SUMMARY OF MEDICAL PHD THESIS

Transcription

1 MINISTRY OF EDUCATION AND TRAINING MINISTRY OF HEALTH NATIONAL INSTITUTE OF HYGIENE AND EPIDEMIOLOGY * HOANG THI BICH NGOC DISTRIBUTION AND SOME MOLECULAR CHARACTERISTICS OF DIARRHEAGENIC ESCHERICHIA COLI AMONG CHILDREN UNDER 5 YEARS OLD IN HANOI Major : Microbiology Code : SUMMARY OF MEDICAL PHD THESIS HANOI 2017

2 THIS THESIS HAS BEEN COMPLETED AT: NATIONAL INSTITUTE OF HYGIENE AND EPIDEMIOLOGY Academic tutors: Assoc.Prof. Hoang Thi Thu Ha Prof. Phung Dac Cam Reviewer 1: Reviewer 2: Reviewer 3: Assoc. Prof., PhD. Nguyen Thi Tuyen Assoc. Prof., PhD. Nguyen Dang Hien Assoc. Prof., PhD. Ho Ba Do This thesis is defended in front of Institutional Review Committee, the meeting is held at National Institute of Hygiene and Epidemiology. At... on... Full thesis can be found at - Library of National Institute of Hygiene and Epidemiology - National Library

3 THESIS RELATED PUBLICATIONS 1. Hoang Thi Bich Ngoc, Nguyen Thuy Tram, Phung Dac Cam, Hoang Thi Thu Ha (2014), Determination of diarrheagenic E. coli among children under 5 years old in National Hospital of Pediatrics by PCR technique, Vietnam Journal of Preventive Medicine, VolumeXXIV, Issue 8 (157), pp Hoang Thi Bich Ngoc, Do Bich Ngoc, Pham Dieu Quynh, Phung Dac Cam, Hoang Thi Thu Ha (2015), Antibiotic resistance and molecular association of Enteroaggregative E. coli strains isolated from diarrhea and non-diarrhea children by PFGE technique, Vietnam Journal of Preventive Medicine, Volume XXV, Issue 8(168), pp Hoang Thi Bich Ngoc, Nguyen Quoc Hung, Phung Dac Cam, Hoang Thi Thu Ha (2016), Determination of diarrheagenic E. coli among children under 5 years old in Ba Vi General Hospital, Vietnam Journal of Preventive Medicine, Issue 10 (1024), pp

4 ABBREVIATIONS Abb. Meaning AMC Amoxicillin/clavulanic acid AMP Ampicillin BVGH Ba Vi General Hospital CEP Cephalothin CHL Chloramphenicol CIP Ciprofloxacin CXM Cefuroxim DAEC Diffusely adherent E. coli DEC Diarrhea Escherichia coli EAEC Enteroaggregative E. coli EHEC Enterohemorrhagic E. coli EIEC Enteroinvasive E. coli EPEC Enteropathogenic E. coli ETEC Enterotoxigenic E. coli BVD Ba Vi district THQ Tay Ho quarter LT Heat-Labile-Toxin MLST Multi locus sequence typing NAL Nalidixic acid NHP National Hospital of Pediatrics PFGE Pulsed-field gel electrophoresis SXT Trimethoprim/sulfamethoxazole ST Sequence typing TET Tetracyclin VT Verocytotoxin VTEC Verocytotoxin - producing E.

5 1 BACKGROUND Diarrhea is one of the leading causes of child mortality, particularly in developing countries. It is estimated that approximately 2 billion cases of diarrhea are reported annually worldwide, of which about 1.9 million children under five years of age die from diarrhea. In Vietnam, General Department of Preventive Medicine estimated that there were 104,367 diarrhea cases in Hanoi in 2009, which remains the highest prevalence around the country with the rate of /100,000 population. There is the variety of agents causing diarrhea and Escherichia coli (E. coli) is one of the most common agents of diarrhea among children under 5 years old. The proportion of diarrhea due to E. coliare significantly different between countries as well as time of studies. In Vietnam, diarrheagenic E. coli was responsible for 22.5% diarrhea cases in children under 5 years old who hospitalized between 2001 and In China, a study conducted in 4 hospitals between 2012 and 2013 showed that diarrheagenic E. coli accounted for 9.9% of the causes of diarrhea. Identifying the association between clinical symptoms of diarrhea and the pathogens contributes to early detection of the cause that informs timely treatment. Recently, Enteroaggregative E. coli (EAEC) is an emerging diarrheagenic E. coli group which has accounted for the highest proportion of thediarrheagenic E. coli in the developing countries such as in India with 65.4%. In Vietnam, EAEC accounts for 11.6% of the cause of diarrhea among children under 5 years old. The outbreak of diarhea in Germany in 2011 also revealed the important role of EAEC. Studying on the causes of diarrhea, the antibiotic resistant level, and particularly the molecular epidemiological association is significantly necessary to provide evidence for prevention and treatment. The Pulsed-field Gel Electrophoresis (PFGE) has been applied commonly to determine the molecular epidemiological association of the bacteria strains through the

