Escherichia coli diagnostics
|
|
- Shawn Anderson
- 5 years ago
- Views:
Transcription
1 Escherichia coli diagnostics Workshop on Whole Genome Sequencing and Analysis, Mar. 2018
2 Learning objective: After this lecture and exercise, you should be able to describe how the CGE methods for identifying the serotype of E. coli, and virulence factors of E. coli, Enterococcus, Listeria, and S. aureus work use the above-mentioned methods as stand-alone services and interpret the results retrieve information about the genes in the CGE databases generate your own database in FASTA format and use it for searching for specific genes of interest
3 Escherichia coli pathogenicity E. coli is naturally found in the intestinal tract of humans and many other animals Most strains are harmless commensals Acquisition of combination of genetic mobile elements leads to pathogenic phenotype
4 Pathogenic E. coli are able to colonise many sites of the human body EHEC strains comprise a subgroup of Shiga-toxin (Stx)- producing E. coli and cause illness in humans
5 Simplified categorisation that we will use during exercise Non-pathogenic: Few or no obvious virulence factors. UPEC: Adhesion factors to avoid being flushed away from the urinary tract. Also siderophore proteins (e.g., encoded by iron). Presence of Pap (P) fimbriae (papg adhesion) can be a sign of increased virulence. EHEC (VTEC, STEC): The hallmark virulence factor is Shiga toxin (Stx). Stx consists of an A subunit (encoded by stxa) and B subunits (encoded by stxb). EAEC: Contains a 100-kb paa plasmid with many different virulence factors (especially aggregative adherence fimbriae (AFFs), mycolycins (e.g., encoded by pic), and toxins (e.g., encoded by pet and asta). A regulator encoded by the aggr gene, also located on the paa plasmid, is coordinating the virulence factors. ETEC: This pathotype is known for its production of Heat-Stabile Toxin (ST) or Heat-Labile Toxin (LT). The former can be encoded by the sta1 or stb genes and the latter by ltca.
6 Shiga toxin-producing E. coli (STEC) / Verocytotoxin-producing E. coli (VTEC) A gastrointestinal pathogen Produces verocytotoxins as well as other virulence factors May cause bloody diarrhoea and occasionally Haemolytic Uremic Syndrome (HUS) Primary sources are undercooked ground meet, raw milk, and faecal contamination of vegetables In EU, in 2013, there were 6,043 confirmed cases of VTEC and 13 deaths due to VTEC
7 Previous routine typing of VTEC by the Danish State Serum Institute Serotyping Examined for.... β-glucuronidase activity.. haemolysin production.. Verocytotoxin production.. Presence of specific virulence factors, most importantly, verotoxin 1 (vtx1), verotoxin 2 (vtx2) and intimin (eae), which were detected by DNA hybridization Further subtyping of the verocytotoxins was carried out by PCR Isolates with same serotype and toxin profile compared by PFGE
8 Serotyping In serotyping a group of closely related microorganisms are distinguished by a characteristic set of antigens by the use of antibodies E. coli SerotypeFinder O-type is based on the O-processing genes: wzx, wzy, wzm, and wzt, and wzx/wzy or wzm/wzt pairs H-type is based on the detection of flagellin genes: flic, flka, flla, flma, flna O:H serotyping of E. coli using WGS data Joensen KG. et al J.Clin.Microbiol. 53(8):
9 Evaluating the performance of SerotypeFinder Number of genomes for validation with detected genes with consistent WGS -and conventional results O-typing (~95%) 560 (~98%) H-typing (~100%) 503 (~99%) Phenotype vs. genotype - Rough, non-motile, non-typable gets a genotype, which is not the actual serotype Non-distinguishable: - O90/O127 - O107/O117 - O20/O137 - O13/O135/O129
10 Serotyping of Salmonella: SeqSero ( SalmonellaTypeFinder ( Serotyping of P. aeruginoa: PAst (
11
12 VirulenceFinder Joensen et al J. Clin. Microbiol. 52(5):
13
14 Gene content of the E. coli virulence database
15 Database content Static databases at are no longer maintained All databases are in an online repository called BitBucket BitBucket: Web-based hosting service aimed at software version control systems for teams Main advantages: It is easy to see which changes have been done since last update It is possible to roll back to previous versions
