PB1 B/Taiwan/70555/05-PB1 B/Taiwan/70299/05-PB1 B/Taiwan/70122/05-PB1 B/Taiwan/70878/05-PB1 B/Taiwan/70325/05-PB1 B/Taiwan/70007/05-PB1 B/Taiwan/00710/05-PB1 B/Taiwan/90680/05-PB1 B/Taiwan/70949/05-PB1 B/Taiwan/70149/05-PB1 B/Taiwan/72266/04-PB1 III II I

19 99.3 Yama-lineage B/Lee/40-PA B/Victoria/2/87-PA B/Yamagata/16/88-PA B/Taiwan/70878/05-PA B/Taiwan/70149/05-PA B/Taiwan/00710/05-PA B/Taiwan/70122/05-PA B/Taiwan/70949/05-PA B/Taiwan/72266/04-PA B/Taiwan/70555/05-PA B/Taiwan/90680/05-PA B/Taiwan/70007/05-PA B/Taiwan/70299/05-PA B/Taiwan/70325/05-PA B/Taiwan/00076/03-PA B/Taiwan/00937/03-PA B/Taiwan/71207/04-PA B/Taiwan/90584/05-PA B/Taiwan/70513/05-PA B/Taiwan/70864/05-PA B/Taiwan/71540/04-PA B/Taiwan/71024/04-PA B/Taiwan/71426/04-PA B/Taiwan/02112/01-PA B/Taiwan/00013/01-PA B/Taiwan/70125/04-PA B/Taiwan/70539/05-PA B/Taiwan/00202/05-PA B/Taiwan/71718/04-PA B/Taiwan/71891/04-PA B/Taiwan/01026/05-PA B/Taiwan/70131/05-PA B/Taiwan/03395/04-PA B/Taiwan/70146/05-PA B/Taiwan/01742/00-PA B/Taiwan/03852/00-PA B/Taiwan/02091/00-PA B/Taiwan/01709/02-PA B/Taiwan/00979/02-PA I III II

20 100 Yama-lineage B/Lee/40-HA B/Yamagata/16/88-HA B/Taiwan/2112/01-HA B/Taiwan/0013/01-HA B/Taiwan/2091/00-HA B/Taiwan/3852/00-HA B/Taiwan/1742/00-HA B/Taiwan/0979/02-HA B/Taiwan/1709/02-HA B/Taiwan/70125/04-HA B/Taiwan/1026/05-HA B/Taiwan/70131/05-HA B/Taiwan/70146/05-HA B/Taiwan/3395/04-HA B/Taiwan/202/05-HA B/Taiwan/70539/05-HA B/Taiwan/71891/04-HA B/Taiwan/71718/04-HA B/Taiwan/70864/05-HA B/Taiwan/90584/05-HA B/Taiwan/70513/05-HA B/Taiwan/71426/04-HA B/Taiwan/71024/04-HA B/Taiwan/71540/04-HA B/Victoria/2/87-HA B/Taiwan/0937/03-HA B/Taiwan/71207/04-HA B/Taiwan/70122/04-HA B/Taiwan/710/05-HA B/Taiwan/70149/05-HA B/Taiwan/70878/05-HA B/Taiwan/90680/05-HA B/Taiwan/70299/05-HA B/Taiwan/72266/04-HA B/Taiwan/70555/05-HA B/Taiwan/0076/03-HA B/Taiwan/70325/05-HA B/Taiwan/70007/05-HA B/Taiwan/70949/05-HA 99.8 Vic-lineage II III I

