Escherichia coli diagnostics

Size: px
Start display at page:

Download "Escherichia coli diagnostics"

Transcription

1 Escherichia coli diagnostics Workshop on Whole Genome Sequencing and Analysis, Mar. 2018

2 Learning objective: After this lecture and exercise, you should be able to describe how the CGE methods for identifying the serotype of E. coli, and virulence factors of E. coli, Enterococcus, Listeria, and S. aureus work use the above-mentioned methods as stand-alone services and interpret the results retrieve information about the genes in the CGE databases generate your own database in FASTA format and use it for searching for specific genes of interest

3 Escherichia coli pathogenicity E. coli is naturally found in the intestinal tract of humans and many other animals Most strains are harmless commensals Acquisition of combination of genetic mobile elements leads to pathogenic phenotype

4 Pathogenic E. coli are able to colonise many sites of the human body EHEC strains comprise a subgroup of Shiga-toxin (Stx)- producing E. coli and cause illness in humans

5 Simplified categorisation that we will use during exercise Non-pathogenic: Few or no obvious virulence factors. UPEC: Adhesion factors to avoid being flushed away from the urinary tract. Also siderophore proteins (e.g., encoded by iron). Presence of Pap (P) fimbriae (papg adhesion) can be a sign of increased virulence. EHEC (VTEC, STEC): The hallmark virulence factor is Shiga toxin (Stx). Stx consists of an A subunit (encoded by stxa) and B subunits (encoded by stxb). EAEC: Contains a 100-kb paa plasmid with many different virulence factors (especially aggregative adherence fimbriae (AFFs), mycolycins (e.g., encoded by pic), and toxins (e.g., encoded by pet and asta). A regulator encoded by the aggr gene, also located on the paa plasmid, is coordinating the virulence factors. ETEC: This pathotype is known for its production of Heat-Stabile Toxin (ST) or Heat-Labile Toxin (LT). The former can be encoded by the sta1 or stb genes and the latter by ltca.

6 Shiga toxin-producing E. coli (STEC) / Verocytotoxin-producing E. coli (VTEC) A gastrointestinal pathogen Produces verocytotoxins as well as other virulence factors May cause bloody diarrhoea and occasionally Haemolytic Uremic Syndrome (HUS) Primary sources are undercooked ground meet, raw milk, and faecal contamination of vegetables In EU, in 2013, there were 6,043 confirmed cases of VTEC and 13 deaths due to VTEC

7 Previous routine typing of VTEC by the Danish State Serum Institute Serotyping Examined for.... β-glucuronidase activity.. haemolysin production.. Verocytotoxin production.. Presence of specific virulence factors, most importantly, verotoxin 1 (vtx1), verotoxin 2 (vtx2) and intimin (eae), which were detected by DNA hybridization Further subtyping of the verocytotoxins was carried out by PCR Isolates with same serotype and toxin profile compared by PFGE

8 Serotyping In serotyping a group of closely related microorganisms are distinguished by a characteristic set of antigens by the use of antibodies E. coli SerotypeFinder O-type is based on the O-processing genes: wzx, wzy, wzm, and wzt, and wzx/wzy or wzm/wzt pairs H-type is based on the detection of flagellin genes: flic, flka, flla, flma, flna O:H serotyping of E. coli using WGS data Joensen KG. et al J.Clin.Microbiol. 53(8):

9 Evaluating the performance of SerotypeFinder Number of genomes for validation with detected genes with consistent WGS -and conventional results O-typing (~95%) 560 (~98%) H-typing (~100%) 503 (~99%) Phenotype vs. genotype - Rough, non-motile, non-typable gets a genotype, which is not the actual serotype Non-distinguishable: - O90/O127 - O107/O117 - O20/O137 - O13/O135/O129

10 Serotyping of Salmonella: SeqSero ( SalmonellaTypeFinder ( Serotyping of P. aeruginoa: PAst (

11

12 VirulenceFinder Joensen et al J. Clin. Microbiol. 52(5):

13

14 Gene content of the E. coli virulence database

15 Database content Static databases at are no longer maintained All databases are in an online repository called BitBucket BitBucket: Web-based hosting service aimed at software version control systems for teams Main advantages: It is easy to see which changes have been done since last update It is possible to roll back to previous versions

16 _db means it is a database repository Otherwise it is a software repository

17

18

19

20

21 AU! Mouse arm SourceTree to the rescue!

22 Graphical User Interface client for Windows and Mac Used for connecting databases of interest stored on local computer with BitBucket repositories SourceTree makes it easy to see if changes have been made to BitBucket repository and to download (pull) those changes