16 _db means it is a database repository Otherwise it is a software repository
17
18
19
20
21 AU! Mouse arm SourceTree to the rescue!
22 Graphical User Interface client for Windows and Mac Used for connecting databases of interest stored on local computer with BitBucket repositories SourceTree makes it easy to see if changes have been made to BitBucket repository and to download (pull) those changes
23 BLAST-based CGE finder tools >Gene_1 GATAATGTAATAGAAATTGGATCAGGAAAAG GTCATTTTACCAAAGAACTTGTCAAAATGAG TCGGTGGGTGGATTCTATAGAAATTGATGAG GACTTGTGTCAAGTCACCCAAAAAGTCGTGA AGCCTTTTCAGAATATAAAAGTTATCCATAC GGATATTCTGAAATTTAACTTCCCCAAAAAC AAAGACTATAAAATATTTGGTAATATCCCCT TTAACATCAGTACTGATATTGTCAAAAAAAT TGCTTTTGAAAGCAATTCGAAATATAGTTA >Gene_2a ATGAACAAAAATATAAAATATTCTCAAAACT TTTTAACGAGTGAAAAAGTACTCAACCAAAT AATAAAACAATTGAATTTAAAAGAAACCGAT ACCGTTTACGAAATTGGAACAGGTAAAGGGC ATTTAACGACGAAACTGGCTAAAATAAGTAA ACAGGTAACGTCTATTGAATTAGACAGTCAT CTATTCAACTTATCGTCAGAAAAA Gene_2b ATGAAAAAAAATATAAAATATTCTCAAAACT TTTTAACGAATGAAAAGGTACTCAACCAAAT AATAAAACAATTGAATTTAAAAGAAACCGAT ACCGTTTACGAAATTGGAACAGGTAAAGGGC ATTTAACGACGAAACTGGCTAAAATAAGTAA ACAGGTAACGTCTATTGAATTAGACAGTCAT CTATTCAACTTATCTTCAGAAAAA Database >Contig_1 TGGATTCTATAGAAATTGATGAGGACTTGTG TCAAGTCACCCAAAAAGTCGTGAAGCCTTTT CAGAATATAAAAGTTATCCATACGGATATTC TGAAATTTAACTTCCCCAAAAACAAAGACTA TAAAATATTTGGTAATATCCCCTTTAACATC AGTACTGATATTGTCAAAAAAATTGCTTTTG AAAGCAATTCGAAATATAGTTAAATATAAAA TATTCTCAAAACTTTTTAACGAGTGAAAAAG TACTCAACCAAATAATAAAACAATTGAATTT AAAAGAAACCGATACCGTTTACGAAATTGGA ACAGGTAAAGGGCATTTAACGACGAAACTGG CTAAAATAAGTAAACAGGTAACGTCTATTGA ATTAGACAGTCATCTATTCAACTTATCGTCA GAAAAAATGAAAAAAAATATAAAATATTCTC AAAACTTTTTAACGAATGAAAAGGTACTCAA CCAAATAATAAAACAATTGAATTTAAAAGAA ACCGATACCGTTTACGAAATTGGAACAGGTA AAGGGCATTTAACGACGAAACTGGCTAAAAT AAGTAAACAGGTAACGTCTATTGAATTAGAC AGTCATCTATTCAACTTATCTTCAGAAAAA >Contig_12 AGTGTGTGCGAGAGAGCGAGCGTGCGTGCGA GAGAGTTTCGCGCGCGCTTTAGAGAGCGTGC GAGCGAGCGAGCGTGTTTGTGCCCCAGAGAA ATGGTAATATCCCCTTTAACATCAGTACTGA TATTGTCAAAAAAATTGCTTTTGAAAGCAAT TCGAAATATAGTTAAATATAAAATATTCTCA AAACTTTTTAACGAGTGAAAAAGTACTCAAC CAAATAATAAAACAATTGAATTTAAAAGAAA CCGATACCGTTTACGAAATTGGAACAGGTAA Draft assembly
24 BLAST-based CGE finder tools MLST ResFinder PlasmidFinder pmlst SerotypeFinder VirulenceFinder
25 Generating your own database Collect DNA sequences of the genes you wish to search for Save the DNA sequences in FASTA format Take care to provide each gene with a unique identifier (everything from the > to the first space) Save the FASTA file as pure text Congratulations - you have made your own database!
26 MyDBFinder Use your own database with any gene(s) of interest
27 Exercise 2 data
28 > Just one out of many papers about this outbreak
29 A single lot of fenugreek seeds, from an exporter in Egypt German farm French farm German outbreak Smaller outbreak in France: On June 24, 2011, France identified a cluster of E. coli O104:H4 infections among attendees of an event in Bordeaux, France
30 By July 2011 the outbreak was over: German outbreak: 4,000 cases of bloody diarrhoea 850 cases of HUS 50 deaths French outbreak: 15 cases of bloody diarrhoea 9 cases of HUS 0 deaths
31 Characterisation of the bacteria causing the outbreak Species: Escherichia coli Serotype: O104:H4 (historically, E. coli with this serotype is enteroaggregative, but not Shiga toxin-producing) MLST: ST-678 Plasmids: Name Size Note (kbp) pg-ea Cryptic plasmid, only encodes repa genes pesbml-ea11 90 IncI1 plasmid, carries CTX-M-15 beta-lactamase paa-ea11 75 a Tn5-insert derivative of adherence plasmid Ahmed S. et al 2012, PLOS One, 7 (11). e48228
32 Antibiotic resistance profile Resistance Ampicillin and 3rd gen. cephalosporins (ESBL production) Streptomycin Nalidixic acid Tetracyclin Cotrimoxazole Susceptible Carbapenems Ciprofloxacin Chloramphenicol Kanamycin Gentamicin It is not recommend that STEC infections are treated with antibiotics, so the fact that this strain is resistant towards certain types of antibiotics does not impact the care that infected patients receive
Real-Time WGS for Routine Typing, Surveillance, and Outbreak Detection of VTEC. Katrine Grimstrup Joensen, Ph.d.student
Real-Time WGS for Routine Typing, Surveillance, and Outbreak Detection of VTEC Katrine Grimstrup Joensen, Ph.d.student Short about me DTU Food Division for Epidemiology and Microbial Genomics (Frank Møller
More informationReal-Time WGS for Routine Typing, Surveillance, and Outbreak Detection of VTEC. Katrine Grimstrup Joensen
Real-Time WGS for Routine Typing, Surveillance, and Outbreak Detection of VTEC Katrine Grimstrup Joensen Short about me Ph.d project: Application of WGS for Diagnostics, Surveillance and Outbreak Detection
More informationSurveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change!
Surveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change! Dr Marie Anne Chattaway Deputy Head STEC Laboratory Gastrointestinal
More information3/08/2012. EHECO104: Lessons for Australia from the German outbreak. E. coli Pathotypes. EHEC Reservoirs & Transmission. EHEC Virulence Markers
E. coli Pathotypes E. coli O157:H7 EHECO104: Lessons for Australia from the German outbreak Rowland Cobbold Senior Lecturer - Veterinary Public Health School of Veterinary Science University of Queensland
More informationPT18 Identification and typing of STEC and other pathogenic E. coli
12 th Annual Worksop of the National Reference Laboratories for E. coli Rome 12-13 October 2017 PT18 Identification and typing of STEC and other pathogenic E. coli Istituto Superiore di Sanità, Food Safety,
More informationIs Whole Genome Sequencing Really Replacing Traditional Microbiology?
Is Whole Genome Sequencing Really Replacing Traditional Microbiology? Peter Gerner-Smidt, MD, DSc Enteric Diseases Laboratory Branch InFORM II Phoenix, AZ, 18 November 2015 National Center for Emerging
More informationMichael Weizenegger Laboratory Group Limbach, Heidelberg, Germany, Dept. of Microbiology and Molecular Genetic
Michael Weizenegger Laboratory Group Limbach, Heidelberg, Germany, Dept. of Microbiology and Molecular Genetic The story of the E. coli out break in Germany A novel strain of Escherichia coli O104.H4 (the
More informationGlobal food trade and emerging foodborne pathogens: The example of STEC O104
Global food trade and emerging foodborne pathogens: The example of STEC O104 Stefano Morabito EU Reference Laboratory for E. coli Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Istituto
More informationNATIONAL REFERENCE CENTRE FOR SHIGA TOXIN/VEROTOXIN- PRODUCING ESCHERICHIA COLI (NRC STEC/VTEC)
Laboratory of Microbiology and Infection Control, UZ Brussel NATIONAL REFERENCE CENTRE FOR SHIGA TOXIN/VEROTOXIN- PRODUCING ESCHERICHIA COLI (NRC STEC/VTEC) ANNUAL REPORT 2016 K. De Rauw Prof. Dr. D. Piérard
More informationRelevance of sprouts and germ buds as well as seeds for sprout production in the current EHEC O104:H4 outbreak event in May and June 2011
Relevance of sprouts and germ buds as well as seeds for sprout production in the current EHEC O104:H4 outbreak event in May and June 2011 Updated Opinion No. 23/2011 of BfR of 5 July 2011 The Federal Institute
More informationAntimicrobial resistance and virulence genes in bacteria
Antimicrobial resistance and virulence genes in bacteria Johanne Ahrenfeldt PhD Student BSU course - November 2016 1 How to analyse WGS data part 2 an introduction to CGEs methods KmerFinder SpeciesFinder
More informationAre all VTEC created Equal?
PHL-HSE-Dublin Mid Leinster Are all VTEC created Equal? Anne Carroll Escherichia coli Commensal Microrganism but some strains are cause of infections in humans Syndromes associated to E. coli infections:
More informationPig digest: Bacteriology Manakorn Sukmak
Pig digest: Bacteriology 24th International Pig Veterinary Society Congress 8th European Symposium of Porcine Health Management June 7th - 10th 2016Dublin, Ireland Manakorn Sukmak, DVM, MSc, PhD Dept.
