Received 31 July 2009/Returned for modification 18 September 2009/Accepted 31 December 2009

Transcription

1 JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2010, p Vol. 48, No /10/$12.00 doi: /jcm Copyright 2010, American Society for Microbiology. All Rights Reserved. Development of a Reverse Transcription-Loop-Mediated Isothermal Amplification Assay for Detection of Pandemic (H1N1) 2009 Virus as a Novel Molecular Method for Diagnosis of Pandemic Influenza in Resource-Limited Settings Toru Kubo, 1,2 Masanobu Agoh, 3 Le Q. Mai, 4 Kiyoyasu Fukushima, 5 Hidekazu Nishimura, 6 Akinori Yamaguchi, 3 Manabu Hirano, 3 Akira Yoshikawa, 3 Futoshi Hasebe, 1,2 Shigeru Kohno, 7 and Kouichi Morita 2 * Center for International Collaborative Research, Institute for Tropical Medicine, Nagasaki University, , Sakamoto, Nagasaki , Japan 1 ; Department of Virology, Institute of Tropical Medicine, Nagasaki University, , Sakamoto, Nagasaki , Japan 2 ; Nagasaki Prefectural Institute for Environmental Research and Public Health, , Ikeda, Omura, Nagasaki, Japan 3 ; National Institute of Hygiene and Epidemiology, No. 1 Yersin Street, Hai Ba Trung District, Hanoi 10000, Vietnam 4 ; Division of Respiratory Medicine, Japanese Red Cross Nagasaki Genbaku Isahaya Hospital, 986-2, Keya, Tarami, Isahaya, Nagasaki, Japan 5 ; Virus Research Center, Clinical Research Division, Sendai Medical Center, National Hospital Organization, Miyagino, Sendai, Miyagi , Japan 6 ; and Department of Molecular Microbiology and Immunology, Nagasaki University Graduate School of Biomedical Sciences, , Sakamoto, Nagasaki , Japan 7 Received 31 July 2009/Returned for modification 18 September 2009/Accepted 31 December 2009 This paper reports on the development of a one-step, real-time reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay targeting the hemagglutinin (HA) gene for the rapid molecular-based detection of pandemic (H1N1) 2009 virus. The detection limit of the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay was same as that of the currently used real-time reverse transcription-pcr method. The assay detected the pandemic (H1N1) 2009 virus HA gene in 136 RNA samples extracted from nasopharyngeal swab specimens from Japanese and Vietnamese patients. No cross-reactive amplification with the RNA of other seasonal influenza viruses was observed, and the detection of specific viral genome targets in clinical specimens was achieved in less than 40 min. The sensitivity and specificity of the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay obtained in this study were 97.8% and 100%, respectively. Use of the (H1N1) 2009 virus HA-specific RT-LAMP assay will enable the faster and easier diagnosis of pandemic (H1N1) 2009 virus infection, especially in resource-limited situations in developing countries. Since the early reports of human cases of pandemic (H1N1) 2009 virus infection (1, 4), this newly emerged human influenza virus, which is a triple reassortant that includes segments from swine, avian, and human influenza viruses (7, 16, 17), has spread throughout the world. The World Health Organization (WHO) declared phase 6 of an influenza pandemic on 11 June 2009 (24). As of 6 July 2009, according to WHO, a total of 94,512 cases with 429 fatalities had been reported from more than 130 countries, territories, and areas on five continents, with most of these cases occurring in developing countries (25). The number of infected cases is still increasing throughout the world. Although the world seems to have failed with the rapid containment of this pandemic influenza virus, the development of a mitigation strategy should be considered in order to minimize the impact of an influenza pandemic (6). A mitigation strategy should be composed of various approaches, including public health interventions and pharmaceutical interventions, although there is no single, definitive solution. However, for any kind of possible intervention for pandemic influenza, the * Corresponding author. Mailing address: Department of Virology, Institute of Tropical Medicine, Nagasaki University, , Sakamoto, Nagasaki , Japan. Phone: Fax: moritak@nagasaki-u.ac.jp. Published ahead of print on 13 January rapid and accurate diagnosis of the infection is of great importance. To meet the enormous demand for diagnostic tests, especially in developing countries, which may be under a greater threat from an influenza pandemic (11), the development of a rapid, accurate, and concise diagnostic test method for pandemic influenza which can be conducted even in resource-limited settings is required. At present, laboratory techniques for the detection of pandemic (H1N1) 2009 virus include molecular diagnostics, virus isolation, typing by hemagglutination inhibition assays or by immunofluorescence assays, rapid tests, immunofluorescence assays, and serology (23). Currently, a rapid test may be the most widely used first-line method for the diagnosis of influenza virus infection in many countries. However, the cost of the test kits is an issue in developing countries, and it remains controversial whether the rapid tests used for the diagnosis of pandemic (H1N1) 2009 virus infection are accurate (3, 5). Molecular diagnostics are currently the methods of choice for the detection of pandemic (H1N1) 2009 virus infection. A real-time reverse transcription (RT)-PCR (rrt-pcr) assay based on the TaqMan probe technology has been used to detect pandemic (H1N1) 2009 virus RNA (22), and modified rrt-pcr test methods have also been reported (2, 15, 19, 20). The real-time RT-PCR is less time-consuming than conven- 728

