GR.T.POPA IAȘI UNIVERSITY OF MEDICINE AND PHARMACY FACULTY OF DENTAL MEDICINE PHD THESIS ABSTRACT

Transcription

1 GR.T.POPA IAȘI UNIVERSITY OF MEDICINE AND PHARMACY FACULTY OF DENTAL MEDICINE PHD THESIS ABSTRACT THE ASSESSMENT OF DENTAL AND PERIODONTAL STATUS IN OSTEOPOROSIS PATIENTS Scientific Coordinator Univ. Prof. Dr. SILVIA MÂRȚU PhD Student URSĂRESCU ( ȘUFARU) IRINA-GEORGETA 0

2 IAȘI

3

4 SUMMARY Page ABBREVIATION INDEX INTRODUCTION The importance of the subject in the current context. The motivation of the research topic iii v STATE OF KNOWLEDGE Chapter I ETIOPATHOGENIC AND THERAPY ASPECTS IN PERIODONTAL IMPAIRMENT 1 I.1 The etiopathogeny of the periodontal disease 1 I.2 The classification of the periodontal forms of disease 11 I.3 Treatment methods of the periodontal disease 15 Chapter II SYSTEMIC AND PERIODONTAL CHANGES IN OSTEOPOROSIS PATIENTS 26 II.1 Osteoporosis general data 26 II.2 Osteoporosis and osteopenia: elements of physiopathology 28 II.3 Current therapies of the osteoporotic disease 33 II.4 Osteoporosis systemic risk factor for periodontal diseases 36 PERSONAL CONTRIBUTIONS Chapter III RESEARCH OBJECTIVES. MATERIAL AND METHODS 41 III.1 Research objectives 41 III.2 Materials and method 41 Chapter IV CLINIC AND PARACLINIC EVALUATION OF THE PERIODONTAL STATUS IN PATIENTS WITH PERIODONTAL DISEASE AND OSTEOPOROSIS 51 IV.1 STUDY I: The evaluation of the clinic and radiologic periodontal status in patients with 51 periodontal disease and osteoporosis IV.1.1 Introduction and aim of the study 51 IV.1.2 Materials and method 51 IV.1.3 Results 54 IV.1.4 Discussions 58 IV.1.5 Conclusions 62 IV.2 STUDY II : The quantification of TNF-α in patients with periodontal disease and 63 osteoporosis IV.2.1 Introduction and aim of the study 63 IV.2.2 Materials and method 63 IV.2.3 Results 64 IV.2.4 Discussions 67 IV.2.5 Conclusions 70 IV.3 STUDY III : The quantification of IL-1α and IL-1β in patients with periodontal disease and 71 osteoporosis IV.3.1 Introduction and aim of the study 71 IV.3.2 Materials and method 72 IV.3.3 Results 73 IV.3.4 Discussions 75 IV.3.5 Conclusions 79 Chapter V THE EVALUATION OF THE LOCAL AND SYSTEMIC THERAPY IN PATIENTS WITH PERIODONTAL DISEASE AND OSTEOPOROSIS 80 V.1 STUDY I: Study regarding the influence of hormonal substitution therapy on the periodontal 80 parameters in patients with osteoporosis V.1.1 Introduction and aim of the study 80 V.1.2 Materials and method 80 V.1.3 Results 81 1

5 V.1.4 Discussions 85 V.1.5 Conclusions 95 V.2 STUDY II: Study regarding the effects of the conventional periodontal therapy on IL-6 and 95 RANKL levels in patients with chronic periodontitis and osteoporosis V.2.1 Introduction and aim of the study 95 V.2.2 Materials and method 96 V.2.3 Results 97 V.2.4 Discussions 100 V.2.5 Conclusions 103 V.3 STUDY III: The evaluation of the inflammatory response modulation therapy in patients with 104 chronic periodontitis and osteoporosis V.3.1 Introduction and aim of the study 104 V.3.2 Materials and method 104 V.3.3 Results 105 V.3.4 Discussions 107 V.3.5 Conclusions 113 V.4 STUDY IV: Study regarding the action of methylation inhibition of DNA on the cellular 113 response to TGFβ1 in vitro V.4.1 Introduction and aim of the study 113 V.4.2 Materials and method 114 V.4.3 Results 116 V.4.4 Discussions 118 V.4.5 Conclusions 123 Chapter VI THE ORIGINALITY OF THE STUDY. CONTRIBUTIONS IN THE DEVELOPMENT OF THE FIELD 124 Chapter VII GENERAL CONCLUSIONS 126 REFERENCES 127 ANNEX 1. PUBLICATIONS 2

6 Note: The abstract of the PhD thesis presents the results of personal researches, general conclusions and selective references. The editing of the abstract respected the same countering of tables and pictures used in the PhD thesis. The PhD thesis contains 46 figures, 50 tables and 382 references. The abstract includes a limited number of tables and figures, maintaining the original numbers from the PhD thesis. KEY WORDS: Chronic periodontitis Osteoporosis Periodontal parameters Periodontal therapy Systemic therapy 3

7 4

8 PERSONAL CONTRIBUTIONS CHAPTER III. RESEARCH OBJECTIVES. MATERIALS AND METHODS III.1 The general objectives of the research The research topic is complex, proposing a clarification of the relationship between a systemic disease - osteoporosis and one local - periodontal disease, both with a chronic character. The research aims to establish a correlation between periodontal clinical parameters (index of hygiene, gingival inflammation index, probing depth, attachment loss) and systemic status (measured by bone densitometry and analysis of IL-6 and RANKL). We have proposed a thorough local evaluation of the periodontal status by clinical examination and radiographs. These assessments acquire relevance in the context of the existence of a systemic disease - osteoporosis, reported to control groups of systemically healthy patients. In order to cover the real complexity of the interrelation, the clinical evaluations were completed by laboratory tests which aimed to quantify proinflammatory molecules (TNF, IL- 1α, IL-1β, IL-6, RANKL) in gingival crevicular fluid (GCF) in patients with osteoporosis versus systemically healthy patients The sensitive issue of hormone replacement therapy was addressed by assessing differentiated periodontal status in post-menopausal women who were or not under such therapy. We also proposed an assessment of the degree of impact that non-surgical periodontal therapy generated on the destructive systemic inflammatory status, reflected by serological dosages of IL-6 and RANKL. We proposed an analysis in the context of the association of the two diseases - periodontal disease and osteoporosis of the effects generated by an adjunctive form of periodontal therapy of extreme actuality, the therapy with chemotherapeutic agents modulating the host inflammatory response. In order to complete the clinical trials, we have proposed an in vitro evaluation in cultured human fibroblasts, of the changes in cellular response to stimulation with growth factors (TGF-β1 and BCM), in the circumstance of inhibition of the methylation pathophysiological process with 5-aza-2'-deoxycitidine. III.2 Materials and Methods The study followed the rules stated in the Declaration of Helsinki and was made according to the basic principles of ethics in clinical and paraclinical research on human subjects. Patients were informed of the implications of the study; each patient's signed consent has been obtained. The study included patients with chronic periodontitis, systemically healthy or osteoporosis subjects. To avoid any risk of compromising the validity and relevance of results, exclusion criteria from the study were represented by: - Smoking - Patients with systemic infectious and/or inflammatory diseases that might compromise periodontal status, except osteoporosis - Patients who undergo periodontal therapy in the last 6 months 5

