IDENTIFICATION AND GENETIC ANALYSIS OF PANAMA-GENOTYPE VENEZUELAN EQUINE ENCEPHALITIS VIRUS SUBTYPE ID IN PERU

Transcription

1 Am. J. Trop. Med. Hyg., 58(1), 1998, pp Copyright 1998 by The American Society of Tropical Medicine and Hygiene ENTIFATION AND GENET ANALYSIS OF PANAMA-GENOTYPE VENEZUELAN EQUINE ENCEPHALITIS VIRUS SUBTYPE IN PERU M. STEVEN OBERSTE, SCOTT C. WEAVER, DOUGLAS M. WATTS, AND JONATHAN F. SMITH Virology Division, U.S. Army Medical Research Institute of Infectious Diseases, Fort Detrick, Frederick, Maryland; Center for Tropical Diseases and Department of Pathology, University of Texas Medical Branch, Galveston, Texas; U.S. Naval Medical Research Institute Detachment, Lima, Peru Abstract. Venezuelan equine encephalitis (VEE) virus was isolated in,, and from human cases of acute, undifferentiated, febrile illness in the Peruvian Amazon Basin. Two virus isolates were recovered in from Peruvian soldiers at a jungle outpost near Pantoja in northern Peru, and 10 isolates were obtained from military personnel and civilians in in Iquitos, an urban center in northeastern Peru. The genetic relationship of these isolates to other VEE virus strains was determined by sequencing nucleotide reverse transcription polymerase chain reaction fragments derived from the PE2 glycoprotein gene. The sequences were compared with those of other VEE virus strains, including representatives of the IAB,,, IE, II, and II subtypes. The two Pantoja isolates were most closely related to subtype and viruses previously isolated in Colombia and Venezuela, and to the viruses isolated during the 1970s in Iquitos. All of the recent Iquitos isolates were similar to one another, but they were more closely related to Panamanian strains than to isolates previously obtained in Iquitos, Peru, or in Colombia and Venezuela. The recent Iquitos VEE viral isolates were the first Panama-genotype VEE virus strains identified outside of the Republic of Panama. Venezuelan equine encephalitis (VEE) virus subtype IAB was the cause of equine epizootics and epidemic human disease along the Peruvian coastal plains in the 1940s, 1950s, 1969, and , 2 The irregular occurrence of VEE virus epizootics in the mostly dry coastal plains of Peru, coupled with serologic evidence of VEE viral infection among equine and human populations in the Amazon region of Peru, 3 led to speculation that the coastal epizootics were caused by viruses introduced from the Amazon region by infected humans and/or animals. 4, 5 Ecologic surveys aimed at finding the source of the epizootic virus were conducted in the Peruvian Amazon basin in 1970 and 1975 and yielded 11 VEE virus isolates from mosquitoes and sentinel hamsters in Quistococha, near the city of Iquitos. 4, 5 Venezuelan equine encephalitis virus was not isolated at two other sites near Iquitos nor at sites near Pucallpa, Yurimaguas, or Imacita. 4, 5 Ten of the Quistococha isolates were shown to belong to subtype 5, 6 and the other virus remains the only known isolate of subtype II. 6, 7 The VEE virus strains isolated near Iquitos in 1970 and 1975 were serologically similar to those found in Panama, Venezuela, and Colombia. 4, 5 These isolates are serologically and genetically distinguishable from those of Ecuador and the Pacific coast of Colombia (near Tumaco) using monoclonal antibodies 8 or ribonuclease fingerprinting, 9 respectively. Panama isolates can be differentiated from the Colombia-Venezuela strains only by nucleotide sequencing and phylogenetic analysis. 