2 VOL. 48, 2010 RT-LAMP FOR DETECTION OF PANDEMIC (H1N1) 2009 VIRUS 729 TABLE 1. Primer sets designed for RT-LAMP assay detection of pandemic (H1N1) 2009 viruses in this study Primer Sequence Genome position Length (bp) Pdm-F3 GCTAAGAGAGCAATTGAGC Pdm-B3 ATGTAGGATTTGCTGAGCT Pdm-FIP a F1c CGAGTCATGATTGGGCCATGA F2 CAGTGTCATCATTTGAAAGGTTT Pdm-BIP b B1c AAGGTGTAACGGCAGCATGTCC B2 GAATTTCCTTTTTTAACTAGCCAT Pdm-LF ACTTGTCTTGGGGAATATCTC Pdm-LB ATGCTGGAGCAAAAAGCT a Pdm-FIP is one long primer with two recognition sequences, F1c and F2. b Pdm-BIP is one long primer with two recognition sequences, B1c and B2. tional RT-PCR methods, is performed in a closed system to minimize contamination, and usually has a higher sensitivity than conventional RT-PCR methods. However, rrt-pcr requires an expensive machine system, primers/probes with special modifications, and experienced laboratory workers. The loop-mediated isothermal amplification (LAMP) assay is a rapid, accurate, and cost-effective diagnostic method which amplifies the target nucleic acid under isothermal conditions, usually between 60 C and 65 C (12, 18). Hence, only simple equipment, such as a heating block or a water bath, is required. The one-step RT-LAMP assay relies on autocycling strand displacement DNA synthesis performed with avian myeloblastosis virus reverse transcriptase and Bst DNA polymerase, which has a high degree of strand displacement activity. The assay also uses a set of six primers: two inner primers and two outer primers define the target region, and two loop primers increase the sensitivity of the assay. The final products of the RT-LAMP reaction are DNA molecules with a cauliflower-like structure and multiple loops consisting of several repeats of the target sequence (12). These products can be analyzed by agarose gel electrophoresis, real-time monitoring of the turbidity caused by the precipitation of magnesium pyrophosphate during amplification, or, alternatively, by visualization under UV irradiation with an intercalating fluorescent dye (18). The LAMP method has been used to detect a number of pathogens, including RNA viruses (8 10, 13, 14, 21), and has the potential to be used as a simple tool for the rapid laboratory confirmation of the occurrence of infectious diseases in basic diagnostic facilities, even in resource-limited settings. This paper reports on the development and diagnostic evaluation of a real-time, one-step RT-LAMP assay specific for the hemagglutinin (HA) gene of pandemic (H1N1) 2009 virus. This pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay may enable the diagnosis of pandemic (H1N1) 2009 virus infection faster and easier, even in resource-limited settings. MATERIALS AND METHODS Design of RT-LAMP assay primers for pandemic (H1N1) 2009 virus. The pandemic (H1N1) 2009 virus HA-specific oligonucleotide primers used with the RT-LAMP assay were designed to be specific for segment 4 of the HA gene. The nucleotide sequences of the HA genes of human isolates of pandemic (H1N1) 2009 virus were retrieved from the GenBank database and were aligned to identify potential target regions by using a sequence viewer (CLC bio, Aarhus, Denmark; 28). In total, the HA gene sequences of 333 strains of pandemic (H1N1) 2009 viruses were aligned. The alignments of the HA gene sequences of 500 randomly selected strains of seasonal H1N1 virus subtypes recovered between 1934 and 2008 were also examined. A set of six primers comprising two outer primers (forward primer F3 and backward primer B3), two inner primers (forward inner primer FIP and backward inner primer BIP), and two loop primers (forward loop primer LF and backward loop primer LB) that recognize eight distinct regions on the target sequence was designed by use of the LAMP primer design software Primer- Explorer (version 4; Eiken Chemical Co., Japan; The primers for the RT-LAMP assay were designed on the basis of the HA gene sequence of the A/Ohio/07/2009(H1N1) virus (GenBank accession number FJ984401). The maximum number of mismatched nucleotides between the pandemic (H1N1) 2009 virus HA-specific primer sequence and seasonal H1N1 virus HA sequences was incorporated in order to avoid crossreactive amplification. In total, six different primer combinations for use with the RT-LAMP assay were designed and tested for their ability to detect pandemic (H1N1) 2009 virus, and the best combinations in terms of sensitivity and specificity were selected. All the primers used in this study were synthesized by Hokkaido System Science Co., Ltd., Japan. Inner longer primers FIP and BIP were purified by high-pressure liquid chromatography (HPLC). The details for each primer and the positions of the primers in the genomic sequences are shown