6 2 distinction in genotype. Currently, the Multilocus Sequence Typing (MLST) has been evaluated as a good technique to classify some bacteria such as Pseudomonas aeruginosa, Staphylococcus aureus. In Vietnam, limited research applies both PFGE and MLST techniques to determine the molecular epidemiological relation of EAEC strains. Therefore, we conducted the reseach, namely The distribution and molecular characteristics of diarrheagenic Escherichia coli among children under 5 years old in Hanoi with 2 following objectives: 1. To determine the proportion, distribution and some associated factors of diarrheagenic Escherichia coli among children under 5 years old in National Hospital of Pediatrics and Ba Vi General Hospital from 2010 to To describe some molecular characteristics of Enteroaggregative E. coli strains in 2 hospitals and among non-diarrhea children in Ba Vi district and Tay Ho quarter in Hanoi from 2010 to The contribution of the thesis This is the first research in Vietnam applying both PFGE and MLST techniques to determine the molecular epidemiological association of EAEC strains. The results show that MLST is more likely to detect EAEC strains than PFGE. Some related factors of diarrhea caused by EAEC among diarrhea pediatric patients under 5 years old are identified. Structure of thesis pageslength - Background: 2 pages, Chapter 1: Literature review (36 pages), Chapter 2: Study Methods and Subjects (17 pages), Chapter 3: Study results (32 pages), Chapter 4: Discussion (25 pages), Conclusion (1 page), Recommendation (1 page), New contribution of the thesis (1 page) There are 29 tables, 15 figures and 17 pictures in this thesis. This thesis has 127 references including 13 Vietnamese articles, 114 English articles.

7 3 CHAPTER 1. LITERATURE REVIEW 1.1. Diarrhea in the world and in Vietnam In the world, there are nearly 9 million children die from diarrhea annually, diarrhea still remains the second common cause of child mortality (just behind pneumonia) among children under 5 years old, which accounted for 11%. More than 80% of those occur in Africa and South East Asia. The 10-year survey (from 2004 to 2014) on the situation of diarrhea in Vietnam showed that there were 922,832 diarrhea cases in 2004, and it sharply increased to 1,012,378 cases in 2005, and then gradually decreasedover the years to cases in Diarrhea disease Diarrhea is defined as the passage of three or more of loose or liquid stool within 24 hour, which accompany some symptoms such as fever, vomiting, abdominal pain. The acute watery diarrhea lasts for no longer than 14 days, and persistent diarrhea lasts for more than 14 days. The causative agents for diarrhea are very diverse which are viruses, bacteria, parasitic organisms and fungi. In the developing countries, the bacteria and parasites are more popular causes. There are several clinical symptoms of diarrhea such as restless or irritable behaviors, crying, being in coma if they are severely dehydrated, nausea or vomiting, and feeling thirsty. The stools are loose or bloody or mucous-bloody. Diarrhea can be treated with rehydration and electrolyte replacement, combining antibiotics if the agent causing diarrhea is bacteria Diarrhea caused by E. coli Diarrhea caused by E. coli is very common disease in the world particularly among children in developing countries. The proportions are very different between geographic regions. In the suburb of Sudan in Africa, diarrhea due to E. coli accounted for 48% among children under 5 years. In China, the study from 2009 to 2013 among children

8 4 under 5 years hospitalized due to diarrhea showed only 5% diarrhea cases caused by E. coli. In 2011,in many European countries including Germany, the outbreak of acute diarrhea caused by E. coli O104:H4 occurred with 3910 infected cases, 782 cases with haemolytic syndrome, and high urea in blood and 45 of which died. In Vietnam, according to the study of Nguyen Vu Trung, Bui Thi Thu Hien among diarrhea pediatric patients under 5 years old, the proportion of E. coli causing diarrhea accounted for more than 20%. During 2010 to 2012, a study on pathogens of diarrhea isolated from the samples of pediatric patients admitted to Thai Binh Hospital showed that 15% were E. coli Diarrheagenic E. coli (DEC) E. coli carries virulence genes of diarrhea. The diarrheagenic E. coli are classified into the following groups based on the pathogenesis ability: Enteropathogenic E. coli (EPEC): E. coli causing intestinal diseases Enteroaggregative E. coli (EAEC): E. coli aggregating with intestine Enterohemorrhagic E. coli (EHEC): E. colicausing intestinal hemorrhage Enterotoxigenic E. coli (ETEC): E. coli generating toxin Enteroinvasive E. coli (EIEC): E. coli invading intestine Diffusely adherent E. coli (DAEC): E. coli adhering to intestine EPEC causes diarrhea by attaching and damaging the intestine microvilli that shortens the microvilli. Attachment factor bfp is defined by bfpa gene, not all EPEC has bfp factor. The strains with bfp are typical EPEC, and the strains without bfp are not typical EPEC. EPEC transfers the Tir receptor into the membrane of host cells. EPEC is able to attach with host cell membrane because of intimin factor that is defined by eaea gene. EAEC causes diarrhea in both adults and children. The mechanism of pathogenesis of EAEC is that the bacteria aggregates with intestinal