10 In addition, Colombia-Venezuela strains are phylogenetically related to the epizootic subtype strains that have been isolated in Colombia and Venezuela Several VEE virus strains have caused human disease in Panama, Colombia, Venezuela, and Ecuador Serologic surveys conducted in 1965, 1970,, and 1975 showed evidence of VEE infection of humans in the Peruvian Amazon basin, 3 5, 16 but no isolates were made from humans and the subtype of the infecting virus was not determined. In, VEE virus was first associated with human disease in the Amazon region of Peru. 17, 18 The VEE virus 41 isolates were obtained from the sera of two patients near Pantoja in, 17 and from 10 patients in and around the city of Iquitos in. 18 One isolate from each of the outbreaks was serologically identified as belonging to subtype (Colombia-Venezuela-Panama serologic group) on the basis of a monoclonal antibody ELISA. 17, 18 Limited nucleotide sequence analysis suggested that the Pantoja isolates belonged to the Colombia-Venezuela genotypic group, whereas the Iquitos isolates were of the Panama genotype. The detailed phylogenetic analysis of all known Peruvian enzootic VEE isolates, with comparisons to Panama- and Colombia-Venezuela-genotype VEE virus isolates is reported here. These analyses show that the two Pantoja isolates, as well as the 1970s Iquitos VEE subtype virus isolates, belong to the Colombia-Venezuela / genotypic group. In contrast, the Iquitos VEE virus isolates belonged to the Panama genotypic group. These results, coupled with previous analyses of other strains, 10, 11 demonstrated for the first time the presence of Panama-genotype strains outside of the Republic of Panama, and suggested that the Panama genotype may have been recently introduced into Peru. MATERIALS AND METHODS Viruses and nucleotide sequencing. The VEE virus isolates used in phylogenetic analyses are listed in Table 1. The isolation of viruses from clinical specimens in Pantoja and Iquitos has been described in detail elsewhere. 17, 18 Viral RNA was extracted from cell-free supernatants of virus-infected Vero cells using Trizol-LS (Life Technologies, Inc., Gaithersburg, MD) by the manufacturer s recommended procedure. Reverse transcription (RT) and the polymerase chain reaction (PCR) were performed as described previously, 19 using RT primer VEE116 (TACACCCAYTTRTCRTTCTG, nucleotides 9276 to 9257) or 9207 (TRCACTGGCT- GAACTGTT, nucleotides 9224 TO 9207) and PCR primers VEE130 (GAGAACTGCGAGCAATGGTCA, nucleotides 8369 to 8389) and VEE116 or 9207 to amplify a portion of

2 42 OBERSTE AND OTHERS TABLE 1 Venezuelan equine encephalitis virus strains used in phylogenetic analysis Subtype* Strain Location Code Year Host Passage History IAB IAB IAB or IE IE II II Trinidad Donkey 52/ P676 SH P. Quintero F P U D D D D D D D D143 83U434 MenaII 68U201 Fe3-47et 71D1252 DEI5191 DEI5193 IQT0988 IQT1015 IQT1026 IQT1081 IQT1085 IQT1098 IQT1101 IQT1120 IQT1724 IQT1735 Trinidad Peru Texas Venezuela Venezuela Venezuela Colombia Colombia Canito, Panama El Rincon, Panama Gamboa, Panama Juan Mina, Panama Gamboa, Panama Canito, Panama Bayano, Panama Bayano, Panama Lake Gatun, Panama Rio de Oro, Tibu, Colombia Almirante, Panama La Avellana, Guatemala Everglades, Florida Pantoja, Peru Pantoja, Peru IAB-TR43-TRD IAB-PE73-52/73 IAB-TX VE63-P676 -VE93-SH3 -VE CO /D-CO PA PA PA PA64-P.Quintero -PA PA65-F322 -PA PA PA93-93P1513 -PE70-70U1134 -PE71-71D1249 -PE71-71D1315 -PE71-71D1316 -PE71-71D1317 -PE71-71D1384 -PE71-71D1392 -PE71-71D1394 -PE75-75D143 -CO83-83U434 IE-PA62-MenaII IE-GU68-68U201 II-FL63-Fe3-47et II-PE71-71D1252 -PE94-DEI5191 -PE94-DEI5193 PE93-IQT0988 PE93-IQT1015 PE93-IQT1026 PE94-IQT1081 PE94-IQT1085 PE94-IQT1098 PE94-IQT1101 PE94-IQT1120 PE95-IQT1724 PE95-IQT Donkey Donkey Proechymys semispinosus Culex aikenii sensu lato Culex aikenii sensu lato Hamster Hamster Hamster GP1, V6, BHK1 SM2 SM1, H1,, C6/36-1, BHK2 SM1,, CEC2 CEC1, SM1 SM2, V2 SM1, SM1, V2 CEC1, CEC1, SM1, SM1, SM1, SM1, SM1, SM1, SM1, SM1, SM1, SM2, CEC1, SM4, SM4, BHK3 SM6, SM3, BHK1 * Subtype: published subtype/variety, determined by hemagglutination inhibition or ELISA. Passage: GP guinea pig; V Vero cells; BHK baby hamster kidney cells; SM suckling mouse; H horse; CEC primary chicken embryo fibroblast cells. Strain has not been typed serologically.