in Table 1. Cell culture and viruses. Madin-Darby canine kidney (MDCK) cells (JCRB9029) were purchased from the Health Science Research Resources Bank, Osaka, Japan. MDCK cells were cultured in Eagle s minimum essential medium (EMEM; MP Biomedicals) with 10% fetal calf serum (FCS, HyClone Laboratories, Inc.) containing 100 IU/ml penicillin and 100 g/ml streptomycin. Influenza virus was cultured with MDCK cells in virus growth medium (VGM) consisting of EMEM with 0.2% bovine serum albumin (Invitrogen), 25 mm HEPES buffer (Invitrogen), 2 g/ml of L-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK) trypsin (Sigma), 100 IU/ml penicillin, and 100 g/ml streptomycin. All the influenza virus strains (n 17) used in this study are listed in Table 2. Among the three pandemic (H1N1) 2009 virus strains, the A/Nagasaki/I01/ 2009(H1N1) virus (GenBank accession number GU117765) was isolated from a nasopharyngeal swab specimen from a patient in Nagasaki, Japan, by using MDCK cells. The other two strains, strains 31783T and 31784T, were isolated from pandemic (H1N1) 2009 virus-infected specimens from patients in Vietnam by using MDCK cells, and only RNA extracted from infected culture supernatants was used as the positive control in this study. Thirteen seasonal influenza virus strains (H1N1 and H3N2) were isolated for diagnostic purposes from patient nasopharyngeal swab specimens by using MDCK cells at the Nagasaki Prefectural Institute for Environmental Research and Public Health. Seven of these strains were of the H1N1 subtype and six were of the H3N2 subtype (Table 2). Prototype laboratory strains of type B influenza virus B/Lee/40 (GenBank accession number DQ792897) were also used. Eleven other respiratory viruses

3 730 KUBO ET AL. J. CLIN. MICROBIOL. TABLE 2. Subtype, strain identification, and year of isolation of the influenza viruses used in this study Virus subtype Strain Yr of isolation Pandemic (H1N1) 2009 A/Nagasaki/I01/2009v T T 2009 A/H1N1 A/Nagasaki/49/ A/Nagasaki/50/ A/Nagasaki/3/ A/Nagasaki/4/ A/Nagasaki/5/ A/Nagasaki/6/ A/Nagasaki/7/ A/H3N2 A/Nagasaki/12/ A/Nagasaki/3/ A/Nagasaki/50/ A/Nagasaki/51/ A/Nagasaki/52/ A/Nagasaki/53/ Type B B/Lee/ (adenovirus types 1 and 5; respiratory syncytial virus; echovirus types 4 and 6; rhinovirus type 2; human metapneumovirus; parainfluenza virus types 1, 2, 3, and 4), which were kept at the Virus Research Center, Clinical Research Division, Sendai Medical Center, Japan, were used to investigate cross-reactivity with the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay primers. RNA extraction. Genomic viral RNA was extracted from 140 l of infected culture supernatant and patient nasopharyngeal swab specimens with a QIAamp viral RNA minikit (Qiagen, Hilden, Germany), according to the manufacturer s protocol. The RNA was eluted in a final volume of 60 l of AVE buffer and was stored at 80 C until further use. The RNA concentration (ng/ l) was measured with a NanoDrop ND-1000 apparatus (Thermo Scientific). Clinical samples. In total, 260 samples of RNA extracted directly from clinical specimens were used in this study. These RNA samples were classified into three categories: (i) two RNA samples (samples 6/24-1 and 6/24-2) were extracted from pandemic (H1N1) 2009 virus-infected patients for diagnostic purposes at the Nagasaki Prefectural Institute for Environmental Research and Public Health. (ii) One hundred eight RNA samples were extracted from suspected influenza cases and tested at the influenza reference laboratory in Hanoi, Vietnam. Eight of them (samples I, 31844, 31847, 31854, 31865, 31887, 31888, and 31890) were previously found to be positive for pandemic (H1N1) 2009 virus RNA by the real-time RT-PCR method (16). The other 100 RNA samples were found to be negative for pandemic (H1N1) 2009 virus; 40 of them tested positive for H3 by conventional RT-PCR (forward primer AAGCATTCCYAATGACA AACC, reverse primer ATTGCRCCRAATATGCCTCTAGT), 10 of them tested positive for influenza B virus, and the other 50 tested negative for influenza virus RNA by conventional RT-PCR in Vietnam. (iii) One hundred fifty RNA samples (samples INF001 to INF150) were extracted at the Department of Virology, Institute of Tropical Medicine, Nagasaki University, directly from the clinical specimens collected from 144 suspected influenza cases (age range, 7 months to 73 years; mean age standard deviation [SD], years; 35.4% females) for diagnostic purposes by the Isahaya, Omura, and Nanko Medical Associations, Nagasaki, Japan, between 28 July and 8 September Specimens were taken at two different time points from four patients and three different time points from one patient. One hundred forty-nine of those specimens were nasopharyngeal swab specimens and one was a cerebrospinal fluid specimen. Among those RNA samples, 129 samples (86%) collected from 127 individuals (age range, 7 months to 73 years; mean age SD, years; 34.6% females) were found to be positive for pandemic (H1N1) 2009 virus and 21 (14%) were negative for influenza A virus by the TaqMan rrt-pcr. RT-LAMP assay. The RT-LAMP assay was carried out in a final reaction volume of 25 l with a Loopamp RNA amplification