23 BLAST-based CGE finder tools >Gene_1 GATAATGTAATAGAAATTGGATCAGGAAAAG GTCATTTTACCAAAGAACTTGTCAAAATGAG TCGGTGGGTGGATTCTATAGAAATTGATGAG GACTTGTGTCAAGTCACCCAAAAAGTCGTGA AGCCTTTTCAGAATATAAAAGTTATCCATAC GGATATTCTGAAATTTAACTTCCCCAAAAAC AAAGACTATAAAATATTTGGTAATATCCCCT TTAACATCAGTACTGATATTGTCAAAAAAAT TGCTTTTGAAAGCAATTCGAAATATAGTTA >Gene_2a ATGAACAAAAATATAAAATATTCTCAAAACT TTTTAACGAGTGAAAAAGTACTCAACCAAAT AATAAAACAATTGAATTTAAAAGAAACCGAT ACCGTTTACGAAATTGGAACAGGTAAAGGGC ATTTAACGACGAAACTGGCTAAAATAAGTAA ACAGGTAACGTCTATTGAATTAGACAGTCAT CTATTCAACTTATCGTCAGAAAAA Gene_2b ATGAAAAAAAATATAAAATATTCTCAAAACT TTTTAACGAATGAAAAGGTACTCAACCAAAT AATAAAACAATTGAATTTAAAAGAAACCGAT ACCGTTTACGAAATTGGAACAGGTAAAGGGC ATTTAACGACGAAACTGGCTAAAATAAGTAA ACAGGTAACGTCTATTGAATTAGACAGTCAT CTATTCAACTTATCTTCAGAAAAA Database >Contig_1 TGGATTCTATAGAAATTGATGAGGACTTGTG TCAAGTCACCCAAAAAGTCGTGAAGCCTTTT CAGAATATAAAAGTTATCCATACGGATATTC TGAAATTTAACTTCCCCAAAAACAAAGACTA TAAAATATTTGGTAATATCCCCTTTAACATC AGTACTGATATTGTCAAAAAAATTGCTTTTG AAAGCAATTCGAAATATAGTTAAATATAAAA TATTCTCAAAACTTTTTAACGAGTGAAAAAG TACTCAACCAAATAATAAAACAATTGAATTT AAAAGAAACCGATACCGTTTACGAAATTGGA ACAGGTAAAGGGCATTTAACGACGAAACTGG CTAAAATAAGTAAACAGGTAACGTCTATTGA ATTAGACAGTCATCTATTCAACTTATCGTCA GAAAAAATGAAAAAAAATATAAAATATTCTC AAAACTTTTTAACGAATGAAAAGGTACTCAA CCAAATAATAAAACAATTGAATTTAAAAGAA ACCGATACCGTTTACGAAATTGGAACAGGTA AAGGGCATTTAACGACGAAACTGGCTAAAAT AAGTAAACAGGTAACGTCTATTGAATTAGAC AGTCATCTATTCAACTTATCTTCAGAAAAA >Contig_12 AGTGTGTGCGAGAGAGCGAGCGTGCGTGCGA GAGAGTTTCGCGCGCGCTTTAGAGAGCGTGC GAGCGAGCGAGCGTGTTTGTGCCCCAGAGAA ATGGTAATATCCCCTTTAACATCAGTACTGA TATTGTCAAAAAAATTGCTTTTGAAAGCAAT TCGAAATATAGTTAAATATAAAATATTCTCA AAACTTTTTAACGAGTGAAAAAGTACTCAAC CAAATAATAAAACAATTGAATTTAAAAGAAA CCGATACCGTTTACGAAATTGGAACAGGTAA Draft assembly

24 BLAST-based CGE finder tools MLST ResFinder PlasmidFinder pmlst SerotypeFinder VirulenceFinder

25 Generating your own database Collect DNA sequences of the genes you wish to search for Save the DNA sequences in FASTA format Take care to provide each gene with a unique identifier (everything from the > to the first space) Save the FASTA file as pure text Congratulations - you have made your own database!

26 MyDBFinder Use your own database with any gene(s) of interest

27 Exercise 2 data

28 > Just one out of many papers about this outbreak

29 A single lot of fenugreek seeds, from an exporter in Egypt German farm French farm German outbreak Smaller outbreak in France: On June 24, 2011, France identified a cluster of E. coli O104:H4 infections among attendees of an event in Bordeaux, France

30 By July 2011 the outbreak was over: German outbreak: 4,000 cases of bloody diarrhoea 850 cases of HUS 50 deaths French outbreak: 15 cases of bloody diarrhoea 9 cases of HUS 0 deaths

31 Characterisation of the bacteria causing the outbreak Species: Escherichia coli Serotype: O104:H4 (historically, E. coli with this serotype is enteroaggregative, but not Shiga toxin-producing) MLST: ST-678 Plasmids: Name Size Note (kbp) pg-ea Cryptic plasmid, only encodes repa genes pesbml-ea11 90 IncI1 plasmid, carries CTX-M-15 beta-lactamase paa-ea11 75 a Tn5-insert derivative of adherence plasmid Ahmed S. et al 2012, PLOS One, 7 (11). e48228

32 Antibiotic resistance profile Resistance Ampicillin and 3rd gen. cephalosporins (ESBL production) Streptomycin Nalidixic acid Tetracyclin Cotrimoxazole Susceptible Carbapenems Ciprofloxacin Chloramphenicol Kanamycin Gentamicin It is not recommend that STEC infections are treated with antibiotics, so the fact that this strain is resistant towards certain types of antibiotics does not impact the care that infected patients receive

Real-Time WGS for Routine Typing, Surveillance, and Outbreak Detection of VTEC. Katrine Grimstrup Joensen, Ph.d.student

Real-Time WGS for Routine Typing, Surveillance, and Outbreak Detection of VTEC. Katrine Grimstrup Joensen, Ph.d.student Real-Time WGS for Routine Typing, Surveillance, and Outbreak Detection of VTEC Katrine Grimstrup Joensen, Ph.d.student Short about me DTU Food Division for Epidemiology and Microbial Genomics (Frank Møller

More information

Real-Time WGS for Routine Typing, Surveillance, and Outbreak Detection of VTEC. Katrine Grimstrup Joensen

Real-Time WGS for Routine Typing, Surveillance, and Outbreak Detection of VTEC. Katrine Grimstrup Joensen Real-Time WGS for Routine Typing, Surveillance, and Outbreak Detection of VTEC Katrine Grimstrup Joensen Short about me Ph.d project: Application of WGS for Diagnostics, Surveillance and Outbreak Detection

More information

Surveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change!

Surveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change! Surveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change! Dr Marie Anne Chattaway Deputy Head STEC Laboratory Gastrointestinal

More information

3/08/2012. EHECO104: Lessons for Australia from the German outbreak. E. coli Pathotypes. EHEC Reservoirs & Transmission. EHEC Virulence Markers

3/08/2012. EHECO104: Lessons for Australia from the German outbreak. E. coli Pathotypes. EHEC Reservoirs & Transmission. EHEC Virulence Markers E. coli Pathotypes E. coli O157:H7 EHECO104: Lessons for Australia from the German outbreak Rowland Cobbold Senior Lecturer - Veterinary Public Health School of Veterinary Science University of Queensland

More information

PT18 Identification and typing of STEC and other pathogenic E. coli

PT18 Identification and typing of STEC and other pathogenic E. coli 12 th Annual Worksop of the National Reference Laboratories for E. coli Rome 12-13 October 2017 PT18 Identification and typing of STEC and other pathogenic E. coli Istituto Superiore di Sanità, Food Safety,

More information

Is Whole Genome Sequencing Really Replacing Traditional Microbiology?