9 5 epithelial cells by aggregating factors defined by agga, aafa, agg3, agg4 genes. aggr gene coordinately controls the expression of the genes defining aggregating factors. aap gene encodes the dispersion, aata gene encodes the dispersin transporter protein, aaic gene encode the secreted protein. EAEC produces mucous substance that forms biofilm on the surface of epithelial cells. EAEC also produces toxin such as EAST1 encoded by asta gene, ShET1 toxin encoded by set1a gene that damages the epithelium. EHEC can cause the hemorrhagic syndrome, blood urea. EHEC attaches, invades, aggregates with intestinal epithelium and damage the epithelium locally like EPEC. EHEC produce toxin Stx1 and Stx2 that attack and damage intestinal epithelial cells, each strain of EHEC can consist of Stx1 and/or Stx2. ETEC causes the disease by attaching to epithelial cells and producing toxin. The main toxins are LT and ST, of which LT is encoded by eltab gene compound including 2 genes elta and eltb. ST toxin includes ST-I (also known as Sta) encoded by esta gene and ST-II (or STb) encoded by estb gene. Some strains of ETEC contain either LT toxin or ST toxin, but there are some strains have both LT and ST. EIEC invades in colonal cell monolayers, multiplying in the cell and damage the cell, and then invading and damaging macrophage cells. The ial, ipah genes encode the invasion factor of EIEC. DAEC is currently considered, DAEC has attachment factor Afa encoded by afa gene, including afaa, afab, afac, afad, afae and afabc genes Techniques to determine E. coli causing diarrhea Common techniques Molecular techniques 1.6. PFGE and MLST techniques to determine the molecular epidemiological association of E. coli agents that causes diarhea in the world and in Vietnam

10 6 CHAPTER 2 STUDY METHODS AND PARTICIPANTS 2.1. Participants, sites and time Participants for objective 1 Diarrhea pediatric patients admitted to National Hospital of Pediatrics and Ba Vi General Hospital. Participants for objective 2 EAEC strains isolated from samples of patients under 5 years old in National Hospital of Pediatrics and Ba Vi General Hospital and non-diarrhea, healthy children in Ba Vi district and Tay Ho quarter, Hanoi capital. Stool samples are collected from those participants for testing diarrheagenic E.coli. Selection criteria - Children under 5 years old, residing in Hanoi in at least 3 months. - Children with diarrhea: is defined as 3 or more passage of stool in 24 hours, liquid or loose stool or change in characteristics of normal stool. Episode of diarrhea is counted from the first day of diarrhea to the date of diagnosis, the diarrhea may decrease or stop in 1 day. Patients being treated with antibiotics are excluded from this study. - Non-diarrhea children: who are healthy, had no episode of diarrhea in at least one month before collecting stool sample Time The sample collection time was from January in 2010 to September in Design A Cross-sectional study was designed to determine the proportion and the distribution of strains of E. coli causing diarrhea. The descriptive study are used and based on data from microbiology laboratory and molecular biology of E. coli causing diarrhea.

11 2.4. Sampling - Sample for the first objective: Z n 2 1 α/2 7 p (1 p) 2 x DE d Of which: n is minimum sample size, Z is coefficient of reliability, α is degree of reliability (α =95%; Z=1.96), d is the precision of estimate (select d = 0.05), p is prevalence of DEC among diarrhea children of previous studies (p=0.225), DE is design effect (DE=1.2). The calculated minimum sample size is 347 diarrhea children. In fact, we recruited 360 diarrhea children admitted to the two hospitals. - Sample for the second objective: From the stool samples of 360 diarrhea children in hospitals and 386 non-diarrhea children recruited in kindergartens in the sites, 33 strains of EAEC were identified and tested with PFGE technique to determine the molecular characteristics and its association. 10 strains of EAEC were randomly withdraw from 33 strains (7 strains from diarrhea children and 3 strains from non-diarrhea children) to identify molecular characteristics and its association by using MLST technique Methods and techniques Technique for stool sample collection from diarrhea children Technique for culture, isolation and test of antibiotic susceptibility on E. coli The stool samples are cultured in Mac Conkey media, incubated in 35 o C in hours for identification of bio-chemical characteristics of E.coli. After being identified, the EAEC strains are tested for antibiotic susceptibility by disc disfusion method on Muller Hinton agar media with the following antibiotics: ampicillin (AMP) 10 µg, cephalothin (CEP) 30 µg, cefuroxim (CXM) 30 µg,