kit (Eiken Chemical Co., Ltd. Tokyo, Japan; with 5 pmol each of primers F3 and B3, 20 pmol each of primers LF and LB, and 40 pmol each of primers FIP and BIP, as described previously (9). Both of the FIP and BIP inner primers were of purified HPLC grade. All the RT-LAMP assay reactions were conducted at 60 C for 60 min and were then inactivated at 80 C for 5 min. The RT-LAMP assay reactions were conducted with either a LA-320C Loopamp real-time turbidimeter (Teramecs, Japan), a heating block (dry thermo unit DTU-2B; TAITEC, Japan), or a water bath (Ex Thermo Minder; TAITEC). One microliter of the extracted RNA was used as the template in each reaction mixture. A positive control (a sample known to be positive for the template) and a negative control (a sample to which no template was added) were included in each run. Real-time RT-PCR. The TaqMan real-time RT-PCR was done as described in the CDC protocol for real-time RT-PCR detection of influenza A(H1N1) virus (22); and the InfA, SW InfA, SW H1, and RNaseP primer/probe sets were used. In this study, the rrt-pcr assay was performed with an Applied Biosystems 7500 real-time PCR system and a QuantiTect Probe RT-PCR kit (Qiagen), according to the manufacturers instructions. One microliter of the extracted RNA was used as the template in each reaction mixture. A sample whose growth curve crossed the threshold line within 40 cycles (i.e., the threshold cycle [C T ] was 40) was considered positive. In vitro transcription and quantification. To obtain a quantitative RNA standard with which to check the detection limit of the RT-LAMP and rrt-pcr assays, an amplicon which had both target regions of the HA gene for the RT-LAMP and rrt-pcr assays was generated and cloned into a plasmid vector. In brief, viral genomic RNA of the A/Nagasaki/I01/2009(H1N1) virus was reverse transcribed with a Transcriptor high-fidelity cdna synthesis kit (Roche, Germany) and random hexamer primers. The target region of the HA gene was amplified by PCR with TaKaRa LA Taq polymerase (Takara, Japan) and WHO/ CDC sequence primers (26) HA351 and HA1204 (primer HA351, TGTAAAA CGACGGCCAGTACRTGTTACCCWGGRGATTTCA; primer HA1204, CA GGAAACAGCTATGACCTCTTTACCYACTRCTGTGAA). The 961-bp amplicon was then purified with a DNA gel extraction kit (Millipore) and was cloned into the pcr2.1-topo vector with a TOPO TA cloning kit (Invitrogen), according to the manufacturer s instruction. The standard control plasmid with an insert in the correct direction was confirmed by sequencing with primer T7 (TAATACGACTCACTATAGGG). The plasmid, which was confirmed to contain the correct sequence, was linearized with vector-specific restriction enzyme BamHI (Takara, Japan) and was purified with a MinElute PCR purification kit (Qiagen). The concentration (ng/ l) of the linearized plasmid preparation was determined by measuring the optical density (OD) at 260 nm with the NanoDrop ND-1000 apparatus (Thermo Scientific). The numbers of copies/ l were determined by using the following formula: concentration of plasmid (g per l)/ [(plasmid length 660) ( )], where the plasmid length is 4,890 bp. The linearized plasmids were then transcribed in vitro with an in vitro transcription kit (T7; Takara) and digested with DNase I, according to the manufacturer s protocol. The RNA was purified with an RNeasy minikit (Qiagen). The target RNA copy number was calculated, and serial dilutions ranging from 10 0 to 10 4 RNA copies were used to determine the range of quantification. Analysis of RT-LAMP product. (i) Real-time monitoring. A real-time turbidimeter was used to monitor the accumulation of magnesium pyrophosphate spectrophotometrically at 650 nm, as described previously (9). The cutoff value for positive samples was determined when the turbidity increased above the threshold value, which was fixed at 0.1 over time (time of positivity [T p ], in min). The results were analyzed by use of the LA-320C software package (Teramecs). (ii) Agarose gel analysis. Following amplification, 4 l of the RT-LAMP assay product was electrophoresed on a 2% NuSieve 3:1 agarose gel (Biowhittaker Molecular Applications, Rockland, ME) in Tris-acetate-EDTA (TAE) buffer, followed by staining with ethidium bromide and visualization on a UV transilluminator at 302 nm. (iii) Visualization with the naked eye and by UV irradiation. The reaction tubes were pulse centrifuged to deposit the magnesium pyrophosphate on the bottom of the tube to detect amplification with the naked eye. Alternatively, 1 l of Loopamp fluorescent detection reagent (FD; Eiken Chemical Co., Ltd., Tokyo, Japan) was added to the RT-LAMP assay reaction mixture. For a positive reaction, a change in the color of the reaction solution from orange to fluorescent yellow could be recognized under UV irradiation. (iv) Restriction enzyme digestion and DNA sequencing. The specificity of the product amplified by the RT-LAMP assay was confirmed by restriction enzyme digestion with a single restriction enzyme with a cutting site at the target sequence, which lies between F2 and B2. On the basis of the profiles of the target HA sequences obtained by restriction enzyme digestion, HindIII (Takara) was used to detect the pandemic (H1N1) 2009 virus-specific RT-LAMP assay product. Following digestion at 37 C for 1 h, the digested products were analyzed by agarose gel electrophoresis, as described above. In addition, the product of the