More informationTECHNICAL REPORT. Fourth external quality assessment scheme for typing of verocytotoxin-producing E.coli (VTEC)
Fourth external quality assessment scheme for typing of verocytotoxin-producing E.coli (VTEC) www.ecdc.europa.eu ECDC TECHNICAL REPORT Fourth external quality assessment scheme for typing of verocytotoxinproducing
More informationTransitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens
Transitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens Peter Gerner-Smidt, MD ScD, Chief Enteric Diseases Laboratory Branch 2015 APHL
More informationShiga Toxin producing E. coli (STEC) in food which serotypes are important? Lothar Beutin
BUNDESINSTITUT FÜR RISIKOBEWERTUNG Shiga Toxin producing E. coli (STEC) in food which serotypes are important? Lothar Beutin National Reference Laboratory for Escherichia coli Federal Institute for Risk
More informationZoonosis from the ground
Zoonosis from the ground Alex W. Friedrich Medical Microbiology University Medical Center Groningen alex.friedrich@umcg.nl Reported hospitalisation and case-fatality rates due to zoonoses in confirmed
More informationFoodborne Outbreak of E. coli Infections and Hemolytic Uremic Syndrome in Germany, 2011
Foodborne Outbreak of E. coli Infections and Hemolytic Uremic Syndrome in Germany, 2011 Kirk Smith, DVM, MS, PhD Supervisor Foodborne, Vectorborne and Zoonotic Diseases Unit Minnesota Department of Health
More informationE. coli O104:H7 an example of evolution in foodborne pathogens and revolution in food microbiology. Prof Steve Forsythe
E. coli O104:H7 an example of evolution in foodborne pathogens and revolution in food microbiology Introduction: Prof Steve Forsythe I have been holding back on releasing any comment until now due to the
More informationFrench EHEC outbreaks in 2011
6th annual workshop of the EU- RL Rome, 4th November, 2011 French EHEC outbreaks in 2011 Dr. Estelle LOUKIADIS French NRL/ Laboratoire d étude des microorganismes alimentaires pathogènes (LMAP) UR CALITYSS
More informationE-BOOK # E COLI IN WELL WATER EBOOK
02 February, 2018 E-BOOK # E COLI IN WELL WATER EBOOK Document Filetype: PDF 332.93 KB 0 E-BOOK # E COLI IN WELL WATER EBOOK Addresses the presence of total coliforms and E. Most common water quality problem
More informationMedical Microbiology Coursework Essay High Class 1 essay. North Germany. This outbreak caused the highest frequency of HUS cases caused by
High Class 1 essay Discuss the new insights in the understanding of Haemolytic Uraemic Syndrome and its worldwide implications following the large scale outbreak of E.Coli O104:H4 diarrhea in Germany 2011
More information3/18/ Update: STEC Diagnosis and Surveillance in Wisconsin. Objectives. Objectives. Shiga toxin-producing Escherchia coli (STEC)
2014 Update: STEC Diagnosis and Surveillance in Wisconsin Mike Rauch Tim Monson WI State Laboratory of Hygiene Communicable Disease Division WCLN Teleconference March 19, 2014 WISCONSIN STATE LABORATORY
More information2014 Update: STEC Diagnosis and Surveillance in Wisconsin
2014 Update: STEC Diagnosis and Surveillance in Wisconsin Mike Rauch Tim Monson WI State Laboratory of Hygiene Communicable Disease Division WCLN Teleconference March 19, 2014 WISCONSIN STATE LABORATORY
More informationScottish E. coli O157/Shiga toxin-producing E. coli Reference Laboratory
Scottish E. coli O157/Shiga toxin-producing E. coli Reference Laboratory 1 Authors: SERL68:Version L. Allison 6 Issue date & M. 27/09/2017 Hanson This is an electronic document Authors: L. Allison which
More information2. REVIEW OF LITERATURE
2. REVIEW OF LITERATURE 2.1 PROBLEM STATEMENT Diarrheal diseases are the major cause of death in children under 5 years of age in resourcepoor countries, resulting in approximately 2.5 million deaths each
More informationEFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on VTECseropathotype and scientific criteria regarding pathogenicity assessment
Downloaded from orbit.dtu.dk on: Jan 29, 2019 EFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on VTEC and scientific criteria regarding pathogenicity assessment EFSA publication; Hald, Tine;
More informationImproving the Detection of Shiga Toxin- Producing Escherichia coli (STEC)
Improving the Detection of Shiga Toxin- Producing Escherichia coli (STEC) C a ra W i l d e r, P h. D. Te c h n i c a l Wr i t e r, ATC C A u g u s t 1 8, 2016 About ATCC Founded in 1925, ATCC is a non-profit
More informationEscherichia coli: Great Diversity around a Common Core
Escherichia coli: Great Diversity around a Common Core Author G. Moriel, Danilo, Rosini, Roberto, L. Seib, Kate, Serino, Laura, Pizza, Mariagrazia, Rappuoli, Rino Published 2012 Journal Title mbio DOI
More informationIPCVA, Buenos Aires - 7 December Infections with Shiga toxin producing E.coli (STEC): emerging issues and reflections on the global food trade
IPCVA, Buenos Aires - 7 December 2012 Infections with Shiga toxin producing E.coli (STEC): emerging issues and reflections on the global food trade Alfredo Caprioli EU Reference Laboratory for Escherichia