21 B/Lee/40-NP B/Victoria/2/87-NP B/Yamagata/16/88-NP B/Taiwan/71207/04-NP B/Taiwan/00937/03-NP Yama-lineage B/Taiwan/00076/03-NP B/Taiwan/00710/05-NP B/Taiwan/70878/05-NP B/Taiwan/70007/05-NP B/Taiwan/70325/05-NP B/Taiwan/90680/05-NP B/Taiwan/72266/04-NP B/Taiwan/70149/05-NP B/Taiwan/70299/05-NP B/Taiwan/70555/05-NP B/Taiwan/70949/05-NP B/Taiwan/70122/05-NP B/Taiwan/01709/02-NP B/Taiwan/00979/02-NP B/Taiwan/00202/05-NP B/Taiwan/70539/05-NP B/Taiwan/71891/04-NP B/Taiwan/71718/04-NP B/Taiwan/70125/04-NP B/Taiwan/01026/05-NP B/Taiwan/70146/05-NP B/Taiwan/70131/05-NP B/Taiwan/03395/04-NP I II B/Taiwan/02112/01-NP B/Taiwan/00013/01-NP B/Taiwan/03852/00-NP B/Taiwan/02091/00-NP B/Taiwan/01742/00-NP B/Taiwan/70864/05-NP B/Taiwan/90584/05-NP B/Taiwan/70513/05-NP B/Taiwan/71540/04-NP III B/Taiwan/71426/04-NP B/Taiwan/71024/04-NP

22 96.6 Yama-lineage B/Lee/40 B/Victoria/2/87-NA B/Yamagata/16/88-NA B/Taiwan/71207/04-NA B/Taiwan/0076/03-NA B/Taiwan/0937/03-NA B/Taiwan/70555/05-NA B/Taiwan/70149/05-NA B/Taiwan/90680/05-NA B/Taiwan/70325/05-NA B/Taiwan/70007/05-NA B/Taiwan/70299/05-NA B/Taiwan/70949/05-NA B/Taiwan/710/05-NA B/Taiwan/72266/04-NA B/Taiwan/70878/05-NA B/Taiwan/70122/05-NA B/Taiwan/70125/04-NA B/Taiwan/202/05-NA B/Taiwan/70539/05-NA B/Taiwan/71891/04-NA B/Taiwan/71718/04-NA B/Taiwan/1026/05-NA B/Taiwan/70146/05-NA B/Taiwan/3395/04-NA B/Taiwan/70131/05-NA B/Taiwan/0013/01-NA B/Taiwan/2112/01-NA B/Taiwan/2091/00-NA B/Taiwan/1742/00-NA B/Taiwan/3852/00-NA B/Taiwan/1709/02-NA B/Taiwan/0979/02-NA B/Taiwan/71540/04-NA B/Taiwan/71024/04-NA B/Taiwan/71426/04-NA B/Taiwan/70864/05-NA B/Taiwan/70513/05-NA B/Taiwan/90584/05-NA I II III

23 98.5 Yama-lineage B/Lee/40-M B/Victoria/2/87-M B/Yamagata/16/88-M B/Taiwan/710/05-M B/Taiwan/70878/05-M B/Taiwan/70122/04-M B/Taiwan/70325/05-M B/Taiwan/70149/05-M B/Taiwan/70555/05-M B/Taiwan/70007/05-M B/Taiwan/90680/05-M B/Taiwan/72266/04-M B/Taiwan/70299/05-M B/Taiwan/70949/05-M B/Taiwan/0076/03-M B/Taiwan/0937/03-M B/Taiwan/71207/04-M B/Taiwan/70125/04-M B/Taiwan/70131/05-M B/Taiwan/3395/04-M B/Taiwan/1026/05-M B/Taiwan/70146/05-M B/Taiwan/71718/04-M B/Taiwan/71891/04-M B/Taiwan/202/05-M B/Taiwan/70539/05-M B/Taiwan/2112/01-M B/Taiwan/0013/01-M B/Taiwan/2091/00-M B/Taiwan/1742/00-M B/Taiwan/3852/00-M B/Taiwan/1709/02-M B/Taiwan/0979/02-M B/Taiwan/71024/04-M B/Taiwan/71426/04-M B/Taiwan/71540/04-M B/Taiwan/70864/05-M B/Taiwan/70513/05-M B/Taiwan/90584/05-M I II III