4 VOL. 48, 2010 RT-LAMP FOR DETECTION OF PANDEMIC (H1N1) 2009 VIRUS 731 Downloaded from FIG. 1. Real-time kinetics of pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay (A) and TaqMan rrt-pcr with the SW H1 primer/probe set (B) performed in quadruplicate with 10-fold serial dilutions (from 10 0 to 10 4 copies) of in vitro-transcribed target RNA. RNA from all samples with more than 100 copies of the target RNA per reaction volume was amplified by both assays. Both assays showed the same detection limit, as RNA could be amplified from two of the four samples with 10 RNA copies per reaction volume. RNA from none of the samples with one RNA copy per reaction volume was amplified. on May 2, 2018 by guest pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay was sequenced with loop primers LF and LB. RESULTS Design of influenza virus subtype-specific RT-LAMP assay primers. The pandemic (H1N1) 2009 virus HA-specific RT- LAMP assay primers were designed on the basis of the of the alignments of the conserved sequence of the HA genes from 333 strains of pandemic (H1N1) 2009 virus listed in GenBank as of 15 June Among these 333 complete HA gene sequences of pandemic (H1N1) 2009 virus, 12 had only 1 mismatched nucleotide sequence, which occurred in the middle part of one of the primers, and the other 321 sequences matched the pandemic (H1N1) 2009 virus HA-specific RT- LAMP assay primer sequences 100%. Evaluation of pandemic (H1N1) 2009 virus HA-specific RT- LAMP assay. (i) Sensitivity and specificity of pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay. The sensitivities of the pandemic (H1N1) 2009 virus HA-specific-RT- LAMP assay and a TaqMan rrt-pcr assay performed with the SW H1 primer/probe set (22) were compared by testing 10-fold serial dilutions of in vitro-transcribed target RNA (from 10 0 to 10 4 copies) in quadruplicate (Fig. 1A and B). Both assays were equally sensitive, and the detection limit was 10 copies of target RNA per reaction volume, as RNA was amplified from two of four samples with 10 copies of target RNA

5 732 KUBO ET AL. J. CLIN. MICROBIOL. FIG. 2. (A) Real-time kinetics of pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay performed with 10 clinical specimens positive for pandemic (H1N1) 2009 virus and two pandemic (H1N1) 2009 virus-positive control RNA samples (samples 31783T and 31784T). (B) Agarose gel electrophoresis profile of pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay product (lane 1). Lane M, 100-bp DNA marker (Sigma); lane 2, pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay product digested with the HindIII restriction enzyme. (C) Direct visual detection of the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay product amplified in a 1.5-ml plastic tube after incubation at 60 C for 30 min on a heating block. Lane 1, amplification of pandemic (H1N1) 2009 virus RNA from sample in a reaction volume of 25 l; lane 2, amplification of RNA from sample in a reaction volume of 12.5 l; lane 3, no amplification of the negative control RNA in a reaction volume of 25 l. Positive amplification is indicated by the detection of a change in the color of the FD to a bright fluorescent green under UV irradiation (lanes 1 and 2), and a negative reaction showed no fluorescence (lane 3). per reaction volume. All the positive amplifications by the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay were achieved in less than 40 min (Fig. 1A and 2A). Agarose gel electrophoresis of the RT-LAMP products displayed the typical ladder-like pattern for the amplified product and products of the expected size after digestion with restriction endonuclease HindIII of 166, 197, 233, and 591 bp (Fig. 2B) (12). DNA sequencing of the pandemic (H1N1) 2009 virus HAspecific RT-LAMP assay product with loop primers also confirmed the amplification of the target gene of pandemic

6 VOL. 48, 2010 RT-LAMP FOR DETECTION OF PANDEMIC (H1N1) 2009 VIRUS 733 TABLE 3. Comparison of results of pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay and TaqMan rrt-pcr performed with 10 clinical specimens positive for pandemic (H1N1) 2009 virus and 2 pandemic (H1N1) 2009 virus-positive control RNA samples (31783T and 31784T) a Sample identifier Origin RT-LAMP assay result rrt-pcr a result Amplification T p (min) Amplification C T b 6/24-1 Japan /24-2 Japan 23.5 NT I Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam Vietnam T Vietnam T Vietnam 12.5 NT a, positive result;, negative result; NT, not tested. b The rrt-pcr was performed with the SW H1 primer/probe set. (H1N1) 2009 virus RNA (results not shown). Furthermore, the possibility of cross-reactivities with other subtypes of influenza viruses and other respiratory viruses was also investigated. The specificity of the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay was confirmed, as no amplification of any genomic viral RNA extracted from infected culture