More informationIn May 2011 there was a large scale outbreak of Haemolytic Uraemic Syndrome (HUS) in
Discuss the new insights in the understanding of Haemolytic Uraemic Syndrome and its worldwide implications following the large scale outbreak of E.Coli O104:H4 diarrhea in Germany 2011 In May 2011 there
More informationThorough identification of pathogenic Shigatoxin producing Escherichia coli (STEC) in Belgium
Thorough identification of pathogenic Shigatoxin producing Escherichia coli (STEC) in Belgium Dr. Ir. Sarah Denayer NRL VTEC WIV-ISP, Brussels, Belgium 10 th Annual workshop of the NRLs for E. coli in
More informationShiga toxin-producing Escherichia coli
Shiga toxin-producing Escherichia coli Terry Arthur Research Microbiologist Meat Safety and Quality Research Unit U.S. Meat Animal Research Center Use of product names by USDA implies no approval to the
More informationE. coli 0157:H7. By Christopher Tong
E. coli 0157:H7 By Christopher Tong The etiologic agent E. coli 0157:H7 have several transmissions that can be spread around to animals and humans. In humans this serotype of E. coli is transmitted to
More informationA genomic dissection of travel associated ESBL producing Salmonella Typhi originating from the Philippines
A genomic dissection of travel associated ESBL producing Salmonella Typhi originating from the Philippines A one-off occurrence or threat to the effective treatment of typhoid fever? Rene S. Hendriksen,
More informationGram-Negative rods Introduction to
Lec 5 Oral Microbiology Dr. Chatin Gram-Negative rods Introduction to Enterobacteriaceae Characteristics: جامعة تكريت كلية طب االسنان Small gram-negative rods (2-5 by 0.5 microns) Most motile with peritrichous
More informationLessons learned from recent foodborne outbreaks in Germany
FEDERAL INSTITUTE FOR RISK ASSESSMENT Lessons learned from recent foodborne outbreaks in Germany B. Appel for the BfR outbreak team and the food chain research team, Dept. of Biological Safety Outline
More informationGastrointestinal Disease from 2007 to 2014
Data Requested by Amber Erickson, Epidemiologist, North Central Health District Gastrointestinal Disease from 2007 to 2014 North Central Health District Aemon Weaver, Epidemiology Intern, NCHD September
More informationEscherichia coli Pathotypes Associated with Diarrhea in Romanian Children Younger than 5 Years of Age
Jpn. J. Infect. Dis., 62, 289-293, 2009 Original Article Escherichia coli Pathotypes Associated with Diarrhea in Romanian Children Younger than 5 Years of Age Codruţa-Romaniţa Usein*, Dorina Tatu-Chiţoiu
More informationEscherichia coli Verotoxigenic Infections
Revision Dates Case Definition Reporting Requirements Epidemiology/Public Health Management March 2011 May 2018 March 2011 Includes O157:H7 Case Definition Confirmed Case Laboratory confirmation of infection
More informationEHEC Outbreak 2011: Updated Analysis as a Basis for Recommended Measures
EHEC Outbreak 2011: Updated Analysis as a Basis for Recommended Measures BfR opinion No. 049/2011, 23 November 2011 The EHEC O104:H4 outbreak in Germany of the early summer 2011 is now over. The investigations
More informationDR. HUDA ABO- ALEES GRAM-NEGATIVE BACILLI THE ENTERICS:
DR. HUDA ABO- ALEES 214-2-15 GRAM-NEGATIVE BACILLI THE ENTERICS: Family Enterobacteriaceae: Genus Escherichia & Genus Klebsiella OBJECTIVES Describe the morphology & physiology for E.coli & Klebsiella
More informationSHIGA-TOXIN PRODUCING ESCHERICHIA COLI STEC Update. Roshan Reporter, MD, MPH Rita Bagby, PS-PHN Leticia Martinez, PS-PHN
SHIGA-TOXIN PRODUCING ESCHERICHIA COLI STEC Update Roshan Reporter, MD, MPH Rita Bagby, PS-PHN Leticia Martinez, PS-PHN Objectives At the conclusion of this presentation the participant should be able
More informationVeterinary and Agrochemical Research Centre
Veterinary and Agrochemical Research Centre Report on susceptibility of Salmonella serotypes in Belgium. P. Butaye Susceptibility of Salmonella strains was assessed by MIC determination using Sensititer
More informationGRAM-NEGATIVE BACILLI THE ENTERICS: Family Enterobacteriaceae: Genus Escherichia & Genus Klebsiella
DR. HUDA ABO- ALEES 214-2-15 Obgectives: GRAM-NEGATIVE BACILLI THE ENTERICS: Family Enterobacteriaceae: Genus Escherichia & Genus Klebsiella Describe the morphology & physiology for E.coli & Klebsiella
More informationEUROPEAN COMMISSION HEALTH & CONSUMER PROTECTION DIRECTORATE-GENERAL. (Adopted on 23 January 2003)
EUROPEAN COMMISSION HEALTH & CONSUMER PROTECTION DIRECTORATE-GENERAL Directorate C - Scientific Opinions C2 - Management of scientific committees; scientific co-operation and networks REPORT OF THE SCIENTIFIC
More informationRobert Tauxe, MD, MPH
Robert Tauxe, MD, MPH Deputy Director, Division of Foodborne, Waterborne and Environmental Diseases National Center for Emerging and Zoonotic Infectious Diseases Centers for Disease Control and Prevention
More informationEnterovirulent Escherichia coli. Tom Cheasty Laboratory of Enteric Pathogens