Is Whole Genome Sequencing Really Replacing Traditional Microbiology? Is Whole Genome Sequencing Really Replacing Traditional Microbiology? Peter Gerner-Smidt, MD, DSc Enteric Diseases Laboratory Branch InFORM II Phoenix, AZ, 18 November 2015 National Center for Emerging

More information

Michael Weizenegger Laboratory Group Limbach, Heidelberg, Germany, Dept. of Microbiology and Molecular Genetic

Michael Weizenegger Laboratory Group Limbach, Heidelberg, Germany, Dept. of Microbiology and Molecular Genetic Michael Weizenegger Laboratory Group Limbach, Heidelberg, Germany, Dept. of Microbiology and Molecular Genetic The story of the E. coli out break in Germany A novel strain of Escherichia coli O104.H4 (the

More information

Global food trade and emerging foodborne pathogens: The example of STEC O104

Global food trade and emerging foodborne pathogens: The example of STEC O104 Global food trade and emerging foodborne pathogens: The example of STEC O104 Stefano Morabito EU Reference Laboratory for E. coli Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Istituto

More information

NATIONAL REFERENCE CENTRE FOR SHIGA TOXIN/VEROTOXIN- PRODUCING ESCHERICHIA COLI (NRC STEC/VTEC)

NATIONAL REFERENCE CENTRE FOR SHIGA TOXIN/VEROTOXIN- PRODUCING ESCHERICHIA COLI (NRC STEC/VTEC) Laboratory of Microbiology and Infection Control, UZ Brussel NATIONAL REFERENCE CENTRE FOR SHIGA TOXIN/VEROTOXIN- PRODUCING ESCHERICHIA COLI (NRC STEC/VTEC) ANNUAL REPORT 2016 K. De Rauw Prof. Dr. D. Piérard

More information

Relevance of sprouts and germ buds as well as seeds for sprout production in the current EHEC O104:H4 outbreak event in May and June 2011

Relevance of sprouts and germ buds as well as seeds for sprout production in the current EHEC O104:H4 outbreak event in May and June 2011 Relevance of sprouts and germ buds as well as seeds for sprout production in the current EHEC O104:H4 outbreak event in May and June 2011 Updated Opinion No. 23/2011 of BfR of 5 July 2011 The Federal Institute

More information

Antimicrobial resistance and virulence genes in bacteria

Antimicrobial resistance and virulence genes in bacteria Antimicrobial resistance and virulence genes in bacteria Johanne Ahrenfeldt PhD Student BSU course - November 2016 1 How to analyse WGS data part 2 an introduction to CGEs methods KmerFinder SpeciesFinder

More information

Are all VTEC created Equal?

Are all VTEC created Equal? PHL-HSE-Dublin Mid Leinster Are all VTEC created Equal? Anne Carroll Escherichia coli Commensal Microrganism but some strains are cause of infections in humans Syndromes associated to E. coli infections:

More information

Pig digest: Bacteriology Manakorn Sukmak

Pig digest: Bacteriology Manakorn Sukmak Pig digest: Bacteriology 24th International Pig Veterinary Society Congress 8th European Symposium of Porcine Health Management June 7th - 10th 2016Dublin, Ireland Manakorn Sukmak, DVM, MSc, PhD Dept.

More information

TECHNICAL REPORT. Fourth external quality assessment scheme for typing of verocytotoxin-producing E.coli (VTEC)

TECHNICAL REPORT. Fourth external quality assessment scheme for typing of verocytotoxin-producing E.coli (VTEC) Fourth external quality assessment scheme for typing of verocytotoxin-producing E.coli (VTEC) www.ecdc.europa.eu ECDC TECHNICAL REPORT Fourth external quality assessment scheme for typing of verocytotoxinproducing

More information

Transitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens

Transitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens Transitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens Peter Gerner-Smidt, MD ScD, Chief Enteric Diseases Laboratory Branch 2015 APHL

More information

Shiga Toxin producing E. coli (STEC) in food which serotypes are important? Lothar Beutin

Shiga Toxin producing E. coli (STEC) in food which serotypes are important? Lothar Beutin BUNDESINSTITUT FÜR RISIKOBEWERTUNG Shiga Toxin producing E. coli (STEC) in food which serotypes are important? Lothar Beutin National Reference Laboratory for Escherichia coli Federal Institute for Risk

More information

Zoonosis from the ground

Zoonosis from the ground Zoonosis from the ground Alex W. Friedrich Medical Microbiology University Medical Center Groningen alex.friedrich@umcg.nl Reported hospitalisation and case-fatality rates due to zoonoses in confirmed

More information

Foodborne Outbreak of E. coli Infections and Hemolytic Uremic Syndrome in Germany, 2011

Foodborne Outbreak of E. coli Infections and Hemolytic Uremic Syndrome in Germany, 2011 Foodborne Outbreak of E. coli Infections and Hemolytic Uremic Syndrome in Germany, 2011 Kirk Smith, DVM, MS, PhD Supervisor Foodborne, Vectorborne and Zoonotic Diseases Unit Minnesota Department of Health

More information

E. coli O104:H7 an example of evolution in foodborne pathogens and revolution in food microbiology. Prof Steve Forsythe

E. coli O104:H7 an example of evolution in foodborne pathogens and revolution in food microbiology. Prof Steve Forsythe E. coli O104:H7 an example of evolution in foodborne pathogens and revolution in food microbiology Introduction: Prof Steve Forsythe I have been holding back on releasing any comment until now due to the

More information

French EHEC outbreaks in 2011

French EHEC outbreaks in 2011 6th annual workshop of the EU- RL Rome, 4th November, 2011 French EHEC outbreaks in 2011 Dr. Estelle LOUKIADIS French NRL/ Laboratoire d étude des microorganismes alimentaires pathogènes (LMAP) UR CALITYSS

More information

E-BOOK # E COLI IN WELL WATER EBOOK

E-BOOK # E COLI IN WELL WATER EBOOK 02 February, 2018 E-BOOK # E COLI IN WELL WATER EBOOK Document Filetype: PDF 332.93 KB 0 E-BOOK # E COLI IN WELL WATER EBOOK Addresses the presence of total coliforms and E. Most common water quality problem

More information

Medical Microbiology Coursework Essay High Class 1 essay. North Germany. This outbreak caused the highest frequency of HUS cases caused by

Medical Microbiology Coursework Essay High Class 1 essay. North Germany. This outbreak caused the highest frequency of HUS cases caused by High Class 1 essay Discuss the new insights in the understanding of Haemolytic Uraemic Syndrome and its worldwide implications following the large scale outbreak of E.Coli O104:H4 diarrhea in Germany 2011