supernatants of the seasonal influenza viruses listed in Table 2 and 11 other respiratory viruses (results not shown) could be detected. (ii) Diagnostic evaluation of pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay with clinical samples. The diagnostic accuracy of the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay was evaluated with 260 RNA samples extracted from clinical specimens from patients in Japan and Vietnam. The RT-LAMP assay amplification results for 10 clinical samples are shown in Fig. 2A and are compared with the results obtained by the TaqMan rrt-pcr assay with the SW H1 primer/probe set (22) in Table 3. RNA sample tested positive by the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay but tested negative by rrt-pcr with the SW H1 primer/probe set. Twelve samples, including RNA sample 31888, tested negative by rrt-pcr with the SW H1 primer/ probe set but positive by rrt-pcr with the InfA, SW InfA, and RNaseP primers/probes. Those samples were considered pandemic (H1N1) 2009 virus positive (results not shown). The TaqMan rrt-pcr assay with the InfA and SW InfA primer/ probe set was 10 times more sensitive than the rrt-pcr assay with the SW H1 primer/probe set (results not shown). Among the 260 RNA samples, 139 (53.5%) were positive for pandemic (H1N1) 2009 virus and 121 (46.5%) by TaqMan rrt-pcr were negative (Table 4). One hundred thirty-six (97.8%) of the rrt-pcr-positive samples were amplified by the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay (Table 4). Three rrt-pcr-positive samples were not amplified by the RT-LAMP assay. All positive amplifications by the RT-LAMP assay were achieved in less than 40 min, and positive amplifications were obtained for 129 (94.9%) of them within 30 min (results not shown). None of the 121 rrt-pcr-negative RNA samples was amplified by the pandemic (H1N1) 2009 virus Result TABLE 4. Comparative analysis of all clinical samples for pandemic (H1N1) 2009 virus positivity by RT-LAMP assay and TaqMan rrt-pcr RT-LAMP assay HA-specific RT-LAMP assay (Table 4). Among those RNA samples, nonspecific amplification was observed for five samples (1.9%), for which the T p values were greater than 40 min (T p s 47, 48, 48.8, 52, and 56, respectively). The nonspecificities of the amplified products were confirmed by gel electrophoresis and HindIII digestion (results not shown). The nonspecific amplification for these five samples was not reproduced when the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay was repeated (results not shown). Nonspecific amplification could easily be distinguished by considering the T p and analysis of the judgment curve for the specimen produced by the analysis software. No amplification for most of the pandemic (H1N1) 2009 virus-negative RNA samples also confirmed the specificity of the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay. A T p cutoff value of 40 min was set as the cutoff for a positive result by the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay reaction. The sensitivity and the specificity of the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay, determined by comparison with the results of the rrt-pcr method, were 97.8% and 100%, respectively. The FD reagent was also used for the detection of amplification of pandemic (H1N1) 2009 RNA from clinical specimens (Fig. 2C). The pandemic (H1N1) 2009 virus HA-specific RT- LAMP assay reaction was conducted in 1.5-ml plastic tubes, and the tubes were incubated at 60 C for 60 min with a heating block. With UV irradiation, positive samples had a deep green fluorescence, whereas negative samples showed no fluorescence. Positive amplification could be observed by use of half of the reaction volume of 12.5 l (Fig. 2C). The same results were obtained by incubation with a water bath (results not shown). DISCUSSION No. (%) of samples a TaqMan rrt-pcr Positive 136 (52.3) 139 (53.5) Negative 124 (47.7) 121 (46.5) a The numbers in parentheses indicate the percent positivity and negativity of the total of 260 samples analyzed in this study. The further expansive spread of pandemic influenza virus globally has resulted in an increased international demand for rapid, accurate, and sensitive molecular tools for the diagnosis of pandemic influenza virus infection. Although an array of molecular techniques for use for the molecular detection of pandemic influenza virus has recently been reported, most of them seem to be difficult to conduct on a regular basis in resource-limited settings in developing countries because they require highly specialized equipment. The study described here investigated the utility of a onestep RT-LAMP assay for the rapid and accurate detection of pandemic (H1N1) 2009 virus RNA in clinical specimens. The sensitivity and the specificity of the pandemic (H1N1) 2009