Enterovirulent Escherichia coli Tom Cheasty Laboratory of Enteric Pathogens Classes of Enterovirulent E. coli Urinary Tract Septicaemia / Meningitis Enteropathogenic Enteroinvasive Enterotoxigenic Vero
More informationWGS Works! Shared Mission Different Roles APPLICATIONS SEQUENCING (WGS) Non-regulatory. Regulatory CDC. FDA and USDA. Peter Gerner-Smidt, MD ScD
PUBLIC HEALTH FOOD SAFETY APPLICATIONS FOR WHOLE GENOME SEQUENCING (WGS) Peter Gerner-Smidt, MD ScD Chief, Enteric Diseases Laboratory Branch 4 th Asia-Pacific International Food Safety Conference, Penang,
More informationAyman Musleh. Osama Hussein, Saba Massimi ... Dr.Anas
14 Ayman Musleh Osama Hussein, Saba Massimi... Dr.Anas Enterobacteriaceae: *General properties: 1. Enterobacteriaceae are moderate-sized (0.3 to 1.0 1.0 to 6.0 μm). 2. non spore-forming. 3. gram-negative
More informationWhole genome sequencing
Downloaded from orbit.dtu.dk on: Dec 20, 2017 Whole genome sequencing Torpdahl, Mia; Löfström, Charlotta; Møller Nielsen, Eva Published in: Publication date: 2014 Document Version Publisher's PDF, also
More informationPosition Statement Template
Submission Date: 7/6/2005 Committee: Infectious Diseases 05-ID-07 Position Statement Template Title: Revision of the Enterohemorrhagic Escherichia coli (EHEC) condition name to Shiga toxin-producing Escherichia
More informationSUMMARY OF MEDICAL PHD THESIS
MINISTRY OF EDUCATION AND TRAINING MINISTRY OF HEALTH NATIONAL INSTITUTE OF HYGIENE AND EPIDEMIOLOGY -----------------*------------------- HOANG THI BICH NGOC DISTRIBUTION AND SOME MOLECULAR CHARACTERISTICS
More informationFood Microbiology 101
Food Microbiology 101 Nina G. Parkinson NGP Consulting November 6, 2018 Food Safety and Sanitation Conference Summary Microbiological contamination of food Routes of contamination by pathogens Overview
More information51 st International Congress of Meat Science and Technology
Use of Comparative Genomics as a Tool to Assess the Clinical and Public Health Significance of Emerging Shiga toxin Producing Escherichia coli Serotypes 51 st International Congress of Meat Science and
More informationReceived 23 February 2011/Returned for modification 28 March 2011/Accepted 5 April 2011
JOURNAL OF CLINICAL MICROBIOLOGY, June 2011, p. 2274 2278 Vol. 49, No. 6 0095-1137/11/$12.00 doi:10.1128/jcm.00386-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Characterization
More informationoverview Domain: Bacteria Kingdom: Bacteria Phylum: Proteobacteria Class: Gamma Proteobacteria Order: Enterobacteriales Family: Enterobacteriaceae
E.coli overviwe E. coli is a Gram negative rod-shaped bacterium that is commonly found in the lower intestine of warm-blooded organisms. Most E. coli strains are harmless, but some, such as serotype O157:H7,
More informationThose Pathogens, What You Should Know
Those Pathogens, What You Should Know Ted F. Beals, MS, MD Short 1 We are at war over our Food Most of us here are convinced that what we eat, and why we choose is our responsibility, not the responsibility
More informationNucleotide Polymorphisms within the O-antigen Gene Cluster of Escherichia coli O26,
AEM Accepts, published online ahead of print on 13 July 2012 Appl. Environ. Microbiol. doi:10.1128/aem.01259-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Nucleotide Polymorphisms
More information7th annual workshop of the NRL for E. coli in the EU Rome, 8th -9th November 2012
Prevalence of the 7 major serogroups of enterohemorrhagic Escherichia coli (EHEC) in fresh minced beef in France: A novel real-time PCR strategy for their early detection in food C.Mazuy-Cruchaudet 1,
More informationN Jourdan-Da Silva, M Watrin, F X Weill, L A King, M Gouali, A Mailles, D Van Cauteren, M Bataille, S Guettier, C Castrale, et al.
Outbreak of haemolytic uraemic syndrome due to Shiga toxin-producing Escherichia coli O104:H4 among French tourists returning from Turkey, September 2011. N Jourdan-Da Silva, M Watrin, F X Weill, L A King,
More informationSTEC Whole Genome Sequencing Project
STEC Whole Genome Sequencing Project Eija Trees, PhD, DVM Chief, PulseNet Next Generation Subtyping Methods Unit 16 th Annual PulseNet Update Meeting August 29 th, 2012 National Center for Emerging and
More informationcoli (EHEC)Hemolysin Genes of a Shiga Toxin 1 (Stx1)- and Stx2Producing, Serotype 0128 Escherichia
Ada Me e log ica Bio tdica Vo l.2000 No. l, 18, 48, ll- The Enterohemorrhagic Escherichia coli (EHEC)Hemolysin Genes of a Shiga Toxin 1 (Stx1)- and Stx2Producing, Serotype 0128 Escherichia coli Strain
More informationE. coli O157:H7 shedding in beef cattle. Jane Heller, Geraldine Lammers and Craig McConnel
E. coli O157:H7 shedding in beef cattle Jane Heller, Geraldine Lammers and Craig McConnel Overview Background on E.coli O157:H7 Supershedding of E.coli O157:H7 Overview of collaborative study - MLA Future
More informationExtra-intestinal pathogenic E. coli carrying the. shiga toxin gene stx2