12 8 amoxicillin/clavulanic acid (AMC) 20/10 µg, trimethoprim/sulfamethoxazol (SXT) 1,25/23,75 µg, chloramphenicol (CHL) 30 µg, tetracycline (TET) 30µg, nalidixic acid (NAL) 30 µg, ciprofloxacin (CIP) 5 µg PCR test for identification of diarrheagenic E.coli Table 2.2. Primer pairs used to identify diarrheagenic E. coli Primer bfpa eae LT ST VT1 VT2 Target gene bfpa eaea eltb esta vt1 vt2 Sequence of nucleotide (5 3 ) TTCTTGGTGCTTGCGTGTCTTTT TTTTGTTTGTTGTATCTTTGTAA CACACGAATAAACTGACTAAAATG AAAAACGCTGACCCGCACCTAAAT TCTCTATGTGCATACGGAGC CCATACTGATTGCCGCAAT GCTAAACCAGTA G AGGTCTTCAAAA CCCGGTACA G A GCAGGATTACAACA GAAGAGTCCGTGGGATTACG AGCGATGCAGCTATTAATAA ACCGTTTTTCAGATTTT G A CACATA TACACAGGAGCAGTTTCAGACAGT - Standard for identification of diarrheagenic E. coli Size of product (bp) EPEC contains bfpa and eaea genes. ETEC contains eltb and/or esta genes. EHEC contains vt1and/or vt2 genes, and is identified as typical EHEC if the strain contains eaea gene. EIEC contains ial gene. EAEC contains pcvd gene. DAEC contains afabc gene.

13 PCR test for identification of virulence genes of EAEC 9 Table 2.3. Primer pairs used to identify the virulence genes of EAEC Target genes aggr agga aafa aap asta Sequence of primers (5 3 ) GTATACACAAAAGAAGGAAGC ACAGAATCGTCAGCATCAGC TTAGTCTTCTATCTAGGG AAATTAATTCCGGCATGG TGCGATTGCTACTTTATTAT ATTGACCGTGATTGGCTTCC CTTGGGTATCAGCCTGAATG AACCCATTCGGTTAGAGCAC CCATCAACACAGTATATCCGA GGTCGCGAGTGACGGCTTTGT Size of product (bp) Analysis of genome association by applying PFGE technique For preparation of bacteria DNA, we used restricted enzyme XbaI to cut the DNA of bacteria, the DNA products were electrophoresed and compared with each other and with standard strain S. braenderup H9812 which was also electrophoresed as a standardized scale. The homogeneity of EAEC strains was analysed by GelCompar II software that helps generate bacteria taxonomy.

14 Analysis of molecular characteristics by using MLST technique Table 2.4. Sequence of primers used in MLST technique on E.coli strains Gen Sequence of primers (5 3 ) adk fumc gyrb icd mdh pura reca ATTCTGCTTGGCGCTCCGGG CCGTCAACTTTCGCGTATTT TCACAGGTCGCCAGCGCTTC TCCCGGCAGATAAGCTGTGG TCGGCGACACGGATGACGGC GTCCATGTAGGCGTTCAGGG ATGGAAAGTAAAGTAGTTGTTCCGGCACA GGACGCAGCAGGATCTGTT AGCGCGTTCTGTTCAAATGC CAGGTTCAGAACTCTCTCTGT CGCGCTGATGAAAGAGATGA CATACGGTAAGCCACGCAGA CGCATTCGCTTTACCCTGACC TCGTCGAAATCTACGGACCGGA Size of product (bp) Sequencing and analysis of gene segments of 7 consensus genes including: adk (536 bp), fumc (469 bp), gyrb (460 bp), icd (518 bp), mdh (452 bp), pura (478 bp), reca (510 bp) with the support of MLST Bionumeric 6.5 software.