24 Clade A B/Lee/40-NS B/Victoria/2/87-NS B/Yamagata/16/88-NS B/Taiwan/71207/04-NS B/Taiwan/0937/03-NS B/Taiwan/0076/03-NS B/Taiwan/72266/04-NS B/Taiwan/710/05-NS B/Taiwan/70555/05-NS B/Taiwan/70299/05-NS B/Taiwan/90680/05-NS B/Taiwan/70149/05-NS B/Taiwan/70878/05-NS B/Taiwan/70949/05-NS B/Taiwan/70122/05-NS B/Taiwan/70325/05-NS B/Taiwan/70007/05-NS B/Taiwan/71540/04-NS B/Taiwan/71024/04-NS B/Taiwan/71426/04-NS B/Taiwan/70864/05-NS B/Taiwan/70513/05-NS B/Taiwan/90584/05-NS B/Taiwan/1026/05-NS B/Taiwan/70146/05-NS B/Taiwan/3395/04-NS B/Taiwan/70131/05-NS B/Taiwan/70539/05-NS B/Taiwan/71718/04-NS B/Taiwan/71891/04-NS B/Taiwan/202/05-NS B/Taiwan/70125/04-NS B/Taiwan/2112/01-NS B/Taiwan/0013/01-NS B/Taiwan/0979/02-NS B/Taiwan/1709/02-NS B/Taiwan/1742/00-NS B/Taiwan/2091/00-NS B/Taiwan/3852/00-NS Clade B 100 I III II

25 Figure 2 Phylogenetic relationship of 6 Taiwanese pattern III influenza B strains vs 37 international influenza B viral genomes for 8 genomic segments.

26 100 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Hong Kong/330/2001 B/Barcelona/215/03 B/Moscow/3/03 B/Memphis/13/03 B/Geneva/5079/03 B/Cheju/303/03 B/Tehran/80/02 B/Israel/95/03 B/Los Angeles/1/02 B/Shandong/7/97 B/Nanchang/2/97 B/Nanchang/6/98 B/Victoria/2/87 B/Houston/1/91 B/Memphis/5/93 B/Yamagata/16/88 B/Beijing/76/98 B/Nanchang/6/96 B/Nanchang/630/94 B/Hong Kong/293/ B/Hong Kong/557/00 B/Beijing/184/93 B/Memphis/12/97 B/Yamanashi/166/98 B/Maryland/1/01 B/Sichuan/379/99 B/Victoria/504/2000 B/Bucharest/795/03 B/Bangkok/460/03 B/Hong Kong/692/01 B/Nebraska/2/01 B/Nebraska/1/01 B/Oslo/71/04 B/Taiwan/70513/05-PB2 B/Taiwan/90584/05-PB2 B/Taiwan/70864/05-PB2 B/England/23/04 B/Taiwan/71024/04-PB2 B/Taiwan/71540/04-PB2 B/Taiwan/71426/04-PB2

27 100 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Memphis/5/93 B/Hong Kong/330/2001 B/Los Angeles/1/02 B/Cheju/303/03 B/Geneva/5079/03 B/Memphis/13/03 B/Israel/95/03 B/Tehran/80/02 B/Barcelona/215/03 B/Moscow/3/03 B/Shangdong/7/97 B/Nanchang/2/97 B/Nanchang/6/98 B/Nanchang/6/96 B/Nanchang/630/94 B/Victoria/2/87 B/Houston/1/91 B/Yamagata/16/88 B/Beijing/184/93 B/Victoria/504/ B/Hong Kong/692/01 B/Nebraska/1/01 B/Nebraska/2/01 B/Sichuan/379/99 B/Maryland/1/01 B/Bangkok/460/03 B/Bucharest/795/03 B/Yamanashi/166/98 B/Memphis/12/97 B/Beijing/76/98 B/Hong Kong/557/00 B/Hong Kong/293/02 B/Oslo/71/04 B/England/23/04 B/Taiwan/71024/04-PB1 B/Taiwan/71540/04-PB1 B/Taiwan/70864/05-PB1 B/Taiwan/90584/05-PB1 B/Taiwan/70513/05-PB1 B/Taiwan/71426/04-PB1