3 GENET ANALYSIS OF VEE VIRUS IN PERU AND PANAMA 43 the PE2 glycoprotein gene. The PCR products were purified using the Wizard PCR Preps kit (Promega Corp., Madison, WI) and sequenced directly with the PRISM dyedeoxy terminator sequencing kit and a model 373A or 377 automated sequencer (Applied Biosystems Division, Perkin Elmer, Inc., Foster City, CA). Nucleotide sequence analysis. Nucleotide sequences of Peru and Panama VEE virus isolates were aligned with one another and with other homologous VEE virus sequences determined previously 12, using the PILEUP program. 24 Phylogenetic analyses were conducted using the Phylogenetic Analysis Using Parsimony (PAUP) program 25 and the DNAPARS parsimony, NEIGHBOR neighbor-joining, and FITCH distance matrix programs implemented in the PHY- LIP package. 26 Parsimony analysis was implemented using the heuristic algorithm and both ordered (transition:transversion 4:1, based on previous alphavirus estimates ) and unordered characters, and sequences were added at random with 100 replications. Bootstrap resampling 30 was used to place confidence values on groupings within trees. The nucleotide sequences determined were submitted to the GenBank library under accession numbers U88632-U RESULTS Preliminary studies comparing partial nonstructural protein 4 (ns4) gene sequences indicated that the recently isolated VEE virus strains from resembled Panamanian strains, 18 whereas recent isolates from Pantoja, Peru, as well as a 1975 virus from Iquitos, were genetically similar to and strains from Colombia and Venezuela. 17 Sequencing and phylogenetic analyses were used to determine whether any of the Iquitos isolates obtained during the 1970s were of the Panama genotype and to analyze the genetic relationships among Peruvian and Panamanian VEE virus isolates. An nucleotide segment of the PE2 glycoprotein gene from nine Panama strains isolated between 1961 and, 10 Iquitos strains isolated in 1970,, and 1975, two Pantoja isolates from, and 10 Iquitos isolates from,, and was amplified by the reverse transcription polymerase chain reaction and sequenced. The aligned VEE virus PE2 nucleotide sequences differed by up to 6.4%, with most of the differences clustered within a region that codes for known neutralization domains; however, few of the differences resulted in amino acid changes. The partial PE2 nucleotide sequence of 31 Peruvian and Panamanian strains, including all known Peru isolates, were aligned to the homologous regions of representative IAB,,, II, and II strains. Phylogenetic trees were constructed from this alignment by the maximum parsimony, neighbor joining, and distance matrix methods. All phylogeny algorithms yielded trees with nearly identical branching patterns; differences were only found within closely related groupings of viruses from Panama or, and all trees were consistent with previously published VEE phylogenies A tree generated by parsimony analysis is shown in Figure 1. The Panama isolates clustered together, whereas the Pantoja isolates and all Iquitos isolates from the 1970s were in the Colombia-Venezuela / genotypic group. The phylogenetic trees also showed that within the Colombia-Venezuela - group, the two Pantoja isolates segregated separately from subtype viruses isolated in Venezuela and Colombia from 1992 to, indicating that the Pantoja outbreak was unrelated to these other recent outbreaks. The Colombia-Venezuela genotype, which was present in Iquitos during the 1970s, was not isolated from any of the human VEE cases in Iquitos in. However, the phylogenetic analyses indicate that Colombia-Venezuela lineage virus was present elsewhere in Peru in, in the Pantoja area, about 380 km northwest of Iquitos. DISCUSSION The VEE viruses from Panama were phylogenetically distinct from those isolated in Colombia and Venezuela. The strains isolated in in the 1970s or near Pantoja, Peru in clustered with viruses from Colombia and Venezuela, while those isolated in Iquitos in clustered within the Panama genotypic group (Figure 1). Of the nine Panama VEE virus isolates included in our analyses, two were from eastern Panama (-PA and - PA ) and seven were from central Panama, in or near the Canal Zone (Table 1). This phylogenetic grouping of the Panama viruses reflected their geographic origins in central or eastern Panama. There are no obvious barriers to arbovirus movement between central