15 11 Chapter 3 STUDY RESULTS 3.1. Proportion, distribution and some associated factors of E.coli infection causing diarrhea among children under 5 years old admitted to National Hospital of Pediatrics and Ba Vi General Hospital from Main characteristics of diarrhea pediatric patients Children recruited for this study are classified into 3 age groups as follows: 0 12 months: 1 year, months: 2 years, months: 3 years months: 4 years, months: 5 years 0-24 months: under 2 years old, more than 24 months - 60 months: 3 5 years old. Among 360 pediatric children of 2 hospitals in Hanoi including National Hospital of Pediatrics and Ba Vi General Hospital, children under 2 years old accounted for 79.2%, group of 3-5 years old made up 20.8%. The participants consisted of 142 girls (39.4%) and 218 boys (60.6%). Among 360 diarrhea cases, 55 strains of DEC were identified, accounting for 15.3% Distribution of E. coli strains causing diarrhea among diarrhea pediatric patients with DEC Hospital Table 3.2. Distribution of DEC by hospitals (n=360) National Hospital of Pediatrics Number of diarrhea children Number of DEC Positive (%) Ba Vi General Hospital The results showed that the proportion of DEC in National Hospital of Pediatrics was 20.1% while it was 11.4% in Ba Vi General Hospital.

16 12 Table 3.3. Proportion of DEC strains among diarrhea pediatric patients (n=360) Strains of DEC Quantity Percentage(%) EAEC EPEC EHEC ETEC EIEC DAEC Among 360 study participants, EAEC took the highest proportion with 6.7%, being followed by EPEC with 4.2%, EIEC with 2.2%, EHEC with 1.1%, ETEC with 0.8% and DAEC with 0.3%. There was no co-infection of 2 or more strains of DEC among the patients. Table 3.4. Distribution of of genes determining DEC strains (n=55) Strains of DEC Gene Number of strain EAEC pcvd 24 EPEC eaea 7 eaea + bfp 8 vt1 0 EHEC vt2 3 vt1 + vt2 1 eltb 2 ETEC esta 0 eltb + esta 1 EIEC ial 8 DAEC afabc 1 2 genes eaea and bfpa were found in 8 out of 15 strains of EPEC while 7 strains are determined by eaea. 3 strains of EHEC were found with vt2 gene while 1 strains were found with both vt1 and vt2 genes. Among ETEC strains, eltb gene was found in 2 strains but only 1 strain contained both eltb and esta genes

17 13 Table 3.6. Distribution of DEC strains by age group of diarrhea pediatric patients with DEC (n=55) Strains of DEC 2 years 3 5 years Total n % n % n % EAEC EPEC EHEC ETEC EIEC DAEC Total In the group of children under 2 years old, the most frequent strain was EAEC with 22 strains (51.2%), followed by EPEC with 9 strains (20.9%), only 1 strain of DAEC was found (2.3%). In the older group of 3-5 years old, EPEC accounted for the highest proportion with 6 strains, equivalent to 50%. The second common strain in this group was EIEC with 3 strains that made up 25%, followed by EAEC with 2 strains (16.7%). None of case was found with ETEC and DAEC Some associated factors of diarrhea caused by DEC Table Association between diarrhea with DEC and number of passage of stool(n= 360) Number of passage Mean ± SD (Min Max) With DEC (n = 55) 7.22± 3.02 (3-20) Without DEC (n = 305) 6.54 ± 2.2 (3-15) p = 0.05 The probability of carrying DEC was higher among pediatric patients with the average number of stool passage around 7.22±3.02 times than those with 6.54 ± 2.2 times, the distinction was statistically significant with p = 0.05.

18 14 Table Comparison of feature of clinical symptoms with and without DEC Clinical With DEC Without DEC p symptoms (n = 55) (n = 305) Fever 26 (47.3%) 86 (28.2%) p <0.001 Vomiting 21 (38.2%) 77 (25.3%) p <0.05 Dehydration 17 (30.9%) 34 (11.1%) p <0.001 The results in table 3.12 show that the clinical symptoms including fever, vomiting and dehydration are more frequent among diarrhea patient with DEC than those without DEC. The difference is statistically significant with p<0.05. Table Comparison of feature of stool with and without DEC With DEC Without DEC Feature p (n = 55) (n = 305) Mucous or bloody or 45 (81.8%) 169 (55.4%) p <0.001 bloody-mucousstool The results indicate higher percentage of symptoms of mucous or bloody or bloody-mucous stool among patients with DEC diarrhea than those with other diarrhea, the difference is statistically significant with p< Some molecular characteristics of EAEC strains among diarrhea pediatric patients admitted to National Hospital of Pediatrics and Ba Vi General Hospital and children without diarrhea in Ba Vi district, Tay Ho quarter Hanoi from Some common characteristics of EAEC strains 33 strains were identified from the samples collected from diarrhea pediatric children (24 strains) and children without diarrhea (9 strains).