More information

3/18/ Update: STEC Diagnosis and Surveillance in Wisconsin. Objectives. Objectives. Shiga toxin-producing Escherchia coli (STEC)

3/18/ Update: STEC Diagnosis and Surveillance in Wisconsin. Objectives. Objectives. Shiga toxin-producing Escherchia coli (STEC) 2014 Update: STEC Diagnosis and Surveillance in Wisconsin Mike Rauch Tim Monson WI State Laboratory of Hygiene Communicable Disease Division WCLN Teleconference March 19, 2014 WISCONSIN STATE LABORATORY

More information

2014 Update: STEC Diagnosis and Surveillance in Wisconsin

2014 Update: STEC Diagnosis and Surveillance in Wisconsin 2014 Update: STEC Diagnosis and Surveillance in Wisconsin Mike Rauch Tim Monson WI State Laboratory of Hygiene Communicable Disease Division WCLN Teleconference March 19, 2014 WISCONSIN STATE LABORATORY

More information

Scottish E. coli O157/Shiga toxin-producing E. coli Reference Laboratory

Scottish E. coli O157/Shiga toxin-producing E. coli Reference Laboratory Scottish E. coli O157/Shiga toxin-producing E. coli Reference Laboratory 1 Authors: SERL68:Version L. Allison 6 Issue date & M. 27/09/2017 Hanson This is an electronic document Authors: L. Allison which

More information

2. REVIEW OF LITERATURE

2. REVIEW OF LITERATURE 2. REVIEW OF LITERATURE 2.1 PROBLEM STATEMENT Diarrheal diseases are the major cause of death in children under 5 years of age in resourcepoor countries, resulting in approximately 2.5 million deaths each

More information

EFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on VTECseropathotype and scientific criteria regarding pathogenicity assessment

EFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on VTECseropathotype and scientific criteria regarding pathogenicity assessment Downloaded from orbit.dtu.dk on: Jan 29, 2019 EFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on VTEC and scientific criteria regarding pathogenicity assessment EFSA publication; Hald, Tine;

More information

Improving the Detection of Shiga Toxin- Producing Escherichia coli (STEC)

Improving the Detection of Shiga Toxin- Producing Escherichia coli (STEC) Improving the Detection of Shiga Toxin- Producing Escherichia coli (STEC) C a ra W i l d e r, P h. D. Te c h n i c a l Wr i t e r, ATC C A u g u s t 1 8, 2016 About ATCC Founded in 1925, ATCC is a non-profit

More information

Escherichia coli: Great Diversity around a Common Core

Escherichia coli: Great Diversity around a Common Core Escherichia coli: Great Diversity around a Common Core Author G. Moriel, Danilo, Rosini, Roberto, L. Seib, Kate, Serino, Laura, Pizza, Mariagrazia, Rappuoli, Rino Published 2012 Journal Title mbio DOI

More information

IPCVA, Buenos Aires - 7 December Infections with Shiga toxin producing E.coli (STEC): emerging issues and reflections on the global food trade

IPCVA, Buenos Aires - 7 December Infections with Shiga toxin producing E.coli (STEC): emerging issues and reflections on the global food trade IPCVA, Buenos Aires - 7 December 2012 Infections with Shiga toxin producing E.coli (STEC): emerging issues and reflections on the global food trade Alfredo Caprioli EU Reference Laboratory for Escherichia

More information

In May 2011 there was a large scale outbreak of Haemolytic Uraemic Syndrome (HUS) in

In May 2011 there was a large scale outbreak of Haemolytic Uraemic Syndrome (HUS) in Discuss the new insights in the understanding of Haemolytic Uraemic Syndrome and its worldwide implications following the large scale outbreak of E.Coli O104:H4 diarrhea in Germany 2011 In May 2011 there

More information

Thorough identification of pathogenic Shigatoxin producing Escherichia coli (STEC) in Belgium

Thorough identification of pathogenic Shigatoxin producing Escherichia coli (STEC) in Belgium Thorough identification of pathogenic Shigatoxin producing Escherichia coli (STEC) in Belgium Dr. Ir. Sarah Denayer NRL VTEC WIV-ISP, Brussels, Belgium 10 th Annual workshop of the NRLs for E. coli in

More information

Shiga toxin-producing Escherichia coli

Shiga toxin-producing Escherichia coli Shiga toxin-producing Escherichia coli Terry Arthur Research Microbiologist Meat Safety and Quality Research Unit U.S. Meat Animal Research Center Use of product names by USDA implies no approval to the

More information

E. coli 0157:H7. By Christopher Tong

E. coli 0157:H7. By Christopher Tong E. coli 0157:H7 By Christopher Tong The etiologic agent E. coli 0157:H7 have several transmissions that can be spread around to animals and humans. In humans this serotype of E. coli is transmitted to

More information

A genomic dissection of travel associated ESBL producing Salmonella Typhi originating from the Philippines

A genomic dissection of travel associated ESBL producing Salmonella Typhi originating from the Philippines A genomic dissection of travel associated ESBL producing Salmonella Typhi originating from the Philippines A one-off occurrence or threat to the effective treatment of typhoid fever? Rene S. Hendriksen,

More information

Gram-Negative rods Introduction to

Gram-Negative rods Introduction to Lec 5 Oral Microbiology Dr. Chatin Gram-Negative rods Introduction to Enterobacteriaceae Characteristics: جامعة تكريت كلية طب االسنان Small gram-negative rods (2-5 by 0.5 microns) Most motile with peritrichous

More information

Lessons learned from recent foodborne outbreaks in Germany

Lessons learned from recent foodborne outbreaks in Germany FEDERAL INSTITUTE FOR RISK ASSESSMENT Lessons learned from recent foodborne outbreaks in Germany B. Appel for the BfR outbreak team and the food chain research team, Dept. of Biological Safety Outline

More information

Gastrointestinal Disease from 2007 to 2014

Gastrointestinal Disease from 2007 to 2014 Data Requested by Amber Erickson, Epidemiologist, North Central Health District Gastrointestinal Disease from 2007 to 2014 North Central Health District Aemon Weaver, Epidemiology Intern, NCHD September

More information

Escherichia coli Pathotypes Associated with Diarrhea in Romanian Children Younger than 5 Years of Age