28 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Victoria/2/87 B/Nanchang/630/94 B/Nanchang/6/96 B/Yamagata/16/88 B/Houston/1/91 B/Memphis/5/93 B/Hong Kong/330/2001 B/Nanchang/6/98 B/Nanchang/2/97 B/Shandong/7/97 B/Beijing/76/98 B/Hong Kong/293/02 B/Hong Kong/557/00 B/Beijing/184/93 B/Yamanashi/166/98 B/Memphis/12/97 B/Victoria/504/2000 B/Bucharest/795/03 B/Bangkok/460/03 B/Sichuan/379/99 B/Maryland/1/01 B/Hong Kong/692/01 B/Nebraska/1/01 B/Nebraska/2/01 B/Geneva/5079/03 B/Los Angeles/1/02 B/Barcelona/215/03 B/Tehran/80/02 B/Moscow/3/03 B/Cheju/303/03 B/Memphis/13/03 B/Israel/95/03 B/Oslo/71/04 B/Taiwan/90584/05-PA B/Taiwan/70864/05-PA B/England/23/04 B/Taiwan/70513/05-PA B/Taiwan/71024/04-PA B/Taiwan/71540/04-PA B/Taiwan/71426/04-PA

29 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Victoria/2/87 B/Nanchang/6/96 B/Nanchang/630/94 B/Hong Kong/330/2001 B/Moscow/3/03 B/Geneva/5079/03 B/Cheju/303/03 B/Memphis/13/03 B/Israel/95/03 B/Los Angeles/1/02 B/Tehran/80/02 B/Barcelona/215/03 B/Nanchang/6/98 B/Nanchang/2/97 B/Shangdong/7/97 B/Yamagata/16/88 B/Houston/1/91 B/Memphis/5/93 B/Beijing/184/93 B/Maryland/1/01 B/Victoria/504/2000 B/Sichuan/379/99 B/Hong Kong/692/01 B/Nebraska/1/01 B/Nebraska/2/01 B/Yamanashi/166/98 B/Memphis/12/97 B/Beijing/76/98 B/Hong Kong/557/00 B/Bangkok/460/03 B/Bucharest/795/03 B/Hong Kong/293/02 B/Oslo/71/04 B/England/23/04 B/Taiwan/70864/05-HA B/Taiwan/90584/05-HA B/Taiwan/70513/05-HA B/Taiwan/71024/04-HA B/Taiwan/71540/04-HA B/Taiwan/71426/04-HA

30 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/86 B/Victoria/2/87 B/Memphis/5/93 B/Houston/1/91 B/Yamagata/16/88 B/Nanchang/630/94 B/Nanchang/6/96 B/Shangdong/7/97 B/Tehran/80/02 B/Geneva/5079/03 B/Memphis/13/03 B/Cheju/303/03 B/Israel/95/03 B/Los Angeles/1/02 B/Barcelona/215/03 B/Moscow/3/03 B/Nanchang/6/98 B/Nanchang/2/97 B/Hong Kong/330/2001 B/Beijing/184/93 B/Yamanashi/166/98 B/Memphis/12/97 B/Beijing/76/98 B/Hong Kong/557/00 B/Bangkok/460/03 B/Bucharest/795/03 B/Victoria/504/2000 B/Hong Kong/293/02 B/Sichuan/379/99 B/Maryland/1/01 B/Hong Kong/692/01 B/Nebraska/2/01 B/Nebraska/1/01 B/Oslo/71/04 B/Taiwan/71024/04-NP B/Taiwan/71426/04-NP B/Taiwan/71540/04-NP B/England/23/04 B/Taiwan/90584/05-NP B/Taiwan/70513/05-NP B/Taiwan/70864/05-NP