19 (%) Prevalence Antibiotic resistant level and distribution of virulence genes of EAEC strains Sensitive Intermediate Resistant AMP CEP CXM AMC SXT CHL GEN TET NAL CIP Antibiotic Figure Antibiotic resistant level of EAEC strains isolated from samples of diarrhea pediatric patients (n=24) The results reveal that EAEC strains were resistant to ampicillin with 83.3%, trimethoprim/ sulfamethoxazol wih 75.0%, chloramphenicol with 33.3% and nalidixic acid with 20.8%, none of he strains resists ciprofloxacin but 8.3% were at intermediate level. EAEC was determined to resist cephalothin, cefuroxim, amoxicillin/clavulanic and tetracyclin with the corresponding proportion of 83.3%, 37.5%, 37.5% and 79.2%, respectively.

20 16 Table Multiple antibiotic resistance of EAEC (n=33) Number of antibiotics Diarrhea patients (n=24) Resistant strains Non-diarrhea children (n= 9) Total 2 types types types types types types All EAEC strains resisted 2 or more types of antibiotic, 27/33 strains (81.8%) were resistant to 3 or more types of antibiotic. Table Proportion of EAEC strains carrying virulence genes Gene EAEC among diarrhea patients (n=24) EAEC among nondiarrhea children (n=9) Quant. % Quant. % aggr 20 83,3 3 33,3 agga 9 37,5 3 33,3 aafa 1 4,2 3 33,3 aap 21 87,5 2 22,2 asta 11 45,8 2 22,2 The results in table 3.15 show that 87.5% of EAEC strains carried aap gene, 83.3% carried aggr gene, 45.8% had asta gene, 37.5% with agga gene, and only 4.2% carried aafa gene. On the side of non-diarrhea children, 33.3% contained aggr, agga and aafa, 22.2% with aap and asta genes.

21 17 Table Distribution of virulence genes of EAEC strains among diarrhea patients (n=24) and non-diarrhea children (n=9) Number of genes Diarrhea patients n(%) Non-diarrhea children n(%) EAEC with 1 gene aggr 2 (8.3) agga 2 (22.2) aafa 3 (33.3) EAEC with 2 genes aggr, agga 1 (11.1) aggr, aafa 1 (11.1) aggr, aap 2 (8.3) aggr, asta 1 (4.2) agga, aap 2 (8.3) aafa, aap 1 (4.2) aap, asta 1 (11.1) EAEC with 3 genes aggr, agga, aap 6 (25.0) aggr, aap, asta 9 (37.5) 1 (11.1) EAEC with 4 genes aggr, agga, aap, asta 1 (4.2) Among the diarrhea pediatric patients, 8.3% of EAEC strains carried one gene, 25.0% with 2 genes, 62.5% of the strains had 3 genes and 4.2% carried 4 genes. Among non-diarrhea children, 55.5% of EAEC strains had one gene, 33.3% with 2 genes and 11.1% contained 3 genes

22 Some molecular characteristics of EAEC strains Figure 3.4. PFGE taxonomy of 33 EAEC strains isolated from stool samples of diarrhea and non-diarrhea pediatric patients (n=33) Using PFGE technique on 33 EAEC strains with threshold of homogeneous genotype of 80% and above, 31 out of 33 strains were divided into 5 categories with homogeneity of 80% and above and 2 strains, 337 and 1056, were not classified in the 5 categories. Category I consists of 3 strains with 80% homogeneity, which share resistance mechanism of AMP, SXT. Category II includes 4 strains with 87% homogeneity, particularly 2 strains (14 and 15) had 100% homogeneous genotype, share the resistance mechanism of AMP, CEP, CXM and TET. Category III comprises of 11 homogeneous strains with 80% homogeneity, which share CEP resistance mechanism. Category IV includes 7 strains of 83% homogeneity. Category V with 6 strains of 87% homogeneity, which share TET resistance mechanism.

23 19 Table Analysis of MLST results on EAEC strains EAEC Gene strains adk fumc gyrb icd mdh pura reca ST Strain Strain Strain Strain Strain Strain Strain Strain Strain Strain MLST analysis showed that 10 EAEC strains belong to 6 sequence types (ST) which had been identified in the world, among those 4 strains were of ST10, 2 strains of ST38, 1 strain of ST215, 1 strain of ST414, 1 strain of ST457 and 1 strain of ST678. Table Comparison of PFGE and MLST results on 10 EAEC strains Strains PFGE STcategory MLST Place of residence Time Strain33 Cat. III 10 Tan Hong-Ba Vi 4/2011 Strain 536 Cat. III 10 Chu Minh-Ba Vi 5/2011 Strain 327 Cat. IV 10 Yen Phu-TayHo 1/2010 Strain 903 Cat. III 10 Mai Dinh-Soc Son 10/2011 Strain 938 Cat. V 38 Nguyen Khoai-Thanh Tri 11/2011 Strain 966 Cat. V 38 Tien Thinh-Me Linh 3/2012 Strain 23 Cat. IV 215 Chu Minh-Ba Vi 12/2010 Strain 572 Cat. III 414 Cam Thuong-Ba Vi 2/2010 Strain 333 Cat. III 457 Au Co-Tay Ho 2/2010 Strain 1056 None of 5 cat. 678 Phu Luu-Ung Hoa 9/2012 The table shows that 10 EAEC strains are classified into 3 genotype categories (category III, IV, V) with homogeneity threshold of 80% and above and 1 strain is not stratified into the categories. The strains