9 - Patients who undergo therapy with antibiotics or anti-inflammatory drugs in the last 3 months - Patients with bisphosphonate therapy. Each patient completed a questionnaire that included data on oral hygiene, diet, physiological status (pre / post-menopausal, for female subjects), medication history, current medication. Cases have been diagnosed with osteoporosis by specialist using clinical and radiologic examination. The diagnosis was completed by osteodensitometry which registered the T Score. Personal data included the patient's full name, gender, address, phone number, occupation, family status. The anamnesis included data presentation reasons, personal and family medical history. The extra-oral examination included: inspection (facial expressions, oral breathing, face shape, the symmetry of the face, the proportion of the floors, skin colour, formations, profile) and palpation (sinus points integrity, bone contour, palpation of the soft tissues of the face, palpation of lymph nodes, salivary glands). The periodontal examination was performed by inspection and palpation. On inspection we analyzed the following parameters: the colour of the free and attached gingiva; the surface aspect; the periodontal biotype; the evaluation of gingival recessions. Palpation in periodontal examination was performed periodontal probe. The probingwas conducted with a generation I type Williams probe and with electronic probe systems (PaOn, orangedental, GmbH & Co. KG) to provide the perio chart. Through the survey we evaluated vertical periodontal attachment loss (probing depths); this was done to each tooth individually, in six sites: disto-vestibular, centralvestibular, mesial-buccal, disto-oral, centro-oral, mesio-oral. The dimensions larger than 3mm were considered pathological on teeth without gingival recession. If gingival recession was present, the total attachment loss included size of the recession plus the probing depth. The value of gingival recession was determined by measuring the distance between the visible cement-enamel junction and the apically migrated free gingival margin. The furcation probing was performed using the probe Nabers. In this study, for quantitative and qualitative evaluation, we used the following indices: O'Leary plaque index (PI), gingival index (Loe and Silness), papillary bleeding index PBI, tooth mobility index. For cytokine dosing in the crevicular fluid (GCF = Gingival crevicular fluid), GCF was collected from representative sites (periodontal pockets deeper than 4mm) as follows: - Before sampling, the tooth was isolated with cotton rolls, supragingival plaque was removed carefully and the site was easily sprayed, in order not to dray away the GCF. - A sterile paper cone (Dentsply Maillefer, Tulsa, OK, USA) was placed in each selected periodontal pocket, left in site for 30 seconds and then placed immediately into sterile Eppendorf tubes, which were stored at -20 C until the analysis. In case of visible contamination with blood, paper cone was removed and a new site was selected. - For the determination of cytokines, the cone paper were thawed, cut into 1 cm in length and thawed in 50 pl 1X phosphate saline buffer solution [13 mm Na2HPO4, 7 mm NaHPO4, 100 mm NaCl (ph 7.0)] at 4 C. Further, the paper points were centrifuged at 13,000 x g for 10 min at 4 C. 6

10 CHAPTER IV. CLINIC AND PARACLINIC EVALUATION OF THE PERIODONTAL STATUS IN PATIENTS WITH PERIODONTAL DISEASE AND OSTEOPOROSIS IV.1 STUDY I: Study regarding the influence of hormonal substitution therapy on the periodontal parameters in patients with osteoporosis IV.1.1 Introduction and aim of the study Patients with osteoporosis are prone to changes in cortical morphology by reducing its thickness, age being an important risk factor for osteoporosis (Yasar & Akgunlu, 2006). The purpose of the study was to evaluate the radiological parameters on panoramic radiographs in patients with chronic periodontitis and osteoporosis, as well as to establish a correlation between these and bone mineral density and periodontal clinical parameters. IV.1.2 Materials and Methods The study was conducted on a group of 41 subjects, aged between 44 and 65 years, from November 2012 to March The periodontal examination and diagnosis of patients was performed according to the methodology described above. Analysis of radiographic parameters For radiographic analysis we used digital panoramic radiographs. In these determinations were carried out as follows: Mandibular cortical thickness in the mental region (GCM) Panoramic mandibular index (IMP) Degree of resorption of the alveolar crest (the M/M ratio) Classification of the mandible cortical morphology (C Classes) (Fig. IV.3, IV.4) Data were recorded and statistically analyzed. IV.1.3 Results Mean plaque index was 1.21 ± This index was closely correlated with cortical bone class C2. A positive correlation was demonstrated between this index and the average loss of attachment. Mean gingival index was 0.79 ± This index has been correlated with cortical bone of class C2 and the average loss of attachment. Mean bleeding index was 2.3 ± 0.38, also correlated with cortical bone class C2 and loss of attachment. The mean periodontal probing performed at all 41 participants in the study was 4.72 ± 1,02mm. There was no correlation between probing depth and the bone resorption index. The mean value of attachment loss was 4.35 ± 1,01mm. There was a strong positive correlation between the average loss of periodontal attachment and the cortical bone class C2. There was a negative correlation between the average loss of attachment and bone resorption index. A link between periodontal attachment loss and average plaque index, gingival index, plaque index was observed. The mean values of clinical parameters and their correlations with other variables are presented in Table IV.I. A total of 58.7% of patients had remaining teeth per arch; 27.9% of all examined patients showed up to 15 teeth and the remaining 13.4% of them-more than 30 teeth present on dental arches (Fig. IV.6). Table IV.I: Mean values of parameters and their correlations to the other variables 7

11 CLINICAL PARAMETER MEAN VALUE CORRELATION Plaque Index 1,21 ± 0,32 C2 Class; Mean attachment loss Gingival Index 0,79 ± 0,21 C2 Class; Mean attachment loss Bleeding Index 2,3 ± 0,38 C2 Class; Mean attachment loss Periodontal Probing 4,72 ±1,02mm No correlation to the bone resorption index Periodontal attachment loss 4,35 ± 1,01mm C2 Class; Plaque Index, Calculus Index, Gingival Index A total of 36.5% of patients experienced tooth loss due to periodontal lesions, 30.7% due to carious lesions and 32.8% due to associated periodontal disease and caries (Figure IV.7). Only 3.8% of all patients had dental arches integrity. Wisdom teeth were not considered in the calculation. Table IV.II Descriptive characteristics of the study group Parameter Mean Value (Standard Median (interval) Deviation ) IMP 0,38 (0,24) 0,35 (0,16-2,28) M/M Ratio 2,20 (0,44) 2,23 (0,3-3,5) GCM 4,57 (1,03) 4,9 (2,1-7,1) Absent teeth 9,91 (8,56) 8 (0-28) Lombar T Score -1,27 (1,34) -1,2 (-4 1,7) IMP: Panoramic mandibular index; M/M Ratio: Alveolar ridge resorption; GCM: Mandibular cortex thickness The mean values of IMP, cortical index, the thickness of the mandibular cortical bone and the number of absent teeth are shown in Table IV.II. The number of subjects with osteopenia or osteoporosis is shown in Table IV.III. Table IV.III DEXA Categories (Lombar T Score*) N % Normal 12 29,27% Osteopenia 19 46,34% Osteoporosis 10 24,39% *Normal:>-1; osteopenia: [-1, -2.5]; osteoporosis<-2,5 Using a threshold level of 3mm cortical thickness, only 2 patients had GCM <3mm (Table IV.IV). Table IV.IV Cortical thickness categories Value of the cortical thickness N % <3mm 3 7,31% 3mm 38 93,69% Table IV.V Characteristics comparing inside the T Score categories mean value (Standard Deviation) T Score P Value Normal >1 Osteopenia [-1, -2.5] Osteoporosis <-2,5 Age (years) 55,81 (7,71) 58,8 (8,82) 58,54 (6,27) 0,068 IMP 0,38 (0,15) 0,38 (0,23) 0,41 (0,38) 0,667 M/M Ratio 2,2 (0,5) 2,29 (0,4) 2,09 (0,33) 0,091 GCM 4,81 (0,91) 4,54 (1,1) 4,13 (1,04) 0,017 Absent teeth 9,28 (7,67) 8,88 (8,25) 12,64 (9,75) 0,256 IMP: Panoramic mandibular index; M/M Ratio: Alveolar ridge resorption; GCM: Mandibular cortex thickness Table IV.VI Effect of different characteristics in case of osteopenia/osteoporosis Report CI 95% P Value IMP 1,04 0,89-1,22 0,590 8