and eastern Panama. A more extensive survey of VEE virus ecology in central and eastern Panama is required to determine the factors that influence the maintenance of these distinct VEE virus populations within Panama. The recent Iquitos isolates were closely related phylogenetically to the central Panama viruses, suggesting that the new Iquitos lineage may have originated in central Panama. The presence of Colombia-Venezuela genotype virus in Iquitos in 1975 (and the apparent absence of the Panama genotype at that time, despite intensive surveillance efforts) suggests that the Panama genotype may have arrived in Iquitos after Analysis of additional isolates from both Panama and Peru would be useful to substantiate these hypotheses; however, Panama isolates were not available from the periods , , and , and there was no reported surveillance for VEE in Peru from 1976 to There are several possible explanations for the apparent disappearance of the Colombia-Venezuela VEE virus from Iquitos. The design of the current surveillance study 18 may have biased virus isolations in favor of those strains that occur in highly populated areas of Iquitos, so that Colombia-Venezuela genotype strains in enzootic foci outside the main areas of human activity would have gone undetected. However, there were no obvious geographic correlates among the patients from whom the VEE viruses were isolated, and several of them lived within a few kilometers of Quistococha, the site of virus isolation from mosquitoes and sentinel hamsters in the 1970s. 4, 5 This suggests that the Colombia-Venezuela genotype may no longer exist in Iquitos. We consider it unlikely that all 10 of the 1970s isolates would be of one genotype and all 10 of the 1990s isolates of another genotype, simply due to sampling bias. Colombia-Venezuela genotype VEE virus was recently isolated from febrile human patients near Pantoja,

4 44 OBERSTE AND OTHERS FIGURE 1. Phylogenetic tree depicting evolutionary relationships among Venezuelan equine encephalitis virus sequences. Numbers indicate bootstrap values for groupings to the right. Peru, approximately 380 km northwest of Iquitos. 17 Therefore, it is also unlikely that Colombia-Venezuela genotype strains in Peru are less virulent in humans than are the Panama-genotype strains, and therefore not detected in the current surveillance program. If the Colombia-Venezuela and Panama genotypes both existed in Iquitos when Scherer and others 4, 5 conducted their original studies, then the apparent disappearance of the Colombia-Venezuela genotype from Iquitos may indicate that ecologic or other factors have caused a shift in the dominant VEE virus genotype. The Colombia-Venezuela genotype, if it still exists in Iquitos, must then represent a very minor population since 10 of 10 isolates from patients sampled over a 22-month period were all of the Panama genotype. Since enzootic VEE viruses tend to be maintained in small, geographically restricted foci, genetic drift could possibly play a major role in their population dynamics. The complex series of infection and transmission events required for arbovirus maintenance may also lead to frequent local extinction events. 31 In such a restricted population, relatively minor disturbances in the local ecology, such as clearing a small section of forest, may have eliminated a genetically unique population in one catastrophic event. The third and most likely explanation is that the Panama genotype arrived in Iquitos some time after Rapid movement of epizootic VEE virus strains has been well documented, but the enzootic strains tend to remain within a relatively limited range. 2 In addition to the great distance between central Panama and Iquitos (approximately 900 km), there are major geographic barriers between them that could restrict the movement of viruses. These include the Darienne, a roadless, swampy region that blocks surface transportation along the Panama-Colombia border, and the northern Andes in Colombia, the lowest pass of which is approximately 2,100 2,400 meters above sea level. 4 The distance and geographic barriers make it unlikely that Panama VEE virus was brought to Iquitos after 1975 by the natural movement of infected mosquitoes or mammalian hosts,