Escherichia coli Pathotypes Associated with Diarrhea in Romanian Children Younger than 5 Years of Age Jpn. J. Infect. Dis., 62, 289-293, 2009 Original Article Escherichia coli Pathotypes Associated with Diarrhea in Romanian Children Younger than 5 Years of Age Codruţa-Romaniţa Usein*, Dorina Tatu-Chiţoiu

More information

Escherichia coli Verotoxigenic Infections

Escherichia coli Verotoxigenic Infections Revision Dates Case Definition Reporting Requirements Epidemiology/Public Health Management March 2011 May 2018 March 2011 Includes O157:H7 Case Definition Confirmed Case Laboratory confirmation of infection

More information

EHEC Outbreak 2011: Updated Analysis as a Basis for Recommended Measures

EHEC Outbreak 2011: Updated Analysis as a Basis for Recommended Measures EHEC Outbreak 2011: Updated Analysis as a Basis for Recommended Measures BfR opinion No. 049/2011, 23 November 2011 The EHEC O104:H4 outbreak in Germany of the early summer 2011 is now over. The investigations

More information

DR. HUDA ABO- ALEES GRAM-NEGATIVE BACILLI THE ENTERICS:

DR. HUDA ABO- ALEES GRAM-NEGATIVE BACILLI THE ENTERICS: DR. HUDA ABO- ALEES 214-2-15 GRAM-NEGATIVE BACILLI THE ENTERICS: Family Enterobacteriaceae: Genus Escherichia & Genus Klebsiella OBJECTIVES Describe the morphology & physiology for E.coli & Klebsiella

More information

SHIGA-TOXIN PRODUCING ESCHERICHIA COLI STEC Update. Roshan Reporter, MD, MPH Rita Bagby, PS-PHN Leticia Martinez, PS-PHN

SHIGA-TOXIN PRODUCING ESCHERICHIA COLI STEC Update. Roshan Reporter, MD, MPH Rita Bagby, PS-PHN Leticia Martinez, PS-PHN SHIGA-TOXIN PRODUCING ESCHERICHIA COLI STEC Update Roshan Reporter, MD, MPH Rita Bagby, PS-PHN Leticia Martinez, PS-PHN Objectives At the conclusion of this presentation the participant should be able

More information

Veterinary and Agrochemical Research Centre

Veterinary and Agrochemical Research Centre Veterinary and Agrochemical Research Centre Report on susceptibility of Salmonella serotypes in Belgium. P. Butaye Susceptibility of Salmonella strains was assessed by MIC determination using Sensititer

More information

GRAM-NEGATIVE BACILLI THE ENTERICS: Family Enterobacteriaceae: Genus Escherichia & Genus Klebsiella

GRAM-NEGATIVE BACILLI THE ENTERICS: Family Enterobacteriaceae: Genus Escherichia & Genus Klebsiella DR. HUDA ABO- ALEES 214-2-15 Obgectives: GRAM-NEGATIVE BACILLI THE ENTERICS: Family Enterobacteriaceae: Genus Escherichia & Genus Klebsiella Describe the morphology & physiology for E.coli & Klebsiella

More information

EUROPEAN COMMISSION HEALTH & CONSUMER PROTECTION DIRECTORATE-GENERAL. (Adopted on 23 January 2003)

EUROPEAN COMMISSION HEALTH & CONSUMER PROTECTION DIRECTORATE-GENERAL. (Adopted on 23 January 2003) EUROPEAN COMMISSION HEALTH & CONSUMER PROTECTION DIRECTORATE-GENERAL Directorate C - Scientific Opinions C2 - Management of scientific committees; scientific co-operation and networks REPORT OF THE SCIENTIFIC

More information

Robert Tauxe, MD, MPH

Robert Tauxe, MD, MPH Robert Tauxe, MD, MPH Deputy Director, Division of Foodborne, Waterborne and Environmental Diseases National Center for Emerging and Zoonotic Infectious Diseases Centers for Disease Control and Prevention

More information

Enterovirulent Escherichia coli. Tom Cheasty Laboratory of Enteric Pathogens

Enterovirulent Escherichia coli. Tom Cheasty Laboratory of Enteric Pathogens Enterovirulent Escherichia coli Tom Cheasty Laboratory of Enteric Pathogens Classes of Enterovirulent E. coli Urinary Tract Septicaemia / Meningitis Enteropathogenic Enteroinvasive Enterotoxigenic Vero

More information

WGS Works! Shared Mission Different Roles APPLICATIONS SEQUENCING (WGS) Non-regulatory. Regulatory CDC. FDA and USDA. Peter Gerner-Smidt, MD ScD

WGS Works! Shared Mission Different Roles APPLICATIONS SEQUENCING (WGS) Non-regulatory. Regulatory CDC. FDA and USDA. Peter Gerner-Smidt, MD ScD PUBLIC HEALTH FOOD SAFETY APPLICATIONS FOR WHOLE GENOME SEQUENCING (WGS) Peter Gerner-Smidt, MD ScD Chief, Enteric Diseases Laboratory Branch 4 th Asia-Pacific International Food Safety Conference, Penang,

More information

Ayman Musleh. Osama Hussein, Saba Massimi ... Dr.Anas

Ayman Musleh. Osama Hussein, Saba Massimi ... Dr.Anas 14 Ayman Musleh Osama Hussein, Saba Massimi... Dr.Anas Enterobacteriaceae: *General properties: 1. Enterobacteriaceae are moderate-sized (0.3 to 1.0 1.0 to 6.0 μm). 2. non spore-forming. 3. gram-negative

More information

Whole genome sequencing

Whole genome sequencing Downloaded from orbit.dtu.dk on: Dec 20, 2017 Whole genome sequencing Torpdahl, Mia; Löfström, Charlotta; Møller Nielsen, Eva Published in: Publication date: 2014 Document Version Publisher's PDF, also

More information

Position Statement Template

Position Statement Template Submission Date: 7/6/2005 Committee: Infectious Diseases 05-ID-07 Position Statement Template Title: Revision of the Enterohemorrhagic Escherichia coli (EHEC) condition name to Shiga toxin-producing Escherichia

More information

SUMMARY OF MEDICAL PHD THESIS

SUMMARY OF MEDICAL PHD THESIS MINISTRY OF EDUCATION AND TRAINING MINISTRY OF HEALTH NATIONAL INSTITUTE OF HYGIENE AND EPIDEMIOLOGY -----------------*------------------- HOANG THI BICH NGOC DISTRIBUTION AND SOME MOLECULAR CHARACTERISTICS