12 Increase of 0,10 M/M Ratio 1,147 0,50-2,65 0,747 Increase cu 1 GCM 1,43 0,98-2,08 0,061 Decrease of 1mm Absent teeth Increase of 1 0,998 0,95-1,05 0,942 IMP: Panoramic mandibular index; M/M Ratio: Alveolar ridge resorption; GCM: Mandibular cortex thickness We noticed an association between T Score and GCM value; low values of T Score were correlated with low cortical thickness (p <0.05) (Table IV.V). Table IV.VI presents the results of the logistic regression model, subjects with osteopenia and osteoporosis being included in a single category. Only cortical thickness appears to be close to the limits of statistical significance (p = 0.061). It shall be understood as follows: a 1mm decrease in the GCM increases the risk of osteopenia/osteoporosis by 43%. GCM p value was statistically significant (p = 0.033). Moreover, when morphology is class C2 or C3 (moderate and severe erosion), age is increased, GCM presents a statistically significant decrease (p <0.05) (Table IV.VII). A decrease in the GCM with a millimeter increases the likelihood of moderate to severe cortical eroded by 96% (Table IV.VIII). Regarding dental loss, an increase by one of the number of absent teeth increases the likelihood of moderate or severe erosion by 6%. Table IV.VII Characteristics comparing inside the mandibular cortical index - mean value (Standard Deviation) Mandibular cortex morphology P Value Normal Moderate/severe Age (years) 53,2 (6,97) 60,49 (7,38) <0,001 IMP 0,39 (0,17) 0,38 90,28) 0,110 M/M Ratio 2,24 (0,49) 2,18 (0,4) 0,359 GCM 4,96 (0,85) 4,29 (1,07) <0,001 Absent teeth 7,05 (6,8) 11,92 (9,13) 0,002 IMP: Panoramic mandibular index; M/M Ratio: Alveolar ridge resorption; GCM: Mandibular cortex thickness Table IV.VIII Effect of different characteristics on the mandibular index Report CI 95% P Value IMP 1,03 0,88-1,20 0,719 Increase of 0,10 M/M Ratio 0,71 0,30-1,70 0,442 Increase cu 1 GCM 1,96 1,25-3,03 0,003 Decrease of 1mm Absent teeth Increase of 1 1,06 1,009-1,12 0,021 IMP: Panoramic mandibular index; M/M Ratio: Alveolar ridge resorption; GCM: Mandibular cortex thickness V.1.4 Discussions Given that periodontal examination and oral radiographs are commonly performed procedures (Marques et al., 2003), the clinical significance for the observation of additional risk factors for osteoporosis is extremely high and can occur at status-related questions the skeletal general health. A decrease in the GCM with a millimetre increases the probability for osteopenia or osteoporosis by 43%. We have also shown that the age, the number of absent teeth and GCM have an impact on the mandibular cortical moderate and severe erosion. Moreover, when the morphological mandibular classis C2 or C3 (moderate or severe erosion), GCM is decreased to a statistically significant level. A decrease in cortical thickness of one millimetre 9

13 increases the likelihood of moderate or severe cortical erosions by 96%. Increased categories of cortical morphology (C3) are associated with low systemic skeletal density values (Halling et al., 2005). Regarding tooth loss, an unit increase leads to increased likelihood of moderate or severe erosion by 6%. It has been found that the thickness of the mandibular cortical bone may be an useful parameter to evaluate the clinical and metabolic bone loss and that a gonial thickness of less than 1 mm is an indicator of metabolic bone loss (Bras et al., 1982). Dispersing the information about preventing osteoporosis can produce a significant public effect for the implementation of appropriate ways to minimize bone mass reduction process. Of course, this study presents limitations; postmenopausal female subjects in this study were not under hormone replacement therapy and bisphosphonate therapy, both therapeutics having an influence on the maxillary bones. T he study lacks data on circulating levels of calcium and oestrogen (especially for female patients). Also, the present study is a cross-sectional study, non-interventional. The influence of the specific periodontal therapy needs further research in these particular circumstances. Also, additional research is needed to develop maxillary BMD T-score or Z score that could be used to diagnose osteoporosis of jaws, probably in a similar way to BMD available scores. IV.1.5 Conclusions This study demonstrates a strong correlation between osteoporosis and periodontal disease; the close link between local factors and attachment loss is also important. Thus, systemic osteoporosis creates favourable circumstances for the periodontal disease progression but local predisposing factors are significantly associated. The present study showed a correlation between the densitometric T Score and mandibular cortical thickness, morphological appearance of cortical (erosions) and the number of absent teeth. Therefore, OPT could be an effective and less expensive screening for osteoporosis with a significant role in this procedure for the dentist. IV.2 STUDY II: The quantification of TNF-α in patients with periodontal disease and osteoporosis IV.2.1 Introduction and aim The main mechanism by which TNF-α contributes to the development of osteoporosis is by disrupting the balance between bone resorption and bone formation (Nanes et al., 2003). Previously, blocking TNF-α was considered to be an effective method to suppress and prevent bone resorption (Cenci, 2000). Blocking TNF-α significantly stimulated the bone formation in mice. The purpose of the study was to assess the level of TNF-α in the crevicular fluid and serum of patients with osteoporosis in comparison with a control group of systemically healthy patients, showing all chronic periodontitis. IV.2.2 Materials and Methods This study was conducted on a total of 46 female subjects, who were postmenopausal. Subjects were divided into two groups: study group - patients with osteoporosis and periodontal disease (n = 24) and control group - patients with periodontal disease, 10

