Multiple genotypes of influenza B viruses co-circulated in Taiwan in ACCEPTED
|
|
- Nicholas Matthews
- 5 years ago
- Views:
Transcription
1 JCM Accepts, published online ahead of print on 28 February 2007 J. Clin. Microbiol. doi: /jcm Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. Multiple genotypes of influenza B viruses co-circulated in Taiwan in Guang-Wu Chen 1,2,*, Shin-Ru Shih 1,3,4,*, Mei-Ren Hsiao 3,4, Shih-Cheng Chang, 1,3,4, Shu-Hung Lin 2, Chien-Fen Sun 3,4 and Kuo-Chien Tsao 1,3,4, 1 Emerging Virus Research Center, Chang Gung University & Chang Gung Memorial Hospital 2 Department of Computer Science & Information Engineering, 3 Department of Medical Biotechnology & Laboratory Science, Chang Gung University 4 Clinical Virology Laboratory, Department of Clinical Pathology, Chang Gung Memorial Hospital, Taoyuan, Taiwan * First and second authors contributed equally to this work. Corresponding author: Kuo-Chien Tsao. Mailing address: Department Clinical Pathology, Chang Gung Memorial Hospital No. 5, Fu-Hsing Street, Kwei-Shan, Taoyuan, 333 Taiwan Phone: x 2523 Fax: kctsao@adm.cgmh.org.tw 1
2 Abstract An influenza B outbreak occurred in Taiwan in 2004 to 2005, during which both Victoria and Yamagata lineages co-circulated. This study examined 36 influenza B viral genomes isolated during the outbreak to reveal their reassortment patterns. According to the isolate groupings in phylogenetic analysis, we were able to categorize those 36 isolates as either of Victoria and Yamagata lineage for all 8 influenza B genomic segments, except for the NS gene, in which clade A and B existed. Based on these groupings, three genome patterns clearly emerged, namely, pattern I (Vic+Vic+Ya+Vic+Ya+Ya+Ya+A from segments 1 8), pattern II (Ya+Ya+Ya+Ya+Ya+Ya+Ya+B), and pattern III (Ya+Ya+Ya+Ya+Ya+Ya+Ya+A). According to the timeline of those isolates under investigation, it appears that patterns I and II viruses could have generated pattern III via reassortment of the NS gene. On the other hand, a genome-wide comparison of all six pattern III Taiwanese viruses with 37 international influenza B viral genomes showed that two international strains B/Oslo/71/04 and B/England/23/04, were consistently clustered with those pattern III viruses isolated in Taiwan in , suggesting that Taiwanese pattern III viruses might also have been possibly imported due to their matching genomic composition. 2
3 Keywords: influenza B virus, outbreak, reassortment 3
4 INTRODUCTION Belonging to the Orthomyxoviridae family, influenza B virus contains a single-stranded, negative sense, segmented genome. The eight gene segments code for 11 proteins are as follows: segment 1, 2, and 3 codes for the polymerase proteins PB2, PB1, and PA; segment 4 codes for hemagglutinin (HA); segment 5 codes for the nucleoprotein NP; segment 6 codes for the neuraminidase (NA) and an integral membrane protein NB; segment 7 codes for the matrix protein M1 and another BM2 protein with unclear function; and, segment 8 codes for the nonstructural protein NS1 and a nuclear export protein NS2 (also called NEP) (3). No antigenic shift has ever been detected in influenza B viruses, and no subtype divisions of surface antigens exist, as seen in influenza A viruses. The evolution of influenza B viruses has long been characterized by co-circulation of antigenically and genetically distinct lineages for extended periods of time. Two lineages, as defined by the phylogenetic relationship of the HA gene, have diverged since 1983 (2). One lineage, B/Victoria/2/87, is known as the Victoria lineage (Vic87), whereas the other, an antigenic variant B/Yamagata/16/88 that emerged in 1988, is known as the Yamagata lineage (Yam88) (9). Each of these two viruses achieve predominance at different times and in different geographical regions, as indicated by recommendations for inclusion in influenza vaccines (10). Since 1991, viruses of the Vic87 lineage have 4
5 been infrequently isolated in Africa, America and Europe, but have continued to circulate in Asia and have been the predominant influenza B virus in certain Asian countries for years. The segmented genome of influenza viruses allows genetic exchange to occur via a process called reassortment. Reassortment occurs frequently among influenza B viruses and likely allows unrestricted lineage mixing (4). An influenza B outbreak occurred in Taiwan during the influenza season, in which both Vic87 and Yam88 lineages co-circulated (12). In addition to analyzing 36 influenza B viral genomes isolated during the outbreak to identify their reassortment patterns, this study examines their genetic characteristics when both Vic87 and Yam88 lineages were co-circulating. MATERIALS AND METHODS Specimen collection and transportation. Clinical isolates from patients with symptoms of respiratory tract infections, including coughing, sore throat, tonsillitis, pharyngitis, pneumonia and bronchiolitis, were obtained from Chang Gung Memorial Hospital (CGMH). Throat or nasopharyngeal swabs were collected and placed in transport medium containing 2 ml Eagle s minimum essential medium (EMEM) (ph 7.2) with gelatin (5 mg/l), penicillin (400 U/L), streptomycin (400 µg/l), gentamicin (50 µg/l) and amphotericin B (Fungizone) (1.25 µg/l). Specimens were placed on ice 5
6 and transported to the Clinical Virology Laboratory at CGMH within 24 hours after collection. Virus isolation and identification. Respiratory specimens were inoculated into Madin-Darby canine kidney cells. Influenza viruses were typed using an immunofluorescent assay (IFA) by type-specific monoclonal antibodies (Chemicon International, Inc., Temecula, CA, USA and Canada). RNA extraction and RT-PCR. Viral RNA was extracted using Viral RNA Extraction Miniprep System kit (Viogene, Sunnyvale, CA, USA). Briefly, 300 µl culture medium were mixed with 700 µl RXV buffer. After sitting at room temperature for 10 min, 700 µl 100% ethanol was added to the mixture. Whole mixture was then applied to the spin column, followed by addition of 650 µl WS buffer. The RNA was eluted in 50 µl RNA-free H 2 O, from which 6 µl RNA was used as the template. The Reverse it TM one-step RT-PCR kit (Abgene, Epsom, Surrey, UK) was used with 25 µl reaction mixture under the following conditions: 0.5 µl of kit-supplied enzyme mixture, 1 µl of 10 µm of each primer, 12.5 µl of 2 RT-PCR Master Mix, and 6 µl RNA template. The following RT-PCR program was used for PB2, HA, NP, M and NS genes: 42 C for 1 hour, 94 C for 4 min, followed by 40 cycles of 94 C for 30 sec, 58 C for 30 sec, 72 C for 5 min and a final elongation step of 72 C for 10 min. The same RT-PCR condition was used for NA and PA genes, 6
7 except that annealing temperature was reduced to 55 C. Also, the same RT-PCR condition was utilized for the PB1 gene, except that the annealing temperature was decreased to 50 C. Final products were stored at 4 C and analyzed by gel electrophoresis on 1% agarose gel containing 2 µg/ml ethidium bromide. The DNA bands were visualized and photographed via UV trans-illumination. Table 1 lists the primer sets used for specific target gene amplification by RT-PCR. Nucleotide sequence analysis. The nucleotide sequence of the purified fragments was determined using an automated ABI 3730 DNA sequencer (PE-Applied Biosystems, Foster City, CA, USA). Sequence assembly was performed using EditSeq in Lasergene software version 3.18 (DNASTAR, Madison, WI, USA) (1). Pairwise sequence identities were computed by the needle program in the EMBOSS software package (8). Multiple sequence alignment was conducted using Clustal W version 1.83 (11). Phylogenetic analysis was performed using PHYLIP (6, 7) version 3.63, with a Kimura 2-parameter distance matrix (program dnadist) and the neighbor joining method (program neighbor). Support for tree topology was determined via bootstrap analysis with 1000 pseudo-replicate data sets generated using the seqboot program in PHYLIP. A consensus tree was obtained utilizing the consense program in PHYLIP, and the topology was viewed with TreeView version (5). Partial nucleotide sequences under investigation were PB2:49 693, 7
8 PB1: , PA: , HA: , NP: , NA: , M: and NS:73 843, according to coding sequences of B/Hong Kong/330/01. Nucleotide sequence accession number. The nucleotide sequence data reported in this work were deposited in the GenBank nucleotide sequence database with accession numbers EF to EF RESULTS and DISCUSSION In total, 121 influenza B viruses were isolated in Clinical Virology Laboratory during the outbreak of December 2004 to April 2005, including 74 Victoria-like and 47 Yamagata-like strains according to their HA nucleotide sequences. As both lineages were co-circulating, the question arose as to whether a genetic reassortment occurred during that outbreak. Partial nucleotide sequences from all eight genomic segments of 20 randomly selected Taiwanese isolates were obtained and analyzed during the outbreak (December 2004 to April 2005). Furthermore, six isolates that represent the first monthly isolate in the preceding six months (May 2004 to November 2004) were included in analysis, in addition to 10 isolates that represent the first monthly isolate in the previous four influenza seasons (May 2000 to February 2004). Phylogenetic analysis of eight gene segments of those 36 Taiwanese isolates (listed in Table 2), together with B/Lee/40 (used as an outgroup node for phylogenetic inference), 8