7 734 KUBO ET AL. J. CLIN. MICROBIOL. virus HA-specific RT-LAMP assay, determined by comparison with the results of the rrt-pcr method, were 97.8% and 100%, respectively. The sensitivities of the pandemic (H1N1) 2009 virus HA-specific RT-LAMP and rrt-pcr assays were similar. There was no cross-reactivity with other subtypes of influenza virus. The amplification of virus RNA from all pandemic (H1N1) 2009 virus-positive specimens tested in this study could be detected in less than 40 min. Among the 139 rrt-pcr-positive RNA samples, RNA was not amplified from 3 (2.2%) samples by the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay. These 3 samples were among 12 RNA samples which tested negative by rrt-pcr with the SW H1 primer/probe set but positive by rrt-pcr with the InfA, SW InfA, and RNaseP primers/probes (results not shown). Because the pandemic (H1N1) 2009 virus HAspecific RT-LAMP assay targets only the HA gene, this RT- LAMP method has difficulty with the detection of pandemic (H1N1) 2009 viruses which have HA genes that are difficult to amplify even by rrt-pcr. This may be a limitation of the pandemic (H1N1) 2009 virus HA-specific RT-LAMP method. This limitation could be overcome by combining the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay with conventional RT-PCR for the matrix gene of influenza A virus (23) or by designing influenza A virus consensus RT-LAMP assay primers and performing the two RT-LAMP assays together. Nine RNA samples tested negative by the rrt-pcr with the SW H1 primer/probe set but positive by the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay. This may indicate that the pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay is slightly more sensitive than the rrt-pcr for the detection of the pandemic (H1N1) 2009 virus HA gene in specimens with very low viral titers. Including the time required for RNA extraction from the clinical specimens, the detection of pandemic (H1N1) 2009 virus RNA in clinical specimens could be achieved within less than 1.5 h. In addition to the accuracy and the speed of detection, the RT-LAMP assay utilizes simple and relatively inexpensive equipment and only basic skills in molecular biology are required to perform the assay. Interpretation of the results can be as simple as visual evaluation of the reaction mixture for a color change. The pandemic (H1N1) 2009 virus HA-specific RT-LAMP can be economical, as it can be conducted even in an ordinary 1.5-ml plastic tube with a half volume (12.5 l) of the reaction solution and a heating block or a water bath, as shown in this study. These characteristics render this method promising for use in less well equipped laboratories in developing countries and/or in mobile laboratories during outbreaks in remote areas. In conclusion, a pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay was developed and validated for use for the detection of pandemic (H1N1) 2009 virus RNA in clinical specimens with high a sensitivity and a high specificity. The pandemic (H1N1) 2009 virus HA-specific RT-LAMP assay is a novel molecular diagnostic method for the diagnosis of pandemic (H1N1) 2009 infection. This rapid, accurate, and feasible assay has the potential to enable routine molecular diagnoses of pandemic (H1N1) 2009 virus infections to be made in resource-limited laboratories in developing countries. In addition, there is the possibility that this method may be utilized not only in basic microbiology laboratories in resource-limited settings but also in various clinical settings, for example, as a routine test in more well equipped clinical diagnostic laboratories in developed countries, in emergency departments for patient triage, in hospital wards for infection control, and at international borders for use for determination of the need for implementation of quarantine measures. We hope that this new test method will contribute to the control of pandemic (H1N1) 2009 virus infection and minimize the impact of the influenza pandemic. ACKNOWLEDGMENTS We are grateful for the financial support for the study from the Global COE Program and the Program of Founding Research Centers for Emerging and Reemerging Infectious Diseases, MEXT, Japan. We thank S. Inoue for his continuous support. We thank all the laboratory staff of the Influenza Reference Laboratory at the National Institute of Hygiene and Epidemiology, Vietnam. We thank M. Moriuchi and H. Moriuchi for providing viruses. We thank Y. Ono, A. Tomonaga, and K. Izumikawa for providing clinical samples. We declare that we have no potential conflicts of interest relevant to this article. None of the primers listed in this article are patented. REFERENCES 1. Anonymous Swine influenza A (H1N1) infection in two children Southern California, March April MMWR Morb. Mortal. Wkly. Rep. 58: Carr, M. J., R. Gunson, A. Maclean, S. Coughlan, M. Fitzgerald, M. Scully, B. O Herlihy, J. Ryan, D. O Flanagan, J. Connell, W. F. Carman, and W. W. Hall Development of a real-time RT-PCR for the detection of swinelineage influenza A (H1N1) virus infections. J. Clin. Virol. 45: Chan, K. H., S. T. Lai, L. L. Poon, Y. Guan, K. Y. Yuen, and J. S. Peiris Analytical sensitivity of rapid influenza antigen detection tests for swine-origin influenza virus (H1N1). J. Clin. Virol. 