14 systemically healthy (n = 22). Periodontal examination and diagnosis of the patients were performed according to the methodology described above. The paraclinical stage of the study included the analysis of TNF-α levels in crevicular fluid (GCF) and serum. Figure IV.3 GCF sampling For the serum analysis, 5ml of venous blood were drawn from an antecubital vein using a blood collection tube. Blood was allowed to clot for 30 minutes on ice and centrifuged for 10 minutes at 3000 rpm prior to placing the serum in polypropylene tubes in 0.5 ml aliquots which were stored at C until the biochemical analysis. For the laboratory evaluations of GCF and serum the Enzyme-linked Immunosorbent Assay (ELISA) was conducted. The results were expressed as pg / ml and the minimum sensitivity of each assay was 1.5 <TNF <3 pg / ml. The data were recorded and statistically analyzed. IV.2.3 Results Probing depth (PD), bleeding on probing (BOP) and clinical attachment loss (CAL) were significantly higher in the study group than in the control group (p <0.05). We could not observe significant differences in terms of plaque index values between groups (Table IV.X Figures IV.11, IV.12). Table IV.X. Clinical parameters for the study groups Parameter Study Group (n=24) Control Group (n=22) PD (mm) 3.17± ±0.47 CAL (mm) 3.95± ±0.67 BOP (%) 84±11 65±35 PI (%) 88±5 89±1 The values are expressed as median ± Standard Deviation (SD) PD: probing depth; CAL: clinical attachment loss; BOP: bleeding on probing; PI: Plaque Index Table IV.XI. GCF and serum TNF-α values Parameter Study Group (n=24) TNF-α serum concentration 113.5± ±4.2 (pg/ml) TNF-α GCF level (pg) 14.6± ±1.3 TNF-α GCF concentration 25.7± ±3.5 (pg/ml) The values are expressed as median ± Standard Deviation (SD) GCF: gingival crevicular fluid Control Group (n=22) All samples showed detectable levels of TNF-α. Significant levels of elevated TNF-α were detected both in serum and GCF for the study group, compared to the control group (Table IV.XI, Figure IV.13). Serum TNF-α was positively correlated with BOP (p <0.01). There were no significant correlations between probing depth, clinical attachment loss, plaque index and 11

15 TNF-α levels. Serum levels of TNF-α have been correlated with the level of TNF-α in the crevicular fluid. IV.2.4 Discussions The role of TNF-α was investigated in numerous studies focusing on periodontal disease (Tervahartiala et al., 2001; Bostrom et al., 1999), but to our knowledge, there are no studies to assess the level of TNF-α in GCF and serum in patients with osteoporosis and periodontal disease. Proinflammatory cytokines developed in the periodontal microenvironment increase the number of osteoclasts and precursors of osteoclasts by promoting and extending the life of these cells. Oestrogen blocks bone loss by blocking the production of inflammatory cytokines in the bone marrow, bone cells, periodontal ligaments. IL-1β and TNF-α are potent promoters of bone resorption and bone synthesis inhibitors, and IL-6 promotes the differentiation of osteoclast precursors into osteoclasts, the production of MMP (McLean, 2009). TNF-α is one of the key cytokines which are factors that induce the production and secretion of other cytokines, and even a slight stimulation leads to a significantly higher expression of cytokines, such as IL-6. In our study we demonstrated significant differences between the levels of TNF-α group and the control group with osteoporosis. It may be suggested that elevated values in GCF and serum TNF-α contributes to the high number of B cells and T cells present in inflammatory periodontal tissues, enhancing periodontal tissue destruction. Crevicular fluid values were correlated with serum, clearly showing the influence that the systemic status generates on local status (in our study, periodontal). Our study was an observational study. Interventional studies would be necessary to assess the effects of periodontal therapy generated on local and systemic level. Also, further studies on other types of cytokines are necessary to establish a clearly inflammatory status in patients with osteoporosis and its effects on periodontal tissues. IV.1.5 Conclusions Patients with osteoporosis and periodontal disease had higher levels of TNF-α in the crevicular fluid and serum, compared to systemically healthy patients. Our data suggest that these patients are prone to an exaggerated production of this type of cytokine that activates B cells and also promotes B cell activity in inflammatory periodontal sites, aggravating the periodontal disease progression. IV.3 STUDY III: The quantification of IL-1α and IL-1β in patients with periodontal disease and osteoporosis IV.3.1 Introduction and aim of the study Interleukin-1 is a potent stimulator of bone resorption in vivo; interleukin-1 beta was shown to be the most potent stimulator of bone resorption in vitro. The mechanism by which interleukin-1 beta stimulates the bone resorption involves RANKL expression in osteoblasts and indirect stimulation of osteoclastogenesis (Lorenzo et al., 2008). The aim of this study was to investigate differences in levels of IL-1α and 1β in GCF in patients with chronic periodontitis, with or without associated chronic systemic pathology (in our particular case- osteoporosis). Correlation analysis was then performed with the clinical parameters of periodontal disease. 12

16 IV.3.2 Materials and Methods This study was conducted on a total of 38 female subjects, post-menopausal, divided into two groups: the study group (patients with osteoporosis and periodontal disease) (n = 20) and control group (patients periodontal disease who were systemically healthy) (n = 18). Periodontal examination and diagnosis of the patients was performed according to the methodology described above. Paraclinical stage of the study included the analysis of IL-1α levels and IL-1β in crevicular fluid (GCF). The concentrations of IL-1α and IL-1β was determined using by ELISA (Human Cytokine / Chemokine Kit MPXHCYTO 60K; Millipore Corporation, Billerica, MA, USA) in a Luminex 200 analyzer (Luminex Corporation, Austin, TX, United States of America). Statistical analysis was performed using SPSS 20.0 (IBM, Armonk, NY, USA) and P <0.05 was considered to indicate a statistically significant difference. IV.3.3 Results Probing depth (PD), bleeding on probing (BOP) and clinical attachment loss (CAL) were significantly higher in the study group than in the control group (p <0.05) (Table IV.XIII Figures IV.14, IV.15). We could not observe significant differences in terms of plaque index values between groups (Table IV.XIII, Figure IV.16). Cytokine IL-1α has been more prevalent and has been detected in all study sites (Table IV.XIV). We noted significant higher levels of interleukins for study group (patients with osteoporosis), compared to systemically healthy patients (p <0.05). Table IV.XIII Clinical parameters for the study groups Parameter Study Group (n=24) Control Group (n=22) PD (mm) 4.9± ±0.2 CAL (mm) 1.9± ±0.1 BOP (%) BOP Sites (n) PI (%) 76±2 74±1 The values are expressed as median ± Standard Deviation (SD) PD: Probing Depth; CAL: Clinical attachment loss; BOP: bleeding on probing; PI: Plaque Index Table IV.XIV Cytokine levels in GCF samples Cytokine (pg/site) Study Group (osteoporosis) Control Group P Value IL-1α 72,03 (2, ,89) 29,70(0,75-541,58) 0,001 IL-1β 0,57 (0,00-126,95) 0,09 (0,00-35,15) 0,007 GCF=gingival crevicular fluid; p<0.05 indicates statistic signification; IL=interleukin. Results are expressed as median (min-max). In order to determine the possible clinical relevance of these observations, a correlation analysis between clinical parameters and total levels of cytokines in sample sites was performed. As shown in Table IV.XV, positive correlations were observed between the IL-1α and 1β with PPD and CAL. Table IV.XV Correlation analysis between the clinical parameters (mm) and cytokine levels (pg/site) in GCF PD Correlation Q P Value CAL Correlation Q P Value IL-1α 0,386 0,002 IL-1α 0,390 0,002 IL-1β 0,437 <0,001 IL-1β 0,439 <0,001 GCF= gingival crevicular fluid; Q= Spearman correlation coefficient; p<0.05 indicates statistic signification; PD: Probing Depth; CAL: Clinical attachment loss; IL=interleukin. 13