9 B/Victoria/2/87 and B/Yamagata/16/88, was shown in Figure 1. According to the grouping of isolates to either Victoria-like or Yamagata-like clusters, the isolated were labeled Vic or Ya (Table 2). For the NS gene, 36 Taiwanese isolates were neither grouped to Victoria-like or Yamagata-like clusters, and were assigned to clade A or B based on the tree topology (Fig. 1). Table 2 presents the three patterns of genome composition that clearly emerged. In the 2004/05 winter outbreak (strains superscripted with * in Table 2), 11 of 20 isolates belonged to pattern I (Vic+Vic+Ya+Vic+Ya+Ya+Ya+A from segments 1 8); six belonged to pattern II (Ya+Ya+Ya+Ya+Ya+Ya+Ya+B); and three belonged to pattern III (Ya+Ya+Ya+Ya+Ya+Ya+Ya+A). In those six isolates from the six months (06/2004 to 11/2004) immediately preceding the 2004/05 outbreak, one isolate belonged to pattern I, two belonged to pattern II and three belonged to pattern III. In the 10 isolates from the four previous influenza seasons ( ), two had pattern I in 2003 and eight had pattern II; no isolate had pattern III. According to this analysis, pattern III viruses first appeared in the summer of 2004 (B/Taiwan/71024/04, B/Taiwan/71426/04 and B/Taiwan/71540/04), and continued to be active in the subsequent winter influenza outbreak (February and March, 2005). The two major patterns (I and II) of influenza B viruses that were circulating in the 04/05 season originated in previous years. For example, pattern II 9
10 viruses have been observed since mid-2000, and pattern I viruses emerged in early Thus, we speculate that pattern III viruses either likely originated from a local reassortment of pattern I and II viruses as early as in the summer of 2004, or were imported from other countries. To test this hypothesis, we performed a genome-wide comparison of the six Taiwanese pattern III viruses with 37 international influenza B viral genomes available from the Influenza Virus Resource of NCBI. The phylogenetic trees of each of the eight genomic segments were constructed (Fig. 2). Two international strains B/Oslo/71/04 and B/England/23/04 were consistently clustered together with those six putative reassortants isolated in Taiwan in , suggesting that the Taiwanese reassortants may not have completely originated from a mixing of local Taiwanese strains. In this study we performed phylogenetic analysis on all eight genomic segments of Taiwanese influenza B isolates from 2002 to Our results displayed consistent observation with Tsai et. al. (12) that locally circulated influenza B strains in 2005 were dominated by reassortants with Victoria lineage of hemaglutinin and Yamagata lineage of neuraminidase. We additionally analyzed Vic- and Yama-lineage groupings of the six internal genes and noted that only the NS genes could neither be assigned to Vic- or Yama-lineage. In particular the grouping of NS genes have come across the boundary as depicted by the other seven genes (Table 2). Accordingly we have labeled 10
11 them clade A and B. Based on these groupings of the eight influenza B segments, we have revealed three distinct phylogenetic patterns on those Taiwanese strains under consideration, namely pattern I, II and III. From the timeline of these isolates, it was speculated that pattern III viruses might have been originated from a local mixing of pattern I and II viruses. On the other hand, we cannot completely rule out the possibility that pattern III viruses might have been imported, as shown in Fig. 2 that all six Taiwanese pattern III viruses consistently cluster together with B/Oslo/71/04 and B/England/23/04, and are well separated from the rest of the other international reference strains. NS gene can encode NS1 and NS2 proteins, in which NS1 protein is a multifunctional protein for influenza virus replication. It would be important for further investigation on the impact of observed NS genetic diversity on influenza B virus infection. ACKNOWLEDGEMENTS The authors would like to thank Chang Gung Memorial Hospital (Grant No. CMRPD250031, and CMRPD150161) and the National Science Council of the Republic of China, Taiwan (Grant No. NSC E ) for financially supporting this research. 11
12 REFERENCE 1. Burland, T. G DNASTAR's Lasergene sequence analysis software. Methods Mol Biol 132: Hay, A. J., V. Gregory, A. R. Douglas, and Y. P. Lin The evolution of human influenza viruses. Philos Trans R Soc Lond B Biol Sci 356: Lamb, R. A., and P. W. Choppin The gene structure and replication of influenza virus. Annu Rev Biochem 52: McCullers, J. A., T. Saito, and A. R. Iverson Multiple genotypes of influenza B virus circulated between 1979 and J Virol 78: Page, R. D TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12: Persson, B Bioinformatics in protein analysis. Exs 88: Retief, J. D Phylogenetic analysis using PHYLIP. Methods Mol Biol 132: Rice, P., I. Longden, and A. Bleasby EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet 16: Rota, P. A., T. R. Wallis, M. W. Harmon, J. S. Rota, A. P. Kendal, and K. Nerome Cocirculation of two distinct evolutionary lineages of influenza type B virus since Virology 175: Shaw, M. W., X. Xu, Y. Li, S. Normand, R. T. Ueki, G. Y. Kunimoto, H. Hall, A. Klimov, N. J. Cox, and K. Subbarao Reappearance and global spread of variants of influenza B/Victoria/2/87 lineage viruses in the and seasons. Virology 303: Thompson, J. D., D. G. Higgins, and T. J. Gibson CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: Tsai, H. P., H. C. Wang, D. Kiang, S. W. Huang, P. H. Kuo, C. C. Liu, I. J. Su, and J. R. Wang Increasing appearance of reassortant influenza B virus in taiwan from 2002 to J Clin Microbiol 44:
13 Table 1. Primer sets used in specific gene amplification by RT-PCR Gene Name Sequence (5 to 3 ) Location a Size PB2 PB2-F-34 AGCAGAAGCAGAGCATCTTC PB2-R-709 CGATGCARTTGCAGGCACTT PB1 PB1-F-31 ATCCWTATTTTCTYTTCATAGATGT PB1-R-1228 GATGCHGTTCCTTCTTCATTGAAG PA PA-F-289 CAAGAGCATGGAATAGAGACTCC PA-R-1324 AGTATTTYCTTCTTTCACTCCCT HA HA-F-97 ATAACATCGTCAAACTCACC HA-R-1321 CACCRCTTAGTCTTTGAAG NP NP-F-544 ACCATCTACTTCAGCCCTATAA NP-R-1711 CTGTGTCCCTCCCAAAGAAGAAA M M-F-26 TGTCGCTGTTTGGAGACACAA M-R-1157 CYGACATTGAKTACAATTTGCTT NS NS-F-64 ACACAAATYGAGGTGGGTCC NS-R-1050 CTGTACACTTCAACCACATC NA NA1-F-1 AGCAGAAGCAGAGCATCTTC NA1-R-750 CGATGCARTTGCAGGCACTT NA2-F-621 TATATCGGAGTTGATGG NA2-R-1049 GCTTCCATCATYTGGTCTGG NA3-F-910 CCATAGAATGTGCCTGTAGAG NA3-R-1557 AGTAGTAACAAGAGCATTTTTC a Based on nucleotide position of coding sequences from B/Lee/40. Key to degenerated nucleotides : R = A+G; W = A+T; K = G+T; Y = C+T; H = A+T+C; 13
14 Table 2. Influenza B viruses used for genome analysis. Strain Time of Genome composition isolation PB2 PB1 PA HA NP NA M NS B/Taiwan/00076/ /01 B/Taiwan/00937/ /03 B/Taiwan/71207/ /07 B/Taiwan/72266/04 * 2004/12 B/Taiwan/70007/05 * 2005/01/04 B/Taiwan/70122/05 * 2005/01/11 B/Taiwan/70149/05 * 2005/01/13 Clade B/Taiwan/70299/05 * Vic Vic Ya Vic Ya Ya Ya 2005/01/22 A B/Taiwan/70325/05 * 2005/01/25 B/Taiwan/70555/05 * 2005/02/16 B/Taiwan/00710/05 * 2005/03/16 B/Taiwan/70878/05 * 2005/03/22 B/Taiwan/90680/05 * 2005/03/28 B/Taiwan/70949/05 * 2005/04/07 B/Taiwan/71024/ /06 B/Taiwan/71426/ /08 B/Taiwan/71540/ /09 Clade B/Taiwan/70513/05 * Ya Ya Ya Ya Ya Ya Ya 2005/02/04 A B/Taiwan/90584/05 * 2005/03/11 B/Taiwan/70864/05 * 2005/03/19 B/Taiwan/01742/ /05 B/Taiwan/02091/ /05 B/Taiwan/03852/ /09 B/Taiwan/00013/ /01 B/Taiwan/02112/ /05 B/Taiwan/00979/ /02 B/Taiwan/01709/ /04 B/Taiwan/70125/ /02 Clade Ya Ya Ya Ya Ya Ya Ya B/Taiwan/71718/ /10 B B/Taiwan/71891/ /11 B/Taiwan/03395/04 * 2004/12 B/Taiwan/70131/05 * 2005/01/12 B/Taiwan/70146/05 * 2005/01/13 B/Taiwan/00202/05 * 2005/01/21 B/Taiwan/70539/05 * 2005/02/07 B/Taiwan/01026/05 * 2005/04/18 Vic: Strains grouped with B/Victoria/2/87; Ya: Strains grouped with Phy. group B/Yamagata/16/88. Asterisk: Strains isolated from the winter peak season of 2004/05. I III II 14
15 FIGURE LEGENDS Figure 1. Phylogenetic relationship of 36 Taiwanese influenza B isolates for all 8 genomic segments. According to the grouping in each subplot, isolates were labeled either of Yamagata or Victoria lineage. One exception is that for the NS gene, for which no Taiwanese isolates were grouped to Yamagata or Victoria lineage, clade A and B was used. Also labeled were the three phylogenetic group numbers (Table 2). Some bootstrap values based on the percentage of 1,000 pseudo-replicates are included for reference. Figure 2. Phylogenetic relationship of 6 Taiwanese pattern III influenza B strains versus 37 international influenza B viral genomes. Both B/England/23/04 and B.Oslo/71/04 were consistently grouped together with group III Taiwanese isolates in all 8 subplots. Some bootstrap values based on the percentage of 1,000 pseudo-replicates are included for reference. 15