JCM Accepts, published online ahead of print on 9 October 2013 J. Clin. Microbiol. doi:10.1128/jcm.01349-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10
More informationEU Reference Laboratory for E. coli. Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses. Istituto Superiore di Sanità
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Report of the 18 th inter-laboratory study (PT18) on the
More informationGram-negative rods: Enterobacteriaceae Part II Common Organisms. Escherichia coli. Escherichia coli. Escherichia coli. CLS 418 Clinical Microbiology I
Gram-negative rods: Enterobacteriaceae Part II Common Organisms Karen Honeycutt, M.Ed., MLS(ASCP) CM SM CM Session Enterobacteriaceae Antigens O somatic, part of cell wall (serogroup) Stimulates earliest
More informationEpidemiology of Verotoxigenic E. coli O157 in Ireland, 2003 Patricia Garvey and Paul McKeown
Epidemiology of Verotoxigenic E. coli O157 in Ireland, 2003 Patricia Garvey and Paul McKeown National Disease Surveillance Centre 25-27 Middle Gardiner Street, Dublin 1, Ireland Introduction Verotoxigenic
More informationHompes Method. Practitioner Training Level II. Lesson Seven Part A DRG Pathogen Plus Interpretation
Hompes Method Practitioner Training Level II Lesson Seven Part A DRG Pathogen Plus Interpretation Health for the People Ltd not for reuse without expressed permission Hompes Method is a trading name of
More informationIdentification of different Escherichia coli pathotypes in north and north-west provinces of Iran
Volume 9 Number 1 (February 2017) 33-37 ORIGINAL ARTICLE Identification of different Escherichia coli pathotypes in north and north-west provinces of Iran Seyedeh Tina Miri, Amir Dashti, Saeid Mostaan,
More informationPATHOGENICITY OF MICROORGANISMS
PATHOGENICITY OF MICROORGANISMS Some microorganisms are : 1- Harmless microorganism, as normal flora 2- Harmfull microorganism, as pathogenic. A pathogenic microorganism is defined as one that causes or
More informationCHAPTER 4: DISEASES SPREAD BY FOOD AND WATER
CHAPTER 4: DISEASES SPREAD BY FOOD AND WATER Highlights The incidence of diseases spread by food and water was generally higher in Peel than Ontario with the exceptions of hepatitis A and verotoxinproducing
More informationE. coli peritonitis. Bernie Beckman, DVM Hy-Line International. Genetic Excellence. Genetic Excellence. Hy-Line International
E. coli peritonitis Bernie Beckman, DVM Hy-Line International Hy-Line International Genetic Excellence E. coli peritonitis Lesions Fibrin around the ova thin, yellow strings of fibrin that are very small
More informationPathogens of the Digestive System
Pathogens of the Digestive System Chapter 24 (Pages 625-661) 1. Digestive System Review (Pages 627-629) A. Oral Cavity B. Esophagus C. Stomach D. Small Intestine E. Pancreas F. Liver G. Gall Bladder H.
More informationSUMMARY OF FOODBORNE AND WATERBORNE DISEASE CHARACTERISTICS
SUMMARY OF FOODBNE AND WATERBNE DISEASE CHARACTERISTICS BACTERIAL Bacillus cereus Vomiting toxin Diarrheal toxin Brucella species Campylobacter species Clostridium botulinum Clostridium perfringens 1-6
More informationCHAPTER 5 INTERPRETATION AND DISCUSSION
CHAPTER 5 INTERPRETATION AND DISCUSSION - 189 - Escherichia coli are the predominant facultative anaerobes of the gastrointestinal tract of warm-blooded animals and in humans. As a commensal, it contributes
More informationShigella and salmonella
Sulaimani University College of Pharmacy Microbiology Lec. 9 & 10 Shigella and salmonella Dr. Abdullah Ahmed Hama PhD. Microbiology/Molecular Parasitology abdullah.hama@spu.edu.iq 1 Shigella Shigella species
More informationON-GOING STUDIES ON VTEC IN SWEDEN
NATIONAL VETERINARY INSTITUTE ON-GOING STUDIES ON VTEC IN SWEDEN Anna Aspán & friends Chase-Topping M, Gally D, Low C, Matthews L, Woolhouse M. Nat Rev Microbiol. 2008 Dec;6(12):904-12. Green area routine
More informationGI Bacterial Infections (part-1)
GI Bacterial Infections (part-1) Mohammed Abdulla Mehdi FIBMS (internal medicine), FIBMS (Gastroenterology & Hepatology) Acute diarrhea and vomiting Acute diarrhea, sometimes with vomiting, is the predominant
More informationE. coli Nissle 1917 A Unique Medical Probiotic and it s Clinical Applications. Sudesh Samuel Scientific Director Amber Laboratories
E. coli Nissle 1917 A Unique Medical Probiotic and it s Clinical Applications Sudesh Samuel Scientific Director Amber Laboratories Content E. coli s background Gut Microbiome Pathogenic E. coli Probiotic
More informationKatrine G. Joensen. Whole genome sequencing (WGS) surveillance of VTEC and Shigella
Whole genome sequencing (WGS) surveillance of VTEC and Shigella Katrine G. Joensen & Flemming Scheutz WHO Collaborating Centre for Reference and Research on Escherichia and Klebsiella Foodborne Infections
More informationShiga Toxin Producing Escherichia coli
Shiga Toxin Producing Escherichia coli Funded by The Beef Checkoff Shiga Toxin Producing Escherichia coli Contents Defining STEC... 1 Virulence Markers... 2 Diagnosis of Shiga Toxin-producing E. coli...