More information

Food Microbiology 101

Food Microbiology 101 Food Microbiology 101 Nina G. Parkinson NGP Consulting November 6, 2018 Food Safety and Sanitation Conference Summary Microbiological contamination of food Routes of contamination by pathogens Overview

More information

51 st International Congress of Meat Science and Technology

51 st International Congress of Meat Science and Technology Use of Comparative Genomics as a Tool to Assess the Clinical and Public Health Significance of Emerging Shiga toxin Producing Escherichia coli Serotypes 51 st International Congress of Meat Science and

More information

Received 23 February 2011/Returned for modification 28 March 2011/Accepted 5 April 2011

Received 23 February 2011/Returned for modification 28 March 2011/Accepted 5 April 2011 JOURNAL OF CLINICAL MICROBIOLOGY, June 2011, p. 2274 2278 Vol. 49, No. 6 0095-1137/11/$12.00 doi:10.1128/jcm.00386-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Characterization

More information

overview Domain: Bacteria Kingdom: Bacteria Phylum: Proteobacteria Class: Gamma Proteobacteria Order: Enterobacteriales Family: Enterobacteriaceae

overview Domain: Bacteria Kingdom: Bacteria Phylum: Proteobacteria Class: Gamma Proteobacteria Order: Enterobacteriales Family: Enterobacteriaceae E.coli overviwe E. coli is a Gram negative rod-shaped bacterium that is commonly found in the lower intestine of warm-blooded organisms. Most E. coli strains are harmless, but some, such as serotype O157:H7,

More information

Those Pathogens, What You Should Know

Those Pathogens, What You Should Know Those Pathogens, What You Should Know Ted F. Beals, MS, MD Short 1 We are at war over our Food Most of us here are convinced that what we eat, and why we choose is our responsibility, not the responsibility

More information

Nucleotide Polymorphisms within the O-antigen Gene Cluster of Escherichia coli O26,

Nucleotide Polymorphisms within the O-antigen Gene Cluster of Escherichia coli O26, AEM Accepts, published online ahead of print on 13 July 2012 Appl. Environ. Microbiol. doi:10.1128/aem.01259-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Nucleotide Polymorphisms

More information

7th annual workshop of the NRL for E. coli in the EU Rome, 8th -9th November 2012

7th annual workshop of the NRL for E. coli in the EU Rome, 8th -9th November 2012 Prevalence of the 7 major serogroups of enterohemorrhagic Escherichia coli (EHEC) in fresh minced beef in France: A novel real-time PCR strategy for their early detection in food C.Mazuy-Cruchaudet 1,

More information

N Jourdan-Da Silva, M Watrin, F X Weill, L A King, M Gouali, A Mailles, D Van Cauteren, M Bataille, S Guettier, C Castrale, et al.

N Jourdan-Da Silva, M Watrin, F X Weill, L A King, M Gouali, A Mailles, D Van Cauteren, M Bataille, S Guettier, C Castrale, et al. Outbreak of haemolytic uraemic syndrome due to Shiga toxin-producing Escherichia coli O104:H4 among French tourists returning from Turkey, September 2011. N Jourdan-Da Silva, M Watrin, F X Weill, L A King,

More information

STEC Whole Genome Sequencing Project

STEC Whole Genome Sequencing Project STEC Whole Genome Sequencing Project Eija Trees, PhD, DVM Chief, PulseNet Next Generation Subtyping Methods Unit 16 th Annual PulseNet Update Meeting August 29 th, 2012 National Center for Emerging and

More information

coli (EHEC)Hemolysin Genes of a Shiga Toxin 1 (Stx1)- and Stx2Producing, Serotype 0128 Escherichia

coli (EHEC)Hemolysin Genes of a Shiga Toxin 1 (Stx1)- and Stx2Producing, Serotype 0128 Escherichia Ada Me e log ica Bio tdica Vo l.2000 No. l, 18, 48, ll- The Enterohemorrhagic Escherichia coli (EHEC)Hemolysin Genes of a Shiga Toxin 1 (Stx1)- and Stx2Producing, Serotype 0128 Escherichia coli Strain

More information

E. coli O157:H7 shedding in beef cattle. Jane Heller, Geraldine Lammers and Craig McConnel

E. coli O157:H7 shedding in beef cattle. Jane Heller, Geraldine Lammers and Craig McConnel E. coli O157:H7 shedding in beef cattle Jane Heller, Geraldine Lammers and Craig McConnel Overview Background on E.coli O157:H7 Supershedding of E.coli O157:H7 Overview of collaborative study - MLA Future

More information

Extra-intestinal pathogenic E. coli carrying the. shiga toxin gene stx2

Extra-intestinal pathogenic E. coli carrying the. shiga toxin gene stx2 JCM Accepts, published online ahead of print on 9 October 2013 J. Clin. Microbiol. doi:10.1128/jcm.01349-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10

More information

EU Reference Laboratory for E. coli. Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses. Istituto Superiore di Sanità

EU Reference Laboratory for E. coli. Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses. Istituto Superiore di Sanità EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Report of the 18 th inter-laboratory study (PT18) on the

More information

Gram-negative rods: Enterobacteriaceae Part II Common Organisms. Escherichia coli. Escherichia coli. Escherichia coli. CLS 418 Clinical Microbiology I

Gram-negative rods: Enterobacteriaceae Part II Common Organisms. Escherichia coli. Escherichia coli. Escherichia coli. CLS 418 Clinical Microbiology I Gram-negative rods: Enterobacteriaceae Part II Common Organisms Karen Honeycutt, M.Ed., MLS(ASCP) CM SM CM Session Enterobacteriaceae Antigens O somatic, part of cell wall (serogroup) Stimulates earliest

More information

Epidemiology of Verotoxigenic E. coli O157 in Ireland, 2003 Patricia Garvey and Paul McKeown

Epidemiology of Verotoxigenic E. coli O157 in Ireland, 2003 Patricia Garvey and Paul McKeown Epidemiology of Verotoxigenic E. coli O157 in Ireland, 2003 Patricia Garvey and Paul McKeown National Disease Surveillance Centre 25-27 Middle Gardiner Street, Dublin 1, Ireland Introduction Verotoxigenic