17 IV.3.4 Discussions There is a correlation between the release of inflammatory mediators, such as IL-1, TNF-α and PGE2, and periodontal tissue destruction. These mediators are able to aggravate the inflammatory response. It has been demonstrated that the severity of periodontal disease is associated with their concentration in the crevicular fluid. Some subjects may experience a more pronounced inflammatory response to bacterial aggression; the response depends on the quality and quantity of bacterial flora, as well as on systemic factors (heredity, certain infectious / inflammatory diseases, osteoporosis etc.). Gingival fluid (GCF) is a serum exudate found in gingival sulcus (McCulloch, 1994). GCF is an attractive oral liquid due to its ease of collection and capacity for the clinician to simultaneously evaluate several sites in the oral cavity. In a molecular epidemiological study, Offenbacher et al. described new clinical categories represented by different biological phenotypes based on clinical measures, microbial and inflammatory response of the host to identify periodontal disease. Interestingly, the authors found that subjects with deeper probing depths and more severe bleeding had elevated levels of interleukin-1β (IL-1β) and interleukin-6 (IL-6) (Offenbacher et al, 2007). There is substantial evidence for a role of many pro-inflammatory and inhibiting cytokines in the development of osteoporosis. Finally, it is likely that most of cytokine abnormalities are due to a combination of oestrogen deficiency and secondary hyperparathyroidism, which are possibly superimposed over the effects of inflammation (chronic or recurrent). The two main components that lead to the development of senile osteoporosis are oestrogen deficiency and secondary hyperparathyroidism. Both components can significantly alter the cellular environment and cytokines. It is likely that chronic inflammation provides a further negative effect on bone loss. There is clear evidence that oestrogen deficiency increases the levels of proinflammatory cytokines IL-1, IL-6, IL-7, M-CSF, TNF-α and IFNg. In our study we observed higher concentrations of IL-1α and IL-1β for patients with postmenopausal osteoporosis. Furthermore, these values correlated positively with increased clinical periodontal parameters (probing depth, attachment loss, bleeding in the survey). The present study has limitations in terms of a correlation of the levels of interleukins with the oestrogen, as well as with other serum levels of interleukins; also, further studies are needed to assess effects of systemic and local therapy on these cytokines and thus, on the local and systemic inflammatory status. IV.3.5 Conclusions Periodontal clinical parameters (probing depth, clinical attachment loss, bleeding on probing) showed significantly higher values for patients with osteoporosis, compared to systemically healthy patients. Cytokine IL-1α has been more prevalent in GCF and has been detected in all study sites. We noted significant higher levels of interleukins for study group (patients with osteoporosis), compared to systemically healthy patients (p <0.05). Also, the amounts of cytokines were positively correlated with periodontal parameters. One can hypothesize that patients with osteoporosis are prone to an exaggerated production of interleukin 1; such production can generate local amplification of the inflammatory load, accelerating the destruction of the periodontal tissue. 14

18 CHAPTER V. THE EVALUATION OF THE LOCAL AND SYSTEMIC THERAPY IN PATIENTS WITH PERIODONTAL DISEASE AND OSTEOPOROSIS V.1 STUDY I: Study regarding the influence of hormonal substitution therapy on the periodontal parameters in patients with osteoporosis V.1.1 Introduction and aim of the study The number of patients who are under hormone replacement therapy (HRT) to offset hormonal changes is growing. Patients are under HRT not just to avoid climacteric symptoms but also to protect themselves from cardiovascular diseases and osteoporosis (Grodstein and Stampfer, 1995). We proposed a comparative assessment of periodontal status in post-menopausal women undergoing or not HRT. V.1.2 Material and Methods The study was carried out on a group of 23 female subjects diagnosed with osteoporosis, aged between 50 and 62 years. Subjects were divided into two groups. The first group, the study included patients who were under hormone replacement therapy (n = 13); control group included patients who were not following this therapy (n = 10). The patients were subjected to periodontal clinical examination, according to the methodology described above. The data were recorded and statistically analyzed. V.1.3 Results The risk of tooth loss was similar for both groups (Figure V.2), but this risk has a mild decrease with increasing duration of treatment (Figure V.3). Regarding bleeding on probing, its value was approximately two times higher in patients without hormone replacement therapy compared to the study group (Figure V.4). Index values of subgingival plaque and calculus showed no significant differences between the two groups (Figures V.5, V.6). Figure V.2 Present teeth distribution in study groups Figure V.3 Present teeth distribution and the duration of the substitution therapy 15

19 Figure V.4 Bleeding on probing values in study groups The diagnosis of periodontal disease showed a higher frequency in patients who were not under replacement therapy, compared to those with HRT (Figure V.7). Figure V.5 Plaque index values in study groups Figure V.6 Calculus index values in study groups Figure V.7 Frequency of the periodontitis diagnosis in study groups In the group without HRT, we noticed more severe periodontal attachment loss compared to the study group (Figure V.8). Moreover, clinical attachment level was proportional to the duration of hormone replacement therapy (Figure V.9). Figure V.8 Mean value of the attachment level in study groups Figure V.9 Mean value of the attachment level and the duration of the substitution therapy V.1.4 Discussions Until recently, hormonal substitution therapy was considered the only effective treatment recommended for prevention of diseases associated with oestrogen deficiency 16