31 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Nanchang/6/96 B/Victoria/2/87 B/Houston/1/91 B/Memphis/5/93 B/Hong Kong/330/2001 B/Nanchang/2/97 B/Nanchang/6/98 B/Shangdong/7/97 B/Yamagata/16/88 B/Nanchang/630/94 B/Beijing/184/93 B/Victoria/504/2000 B/Bucharest/795/03 B/Bangkok/460/03 B/Maryland/1/01 B/Sichuan/379/99 B/Hong Kong/692/01 B/Los Angeles/1/02 B/Israel/95/03 B/Cheju/303/03 B/Memphis/13/03 B/Geneva/5079/03 B/Moscow/3/03 B/Barcelona/215/03 B/Tehran/80/02 B/Nebraska/2/01 B/Nebraska/1/01 B/Yamanashi/166/98 B/Memphis/12/97 B/Beijing/76/98 B/Hong Kong/557/00 B/Hong Kong/293/02 B/England/23/04 B/Oslo/71/04 B/Taiwan/71540/04-NA B/Taiwan/71024/04-NA B/Taiwan/71426/04-NA B/Taiwan/70513/05-NA B/Taiwan/90584/05-NA B/Taiwan/70864/05-NA

32 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Victoria/2/87 B/Houston/1/91 B/Memphis/5/93 B/Nanchang/630/94 B/Nanchang/6/96 B/Yamagata/16/88 B/Hong Kong/330/2001 B/Nanchang/6/98 B/Shangdong/7/97 B/Nanchang/2/97 B/Beijing/184/93 B/Israel/95/03 B/Cheju/303/03 B/Geneva/5079/03 B/Memphis/13/03 B/Tehran/80/02 B/Moscow/3/03 B/Los Angeles/1/02 B/Barcelona/215/03 B/Hong Kong/692/01 B/Nebraska/2/01 B/Nebraska/1/01 B/Victoria/504/2000 B/Sichuan/379/99 B/Maryland/1/01 B/Bucharest/795/03 B/Bangkok/460/03 B/Memphis/12/97 B/Yamanashi/166/98 B/Beijing/76/98 B/Hong Kong/557/00 B/Hong Kong/293/02 B/Taiwan/70864/05-M B/England/23/04 B/Taiwan/70513/05-M B/Taiwan/90584/05-M B/Taiwan/71540/04-M B/Taiwan/71426/04-M B/Taiwan/71024/04-M B/Oslo/71/04

33 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Victoria/2/87 B/Houston/1/91 B/Yamagata/16/88 B/Beijing/184/93 B/Beijing/76/98 B/Hong Kong/557/00 B/Hong Kong/330/2001 B/Shangdong/7/97 B/Nanchang/6/98 B/Nanchang/2/97 B/Yamanashi/166/98 B/Memphis/12/97 B/Memphis/5/93 B/Nanchang/630/94 B/Nanchang/6/96 B/Sichuan/379/99 B/Maryland/1/01 B/Hong Kong/293/02 B/Bangkok/460/03 B/Bucharest/795/03 B/Victoria/504/2000 B/Hong Kong/692/01 B/Geneva/5079/03 B/Los Angeles/1/02 B/Moscow/3/03 B/Memphis/13/03 B/Cheju/303/03 B/Israel/95/03 B/Tehran/80/02 B/Barcelona/215/03 B/Nebraska/2/01 B/Nebraska/1/01 B/Oslo/71/04 B/England/23/04 B/Taiwan/70864/05-NS B/Taiwan/70513/05-NS B/Taiwan/90584/05-NS B/Taiwan/71540/04-NS B/Taiwan/71426/04-NS B/Taiwan/71024/04-NS