16 Figure 1 Phylogenetic relationship of 36 Taiwanese influenza B strains for 8 genomic segments.
17 99.9 Yama-lineage 97.5 B/Lee/40-PB2 B/Yamagata/16/88-PB2 B/Taiwan/70125/04-PB2 B/Taiwan/70131/05-PB2 B/Taiwan/3395/04-PB2 B/Taiwan/1026/05-PB2 B/Taiwan/70146/05-PB2 B/Taiwan/202/05-PB2 B/Taiwan/70539/05-PB2 B/Taiwan/71718/04-PB2 B/Taiwan/71891/04-PB2 B/Taiwan/2112/01-PB2 B/Taiwan/0013/01-PB2 B/Taiwan/2091/00-PB2 B/Taiwan/1742/00-PB2 B/Taiwan/3852/00-PB2 B/Taiwan/1709/02-PB2 B/Taiwan/0979/02-PB2 B/Taiwan/70864/05-PB2 B/Taiwan/71426/04-PB2 B/Taiwan/71024/04-PB2 B/Taiwan/71540/04-PB2 B/Taiwan/90584/05-PB2 B/Taiwan/70513/05-PB2 B/Victoria/2/87-PB2 B/Taiwan/71207/04-PB2 B/Taiwan/0937/03-PB2 B/Taiwan/0076/03-PB2 B/Taiwan/70878/05-PB2 B/Taiwan/70007/05-PB2 B/Taiwan/70555/05-PB2 B/Taiwan/70325/05-PB2 B/Taiwan/70122/05-PB2 B/Taiwan/70299/05-PB2 B/Taiwan/710/05-PB2 B/Taiwan/90680/05-PB2 B/Taiwan/70149/05-PB2 B/Taiwan/70949/05-PB2 B/Taiwan/72266/04-PB2 Vic-lineage II III I
18 94.9 Yama-lineage 97.1 Vic-lineage B/Lee/40-PB1 B/Yamagata/16/86 B/Taiwan/01742/00-PB1 B/Taiwan/71024/04-PB1 B/Taiwan/71540/04-PB1 B/Taiwan/71426/04-PB1 B/Taiwan/90584/05-PB1 B/Taiwan/70864/05-PB1 B/Taiwan/70513/05-PB1 B/Taiwan/00202/05-PB1 B/Taiwan/70539/05-PB1 B/Taiwan/71891/04-PB1 B/Taiwan/71718/04-PB1 B/Taiwan/03395/04-PB1 B/Taiwan/70131/05-PB1 B/Taiwan/70146/05-PB1 B/Taiwan/70125/04-PB1 B/Taiwan/01026/05-PB1 B/Taiwan/02112/01-PB1 B/Taiwan/00013/01-PB1 B/Taiwan/01709/02-PB1 B/Taiwan/00979/02-PB1 B/Taiwan/02091/00-PB1 B/Taiwan/03852/00-PB1 B/Victoria/2/87-PB1 B/Taiwan/71207/04-PB1 B/Taiwan/00937/03-PB1 B/Taiwan/00076/03-PB1 B/Taiwan/70555/05-PB1 B/Taiwan/70299/05-PB1 B/Taiwan/70122/05-PB1 B/Taiwan/70878/05-PB1 B/Taiwan/70325/05-PB1 B/Taiwan/70007/05-PB1 B/Taiwan/00710/05-PB1 B/Taiwan/90680/05-PB1 B/Taiwan/70949/05-PB1 B/Taiwan/70149/05-PB1 B/Taiwan/72266/04-PB1 III II I
19 99.3 Yama-lineage B/Lee/40-PA B/Victoria/2/87-PA B/Yamagata/16/88-PA B/Taiwan/70878/05-PA B/Taiwan/70149/05-PA B/Taiwan/00710/05-PA B/Taiwan/70122/05-PA B/Taiwan/70949/05-PA B/Taiwan/72266/04-PA B/Taiwan/70555/05-PA B/Taiwan/90680/05-PA B/Taiwan/70007/05-PA B/Taiwan/70299/05-PA B/Taiwan/70325/05-PA B/Taiwan/00076/03-PA B/Taiwan/00937/03-PA B/Taiwan/71207/04-PA B/Taiwan/90584/05-PA B/Taiwan/70513/05-PA B/Taiwan/70864/05-PA B/Taiwan/71540/04-PA B/Taiwan/71024/04-PA B/Taiwan/71426/04-PA B/Taiwan/02112/01-PA B/Taiwan/00013/01-PA B/Taiwan/70125/04-PA B/Taiwan/70539/05-PA B/Taiwan/00202/05-PA B/Taiwan/71718/04-PA B/Taiwan/71891/04-PA B/Taiwan/01026/05-PA B/Taiwan/70131/05-PA B/Taiwan/03395/04-PA B/Taiwan/70146/05-PA B/Taiwan/01742/00-PA B/Taiwan/03852/00-PA B/Taiwan/02091/00-PA B/Taiwan/01709/02-PA B/Taiwan/00979/02-PA I III II
20 100 Yama-lineage B/Lee/40-HA B/Yamagata/16/88-HA B/Taiwan/2112/01-HA B/Taiwan/0013/01-HA B/Taiwan/2091/00-HA B/Taiwan/3852/00-HA B/Taiwan/1742/00-HA B/Taiwan/0979/02-HA B/Taiwan/1709/02-HA B/Taiwan/70125/04-HA B/Taiwan/1026/05-HA B/Taiwan/70131/05-HA B/Taiwan/70146/05-HA B/Taiwan/3395/04-HA B/Taiwan/202/05-HA B/Taiwan/70539/05-HA B/Taiwan/71891/04-HA B/Taiwan/71718/04-HA B/Taiwan/70864/05-HA B/Taiwan/90584/05-HA B/Taiwan/70513/05-HA B/Taiwan/71426/04-HA B/Taiwan/71024/04-HA B/Taiwan/71540/04-HA B/Victoria/2/87-HA B/Taiwan/0937/03-HA B/Taiwan/71207/04-HA B/Taiwan/70122/04-HA B/Taiwan/710/05-HA B/Taiwan/70149/05-HA B/Taiwan/70878/05-HA B/Taiwan/90680/05-HA B/Taiwan/70299/05-HA B/Taiwan/72266/04-HA B/Taiwan/70555/05-HA B/Taiwan/0076/03-HA B/Taiwan/70325/05-HA B/Taiwan/70007/05-HA B/Taiwan/70949/05-HA 99.8 Vic-lineage II III I
21 B/Lee/40-NP B/Victoria/2/87-NP B/Yamagata/16/88-NP B/Taiwan/71207/04-NP B/Taiwan/00937/03-NP Yama-lineage B/Taiwan/00076/03-NP B/Taiwan/00710/05-NP B/Taiwan/70878/05-NP B/Taiwan/70007/05-NP B/Taiwan/70325/05-NP B/Taiwan/90680/05-NP B/Taiwan/72266/04-NP B/Taiwan/70149/05-NP B/Taiwan/70299/05-NP B/Taiwan/70555/05-NP B/Taiwan/70949/05-NP B/Taiwan/70122/05-NP B/Taiwan/01709/02-NP B/Taiwan/00979/02-NP B/Taiwan/00202/05-NP B/Taiwan/70539/05-NP B/Taiwan/71891/04-NP B/Taiwan/71718/04-NP B/Taiwan/70125/04-NP B/Taiwan/01026/05-NP B/Taiwan/70146/05-NP B/Taiwan/70131/05-NP B/Taiwan/03395/04-NP I II B/Taiwan/02112/01-NP B/Taiwan/00013/01-NP B/Taiwan/03852/00-NP B/Taiwan/02091/00-NP B/Taiwan/01742/00-NP B/Taiwan/70864/05-NP B/Taiwan/90584/05-NP B/Taiwan/70513/05-NP B/Taiwan/71540/04-NP III B/Taiwan/71426/04-NP B/Taiwan/71024/04-NP