More information

Hompes Method. Practitioner Training Level II. Lesson Seven Part A DRG Pathogen Plus Interpretation

Hompes Method. Practitioner Training Level II. Lesson Seven Part A DRG Pathogen Plus Interpretation Hompes Method Practitioner Training Level II Lesson Seven Part A DRG Pathogen Plus Interpretation Health for the People Ltd not for reuse without expressed permission Hompes Method is a trading name of

More information

Identification of different Escherichia coli pathotypes in north and north-west provinces of Iran

Identification of different Escherichia coli pathotypes in north and north-west provinces of Iran Volume 9 Number 1 (February 2017) 33-37 ORIGINAL ARTICLE Identification of different Escherichia coli pathotypes in north and north-west provinces of Iran Seyedeh Tina Miri, Amir Dashti, Saeid Mostaan,

More information

PATHOGENICITY OF MICROORGANISMS

PATHOGENICITY OF MICROORGANISMS PATHOGENICITY OF MICROORGANISMS Some microorganisms are : 1- Harmless microorganism, as normal flora 2- Harmfull microorganism, as pathogenic. A pathogenic microorganism is defined as one that causes or

More information

CHAPTER 4: DISEASES SPREAD BY FOOD AND WATER

CHAPTER 4: DISEASES SPREAD BY FOOD AND WATER CHAPTER 4: DISEASES SPREAD BY FOOD AND WATER Highlights The incidence of diseases spread by food and water was generally higher in Peel than Ontario with the exceptions of hepatitis A and verotoxinproducing

More information

E. coli peritonitis. Bernie Beckman, DVM Hy-Line International. Genetic Excellence. Genetic Excellence. Hy-Line International

E. coli peritonitis. Bernie Beckman, DVM Hy-Line International. Genetic Excellence. Genetic Excellence. Hy-Line International E. coli peritonitis Bernie Beckman, DVM Hy-Line International Hy-Line International Genetic Excellence E. coli peritonitis Lesions Fibrin around the ova thin, yellow strings of fibrin that are very small

More information

Pathogens of the Digestive System

Pathogens of the Digestive System Pathogens of the Digestive System Chapter 24 (Pages 625-661) 1. Digestive System Review (Pages 627-629) A. Oral Cavity B. Esophagus C. Stomach D. Small Intestine E. Pancreas F. Liver G. Gall Bladder H.

More information

SUMMARY OF FOODBORNE AND WATERBORNE DISEASE CHARACTERISTICS

SUMMARY OF FOODBORNE AND WATERBORNE DISEASE CHARACTERISTICS SUMMARY OF FOODBNE AND WATERBNE DISEASE CHARACTERISTICS BACTERIAL Bacillus cereus Vomiting toxin Diarrheal toxin Brucella species Campylobacter species Clostridium botulinum Clostridium perfringens 1-6

More information

CHAPTER 5 INTERPRETATION AND DISCUSSION

CHAPTER 5 INTERPRETATION AND DISCUSSION CHAPTER 5 INTERPRETATION AND DISCUSSION - 189 - Escherichia coli are the predominant facultative anaerobes of the gastrointestinal tract of warm-blooded animals and in humans. As a commensal, it contributes

More information

Shigella and salmonella

Shigella and salmonella Sulaimani University College of Pharmacy Microbiology Lec. 9 & 10 Shigella and salmonella Dr. Abdullah Ahmed Hama PhD. Microbiology/Molecular Parasitology abdullah.hama@spu.edu.iq 1 Shigella Shigella species

More information

ON-GOING STUDIES ON VTEC IN SWEDEN

ON-GOING STUDIES ON VTEC IN SWEDEN NATIONAL VETERINARY INSTITUTE ON-GOING STUDIES ON VTEC IN SWEDEN Anna Aspán & friends Chase-Topping M, Gally D, Low C, Matthews L, Woolhouse M. Nat Rev Microbiol. 2008 Dec;6(12):904-12. Green area routine

More information

GI Bacterial Infections (part-1)

GI Bacterial Infections (part-1) GI Bacterial Infections (part-1) Mohammed Abdulla Mehdi FIBMS (internal medicine), FIBMS (Gastroenterology & Hepatology) Acute diarrhea and vomiting Acute diarrhea, sometimes with vomiting, is the predominant

More information

E. coli Nissle 1917 A Unique Medical Probiotic and it s Clinical Applications. Sudesh Samuel Scientific Director Amber Laboratories

E. coli Nissle 1917 A Unique Medical Probiotic and it s Clinical Applications. Sudesh Samuel Scientific Director Amber Laboratories E. coli Nissle 1917 A Unique Medical Probiotic and it s Clinical Applications Sudesh Samuel Scientific Director Amber Laboratories Content E. coli s background Gut Microbiome Pathogenic E. coli Probiotic

More information

Katrine G. Joensen. Whole genome sequencing (WGS) surveillance of VTEC and Shigella

Katrine G. Joensen. Whole genome sequencing (WGS) surveillance of VTEC and Shigella Whole genome sequencing (WGS) surveillance of VTEC and Shigella Katrine G. Joensen & Flemming Scheutz WHO Collaborating Centre for Reference and Research on Escherichia and Klebsiella Foodborne Infections

More information

Shiga Toxin Producing Escherichia coli

Shiga Toxin Producing Escherichia coli Shiga Toxin Producing Escherichia coli Funded by The Beef Checkoff Shiga Toxin Producing Escherichia coli Contents Defining STEC... 1 Virulence Markers... 2 Diagnosis of Shiga Toxin-producing E. coli...