5 GENET ANALYSIS OF VEE VIRUS IN PERU AND PANAMA 45 even over a period of several generations. Although limited VEE studies have been conducted in the region between Panama and Iquitos, there are no known Panama-genotype VEE virus isolates among strains isolated from Colombia from 1957 to Additional ecologic surveillance is needed between Panama and Iquitos, in both Colombia and Peru to determine the distribution of Panama- and Colombia-Venezuela genotype VEE viruses in the region. Several species of migratory birds are susceptible to experimental infection with VEE varieties IAB,, and IE, In some cases, viremia may reach levels sufficient for transmission to biting mosquitoes, and VEE virus has been isolated from naturally infected avian species on several occasions For at least some of these species, it is possible that an infected bird could cover the 900-km flight distance and arrive in Iquitos with sufficient virus titer to infect the local vector and initiate an enzootic cycle. Increased human activity in previously remote areas may also facilitate the rapid movement of viruses over long distances. The movement of persons and cargo between Iquitos and elsewhere in Latin America, especially by air, has increased dramatically in the last 20 years, and the involvement of air transport in the movement of VEE viruses has been previously postulated. 4 The presence of Colombia-Venezuela genotype VEE virus in Pantoja demonstrates that the Panama virus has not entirely supplanted the Colombia-Venezuela genotype in the Peruvian Amazon basin. Ecologic studies, including vector collections, reservoir host sampling, sentinel hamster studies, and additional human disease surveillance, in Iquitos and radiating outward, are needed to determine the diversity of VEE virus populations in the upper Amazon basin and to help clarify the mechanisms underlying the apparent population shift from Colombia-Venezuela to Panama genotype VEE virus in Iquitos. Acknowledgments: We thank J. Magnifico for providing Panama VEE virus isolate 93P1513 and Dr. G. Ludwig for helpful discussions during the course of this work. We are also indebted to the strain collections of the Gorgas Memorial Laboratory (Panama, Panama), the Middle America Research Unit (Balboa Heights, Panama), and that of the late Dr. W. F. Scherer (Cornell University Medical College, New York, NY). Authors addresses: M. Steven Oberste, Division of Viral and Rickettsial Diseases, Centers for Disease Control and Prevention, Mailstop G-17, 1600 Clifton Road NE, Atlanta, GA Scott C. Weaver, Center for Tropical Diseases and Department of Pathology, University of Texas Medical Branch, Galveston, TX Douglas M. Watts, U.S. Naval Medical Research Institute Detachment, Lima, Peru. Jonathan F. Smith, Virology Division, U.S. Army Medical Research Institute of Infectious Diseases, Fort Detrick, Frederick, MD REFERENCES 1. Johnson KM, Martin DH, Venezuelan equine encephalitis. Adv Vet Sci Comp Med 18: Walton TE, Grayson MA, Venezuelan equine encephalomyelitis. Monath TP, ed. The Arboviruses: Epidemiology and Ecology. Volume IV. Boca Raton, FL: CRC Press, Madalengoitia J, Flores W, Casals J, Arbovirus antibody survey on sera from residents of eastern Peru. Bol Oficina Sanit Panam 7: Scherer WF, Madenengoitia J, Flores W, Acosta M, Ecologic studies of Venezuelan encephalitis virus in Peru during Am J Epidemiol 101: Scherer WF, Madalengoitia J, Menesis O, Acosta M, Study of VE virus and isolation of SLE, EE, group C, and Guama group arboviruses in the Amazon region of Peru, Bull Pan Am Health Organ 13: Scherer WF, Anderson K, Antigenic and biologic characteristics of Venezuelan encephalitis virus strains including a possible new subtype isolated from the Amazon region of Peru in. Am J Epidemiol 101: Scherer WF, Chin J, An unusual strain of Venezuelan encephalitis virus existing sympatrically with subtype strains in a Peruvian rain forest. Am J Trop Med Hyg 32: Rico-Hesse R, Roehrig JT, Dickerman RW, Monoclonal antibodies define antigenic variation in the variety of Venezuelan equine encephalitis virus. Am J Trop Med Hyg 38: Rico-Hesse R, Roehrig JT, Trent DW, Dickerman RW, Genetic variation of Venezuelan equine encephalitis virus strains of the variety in Colombia. Am J Trop Med Hyg 38: Weaver SC, Bellew LA, Rico-Hesse R, Phylogenetic analysis of Alphaviruses in the Venezuelan equine encephalitis complex and identification of the source of epizootic viruses. Virology 191: Rico-Hesse R, Weaver SC, de Siger J, Medina G, Salas RA,. Emergence ofa new