22 96.6 Yama-lineage B/Lee/40 B/Victoria/2/87-NA B/Yamagata/16/88-NA B/Taiwan/71207/04-NA B/Taiwan/0076/03-NA B/Taiwan/0937/03-NA B/Taiwan/70555/05-NA B/Taiwan/70149/05-NA B/Taiwan/90680/05-NA B/Taiwan/70325/05-NA B/Taiwan/70007/05-NA B/Taiwan/70299/05-NA B/Taiwan/70949/05-NA B/Taiwan/710/05-NA B/Taiwan/72266/04-NA B/Taiwan/70878/05-NA B/Taiwan/70122/05-NA B/Taiwan/70125/04-NA B/Taiwan/202/05-NA B/Taiwan/70539/05-NA B/Taiwan/71891/04-NA B/Taiwan/71718/04-NA B/Taiwan/1026/05-NA B/Taiwan/70146/05-NA B/Taiwan/3395/04-NA B/Taiwan/70131/05-NA B/Taiwan/0013/01-NA B/Taiwan/2112/01-NA B/Taiwan/2091/00-NA B/Taiwan/1742/00-NA B/Taiwan/3852/00-NA B/Taiwan/1709/02-NA B/Taiwan/0979/02-NA B/Taiwan/71540/04-NA B/Taiwan/71024/04-NA B/Taiwan/71426/04-NA B/Taiwan/70864/05-NA B/Taiwan/70513/05-NA B/Taiwan/90584/05-NA I II III
23 98.5 Yama-lineage B/Lee/40-M B/Victoria/2/87-M B/Yamagata/16/88-M B/Taiwan/710/05-M B/Taiwan/70878/05-M B/Taiwan/70122/04-M B/Taiwan/70325/05-M B/Taiwan/70149/05-M B/Taiwan/70555/05-M B/Taiwan/70007/05-M B/Taiwan/90680/05-M B/Taiwan/72266/04-M B/Taiwan/70299/05-M B/Taiwan/70949/05-M B/Taiwan/0076/03-M B/Taiwan/0937/03-M B/Taiwan/71207/04-M B/Taiwan/70125/04-M B/Taiwan/70131/05-M B/Taiwan/3395/04-M B/Taiwan/1026/05-M B/Taiwan/70146/05-M B/Taiwan/71718/04-M B/Taiwan/71891/04-M B/Taiwan/202/05-M B/Taiwan/70539/05-M B/Taiwan/2112/01-M B/Taiwan/0013/01-M B/Taiwan/2091/00-M B/Taiwan/1742/00-M B/Taiwan/3852/00-M B/Taiwan/1709/02-M B/Taiwan/0979/02-M B/Taiwan/71024/04-M B/Taiwan/71426/04-M B/Taiwan/71540/04-M B/Taiwan/70864/05-M B/Taiwan/70513/05-M B/Taiwan/90584/05-M I II III
24 Clade A B/Lee/40-NS B/Victoria/2/87-NS B/Yamagata/16/88-NS B/Taiwan/71207/04-NS B/Taiwan/0937/03-NS B/Taiwan/0076/03-NS B/Taiwan/72266/04-NS B/Taiwan/710/05-NS B/Taiwan/70555/05-NS B/Taiwan/70299/05-NS B/Taiwan/90680/05-NS B/Taiwan/70149/05-NS B/Taiwan/70878/05-NS B/Taiwan/70949/05-NS B/Taiwan/70122/05-NS B/Taiwan/70325/05-NS B/Taiwan/70007/05-NS B/Taiwan/71540/04-NS B/Taiwan/71024/04-NS B/Taiwan/71426/04-NS B/Taiwan/70864/05-NS B/Taiwan/70513/05-NS B/Taiwan/90584/05-NS B/Taiwan/1026/05-NS B/Taiwan/70146/05-NS B/Taiwan/3395/04-NS B/Taiwan/70131/05-NS B/Taiwan/70539/05-NS B/Taiwan/71718/04-NS B/Taiwan/71891/04-NS B/Taiwan/202/05-NS B/Taiwan/70125/04-NS B/Taiwan/2112/01-NS B/Taiwan/0013/01-NS B/Taiwan/0979/02-NS B/Taiwan/1709/02-NS B/Taiwan/1742/00-NS B/Taiwan/2091/00-NS B/Taiwan/3852/00-NS Clade B 100 I III II
25 Figure 2 Phylogenetic relationship of 6 Taiwanese pattern III influenza B strains vs 37 international influenza B viral genomes for 8 genomic segments.
26 100 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Hong Kong/330/2001 B/Barcelona/215/03 B/Moscow/3/03 B/Memphis/13/03 B/Geneva/5079/03 B/Cheju/303/03 B/Tehran/80/02 B/Israel/95/03 B/Los Angeles/1/02 B/Shandong/7/97 B/Nanchang/2/97 B/Nanchang/6/98 B/Victoria/2/87 B/Houston/1/91 B/Memphis/5/93 B/Yamagata/16/88 B/Beijing/76/98 B/Nanchang/6/96 B/Nanchang/630/94 B/Hong Kong/293/ B/Hong Kong/557/00 B/Beijing/184/93 B/Memphis/12/97 B/Yamanashi/166/98 B/Maryland/1/01 B/Sichuan/379/99 B/Victoria/504/2000 B/Bucharest/795/03 B/Bangkok/460/03 B/Hong Kong/692/01 B/Nebraska/2/01 B/Nebraska/1/01 B/Oslo/71/04 B/Taiwan/70513/05-PB2 B/Taiwan/90584/05-PB2 B/Taiwan/70864/05-PB2 B/England/23/04 B/Taiwan/71024/04-PB2 B/Taiwan/71540/04-PB2 B/Taiwan/71426/04-PB2
27 100 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Memphis/5/93 B/Hong Kong/330/2001 B/Los Angeles/1/02 B/Cheju/303/03 B/Geneva/5079/03 B/Memphis/13/03 B/Israel/95/03 B/Tehran/80/02 B/Barcelona/215/03 B/Moscow/3/03 B/Shangdong/7/97 B/Nanchang/2/97 B/Nanchang/6/98 B/Nanchang/6/96 B/Nanchang/630/94 B/Victoria/2/87 B/Houston/1/91 B/Yamagata/16/88 B/Beijing/184/93 B/Victoria/504/ B/Hong Kong/692/01 B/Nebraska/1/01 B/Nebraska/2/01 B/Sichuan/379/99 B/Maryland/1/01 B/Bangkok/460/03 B/Bucharest/795/03 B/Yamanashi/166/98 B/Memphis/12/97 B/Beijing/76/98 B/Hong Kong/557/00 B/Hong Kong/293/02 B/Oslo/71/04 B/England/23/04 B/Taiwan/71024/04-PB1 B/Taiwan/71540/04-PB1 B/Taiwan/70864/05-PB1 B/Taiwan/90584/05-PB1 B/Taiwan/70513/05-PB1 B/Taiwan/71426/04-PB1
28 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Victoria/2/87 B/Nanchang/630/94 B/Nanchang/6/96 B/Yamagata/16/88 B/Houston/1/91 B/Memphis/5/93 B/Hong Kong/330/2001 B/Nanchang/6/98 B/Nanchang/2/97 B/Shandong/7/97 B/Beijing/76/98 B/Hong Kong/293/02 B/Hong Kong/557/00 B/Beijing/184/93 B/Yamanashi/166/98 B/Memphis/12/97 B/Victoria/504/2000 B/Bucharest/795/03 B/Bangkok/460/03 B/Sichuan/379/99 B/Maryland/1/01 B/Hong Kong/692/01 B/Nebraska/1/01 B/Nebraska/2/01 B/Geneva/5079/03 B/Los Angeles/1/02 B/Barcelona/215/03 B/Tehran/80/02 B/Moscow/3/03 B/Cheju/303/03 B/Memphis/13/03 B/Israel/95/03 B/Oslo/71/04 B/Taiwan/90584/05-PA B/Taiwan/70864/05-PA B/England/23/04 B/Taiwan/70513/05-PA B/Taiwan/71024/04-PA B/Taiwan/71540/04-PA B/Taiwan/71426/04-PA