More information

FOOD QUALITY AND STANDARDS - Methods of Detection and Characterization of Pathogenic Escherichia Coli - Peter Feng, Nancy Strockbine, Pina Fratamico

FOOD QUALITY AND STANDARDS - Methods of Detection and Characterization of Pathogenic Escherichia Coli - Peter Feng, Nancy Strockbine, Pina Fratamico METHODS OF DETECTION AND CHARACTERIZATION OF PATHOGENIC ESCHERICHIA COLI Peter Feng Division of Microbiology, U.S. Food and Drug Administration, College Park, MD, USA Nancy Strockbine Centers for Disease

More information

Improved methodology for isolating Shiga toxin-producing E. coli (STEC) in food

Improved methodology for isolating Shiga toxin-producing E. coli (STEC) in food Improved methodology for isolating Shiga toxin-producing E. coli (STEC) in food Oscar Cidon Sporrong Master Degree Project in Infection biology, 45 credits. Spring 2018 Department: Swedish National Food

More information

Molecular typing insight on diversity and antimicrobial resistance of Campylobacter jejuni from Belgian chicken meat

Molecular typing insight on diversity and antimicrobial resistance of Campylobacter jejuni from Belgian chicken meat Molecular typing insight on diversity and antimicrobial resistance of Campylobacter jejuni from Belgian chicken meat Ihab Habib Ghent University Department of Public Health and Food Safety. Contents: Molecular

More information

Campylobacter jejuni

Campylobacter jejuni U.S. Food & Drug Administration Center for Food Safety & Applied Nutrition Foodborne Pathogenic Microorganisms and Natural Toxins Handbook Campylobacter jejuni 1. Name of the Organism: Campylobacter jejuni

More information

Glycosphingolipid-mediated interaction of Shiga toxin with the human endothelium: status quo of receptor research

Glycosphingolipid-mediated interaction of Shiga toxin with the human endothelium: status quo of receptor research Glycosphingolipid-mediated interaction of Shiga toxin with the human endothelium: status quo of receptor research Ivan U. Kouzel, Andreas Bauwens, Helge Karch and Johannes Müthing Institute for Hygiene,

More information

Whole genome sequencing & new strain typing methods in IPC. Lyn Gilbert ACIPC conference Hobart, November 2015

Whole genome sequencing & new strain typing methods in IPC. Lyn Gilbert ACIPC conference Hobart, November 2015 Whole genome sequencing & new strain typing methods in IPC Lyn Gilbert ACIPC conference Hobart, November 2015 Why do strain typing? Evolution, population genetics, geographic distribution 2 Why strain

More information

Old bugs in new places The changing face of food safety microbiology

Old bugs in new places The changing face of food safety microbiology Old bugs in new places The changing face of food safety microbiology Roy Betts Campden BRI Chipping Campden Gloucestershire GL55 6LD UKAFP, Cardiff 2017 26 th September 2017 UK Annual Figures UK 25% people

More information

Genomic epidemiology of Gram-negative pathogens: from Acinetobacter to E. coli. Professor Mark Pallen, University of Birmingham

Genomic epidemiology of Gram-negative pathogens: from Acinetobacter to E. coli. Professor Mark Pallen, University of Birmingham Genomic epidemiology of Gram-negative pathogens: from Acinetobacter to E. coli Professor Mark Pallen, University of Birmingham The state we are in: diagnostic microbiology 21st Century problem, but 19th

More information

Foodborne Disease in the Region of Peel

Foodborne Disease in the Region of Peel Foodborne Disease in the Region of Peel HIGHLIGHTS The incidence of selected foodborne diseases was generally higher in Peel than in Ontario between 1993 and 22. A higher incidence was observed in Peel

More information

Less common but more deadly: E. coli and Listeria

Less common but more deadly: E. coli and Listeria 6 Less common but more deadly: E. coli and Listeria In this chapter we discuss two microbes, the verocytotoxin-producing Escherichia coli (or VTEC for short) and Listeria monocytogenes. Compared with Salmonella

More information

Update on infections with and clinical lab guidelines for Shiga toxin-producing E. coli (STEC) in the United States

Update on infections with and clinical lab guidelines for Shiga toxin-producing E. coli (STEC) in the United States Update on infections with and clinical lab guidelines for Shiga toxin-producing E. coli (STEC) in the United States Patricia M. Griffin, MD Enteric Diseases Epidemiology Branch Centers for Disease Control

More information

Toxins 2011, 3, manuscripts; doi: /toxins Short Note

Toxins 2011, 3, manuscripts; doi: /toxins Short Note Toxins 2011, 3, 672-677 manuscripts; doi:10.3390/toxins3060672 Short Note OPEN ACCESS toxins ISSN 2072-6651 www.mdpi.com/journal/toxins Loss of vtx Genes after the First Subcultivation Step of Verocytotoxigenic

More information

Index. D DBETH tool, 23 De Bruijn graph, 53, 54 De novo approaches, 53 De novo assembly, Denmark, 4, 36, 68

Index. D DBETH tool, 23 De Bruijn graph, 53, 54 De novo approaches, 53 De novo assembly, Denmark, 4, 36, 68 A Acute gastroenteritis, 145 AdapterRemoval tool, 24 Adenoviruses, 151 Advanced Molecular Detection (AMD), 37 Amplicon, 59 Amplicon sequencing, 58, 60 Annotated, 54, 69 Antibiotic resistance, 97, 100,

More information

PROFESSOR PETER M. HAWKEY

PROFESSOR PETER M. HAWKEY Multi-drug resistant Escherichia coli PROFESSOR PETER M. HAWKEY School of Immunity and Infection College of Medical and Dental Sciences University of Birmingham Birmingham B15 2TT Health Protection Agency

More information

Title: The Operon Encoding SubAB a Novel Cytotoxin is Present in US STEC Isolates ACCEPTED

Title: The Operon Encoding SubAB a Novel Cytotoxin is Present in US STEC Isolates ACCEPTED JCM Accepts, published online ahead of print on February 00 J. Clin. Microbiol. doi:./jcm.000-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Helen Heffernan and Rosemary Woodhouse Antibiotic Reference Laboratory, Institute of Environmental Science and Research Limited (ESR); July 2014.

Helen Heffernan and Rosemary Woodhouse Antibiotic Reference Laboratory, Institute of Environmental Science and Research Limited (ESR); July 2014. Annual survey of extended-spectrum -lactamase (ESBL)-producing Enterobacteriaceae, 2013 Helen Heffernan and Rosemary Woodhouse Antibiotic Reference Laboratory, Institute of Environmental Science and Research

More information

Report on susceptibility of Salmonella serotypes in Belgium Vicky Jasson

Report on susceptibility of Salmonella serotypes in Belgium Vicky Jasson CODA-CERVA Report on susceptibility of Salmonella serotypes in Belgium 2014. Vicky Jasson Veterinary and Agrochemical Research Centre 1 Introduction Salmonella is one of the most important bacterial zoonotic

More information

Report: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2013

Report: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2013 Veterinary and Agrochemical Research Centre Report: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2013 1 Introduction Commensal E. coli are regarded as general

More information