24 20 sharing similar genotype were identified among pediatric patients coming from different place of residence and in different time. 10 EAEC strains were divided into 6 sequence types (ST) by MLST technique (10, 38, 215, 414, 457, 678). The strains with different sequence types were identified from patients coming from different place of residence and in different time. Chapter 4 DISCUSSION 4.1. Proportion, distribution and some associated factors of E.coli infection causing diarrhea among children under 5 years old admitted to National Hospital of Pediatrics and Ba Vi General Hospital from Main characteristics of diarrhea pediatric patients The proportion of DEC in the two hospitals was 15.3%, which is lower than the proportion in India from with 52%, lower than in Iraq in 2009 with 38%, but higher than in Libya from with 8.6% and higher than in China from with 5%. Some studies also indicated the co-infection of different DEC in study samples, however, our study did not identify any case of coinfection of 2 different DEC. This result is the same as a study conducted in 5 hospitals on 1826 patients in India, which could not idicate the co-infections. Similarly, a study in China on 2318 diarrhea patients which gave the proportion of 7.6% but could not identify the co-infection of 2 DEC among the pediatric patients Distribution of E. coli strains causing diarrhea among diarrhea pediatric patients with DEC EAEC is increasingly common agent causing diarrhea in developing countries, which accounts for the highest proportion among DEC, followed by EPEC as the second most common agent of DEC. In this study, EAEC made up 6.7%, followed by EPEC with 4.2%. Other DEC including EIEC, EHEC, ETEC, EIEC, DAEC were

25 21 identified with lower proportion of 2.2%, 1.1%, 0.8% and 0.3% respectively Some associated factors of diarrhea caused by DEC The pediatric patients who had the symptoms of diarrhea at the same time with fever, vomiting, dehydration that led to more severe condition. In this study, the symptoms were more frequent among the diarrhea patients with DEC than those in the group of patients without DEC, it was statistically significant. The average number of stool passage among patients with diarrhea caused by DEC was 7.22± 3.02 times per day while it was 6.54± 2.2 times per day for non-dec diarrhea patients, the difference is statistically significant with p=0.05. Among 6 DEC types causing diarrhea, EAEC, EPEC, EHEC, EIEC and DEAC damage the intestinal epithelium so that the fecal samples contained blood or mucus or blood and mucus. Among 55 patients with diarrhea due to DEC, 81.8% had bloody or mucous or bloodymucous stool that was higher than in group of patients without DEC with 55.4%, it was statistically significant with p< Some molecular characteristics of EAEC strains among diarrhea pediatric patients admitted to National Hospital of Pediatrics and Ba Vi General Hospital and children without diarrhea in Ba Vi district, Tay Ho quarter Hanoi from Some common characteristics of EAEC strains There were 24 strains of EAEC isolated from 360 diarrhea pediatric patients (6.7%) and 9 strains of EAEC from 386 non-diarrhea pediatric patients (2.3%). Almost all those strains were identified among children under 2 years old (84.8%) and more frequent among boys (66.7%) than among girls (33.3%) Antibiotic resistant level and distribution of virulence genes of EAEC strains The EAEC strains isolated from diarrhea patients were tested with 9 antibiotics, EAEC were highly resistant to common antibiotics that were recommended to treat diarrhea such as ampicillin with 83.3% and trimethoprim/ sulfamethoxazol with 75%. The proportion of E.coli that