29 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Victoria/2/87 B/Nanchang/6/96 B/Nanchang/630/94 B/Hong Kong/330/2001 B/Moscow/3/03 B/Geneva/5079/03 B/Cheju/303/03 B/Memphis/13/03 B/Israel/95/03 B/Los Angeles/1/02 B/Tehran/80/02 B/Barcelona/215/03 B/Nanchang/6/98 B/Nanchang/2/97 B/Shangdong/7/97 B/Yamagata/16/88 B/Houston/1/91 B/Memphis/5/93 B/Beijing/184/93 B/Maryland/1/01 B/Victoria/504/2000 B/Sichuan/379/99 B/Hong Kong/692/01 B/Nebraska/1/01 B/Nebraska/2/01 B/Yamanashi/166/98 B/Memphis/12/97 B/Beijing/76/98 B/Hong Kong/557/00 B/Bangkok/460/03 B/Bucharest/795/03 B/Hong Kong/293/02 B/Oslo/71/04 B/England/23/04 B/Taiwan/70864/05-HA B/Taiwan/90584/05-HA B/Taiwan/70513/05-HA B/Taiwan/71024/04-HA B/Taiwan/71540/04-HA B/Taiwan/71426/04-HA
30 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/86 B/Victoria/2/87 B/Memphis/5/93 B/Houston/1/91 B/Yamagata/16/88 B/Nanchang/630/94 B/Nanchang/6/96 B/Shangdong/7/97 B/Tehran/80/02 B/Geneva/5079/03 B/Memphis/13/03 B/Cheju/303/03 B/Israel/95/03 B/Los Angeles/1/02 B/Barcelona/215/03 B/Moscow/3/03 B/Nanchang/6/98 B/Nanchang/2/97 B/Hong Kong/330/2001 B/Beijing/184/93 B/Yamanashi/166/98 B/Memphis/12/97 B/Beijing/76/98 B/Hong Kong/557/00 B/Bangkok/460/03 B/Bucharest/795/03 B/Victoria/504/2000 B/Hong Kong/293/02 B/Sichuan/379/99 B/Maryland/1/01 B/Hong Kong/692/01 B/Nebraska/2/01 B/Nebraska/1/01 B/Oslo/71/04 B/Taiwan/71024/04-NP B/Taiwan/71426/04-NP B/Taiwan/71540/04-NP B/England/23/04 B/Taiwan/90584/05-NP B/Taiwan/70513/05-NP B/Taiwan/70864/05-NP
31 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Nanchang/6/96 B/Victoria/2/87 B/Houston/1/91 B/Memphis/5/93 B/Hong Kong/330/2001 B/Nanchang/2/97 B/Nanchang/6/98 B/Shangdong/7/97 B/Yamagata/16/88 B/Nanchang/630/94 B/Beijing/184/93 B/Victoria/504/2000 B/Bucharest/795/03 B/Bangkok/460/03 B/Maryland/1/01 B/Sichuan/379/99 B/Hong Kong/692/01 B/Los Angeles/1/02 B/Israel/95/03 B/Cheju/303/03 B/Memphis/13/03 B/Geneva/5079/03 B/Moscow/3/03 B/Barcelona/215/03 B/Tehran/80/02 B/Nebraska/2/01 B/Nebraska/1/01 B/Yamanashi/166/98 B/Memphis/12/97 B/Beijing/76/98 B/Hong Kong/557/00 B/Hong Kong/293/02 B/England/23/04 B/Oslo/71/04 B/Taiwan/71540/04-NA B/Taiwan/71024/04-NA B/Taiwan/71426/04-NA B/Taiwan/70513/05-NA B/Taiwan/90584/05-NA B/Taiwan/70864/05-NA
32 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Victoria/2/87 B/Houston/1/91 B/Memphis/5/93 B/Nanchang/630/94 B/Nanchang/6/96 B/Yamagata/16/88 B/Hong Kong/330/2001 B/Nanchang/6/98 B/Shangdong/7/97 B/Nanchang/2/97 B/Beijing/184/93 B/Israel/95/03 B/Cheju/303/03 B/Geneva/5079/03 B/Memphis/13/03 B/Tehran/80/02 B/Moscow/3/03 B/Los Angeles/1/02 B/Barcelona/215/03 B/Hong Kong/692/01 B/Nebraska/2/01 B/Nebraska/1/01 B/Victoria/504/2000 B/Sichuan/379/99 B/Maryland/1/01 B/Bucharest/795/03 B/Bangkok/460/03 B/Memphis/12/97 B/Yamanashi/166/98 B/Beijing/76/98 B/Hong Kong/557/00 B/Hong Kong/293/02 B/Taiwan/70864/05-M B/England/23/04 B/Taiwan/70513/05-M B/Taiwan/90584/05-M B/Taiwan/71540/04-M B/Taiwan/71426/04-M B/Taiwan/71024/04-M B/Oslo/71/04
33 B/Lee/40 B/Hong Kong/05/1972 B/Ann Arbor/1/1986 B/Victoria/2/87 B/Houston/1/91 B/Yamagata/16/88 B/Beijing/184/93 B/Beijing/76/98 B/Hong Kong/557/00 B/Hong Kong/330/2001 B/Shangdong/7/97 B/Nanchang/6/98 B/Nanchang/2/97 B/Yamanashi/166/98 B/Memphis/12/97 B/Memphis/5/93 B/Nanchang/630/94 B/Nanchang/6/96 B/Sichuan/379/99 B/Maryland/1/01 B/Hong Kong/293/02 B/Bangkok/460/03 B/Bucharest/795/03 B/Victoria/504/2000 B/Hong Kong/692/01 B/Geneva/5079/03 B/Los Angeles/1/02 B/Moscow/3/03 B/Memphis/13/03 B/Cheju/303/03 B/Israel/95/03 B/Tehran/80/02 B/Barcelona/215/03 B/Nebraska/2/01 B/Nebraska/1/01 B/Oslo/71/04 B/England/23/04 B/Taiwan/70864/05-NS B/Taiwan/70513/05-NS B/Taiwan/90584/05-NS B/Taiwan/71540/04-NS B/Taiwan/71426/04-NS B/Taiwan/71024/04-NS
Influenza A Virus PB1-F2 Gene in Recent Taiwanese Isolates
Influenza A Virus PB1-F2 Gene in Recent Taiwanese Isolates Guang-Wu Chen,* Ching-Chun Yang, Kuo-Chien Tsao, Chung-Guei Huang, Li-Ang Lee, Wen-Zhi Yang, Ya-Ling Huang, Tzou-Yien Lin, and Shin-Ru Shih Influenza
More informationModeling the Antigenic Evolution of Influenza Viruses from Sequences
Modeling the Antigenic Evolution of Influenza Viruses from Sequences Taijiao Jiang Center of Systems Medicine, Chinese Academy of Medical Sciences Suzhou Institute of Systems Medicine October 8-10, 2015.