20 (Meisel et al., 2008). However, long-term use of HRT is problematic given the increased risk of breast cancer associated with prolonged use (Castelo Branco et-al., 2005). A study by Meisel et al. (2008) concluded that hormone therapy significantly reduced loss of attachment and therefore periodontal disease (Buencamino et al., 2009). HRT was associated with a reduction in alveolar bone loss (Payne, 1997) but some studies have failed to find an inverse correlation between the density of alveolar bone and severity of periodontal disease (Weyant et al., 1999; Phipps et al., 2007). Moreover, some authors have failed to demonstrate any benefit of HRT on alveolar bone density and height (Taguchi et al., 2004; Bollen et al., 2004). Studies have shown that dental losses are lower in patients following HRT (Meisel et al., 2008; Taguchi et al., 2004); Krall et al. (1997) observed that the edentulous risk was reduced by 6% for each year of HRT. We demonstrated that the degree of gingival inflammation was lower in patients with THS, indicated by a small percentage of bleeding index (P = ). We have demonstrated that patients with HRT showed a significantly increased clinical periodontal attachment level compared to patients without HRT. Ronderos et al. (2000) showed significant differences between patients with clinical attachment HRT and those that never attended HRT; Other studies have demonstrated lower attachment loss in patients with HRT but the differences were not significant (Reinhardt et al., 1999; Norderyd, 1993). V.1.5 Conclusions HRT was associated with a lower degree of gingival inflammation, reflected in a lower percentage of sites with bleeding in the group of patients who were under HRT group compared with control subjects. Dental losses were lower in the group of patients with HRT, compared to non-hrt subjects, and furthermore, the number of teeth present on the arch was higher, as substitution therapy duration was longer. HRT patients experienced a clinical periodontal attachment level significantly increased compared to patients without HRT. In addition, clinical attachment level is increased as the duration of hormone therapy is higher. The diagnosis of periodontal disease was more frequent in patients without HRT compared with those with HRT. Given the results of this study we can say that HRT generates a beneficial effect on periodontal disease, an effect that is better highlighted as HRT has a longer duration. It should be noted, however, that although local effects are beneficial, therapeutic rationale focuses on the patient's overall benefit, weighing the systemic effects of a prolonged hormonal therapies. V.2 II STUDY II: Study regarding the effects of the conventional periodontal therapy on IL-6 and RANKL levels in patients with chronic periodontitis and osteoporosis V.2.1 Introduction and aim Numerous studies to assess the level of proinflammatory cytokines in GCF included a diverse range of patients, including patients with moderate to advanced periodontitis, aggressive periodontitis patients and patients with associated chronic hepatitis and / or systemic diseases. Contrasting data from these studies emphasizes the need for further investigation. The objectives were to investigate the differences in the levels of IL-6 and RANKL in GCF from patients with chronic periodontitis, with or without associated chronic pathology (in particular, osteoporosis). Correlation analysis was performed with the clinical parameters of periodontal disease. 17

21 Additionally, we sought to evaluate the effects of periodontal therapy generated both locally and systemically, by evaluating post-treatment serum inflammatory markers IL-6 and RANKL. V.2.2 Material and Methods The study group consisted of 38 patients with chronic periodontitis, divided into two groups: the study group - patients with osteoporosis (n = 20) and control group - systemically healthy patients (n = 18). Patients were examined and periodontal diagnosed according to the algorithm described above. Paraclinical initial stage of the study included the analysis of IL-6 and RANKL levels in crevicular fluid (GCF = Gingival crevicular fluid). The second phase of the study was therapeutic; periodontal therapy included scaling and root planing (Full-mouth disinfection), with ultrasonic and manual methods. Evaluation of post-treatment local and systemic inflammatory status was carried out 3 months after periodontal therapy. Quantification of IL-6 and RANKL was performed in serum by ELISA. The data were recorded and statistically analyzed. V.2.3 Results Probing depth (PD), bleeding on probing (BOP) and clinical attachment loss (CAL) were significantly higher in the study group than in the control group (p <0.05) (Figure V.11, Figure V.12). Table V.XII. Clinical parameters for the study groups Parameter Study Group (n=24) Control Group (n=22) PD (mm) 4.9± ±0.2 CAL (mm) 1.9± ±0.1 BOP (%) BOP sites (n) PI (%) 76±2 74±1 The values are expressed as median ± Standard Deviation (SD) PD: Probing Depth; CAL: Clinical attachment loss; BOP: bleeding on probing; PI: Plaque Index The cytokine IL-6 has been more prevalent in GCF and has been detected in all study sites (Table V.XIII). We noted significantly higher differences in the levels of interleukins for study group (patients with osteoporosis), compared to systemically healthy patients (p <0.05). Figure V.11 Distribution of probing depth (PD) and clinical attachment loss (CAL) in study groups In order to determine the possible clinical relevance of these observations, a correlation analysis between clinical parameters and total levels of cytokines in sample sites was performed. As shown in Table V.XIV, positive correlations were observed between the levels of IL-6 and RANKL with PPD and CAL. 18

22 Figure V.12 Bleeding on probing values in study groups Figure V.13 Plaque Index values (PI) in study groups Table V.XIII. Cytokine levels in GCF Cytokine (pg/site) Study Group (osteoporosis) Control Group P Value IL-6 72,03 (2, ,89) 29,70 (0,75-541,58) 0,001 RANKL 0,57 (0,00-126,95) 0,09 (0,00-35,15) 0,007 GCF=gingival crevicular fluid; p<0.05 indicates statistic signification; IL=interleukin. Results are expressed as median (min-max). Table V.XIV. Correlation analysis between the clinical parameters (mm) and cytokine levels (pg/site) in GCF PD Correlation Q P Value Correlation CAL Q P Value IL-6 0,386 0,002 IL-6 0,390 0,002 RANKL 0,437 <0,001 RANKL 0,439 <0,001 GCF= gingival crevicular fluid; Q= Spearman correlation coefficient; p<0.05 indicates statistic signification; PD: Probing Depth; CAL: Clinical attachment loss. Post-treatment, we noticed a significant improvement in periodontal parameters for both the group with osteoporosis and the group of systemically healthy subjects (p = and p = 0.006, respectively) (Table V.XV). Table V.XV. Post-therapeutic clinical parameters for the study groups P Parameter Study Group (n=24) Control Group (n=22) PD (mm) 3.8± ±0.2 CAL (mm) 1.2± ±0.1 BOP (%) BOP Sites (n) PI (%) 13±2 11±1 The values are expressed as median ± Standard Deviation (SD) PD: Probing Depth; CAL: Clinical attachment loss; BOP: bleeding on probing; PI: Plaque Index Table V.XVI. Serum cytokine levels in Cytokine (pg/site) Study Group (osteoporosis) Control Group P Value IL-6 1,71 (1,5-2,34) 1,3 (0,5-1,6) 0,65 RANKL 0,03 (0,00-0,95) 0,02 (0,00-0,15) 0,76 p<0.05 indicates statistic signification. Results are expressed as median (min-max). IL-6 and RANKL post-treatment values determined in serum exhibited low values for both groups (Table V.XVI). V.2.4 Discussions 19

23 A possible link between osteoporosis and the loss of alveolar bone was suggested by the fact that osteoporosis will cause a stimulation of pro-resorptive cytokines and bone marrow increases in circulating levels of IL-1, IL-6 and TNF-α. The cytokine IL-6 has been more prevalent in GCF and has been detected in all study sites. We noted significantly higher differences in the levels of interleukins for study group (patients with osteoporosis), compared to systemically healthy patients (p <0.05). Furthermore, the cytokine levels were positively correlated with clinical parameters values. These results support the locally generated influence of the systemic inflammatory status. Conventional therapy generated a clinically improvement in periodontal status observed in both study groups. This was associated with low levels of cytokines in the serum. Therefore, we can say that periodontal therapy may significantly contribute to reducing systemic inflammatory status. These issues open perspectives to test the effects of other adjuvant periodontal therapeutic methods. The new therapeutic approaches must address, in addition to conventional therapy, also to the bone resorption immune component. Understanding the host immune response to bacterial aggression requires a re-evaluation of therapeutic modalities, developing new therapeutic strategies focused on cell-mediated bone destruction. Classic mechanical debridement by scaling and surfacing remains the gold standard of the therapeutic patient management in periodontitis cases but more complex strategies must be considered that could facilitate successful treatment or prevention of periodontal tissue loss. Note: This research received financial support through the "Program for excellence in doctoral and postdoctoral research in multidisciplinary chronic diseases", contract no. POSDRU / 159 / 1.5 / S / , beneficiary U.M.F. "Gr. T. Popa "Iasi, financed from the European Social Fund by Operational Programme of Human Resources Development V.2.5 Conclusions Periodontal clinical parameters (probing depth, clinical attachment loss, bleeding on probing) showed significantly higher values for patients with osteoporosis, compared to systemically healthy patients. Patients with osteoporosis and periodontal disease had higher levels of IL-6 and RANKL in the crevicular fluid, as compared to systemically healthy patients. Also, the amounts of cytokines were positively correlated with periodontal parameters. Therefore, we can say that these patients are prone to an exaggerated production of this type of cytokine, driving the local inflammatory changes that can contribute significantly faster to the development of periodontal disease. Conventional periodontal therapy resulted in a significant improvement in periodontal parameters. In addition, serum levels of cytokines have been reduced. V.3 STUDY III: The evaluation of the inflammatory response modulation therapy in patients with chronic periodontitis and osteoporosis V.3.1 Introduction and aim of the study The importance of host inflammatory response in the pathogenesis of periodontal presents an opportunity to explore new therapeutic strategies by means of modulating this response. Modulation therapy may be associated with traditional therapeutic methods to reduce the bacterial load. 20