More informationFOOD QUALITY AND STANDARDS - Methods of Detection and Characterization of Pathogenic Escherichia Coli - Peter Feng, Nancy Strockbine, Pina Fratamico
METHODS OF DETECTION AND CHARACTERIZATION OF PATHOGENIC ESCHERICHIA COLI Peter Feng Division of Microbiology, U.S. Food and Drug Administration, College Park, MD, USA Nancy Strockbine Centers for Disease
More informationImproved methodology for isolating Shiga toxin-producing E. coli (STEC) in food
Improved methodology for isolating Shiga toxin-producing E. coli (STEC) in food Oscar Cidon Sporrong Master Degree Project in Infection biology, 45 credits. Spring 2018 Department: Swedish National Food
More informationMolecular typing insight on diversity and antimicrobial resistance of Campylobacter jejuni from Belgian chicken meat
Molecular typing insight on diversity and antimicrobial resistance of Campylobacter jejuni from Belgian chicken meat Ihab Habib Ghent University Department of Public Health and Food Safety. Contents: Molecular
More informationCampylobacter jejuni
U.S. Food & Drug Administration Center for Food Safety & Applied Nutrition Foodborne Pathogenic Microorganisms and Natural Toxins Handbook Campylobacter jejuni 1. Name of the Organism: Campylobacter jejuni
More informationGlycosphingolipid-mediated interaction of Shiga toxin with the human endothelium: status quo of receptor research
Glycosphingolipid-mediated interaction of Shiga toxin with the human endothelium: status quo of receptor research Ivan U. Kouzel, Andreas Bauwens, Helge Karch and Johannes Müthing Institute for Hygiene,
More informationWhole genome sequencing & new strain typing methods in IPC. Lyn Gilbert ACIPC conference Hobart, November 2015
Whole genome sequencing & new strain typing methods in IPC Lyn Gilbert ACIPC conference Hobart, November 2015 Why do strain typing? Evolution, population genetics, geographic distribution 2 Why strain
More informationOld bugs in new places The changing face of food safety microbiology
Old bugs in new places The changing face of food safety microbiology Roy Betts Campden BRI Chipping Campden Gloucestershire GL55 6LD UKAFP, Cardiff 2017 26 th September 2017 UK Annual Figures UK 25% people
More informationGenomic epidemiology of Gram-negative pathogens: from Acinetobacter to E. coli. Professor Mark Pallen, University of Birmingham
Genomic epidemiology of Gram-negative pathogens: from Acinetobacter to E. coli Professor Mark Pallen, University of Birmingham The state we are in: diagnostic microbiology 21st Century problem, but 19th
More informationFoodborne Disease in the Region of Peel
Foodborne Disease in the Region of Peel HIGHLIGHTS The incidence of selected foodborne diseases was generally higher in Peel than in Ontario between 1993 and 22. A higher incidence was observed in Peel
More informationLess common but more deadly: E. coli and Listeria
6 Less common but more deadly: E. coli and Listeria In this chapter we discuss two microbes, the verocytotoxin-producing Escherichia coli (or VTEC for short) and Listeria monocytogenes. Compared with Salmonella
More informationUpdate on infections with and clinical lab guidelines for Shiga toxin-producing E. coli (STEC) in the United States
Update on infections with and clinical lab guidelines for Shiga toxin-producing E. coli (STEC) in the United States Patricia M. Griffin, MD Enteric Diseases Epidemiology Branch Centers for Disease Control
More informationToxins 2011, 3, manuscripts; doi: /toxins Short Note
Toxins 2011, 3, 672-677 manuscripts; doi:10.3390/toxins3060672 Short Note OPEN ACCESS toxins ISSN 2072-6651 www.mdpi.com/journal/toxins Loss of vtx Genes after the First Subcultivation Step of Verocytotoxigenic
More informationIndex. D DBETH tool, 23 De Bruijn graph, 53, 54 De novo approaches, 53 De novo assembly, Denmark, 4, 36, 68
A Acute gastroenteritis, 145 AdapterRemoval tool, 24 Adenoviruses, 151 Advanced Molecular Detection (AMD), 37 Amplicon, 59 Amplicon sequencing, 58, 60 Annotated, 54, 69 Antibiotic resistance, 97, 100,
More informationPROFESSOR PETER M. HAWKEY
Multi-drug resistant Escherichia coli PROFESSOR PETER M. HAWKEY School of Immunity and Infection College of Medical and Dental Sciences University of Birmingham Birmingham B15 2TT Health Protection Agency
More informationTitle: The Operon Encoding SubAB a Novel Cytotoxin is Present in US STEC Isolates ACCEPTED
JCM Accepts, published online ahead of print on February 00 J. Clin. Microbiol. doi:./jcm.000-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationHelen Heffernan and Rosemary Woodhouse Antibiotic Reference Laboratory, Institute of Environmental Science and Research Limited (ESR); July 2014.
Annual survey of extended-spectrum -lactamase (ESBL)-producing Enterobacteriaceae, 2013 Helen Heffernan and Rosemary Woodhouse Antibiotic Reference Laboratory, Institute of Environmental Science and Research
More informationReport on susceptibility of Salmonella serotypes in Belgium Vicky Jasson
CODA-CERVA Report on susceptibility of Salmonella serotypes in Belgium 2014. Vicky Jasson Veterinary and Agrochemical Research Centre 1 Introduction Salmonella is one of the most important bacterial zoonotic
More informationReport: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2013
Veterinary and Agrochemical Research Centre Report: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2013 1 Introduction Commensal E. coli are regarded as general
More information