More informationInfluenza Virus Genotypes Circulating In Central Greece During And Vaccine Strain Match
ISPUB.COM The Internet Journal of Microbiology Volume 13 Number 1 Influenza Virus Genotypes Circulating In Central Greece During 2012-2014 And Vaccine Strain Match E Plakokefalos, A Vontas, Z Florou, G
More informationMulti-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis
JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin
More informationExistence of reassortant A (H1N2) swine influenza viruses in Saitama Prefecture, Japan
International Congress Series 1263 (2004) 749 753 Existence of reassortant A (H1N2) swine influenza viruses in Saitama Prefecture, Japan Shin ichi Shimada a, *, Takayasu Ohtsuka b, Masayuki Tanaka b, Munehito
More informationChange of Major Genotype of Enterovirus 71 in Outbreaks of Hand-Foot-and-Mouth Disease in Taiwan between 1998 and 2000
JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 2002, p. 10 15 Vol. 40, No. 1 0095-1137/02/$04.00 0 DOI: 10.1128/JCM.40.1.10 15.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Change
More informationPhylogenetic Methods
Phylogenetic Methods Multiple Sequence lignment Pairwise distance matrix lustering algorithms: NJ, UPM - guide trees Phylogenetic trees Nucleotide vs. amino acid sequences for phylogenies ) Nucleotides:
More informationIn April 2009, a new strain of
managing and reducing Uncertainty in an Emerging Influenza Pandemic 2. Brundage JF, Shanks GD. Deaths from bacterial pneumonia during 1918 19 influenza pandemic. Emerg Infect Dis 2008;14:1193-9. 3. Update:
More informationAvian Influenza Virus H7N9. Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences
Avian Influenza Virus H7N9 Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences Avian Influenza Virus RNA virus, Orthomyxoviruses Influenza A virus Eight Gene segments
More informationIdentification of New Influenza B Virus Variants by Multiplex Reverse Transcription-PCR and the Heteroduplex Mobility Assay
JOURNAL OF CLINICAL MICROBIOLOGY, June 1998, p. 1544 1548 Vol. 26, No. 6 0095-1137/98/$04.00 0 Copyright 1998, American Society for Microbiology Identification of New Influenza B Virus Variants by Multiplex
More informationReassortment of influenza A virus genes linked to PB1 polymerase gene
International Congress Series 1263 (2004) 714 718 Reassortment of influenza A virus genes linked to PB1 polymerase gene Jean C. Downie* www.ics-elsevier.com Centre for Infectious Diseases and Microbiology,
More informationph1n1 H3N2: A Novel Influenza Virus Reassortment
ph1n1 H3N2: A Novel Influenza Virus Reassortment Jonathan Gubbay Medical Microbiologist Public Health Laboratory Public Health Ontario June 16, 2011 ph1n1 H3N2 Reassortment: Talk Overview Explain strain
More informationLaboratory-Based Surveillance and Molecular Epidemiology of Influenza Virus in Taiwan
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2005, p. 1651 1661 Vol. 43, No. 4 0095-1137/05/$08.00 0 doi:10.1128/jcm.43.4.1651 1661.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved.
More informationRESEARCH NOTE ANTIGENIC AND GENETIC CHARACTERIZATION OF INFLUENZA B VIRUSES IN 2012 FROM SLUMS, DHAKA, BANGLADESH
RESEARCH NOTE ANTIGENIC AND GENETIC CHARACTERIZATION OF INFLUENZA B VIRUSES IN 2012 FROM SLUMS, DHAKA, BANGLADESH Mohammad Ariful Islam 1,2, Nazneen Sultana 1, Firoz Ahmed 3, M Majibur Rahman 1 and Sabita
More informationPhylogenetic analysis of influenza B virus in Taiwan, 1997 to 2001
J Microbiol Immunol Infect 2004;37:135-144 Phylogenetic analysis of influenza B virus in Taiwan, 1997 to 2001 Chan et al Chi-Ho Chan 1, You Chan 1, Happy-K Shieh 2, Cheng-Hsien Tsai 3, Chia-Yuan Chen 4,
More informationOrigins and evolutionary genomics of the novel avian-origin H7N9 influenza A virus in China: Early findings
Origins and evolutionary genomics of the novel 2013 avian-origin H7N9 influenza A virus in : Early findings Jiankui He*, Luwen Ning, Yin Tong Department of Biology, South University of Science and Technology
More informationRecommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
More informationInfluenza Global Epidemiologic Update
Influenza Global Epidemiologic Update November 10 th, 2017 1. GLOBAL WHO SUMMARY based on data up to 15 October 2017 North America: Overall influenza virus activity remained low, with detections of predominantly
More informationPalindromes drive the re-assortment in Influenza A
www.bioinformation.net Hypothesis Volume 7(3) Palindromes drive the re-assortment in Influenza A Abdullah Zubaer 1, 2 * & Simrika Thapa 1, 2 1Swapnojaatra Bioresearch Laboratory, DataSoft Systems, Dhaka-15,
More informationSummary of Current Respiratory Season and Genetic Analysis of Influenza Virus Circulating in Alberta
Laboratory Bulletin Date: February 28, 2013 To: From: Re: Alberta Health, Alberta MicroNet, Communicable Disease Nurses, Infectious Diseases Physicians, Infection Prevention and Control, Medical Officers
More informationInfluenza Viruses A Review
Influenza Viruses A Review AVIAN INFLUENZA: INTERSECTORAL COLLABORATION Larnaca, Cyprus 20 22 July 2009 Kate Glynn Scientific and Technical Department, OIE Influenza Viruses C. Goldsmith,1981 Influenza
More informationEvolution of influenza
Evolution of influenza Today: 1. Global health impact of flu - why should we care? 2. - what are the components of the virus and how do they change? 3. Where does influenza come from? - are there animal
More informationInfluenza surveillance and pandemic preparedness - a global challenge Anne Kelso
Influenza surveillance and pandemic preparedness - a global challenge Anne Kelso WHO Collaborating Centre for Reference and Research on Influenza Melbourne, Australia Three global health challenges 243
More informationInfluenza Situation Update
SUMMARY Influenza Situation Update 27 May 2014 http://www.wpro.who.int/emerging_diseases/influenza/en/index.html Northern Hemisphere Overall, in the Northern Hemisphere countries, influenza-like illness
More informationOriginal Article Development and Sequence Analysis of a Cold-Adapted Strain of Influenza A/New Caledonia/20/1999(H1N1) Virus
Iranian Journal of Virology 2011;5(4): 6-10 2011, Iranian Society for Virology Original Article Development and Sequence Analysis of a Cold-Adapted Strain of Influenza A/New Caledonia/20/1999(H1N1) Virus
More informationCurrent Vaccines: Progress & Challenges. Influenza Vaccine what are the challenges?
Current Vaccines: Progress & Challenges Influenza Vaccine what are the challenges? Professor John S. Tam The Hong Kong Polytechnic University Asia-Pacific Alliance for the Control of Influenza (APACI)
More informationTexas Influenza Summary Report, Season (September 28, 2008 April 11, 2009)
Texas Influenza Summary Report, 2008 2009 Season (September 28, 2008 April 11, 2009) Background Influenza and influenza-like illnesses (ILI) were last reportable by law in any county in Texas in 1993 (1).
More informationA Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1) Strain
Viruses 2009, 1, 1204-1208; doi:10.3390/v1031204 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Article A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza
More informationUniversal Influenza Vaccine One For All
Universal Influenza Vaccine One For All MIXiii Conference, May 2014 Forward Looking Statements 2 This presentation includes forward-looking statements within the meaning of applicable securities laws.
More informationLikelihood that an unsubtypeable Influenza A result. in the Luminex xtag Respiratory Virus Panel. is indicative of novel A/H1N1 (swine-like) influenza
JCM Accepts, published online ahead of print on 3 June 2009 J. Clin. Microbiol. doi:10.1128/jcm.01027-09 Copyright 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationAcute respiratory illness This is a disease that typically affects the airways in the nose and throat (the upper respiratory tract).