24 The purpose of the study was to analyze changes in the level of clinical parameters that the host response modulation periodontal therapy with sub-antimicrobial doses of doxycycline may exercise in patients with periodontal disease and osteoporosis. V.3.2 Materials and Methods The study was conducted on a group of 26 subjects, aged 44 and 65, during February April 2014, randomly divided into two groups: the study group (n = 17), which followed classic debridement therapy (scaling and root planing) plus sub-antimicrobial doses of doxycycline (20 mg twice daily) for 3 months and the control group (n = 18) who followed only the classic debridement therapy. Scaling was manual (using the scalers) and ultrasonic; root planing was carried out using Gracey curettes (Hu-Friedy). Each patient was instructed on proper oral hygiene means. We analyzed the following parameters: periodontal probing depth, the clinical attachment index, PBI and PI at baseline (pre-treatment), the last day of medication and 3 months after completion of medication (6 months from baseline). The sites were grouped according to probing depth in: Group 1 - superficial (0-3mm); Group 2 - moderate (4-6mm) and Group 3 - deep ( 7mm). Changes in probing depth and clinical attachment level were evaluated as efficiency measures. Data obtained during and at the end of the 6-month study were statistically analyzed. V.3.3 Results In this study 30 patients were initially enrolled but four of them have failed to complete therapy with doxycycline. Therefore, the study was materialized in the use of two groups: the study group (13 subjects) and control group (13 subjects). Table V.XVIII Distribution of the sub-groups according to the initial probing depth Probing depth Study group Control Group Total 0-3mm 638 (36,21%) 660 (39,76%) mm 748 (42,45%) 686 (41,32%) mm 376 (21,34%) 314 (18,92%) 690 Total We evaluated a total of 3422 sites. The distribution of sites at baseline are presented in Table V.XVIII. Sites with shallow, moderate and profound depths were identically distributed between groups (p> 0.05). There was no statistically significant difference between groups at baseline with respect to the probing depth (Table IV.XIX). No significant differences were observed in the sites of initial depth of 0-3mm (p> 0.05). Significant reductions in the probing depth were observed in the sites of initial depth of 4-6mm and 7mm (p <0.025). Although the mean reduction for sites with a depth of 4-6mm and 7mm was higher for the study group compared to control (1,80mm to 1,46mm for moderate pockets and 3,38mm to 2,57mm for deep pockets), the difference did not reach significance threshold (p> 0.05). Initial analysis with 7mm sites showed that a high percentage of the sites has been reduced by at least 3 mm after administration of doxycycline (66.4%) compared with no 21

25 treatment modulation group (55.1%) in three months, without a statistically significant difference between groups (p> 0.05). Table V.XIX Mean probing depth and attachment level at baseline, after 3 and 6 months on different sub-groups and study/control groups Study group Control group Baseline 3 Months 6 Months Baseline 3 Months 6 Months 4-6mm depth 4,97±0,08 3,23±0,13* 3,17±0,13* 4,97±0,07 3,44±0,10* 3,51±0,15* 4-6mm 6,16±0,18 5,17±0,17* 5,04±0,17* 6,11±0,30 5,10±0,27* 5,33±0,32* attachment Depth 7mm 7,67±0,10 4,45±0,30* 4,29±0,26* 7,43±0,08 4,65±0,15* 4,86±0,25* Attachment 7mm 8,63±0,29 6,79±0,30* 6,48±0,28* 8,12±0,21 6,38±0,39* 6,36±0,40* *Significance level to baseline (p<0,025) However, after 6 months the percentage of sites with an improvement 3mm was significantly increased (p = 0.011) for modulation therapy group (73.4%) compared to the group that followed the conventional therapy alone (49.7% ) (Figure V.14). Figure V.14 Percentage of deep pockets (initial depth 7mm) which presented reductions higher than 3mm to baseline; *Significant difference to the control group (p<0,05) At baseline there were no statistically significant differences regarding clinical attachment level in subgroups after probing depth between the main groups of study (p> 0.05) (Table V.XIX). Sites with moderate depths and deep sites showed significant improvement in the level of attachment at 3 and 6 months compared with baseline (p <0.025). The sites with initial depth of 0-3mm did not show significant changes in attachment during the study (p> 0.05). Sites with original depth of 0-3mm in the control group (without doxycycline therapy) experienced a slight decrease of attachment (-0,04mm 3 months 6 months -0,03mm). On the other hand, sites with original depth of 0-3mm in the study group showed a slight gain of attachment (0.11 mm at 3 months, 6 months 0,14mm), but there were no significant differences between groups (p> 0, 05). PBI and PI values showed significant improvement between the baseline and reassessments at 3 and 6 months (p <0.025). PBI reduction and PI were similar for both groups (p> 0.05). V.3.4 Discussions Doxycycline helps lower the destruction of the connective tissue by inhibiting proinflammatory mediators and cytokines (including IL-1 and TNF) (Milan et al., 1997) and by increasing the production of collagen, the activity of osteoblasts and bone formation (Golub et al., 1998); this last aspect is of great importance especially for patients with osteoporosis, whose bone capital is affected. 22

26 A major concern was given to the long-term administration of doxycycline and its possible association with the development of antibiotic resistance. Indeed, when antimicrobial doses of tetracycline (250mg per day, 2-7 years) were used, up to 77% of the flora of patients exhibited resistance to tetracycline (Kornman & Karl, 1982). One of the new preliminary experiments clearly demonstrated that the formulation of subantimicrobial doses (20mg twice daily), administered for two weeks, inhibited collagenase activity in gingival tissue with 60-80% in patients with chronic periodontitis (Golub et al., 1990). 3-month regimen of doxycycline administration was well tolerated, without reported side effects (gastrointestinal disorders etc.). This may suggest that modulation therapy with doxycycline is a safe long-term treatment of chronic periodontitis. Studies are needed to assess the very long-term therapy effectiveness of subantimicrobial doses of doxycycline in preventing periodontal and dental loss. The financial benefit derived from adjunct therapy must be evaluated (can it minimize costs by avoiding the need for periodontal surgery interventions?). Further studies are necessary to evaluate the impact of the modulation therapy in patients with periodontal disease and osteoporosis at a molecular level (by examination of the crevicular fluid), on the pro-inflammatory cytokines, as well as on systemic condition, by assessing bone mineral density (pre- and post-treatment T-score correlation). V.3.5 Conclusions We have demonstrated that the adjunctive therapy with sub-antimicrobial doses of doxycycline (20 mg twice a day, 3 months), in combination with conventional periodontal therapy generated significant clinical improvement in patients with periodontal disease and osteoporosis, improvements that have maintained throughout the study and could meet the need for pre-surgery. We also demonstrated that sites with relatively small depths (0-3mm) in the study group showed a slight gain of attachment, while these sites in the control group showed a slight loss of attachment. This supports the effectiveness of therapy for modulating the host response by sub-antimicrobial doses of doxycycline. 3-month regimen of doxycycline administration was well tolerated, without reported side effects (gastrointestinal disorders etc.). This may suggest that modulation therapy with doxycycline is a safe long-term treatment of chronic periodontitis. V.4 IV STUDY IV: Study regarding the action of methylation inhibition of DNA on the cellular response to TGFβ1 in vitro V.4.1 Introduction and aim of the study Epigenetic mechanisms, mainly caused by DNA methylation, are involved in the finetuning of gene expression. In accordance with the general concept, aging (Jones et al., 2015; Lopez-Otin et al., 2013], metabolic disorders such as diabetes (Keating & El-Osta, 2015) and osteoporosis (Holroyd et al., 2012 ) were associated with epigenetic changes. Methylation of DNA is catalyzed by DNA methyltransferases (DNMT), a family of enzymes, including DNMT1, DNMT3a and DNMT3b (Ren et al., 2011). 5-aza-2'-deoxycytidine (5-aza-dc; Decitabine; Dacogen ) is a drug for the treatment of myelodysplastic syndrome (Fenaux et al., 2005). 5-aza-dc is an inhibitor of DNA methyltransferase, thus causing hypomethylation of DNA, as an epigenetic mechanism. 5- aza-dc is also a valuable tool for in vitro research to discover DNA hypomethylation impact on the cellular response to growth factors, including TGF- β1. 23

27 We proposed an in vitro assay, on human fibroblasts, of the changes in cellular response to stimulation by growth factors (TGF-β1 and BCM) in the context of pathophysiological process of methylation inhibition of 5-aza-2'-deoxycytidine. V.4.2 Material and Methods The experimental study, conducted in the University Clinic "Bernhard Gottlieb", Vienna, Austria, was conducted on primary gingival fibroblasts. Cell cultures were performed in experimental explant cultures from three independent donors after the approval of the Ethics Committee of the Medical University of Vienna (EK Nr. 631/2007). Cells were grown in a humid atmosphere at 37 C in growth medium consisting of DMEM, with 10% fetal calf serum and 1% antibiotics (Invitrogen Corporation, Carlsbad, CA, USA). Cells were plated in growth medium to 30,000 cells / cm2 in culture dishes (Figure V.15). The next day, cells were exposed to 5-aza-2'-deoxycytidine (5-aza-dC, Sigma, St. Louis, MO) at 5μM, with daily changes of the medium, for 72 hours. The concentration of 5- aza-dc had no negative impact on cell viability as indicated by the formation of the formazan crystals. The cells were then exposed to recombinant human TGF-β1 (PeproTech, Rocky Hill, NJ) at 5ng / mlor 20% BCM and diluted in serum-free medium for 24 hours prior to analysis of gene expression. Pharmacological inhibition of TGF-βRI kinase was carried out with SB (Calbiochem, Merck, Billerica, MA) at 10 pm (Zimmermann, 2015). The BCM was prepared according to protocol (Sawada et al., 2015; Filho et al., 2015): fresh porcine bone chips were harvested from the vestibular cortical bone mandibular and placed in serumfree medium (50% w/v). The BCM was collected after 24 hours of incubation, filtered and stored at -80 C (Figure V.15). Total RNA was isolated with RNA Isolation Kit (Hoffmann-La Roche, Basel Switzerland). Reverse transcription was performed with the cdna master's kit (Hoffmann-La Roche). Polymerase chain reaction (PCR) was performed with FastStart Universal SYBR Green Master (Hoffmann-La Roche), and Real-Time System 7500 PCR (both Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) (Figure V.16). Primer sequences are shown in Table V.XX. The mrna was calculated by normalization to control gene GAPDH, using the ΔΔCt method. Figure V.15 Fibroblast cell cultures in culture medium (DMEM) and cell stimulation (Petri dishes with BCM) Table V.XX Primer sequences 24

28 Gene Primer Forward Primer Reverse hil11 GACCTACTGTCCTACCTGCG AGTCTTCAGCAGCAGCAGTC hprg4 CGACGCCCAATGTAAGAAGT GGTGATGTGGGATTATGCACT hnox4 TCTTGGCTTACCTCCGAGGA CTCCTGGTTCTCCTGCTTGG hdnmt1 CAAACCCCTTTCCAAACCTC TAATCCTGGGGCTAGGTGAA hdnmt3a CCTGAAGCCTCAAGAGCAGT TGGTCTCCTTCTGTTCTTTGC hdnmt3b GTTCCCGGCTACCAGGTC CGTCTGTGAGGTCGATGGTA htgfbr1 GCAGACTTAGGACTGGCAGTAAG AGAACTTCAGGGGCCATGT htgfbr2 GGGAAATGACATCTCGCTGTA CACCTTGGAACCAAATGGAG hgapdh TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG Figure V.16 ARNm isolation, reverse DNA transcription and PCR analysis The in vitro experiments were performed at least twice, with the cells collected from three different donors; data are reported as median, minimum and maximum; paired t-test was used for statistical analysis of the obtained data, with significance level of p <0.05. V.4.3 Results Based on the general assumption that demethylation by 5-aza-dc sensitize TGF-β1 oral fibroblasts, we examined the expression of TGF-beta target genes. As expected, recombinant TGF-β1 significantly increased the expression of IL11 (p = 0.01; 0.008), PRG4 (p = 0.02; p = 0.042), and NOX4 (p = 0.01; p = 0.004), with and without 5- aza-dc, respectively (Table V.XXI). Importantly, demethylation with 5-aza-dc moderately improved the already strong growth induced by TGF-β1 of IL11 (p = 0.14), PRG4 (p = 0.15), and NOX4 (p = 0.36) (Table V.XXII). These results indicate that TGF-β1 exerts its powerful activity in the presence of 5- aza-dc, the latter causing a moderate additive effect on gene expression. To support the concept that the demethylation increases the sensitivity of cells to growth factors, 5-aza-dc alone resulted in a moderate tendency to increase IL11 (p = 0.07), PRG4 (p = 0.08), and NOX4 (p = 0.35) (Table V.XXII). The additive effect of 5-aza-dc in the expression of genes was expressed in the presence of TGF-β1: IL11 (p = 0.045), PRG4 (p = 0.13), and NOX4 (p 25