45: Dawood, F. S., S. Jain, L. Finelli, M. W. Shaw, S. Lindstrom, R. J. Garten, L. V. Gubareva, X. Xu, C. B. Bridges, and T. M. Uyeki Emergence of a novel swine-origin influenza A (H1N1) virus in humans. N. Engl. J. Med. 360: Faix, D. J., S. S. Sherman, and S. H. Waterman Rapid-test sensitivity for novel swine-origin influenza A (H1N1) virus in humans. N. Engl. J. Med. 361: Ferguson, N. M., D. A. Cummings, C. Fraser, J. C. Cajka, P. C. Cooley, and D. S. Burke Strategies for mitigating an influenza pandemic. Nature 442: Garten, R. J., C. T. Davis, C. A. Russell, B. Shu, S. Lindstrom, A. Balish, W. M. Sessions, X. Xu, E. Skepner, V. Deyde, M. Okomo-Adhiambo, L. Gubareva, J. Barnes, C. B. Smith, S. L. Emery, M. J. Hillman, P. Rivailler, J. Smagala, M. de Graaf, D. F. Burke, R. A. Fouchier, C. Pappas, C. M. Alpuche-Aranda, H. Lopez-Gatell, H. Olivera, I. Lopez, C. A. Myers, D. Faix, P. J. Blair, C. Yu, K. M. Keene, P. D. Dotson, Jr., D. Boxrud, A. R. Sambol, S. H. Abid, K. St. George, T. Bannerman, A. L. Moore, D. J. Stringer, P. Blevins, G. J. Demmler-Harrison, M. Ginsberg, P. Kriner, S. Waterman, S. Smole, H. F. Guevara, E. A. Belongia, P. A. Clark, S. T. Beatrice, R. Donis, J. Katz, L. Finelli, C. B. Bridges, M. Shaw, D. B. Jernigan, T. M. Uyeki, D. J. Smith, A. I. Klimov, and N. J. Cox Antigenic and genetic characteristics of swine-origin 2009 A(H1N1) influenza viruses circulating in humans. Science 325: Han, E. T., R. Watanabe, J. Sattabongkot, B. Khuntirat, J. Sirichaisinthop, H. Iriko, L. Jin, S. Takeo, and T. Tsuboi Detection of four Plasmodium species by genus- and species-specific loop-mediated isothermal amplification for clinical diagnosis. J. Clin. Microbiol. 45: Le Roux, C. A., T. Kubo, A. A. Grobbelaar, P. J. van Vuren, J. Weyer, L. H. Nel, R. Swanepoel, K. Morita, and J. T. Paweska Development and evaluation of a real-time reverse transcription-loop-mediated isothermal amplification assay for rapid detection of Rift Valley fever virus in clinical specimens. J. Clin. Microbiol. 47: Mori, Y., and T. Notomi Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases. J. Infect. Chemother. 15: Murray, C. J., A. D. Lopez, B. Chin, D. Feehan, and K. H. Hill Estimation of potential global pandemic influenza mortality on the basis of vital registry data from the pandemic: a quantitative analysis. Lancet 368: Notomi, T., H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino, and T. Hase Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:E Parida, M., G. Posadas, S. Inoue, F. Hasebe, and K. Morita Real-time

8 VOL. 48, 2010 RT-LAMP FOR DETECTION OF PANDEMIC (H1N1) 2009 VIRUS 735 reverse transcription loop-mediated isothermal amplification for rapid detection of West Nile virus. J. Clin. Microbiol. 42: Parida, M. M., S. R. Santhosh, P. K. Dash, N. K. Tripathi, P. Saxena, S. Ambuj, A. K. Sahni, P. V. Lakshmana Rao, and K. Morita Development and evaluation of reverse transcription-loop-mediated isothermal amplification assay for rapid and real-time detection of Japanese encephalitis virus. J. Clin. Microbiol. 44: Poon, L. L., K. H. Chan, G. J. Smith, C. S. Leung, Y. Guan, K. Y. Yuen, and J. S. Peiris Molecular detection of a novel human influenza (H1N1) of pandemic potential by conventional and real-time quantitative RT-PCR assays. Clin. Chem. 55: Shinde, V., C. B. Bridges, T. M. Uyeki, B. Shu, A. Balish, X. Xu, S. Lindstrom, L. V. Gubareva, V. Deyde, R. J. Garten, M. Harris, S. Gerber, S. Vagasky, F. Smith, N. Pascoe, K. Martin, D. Dufficy, K. Ritger, C. Conover, P. Quinlisk, A. Klimov, J. S. Bresee, and L. Finelli Triple-reassortant swine influenza A (H1) in humans in the United States, N. Engl. J. Med. 360: Smith, G. J., D. Vijaykrishna, J. Bahl, S. J. Lycett, M. Worobey, O. G. Pybus, S. K. Ma, C. L. Cheung, J. Raghwani, S. Bhatt, J. S. Peiris, Y. Guan, and A. Rambaut Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A epidemic. Nature 459: Tomita, N., Y. Mori, H. Kanda, and T. Notomi Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 3: Wang, R., Z. M. Sheng, and J. K. Taubenberger Detection of novel (swine origin) H1N1 influenza A virus by quantitative real-time reverse transcription-pcr. J. Clin. Microbiol. 47: Whiley, D. M., S. Bialasiewicz, C. Bletchly, C. E. Faux, B. Harrower, A. R. Gould, S. B. Lambert, G. R. Nimmo, M. D. Nissen, and T. P. Sloots Detection of novel influenza A(H1N1) virus by real-time RT-PCR. J. Clin. Virol. 45: Yamazaki, W., K. Seto, M. Taguchi, M. Ishibashi, and K. Inoue Sensitive and rapid detection of cholera toxin-producing Vibrio cholerae using a loop-mediated isothermal amplification. BMC Microbiol. 8: WHO. 30 April 2009, posting date. CDC protocol of realtime RTPCR for influenza A(H1N1). WHO, Geneva, Switzerland. /publications/swineflu/cdcrealtimertpcr_swineh1assay-2009_ pdf. 23. WHO. 21 May 2009, posting date. WHO information for laboratory diagnosis of new influenza A (H1N1) virus in humans. WHO, Geneva, Switzerland. _RecommendationsH1N1_ pdf. 24. WHO. 11 June 2009, posting date. World now at the start of 2009 influenza pandemic. WHO, Geneva, Switzerland. /news/statements/2009/h1n1_pandemic_phase6_ /en/index.html. 25. WHO. 6 July 2009, posting date. Pandemic (H1N1) 2009 update 58. WHO, Geneva, Switzerland. http: // 26. WHO. 12 May 2009, posting date. Sequencing primers and protocol. WHO, Geneva, Switzerland. /GenomePrimers_ pdf. Downloaded from on May 2, 2018 by guest