Influenza glossary Adapted from the Centers for Disease Control and Prevention, US https://www.cdc.gov/flu/glossary/index.htm and the World Health Organization http://www.wpro.who.int/emerging_diseases/glossary_rev_sept28.pdf?ua=1
More informationChang Gung University co-commissioned final report. Research Ttitle: Antiviral mechanism study for 254 UVC robot system
co-commissioned final report Research Ttitle: Antiviral mechanism study for 254 UVC robot system Project/Research Number:: Execution duration: 2014.10.16-2015.01.16 Principle Investigator: Professor Shin-Ru
More informationInfluenza Weekly Surveillance Bulletin
Influenza Weekly Surveillance Bulletin Northern Ireland, Weeks 50-51 (11 th December 24 th December 2017) Summary Influenza activity across Northern Ireland increased in weeks 50 and 51 (weeks commencing
More informationInfluenza Weekly Surveillance Bulletin
Influenza Weekly Surveillance Bulletin Northern Ireland, Week 1 (1 st January 7 th January 2018) Summary GP consultation rates increased while OOH consultation rates decreased in week 1, (week commencing
More informationEnterovirus 71 Outbreak in P. R. China, 2008
JCM Accepts, published online ahead of print on 13 May 2009 J. Clin. Microbiol. doi:10.1128/jcm.00563-09 Copyright 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationChinese Influenza Weekly Report
Chinese Influenza Weekly Report (All data are preliminary and may change as more reports are received) Summary During week 5, influenza activity is at intra-seasonal levels both in southern and northern
More informationChronic shedders as reservoir for nosocomial. transmission of norovirus
JCM Accepts, published online ahead of print on 1 September 2010 J. Clin. Microbiol. doi:10.1128/jcm.01308-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All
More informationدکتر بهروز نقیلی استاد بیماریهای عفونی مرکس تحقیقات بیماریهای عفونی و گرمسیری پاییس 88
دکتر بهروز نقیلی استاد بیماریهای عفونی مرکس تحقیقات بیماریهای عفونی و گرمسیری پاییس 88 FLU.. How often can you escape? Three viral types are distinguished by their matrix and nucleoproteins Type Host Clinical
More informationGenetic characterization of the hemagglutinin gene of influenza B virus which predominated in the 1985/86 Canadian influenza season
Can J Infect Dis Vol 8 No 5 September/October 1997 265 ORIGINAL ARTICLE Genetic characterization of the hemagglutinin gene of influenza B virus which predominated in the 1985/86 Canadian influenza season
More informationبسم هللا الرحمن الرحيم
- 1 - - - 1 P a g e بسم هللا الرحمن الرحيم This sheet was made from record section 1 all information are included - Introduction Our respiratory tract is divided anatomically to upper (URT),middle and
More informationSummary. Week 13/2018 (26 31 March 2018) season overview
Summary Week 13/2018 (26 31 March 2018) Influenza viruses continued to circulate in the Region, while all countries reported low or medium intensity of activity of respiratory infections. Influenza continued
More informationComputational Analysis and Visualization of the Evolution of Influenza Virus
Computational Analysis and Visualization of the Evolution of Influenza Virus A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY Ham Ching, Lam IN PARTIAL FULFILLMENT
More informationEvaluation of New Rapid Antigen Test for the Detection of Pandemic. Influenza A/H1N Virus
JCM Accepts, published online ahead of print on 31 March 2010 J. Clin. Microbiol. doi:10.1128/jcm.02392-09 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All
More informationChinese Influenza Weekly Report
National Institute for Viral Disease Control and Prevention, China CDC Chinese Weekly Report (All data are preliminary and may change as more reports are received) Summary During week 17, influenza activity
More informationPreparing for the Fall Flu Season. Jonathan Gubbay Medical Microbiologist Public Health Laboratory OAHPP
Preparing for the Fall Flu Season Laboratory Perspective Jonathan Gubbay Medical Microbiologist Public Health Laboratory OAHPP September 21, 2009 Objectives 1. Review the emergence of Novel Influenza A
More informationHuman parainfluenza virus type 2 hemagglutininneuramindase gene: sequence and phylogenetic analysis of the Saudi strain Riyadh 105/2009
Almajhdi et al. Virology Journal 2012, 9:316 SHORT REPORT Open Access Human parainfluenza virus type 2 hemagglutininneuramindase gene: sequence and phylogenetic analysis of the Saudi strain Riyadh 105/2009
More informationEvolution of hepatitis C virus in blood donors and their respective recipients
Journal of General Virology (2003), 84, 441 446 DOI 10.1099/vir.0.18642-0 Short Communication Correspondence Jean-François Cantaloube jfc-ets-ap@gulliver.fr Evolution of hepatitis C virus in blood donors
More informationInfluenza Update N 159
Influenza Update N 159 10 May 2012 Summary The seasonal peak for influenza has passed in most countries in the temperate regions of the northern hemisphere. Different viruses have predominated in different
More informationDetection of novel (swine origin) H1N1 influenza A virus by quantitative. real-time RT-PCR
JCM Accepts, published online ahead of print on 24 June 2009 J. Clin. Microbiol. doi:10.1128/jcm.01087-09 Copyright 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationInfluenza Weekly Surveillance Bulletin
Influenza Weekly Surveillance Bulletin Northern Ireland, Week 4 (22 nd January 28 th January 2018) Summary In week 4, the surveillance data indicates a moderate seasonal flu activity, with indicators showing
More informationSegment-specific and common nucleotide sequences in the
Proc. Nati. Acad. Sci. USA Vol. 84, pp. 2703-2707, May 1987 Biochemistry Segment-specific and common nucleotide sequences in the noncoding regions of influenza B virus genome RNAs (viral transcription/viral
More informationTECHNICAL DOCUMENT. Influenza virus characterisation. Influenza A(H3N2) virus analysis. Summary Europe, December Summary
Community Network of Reference Laboratories (CNRL) for Human Influenza in Europe Influenza virus characterisation Summary Europe, December 2011 Summary Since week 40/2011, influenza A(H1N1)pdm09, influenza
More informationChinese Influenza Weekly Report
Chinese Influenza Weekly Report (All data are preliminary and may change as more reports are received) Summary During week 10, influenza activity was still a little high in southern and northern China
More informationChinese Influenza Weekly Report
Chinese Influenza Weekly Report (All data are preliminary and may change as more reports are received) Summary During week 13, influenza activity was still a little high in mainland China, and it was increasing
More informationReceived 21 December 2010/Returned for modification 4 February 2011/Accepted 29 March 2011
JOURNAL OF CLINICAL MICROBIOLOGY, June 2011, p. 2216 2221 Vol. 49, No. 6 0095-1137/11/$12.00 doi:10.1128/jcm.02567-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Rapid Differentiation
More informationInfluenza Weekly Surveillance Bulletin
Influenza Weekly Surveillance Bulletin Northern Ireland, Week 1 (2 January 217 8 January 217) Summary At this point in the 216/17 influenza season, activity has increased in week 1 (week commencing 9 th
More informationThe BLAST search on NCBI ( and GISAID
Supplemental materials and methods The BLAST search on NCBI (http:// www.ncbi.nlm.nih.gov) and GISAID (http://www.platform.gisaid.org) showed that hemagglutinin (HA) gene of North American H5N1, H5N2 and
More informationInfluenza viruses. Virion. Genome. Genes and proteins. Viruses and hosts. Diseases. Distinctive characteristics
Influenza viruses Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Virion Enveloped particles, quasi-spherical or filamentous Diameter 80-120 nm Envelope is derived
More informationHigh Failure Rate of the ViroSeq HIV-1 Genotyping System for Drug Resistance Testing in Cameroon, a Country with Broad HIV-1 Genetic Diversity
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2011, p. 1635 1641 Vol. 49, No. 4 0095-1137/11/$12.00 doi:10.1128/jcm.01478-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. High Failure
More informationAvian Influenza: Armageddon or Hype? Bryan E. Bledsoe, DO, FACEP The George Washington University Medical Center
Avian Influenza: Armageddon or Hype? Bryan E. Bledsoe, DO, FACEP The George Washington University Medical Center Definitions: Epidemic The occurrence of cases of an illness in a community or region which
More informationNorgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information
More informationOrthomyxoviridae and Paramyxoviridae. Lecture in Microbiology for medical and dental medical students
Orthomyxoviridae and Paramyxoviridae Lecture in Microbiology for medical and dental medical students Orthomyxoviridae and Paramyxoviridae are ss RNA containng viruses Insert Table 25.1 RNA viruses 2 SIZE
More informationChinese Influenza Weekly Report
Chinese Influenza Weekly Report (All data are preliminary and may change as more reports are received) Summary During week 26, influenza activity level in mainland China was very low, only a few A(H1N1)pdm09
More informationWeekly Influenza Surveillance Report. Week 11
Weekly Influenza Surveillance Report Week 11 Report produced: 22/03/2001 Influenza activity in Ireland For the week ending the 18/03/01, week 11, influenza activity has increased. Sentinel general practices
More informationNorgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended
More informationInfluenza A Viruses (Evolution and Current Status) AND H3N2v Outbreak Update
Influenza A Viruses (Evolution and Current Status) AND 2012 H3N2v Outbreak Update Scott Epperson Influenza Division National Center for Immunization and Respiratory Diseases Centers for Disease Control
More informationRelative activity (%) SC35M
a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure
More informationInfluenza vaccine Revisiting Old and Addressing Current Issues. Dr. Leilani T. Sanchez, DPPS, DPIDSP Manila, 18 February 2016
Influenza vaccine Revisiting Old and Addressing Current Issues Dr. Leilani T. Sanchez, DPPS, DPIDSP Manila, 18 February 2016 QIV QIV 2 Influenza Leilani Sanchez, MD 18 Feb 2016 PIDSP Annual Convention
More informationChinese Influenza Weekly Report
Chinese Influenza Weekly Report (All data are preliminary and may change as more reports are received) Summary During week 23, influenza activity level in mainland China was very low, only a few influenza
More informationChinese Influenza Weekly Report
Chinese Influenza Weekly Report (All data are preliminary and may change as more reports are received) Summary During week 27, influenza activity level in mainland China was very low, only a few influenza
More informationINFLUENZA VIRUS. INFLUENZA VIRUS CDC WEBSITE
INFLUENZA VIRUS INFLUENZA VIRUS CDC WEBSITE http://www.cdc.gov/ncidod/diseases/flu/fluinfo.htm 1 THE IMPACT OF INFLUENZA Deaths: PANDEMICS 1918-19 S p a n is h flu 5 0 0,0 0 0 U S 2 0,0 0 0,0 0 0 w o rld
More informationEmergence and Changes in swine and avian influenza viruses of Pandemic Potential
Emergence and Changes in swine and avian influenza viruses of Pandemic Potential Fourth Annual SARInet Meeting May 23-26, 2017 Punta Cana, Dominican Republic Stephen Lindstrom, Ph.D. Diagnostics Development
More informationKit Components Product # EP42720 (24 preps) MDx 2X PCR Master Mix 350 µl Cryptococcus neoformans Primer Mix 70 µl Cryptococcus neoformans Positive
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cryptococcus neoformans End-Point PCR Kit Product# EP42720 Product
More informationInfluenza vaccines. Cheryl Cohen
Influenza vaccines Cheryl Cohen cherylc@nicd.ac.za Overview Burden of influenza and risk groups Clinical presentation, diagnosis and treatment Influenza the virus Currently available influenza vaccines
More informationProduct # Kit Components
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Pneumocystis jirovecii PCR Kit Product # 42820 Product Insert Background Information
More informationInfluenza Update N 176
Update N 176 04 January 2013 Summary Reporting of influenza activity has been irregular in the past two weeks due to the holiday season in many countries. As a result, overall virus detections have dropped
More informationNew Genotypes within Respiratory Syncytial Virus Group B Genotype BA in Niigata, Japan
JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2010, p. 3423 3427 Vol. 48, No. 9 0095-1137/10/$12.00 doi:10.1128/jcm.00646-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. New Genotypes
More informationIncorporating virologic data into seasonal and pandemic influenza vaccines
Incorporating virologic data into seasonal and pandemic influenza vaccines Kanta Subbarao WHO Collaborating Centre for Reference and Research on Influenza & Department of Microbiology and Immunology, University
More informationAppendix B: Provincial Case Definitions for Reportable Diseases
Infectious Diseases Protocol Appendix B: Provincial Case Definitions for Reportable Diseases Disease: Influenza Revised December 2014 Influenza 1.0 Provincial Reporting Confirmed cases of disease 2.0 Type
More informationSummary. Week 15/2018 (9 15 April 2018) season overview
Summary Week 15/2018 (9 15 April 2018) Influenza viruses continued to circulate in the Region with 26% of the individuals sampled from primary healthcare settings testing positive, while all countries
More informationEmergence of distinct avian-like influenza A H1N1 viruses in pigs in Ireland and their reassortment with cocirculating H3N2 viruses
International Congress Series 1263 (2004) 209 213 Emergence of distinct avian-like influenza A H1N1 viruses in pigs in Ireland and their reassortment with cocirculating H3N2 viruses Y.P. Lin a, *, M. Bennett
More informationMolecular epidemiology and antigenic analyses of influenza A viruses H3N2 in Taiwan
ORGNAL ARTCLE VROLOGY Molecular epidemiology and antigenic analyses of influenza A viruses H3N2 in Taiwan J.-H. Lin 1,2, S.-C. Chiu 1,3, J.-C. Cheng 4, H.-W. Chang 1, K.-L. Hsiao 2, Y.-C. Lin 2, H.-S.
More informationRetrospective and Prospective Verification of the Cepheid Xpert Flu Assay
JCM Accepts, published online ahead of print on 20 July 2011 J. Clin. Microbiol. doi:10.1128/jcm.01162-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationRisk assessment of seasonal influenza - Update, EU/EEA, January 2017
RAPID RISK ASSESSMENT Risk assessment of seasonal influenza - Update, EU/EEA, 2016-2017 24 January 2017 Conclusions and options for response Most countries with high influenza activity have reported severe
More informationBioinformation by Biomedical Informatics Publishing Group
Predicted RNA secondary structures for the conserved regions in dengue virus Pallavi Somvanshi*, Prahlad Kishore Seth Bioinformatics Centre, Biotech Park, Sector G, Jankipuram, Lucknow 226021, Uttar Pradesh,
More informationInfluenza. Tim Uyeki MD, MPH, MPP, FAAP
Influenza Tim Uyeki MD, MPH, MPP, FAAP Influenza Division National Center for Immunization and Respiratory Diseases Coordinating Center for Infectious Diseases Centers for Disease Control and Prevention
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationCenters for Disease Control and Prevention U.S. INFLUENZA SEASON SUMMARY*
1 of 6 11/8/2012 1:35 PM Centers for Disease Control and Prevention 2004-05 U.S. INFLUENZA SEASON SUMMARY* NOTE: This document is provided for historical purposes only and may not reflect the most accurate
More informationInfluenza Weekly Surveillance Bulletin
Influenza Weekly Surveillance Bulletin Northern Ireland, Week 15 (9 th April 15 th April 2018) Summary In week 15, the surveillance data indicates influenza activity continues to decrease. Rates remain
More informationInfluenza Weekly Surveillance Bulletin
Influenza Weekly Surveillance Bulletin Northern Ireland, Weeks 40-41 (2 nd October 2017 15 th October 2017) Summary At this point in the 2017/18 influenza season, there is low influenza activity across
More informationRajesh Kannangai Phone: ; Fax: ; *Corresponding author
Amino acid sequence divergence of Tat protein (exon1) of subtype B and C HIV-1 strains: Does it have implications for vaccine development? Abraham Joseph Kandathil 1, Rajesh Kannangai 1, *, Oriapadickal
More informationInfluenza Genome Sequencing Project Proposal
Date of Proposal (MM/DD/YY): 06/13/12 TITLE: Role of the Untranslated Regions of the Influenza A Virus Replication and Vaccines Purpose/Objective-please provide a brief one to two paragraph description
More informationGenetic Diversity of Coxsackievirus A16 Associated with Hand, Foot, and Mouth Disease Epidemics in Japan from 1983 to 2003
JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 2007, p. 112 120 Vol. 45, No. 1 0095-1137/07/$08.00 0 doi:10.1128/jcm.00718-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Genetic Diversity
More informationInfluenza Situation Update
SUMMARY Influenza Situation Update 10 June 2014 http://www.wpro.who.int/emerging_diseases/influenza/en/index.html Northern Hemisphere In the Northern Hemisphere countries, influenza-like illness (ILI)
More informationInfluenza; tracking an emerging pathogen by popularity of Google Searches
Davids 1 Influenza; tracking an emerging pathogen by popularity of Google Searches Background Influenza is a wide spread and occasionally fatal disease, typically infecting children and the elderly. Each
More informationApril 8 to April 14, 2012 (Week 15)
Hanks you April 8 to April 14, 212 (Week 15) Overall Influenza Summary The peak of activity for the 211-212 influenza season in Canada has passed as most indicators of influenza activity continue to decline.
More informationInfluenza Prevention Update
Influenza Prevention Update Dean A. Blumberg, MD, FAAP Disclosure speakers bureau: sanofi pasteur, Merck Discussion off label use of FDA approved vaccines Influenza Prevention Update Seasonal influenza
More informationARIZONA INFLUENZA SUMMARY
ARIZONA INFLUENZA SUMMARY Week 4 (1/21/2018 1/27/2018) Synopsis: Influenza activity is elevated. Arizona reported Widespread Activity for week 4. Subscribe to the Flu & RSV report at azhealth.gov/email.
More informationInfluenza Weekly Surveillance Bulletin
Influenza Weekly Surveillance Bulletin Northern Ireland, Weeks 46-47 (13 th November 26 th November 2017 Summary Influenza activity across Northern Ireland remains low with Flu/FLI consultations low and
More informationSequence analysis for VP4 of enterovirus 71 isolated in Beijing during 2007 to 2008
16 2009 3 4 1 Journal of Microbes and Infection, March 2009, Vol. 4, No. 1 2007 2008 71 VP4 1, 2, 2, 2, 1, 2, 2, 2, 1, 2 1., 100730; 2., 100020 : 2007 2008 71 ( EV71), 2007 3 EV71( 1, 2 ) 2008 5 EV71(
More information