26 22 resists to the two antibiotics was also high in study of Nguyen Vu Trung (86.4% and 88.3%), Peru (85% and 79%). In Vietnam, ampicillin and trimethoprim/ sulfamethoxazol are popular that can be purchased in pharmacy without prescription of physician. This may explain the situation of highly resistant bacteria. Gram negative bacteria including EAEC are susceptible to nalidixic acid, however, it is not recommended to use on children. In this study, 20.8% of EAEC strains resisted to nalidixic acid, which is similar to other studies in Vietnam. 100% of EAEC strains isolated from diarrhea and non-diarrhea patients resisted to 2 or more kinds of antibiotic, 81.8% were resistant to 3 or more kinds antibiotic. The combination of virulence genes increases the toxin of EAEC leading to severe condition of diarrhea. Among diarrhea patients, 62.5% of EAEC strains carrying 3 genes and 4.2% carrying 4 genes. Among non-diarrhea children, 33.3% of the strains carried 2 genes, 11.1% with 3 genes and none of the strains had 4 genes Some molecular characteristics of EAEC strains Among 33 EAEC strains, the analysis conducted with PFGE technique and antibiotic susceptibility with threshold of 80% indicates that not any category share the same resistance mechanism. When the threshold scales up to 90%, the strains show more common characteristics of antibiotic resistance such as strain 14 and 15, 33 and 536, 24 and 572, 938 and 966, 39, 534 and 539. The study of Karen Ejimaes on E.coli causing urinary tract infection revealed that although the homogeneity of 85% was indicated by PFGE technique, there was no association among the cases. The genotype analysis was conducted on 10 strains of EAEC, which identified 6 sequence types including ST10, ST38, ST215, ST414, ST457, ST678. Among those, ST10 accounted for 40%, followed by ST38 with 20%. All of the 6 sequence types were identified in other countries in the world, of which ST10 and ST38 were the most popular types. Susceptibility test on 9 antibiotics

27 23 showed that the strains of ST10 were resistant to ampicillin, cephalothin, cefuroxim, tetracyclin, particularly the strain of 327 and 903 resisted to 6 antibiotics. The strain ST38 was resistant to ampicillin, cephalothin, cefuroxim, trimethoprim/sulfamethoxazol and tetracyclin. EAEC strains, which had similar sequence type, shared relatively resistance mechanism. The strains of 23, 572, 333 and 1056 had distinct sequence types that also expressed different resistance mechanisms. When considering the association in molecular epidemiology of the bacteria strains by using PFGE and MLST techniques, some studies also discussed the validity of those techniques. Jennifer et al found that MLST, a new technique, showed the lower capability to detect Pseudomonas aeruginosa in comparison with PFGE. Similarly, Noller et al also used MLST and PFGE to identify Escherichia coli O157: H7 that showed the lower capability of MLST compared with PFGE. Studies on Salmonella spp, Vibrio cholerae, Enterococcus faecalis, E. coli and S. aureusprovide evidence that MLST gave better results than PFGE. However, other studies indicated no clear difference between the two techniques. CONCLUSION 1. Proportion, distribution and some associated factors of E. coli infection causing diarrhea among children under 5 years old admitted to National Hospital of Pediatrics and Ba Vi General Hospital from Proportion of Escherichia coli causing diarrhea among children under 5 years hospitalized in the two hospital was 15.3%. 20.1% was detected in National Hospital of Pediatrics while the figure was 11.4% in Ba Vi General Hospital. - Proportion of E. coli strains: EAEC accounted for 6.7%, followed by EPEC with 4.2%, then EIEC with 2.2%, EHEC with 1.1%, ETEC with 0.8% and DAEC with 0.3%.

28 24 - The number of stool passage per day was significantly higher in DEC positive diarrhea pediatric patients than in diarrhea patients without DEC. - The symptoms of fever, vomiting, dehydration, bloody/ mucous/ bloody-mucous were reported to be more frequent among DEC (+) diarrhea patients than among patients without DEC. The distinction was statistically significant. - There was no association between age, gender, type of diarrhea and DEC (+) diarrhea condition among study respondents. 2. Some molecular characteristics of EAEC strains among diarrhea pediatric patients admitted to National Hospital of Pediatrics and Ba Vi General Hospital and children without diarrhea in Ba Vi district, Tay Ho quarter Hanoi from The proportion of EAEC strains isolated from diarrhea patients which resisted to some common antibiotics used in diarrhea treatment: ampicillin with 83.3%, trimethoprim/sulfamethoxazol with 75%, nalidixic acid with 20.8%; none of the strains was resistant to ciprofloxacin. 81.8% of the EAEC strains resisted to 3 or more kinds of antibiotics % EAEC strains isolated from samples of diarrhea patients carried 3 virulence genes, aap gene made up highest proportion with 87.5%, lowest proportion was of aafa gene with 4.2%. - 31/33 strains of EAEC had the homogeneity of 80% and above, among those 2 strains with 100% of homogeneity. - 6 sequence types, which were reported in the world, were identified among 10 EAEC strains in this study. 4/10 EAEC strains belonged to ST10 and 2/10 strains were of ST38, which were also popular in the world. - MLST technique showed the higher capability to detect EAEC than PFGE.