epidemic/epizootic Venezuelan equine encephalitis virus in South America. Proc Natl Acad Sci USA 92: Weaver SC, Salas R, Rico-Hesse R, Ludwig GV, Oberste MS, Boshell J, Tesh RB, Reemergence of epidemic Venezuelan equine encephalomyelitis in South America. Lancet 348: Dietz WH, Peralta PH, Johnson KM, Ten clinical cases of human infection with Venezuelan equine encephalomyelitis virus, subtype I-D. Am J Trop Med Hyg 28: Fossaert, H, Endemic behavior in Man. Venezuelan Encephalitis. Publication 243. Washington, DC: Pan American Health Organization, Gutierrez E, Monath TP, Alava AA, Uriguen BD, Arzube RM, Chamberlain RW, Epidemiologic investigations of the 1969 epidemic of Venezuelan encephalitis in Ecuador. Am J Epidemiol 102: Buckley SM, Davis JL, Madalengoitia J, Flores W, Casals J, Arbovirus antibody neutralization with Peruvian sera in Vero cell cultures. Bull World Health Organ 46: Watts DM, Lavera V, Callahan J, Cropp CB, Rossi C, Oberste MS, Karabatsos N, Roehrig JT, Smith JF, Gubler DJ, Wooster MT, Nelson W, Hayes CG, Venezuelan equine encephalitis and Oropouche viral infections among Peruvian military troops in the Amazon region of Peru. Am J Trop Med Hyg 56: Watts DM, Callahan J, Rossi C, Oberste MS, Roehrig JT, Wooster MT, Smith JF, Cropp CB, Gentrau EM, Karaoatsos N, Gubler D, Hayes CG, Venezuelan equine encephalitis febrile cases among humans in the Peruvian Amazon River basin. Am J Trop Med Hyg 58: Oberste MS, Parker MD, Smith JF, Complete sequence of Venezuelan equine encephalitis virus subtype IE reveals conserved and hypervariable domains within the C-terminus of nsp3. Virology 219: Kinney RM, Johnson BJB, Welch JB, Tsuchiya KR, Trent DW, Full-length nucleotide sequences of the virulent Trinidad donkey strain of Venezuelan equine encephalitis virus and its attenuated derivative, strain TC83. Virology 170: Kinney RM, Tsuchiya KR, Sneider JM, Trent DW, Genetic evidence that Venezuelan equine encephalitis (VEE) viruses may have evolved from enzootic VEE subtype I-D virus. Virology 191: Kinney RM, Tsuchiya KR, Sneider JM, Trent DW, Molecular evidence for the origin of the widespread Venezuelan

6 46 OBERSTE AND OTHERS equine encephalitis epizootic of J Gen Virol 73: Sneider J, Kinney R, Tsuchiya K, Trent D,. Molecular evidence that epizootic Venezuelan equine encephalitis (VEE) I-AB viruses are not evolutionary derivatives of enzootic VEE subtype I-E or II viruses. J Gen Virol 74: Devereux J. Haeberli P, Smithies O, A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 12: Swofford DL, PAUP: Phylogenetic Analysis Using Parsimony. Version 3.0. Champaign, IL: Illinois Natural History Survey. 26. Felsenstein J, PHYLIP Manual. Version 3.3. Berkeley, CA: University Herbarium, University of California. 27. Cilnis M, Kang W, Weaver SC, Genetic conservation of Highlands J viruses. Virology 218: Weaver SC, Bellew LA, Hagenoaugh A, Mallampalli V, Holland JJ, Scott TW,. Evolution of alphaviruses in the eastern equine encephalomyelitis complex. J Virol 68: Weaver SC, Scott TW, Rico-Hesse R, Molecular evolution of eastern equine encephalitis virus in North America. Virology 182: Felsenstein J, Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: Weaver SC, Rico-Hesse R, Scott TW, Genetic diversity and slow rates of evolution in New World alphaviruses. Curr Top Microbiol Immunol 176: Chamberlain RW, Kissling RE, Stamm DD, Nelson DB, Sikes RK, Venezuelan equine encephalomyelitis virus in wild birds. Am J Hyg 63: Dickerman RW, Bonacorsa CM, Scherer WF, Viremia in young herons and ibis infected with Venezuelan encephalitis virus. Am J Epidemiol 104: Dickerman RW, Martin MS, Dipaola EA, Studies of Venezuelan encephalitis in migrating birds in relation to possible transport of virus from South to Central America. Am J Trop Med Hyg 29: Dickerman RW, Scherer WF, Moorhouse AS, Toaz E, Essex ME, Steele RE, Ecologic studies of Venezuelan encephalitis virus in southeastern Mexico. VI. Infection of wild birds. Am J Trop Med Hyg 21: Sudia WD, Newhouse VF, Epidemic Venezuelan equine encephalitis in North America: a summary of virus-vector host relationships. Am J Epidemiol 101: Scherer WF, Dickerman RW, Ordonez JV, Seymour C III, Kramer LD, Jahrling PB, Powers CD, Ecologic studies of Venezuelan encephalitis virus and isolation of Nepuyo and Patois viruses during at a marsh habitat near the epicenter of the 1969 outbreak in Guatemala. Am J Trop Med Hyg 25: