Human leukocyte antigen class II genotype in patients with recurrent fetal miscarriage who are positive for anticardiolipin antibody

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Human leukocyte antigen class II genotype in patients with recurrent fetal miscarriage who are positive for anticardiolipin antibody"

Transcription

1 FERTILITY AND STERILITY VOL. 70, NO. 5, NOVEMBER 1998 Copyright 1998 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Human leukocyte antigen class II in patients with recurrent fetal miscarriage who are positive for anticardiolipin antibody Isao Hataya, M.D., Koichi Takakuwa, M.D., and Kenichi Tanaka, M.D. Department of Obstetrics and Gynecology, Niigata University School of Medicine, Asahimachi-dori, Niigata, Japan Objective: To elucidate the relationship between human leukocyte antigen (HLA) class II s and patients with recurrent fetal miscarriage who are positive for anticardiolipin antibody. Design: Prospective clinical study. Setting: Institutional practice at the outpatient clinic for infertility, Niigata University Medical Hospital. Patient(s): with recurrent fetal miscarriage who were positive for anticardiolipin antibody and normal fertile women. Intervention(s): Genomic DNA was extracted from peripheral mononuclear cells. Main Outcome Measure(s): Human leukocyte antigen class II was determined using a polymerase chain reaction restriction fragment length polymorphism method. Result(s): The frequencies of DRB1*0403 and DRB1*0410 were significantly higher in the patient group than in the control group. The frequency of DRB1*04 also was significantly higher in the patient group. As for HLA-DQ, the frequency of HLA-DQB1*0501 was significantly lower in the patient group. Conclusion: Human leukocyte antigen systems appear to be involved in the genesis of antiphospholipid syndrome. (Fertil Steril 1998;70: by American Society for Reproductive Medicine.) Key Words: Anticardiolipin antibody, antiphospholipid syndrome,, HLA class II, PCR-RFLP Received March 13, 1998; revised and accepted June 26, Reprint requests: Isao Hataya, M.D., Department of Obstetrics and Gynecology, Niigata University School of Medicine, 1-757, Asahimachi-dori, Niigata, , Japan (FAX: ) /98/$19.00 PII S (98) It has recently been suggested that autoimmune mechanisms are involved in the genesis of fetal miscarriage, including spontaneous abortion and intrauterine fetal demise. The concept of a new disease, the antiphospholipid syndrome or the reproductive autoimmune failure syndrome, has been proposed (1 4) and has been supported by several clinical reports (5 11), in which patients have diverse reproductive failures. These include recurrent fetal miscarriage, intrauterine fetal growth retardation, and preeclampsia, in connection with positivity for antiphospholipid antibodies. The abnormal generation of autoantibodies, such as those directed against phospholipids, in these patients is thought to suggest aberrations in immune regulation. The immunologic background of this disease entity, however, has not yet been analyzed fully. The human leukocyte antigen (HLA) systems are useful in examining the immunogenetic basis of some diseases because these systems control both the immune response to natural antigens and the susceptibility or resistance to several diseases, especially autoimmune diseases (12). It is also possible that HLA antigen systems are associated with recurrent fetal miscarriage in patients who are positive for antiphospholipid antibodies. Several reports based on serologic HLA typing have pointed out the positive association between patients with recurrent fetal miscarriage who are positive for antiphospholipid antibodies and specific HLA alleles (13, 14). A molecular genetic approach for determining HLA class II genes, however, has not yet been taken to analyze the association between the patients and specific HLA alleles. Polymerase chain reaction (PCR) in combination with restriction fragment length poly- 919

2 TABLE 1 Polymerase chain reaction primers for amplification of DRB1, DQB1, and DPB1 genes. Gene Primer Sequences (5 to 3 ) No. of base pairs Denaturing Annealing Extension DRB1 for DR2 5 primer 5 R2 TTCCTGTGGCAGCCTAAGAGG C 60 C 72 C for DR4 5 primer 5 R4 GTTTCTTGGAGCAGGTTAAAC C 60 C 72 C for DR1 5 primer 5 R1 GGTTGCTGGAAAGATGCATCT C 55 C 72 C for DR7 5 primer 5 R7 AGTTCCTGGAAAGACTCTTCT C 60 C 72 C for DR10 5 primer 5 R10 GGTTGCTGGAAAGACGCGTCC C 60 C 72 C for DR3 5 primer 5 R3568 ACGTTTCTTGGAGTACTCTACG C 60 C 72 C DR5 DR6 DR8 3 primer 3 R* CCGCTGCACTGTGAAGCTCT for DR9 5 primer 5 R9 GGACGGAGCGGGTGCGGTATC C 63 C 72 C 3 primer CCGTAGTTGTGTCTGCACACGG DQB1 for DQ1 5 primer GH28NL GCATGTGCTACTTCACCAACG C 55 C 72 C 3 primer QB202 CACCTGCAGATCCCGCGGTACGCCACCTC for DQ2 5 primer GH28NL GCATGTGCTACTTCACCAACG C 55 C 72 C DQ3 3 primer QB204 CACCTGCAGTGCGGAGCTCCAACTGGTA DQ4 DPB1 5 primer DPB101N GTGAAGCTTTCCCCGCAGAGAATTAC C 62 C 72 C 3 primer DPB201 CACCTGCAGTCACTCACCTCGGCGCTG * Common for DRB1 alleles except DR9 allele. morphism (RFLP) recently has become available for use in typing HLA class II genes at the nucleotide sequence level, thus enabling us to determine accurately two alleles of HLA class II genes in individuals (15 17). In this study, the frequency of s of HLA-DR, HLA-DQ, and HLA-DP antigens was evaluated by means of the PCR- RFLP method. This was done to clarify the role of the HLA class II antigens in patients positive for anticardiolipin antibody who repeatedly have fetal miscarriages. MATERIALS AND METHODS Fifty-six patients who experienced two or more recurrent abortions or fetal deaths and who were positive for anticardiolipin antibodies were enrolled in this study; all patients gave informed consent. with autoimmune disease, such as systemic lupus erythematosus (SLE), were excluded from the study. The control group consisted of 76 women who had not had recurrent fetal miscarriage and who had had at least two normal deliveries; these women were examined for HLA class II s after informed consent was obtained. All women in the control group were negative for anticardiolipin antibody. All individuals were Japanese women, and the difference between the mean age of the individuals in the two groups was not statistically significant. Measurement of Anticardiolipin Antibody Levels of anticardiolipin antibody were determined with use of an ELISA according to the modified method of Loizou et al. (18). Details of the method have been described elsewhere (9). GPL units in the test serum were estimated according to the standard curve drawn from the titration of control serum, and the cutoff value was 20 GPL units of the anticardiolipin antibody. Analyses of HLA Class II Genotypes Analyses of HLA-DRB1 s, HLA-DQB1 s, and HLA-DPB1 s were performed with use of the PCR-RFLP method. Primers used in this study are listed in Table 1, and endonucleases are listed in Table 2. TABLE 2 Restriction endonucleases for genotyping of DRB1, DQB1, and DPB1 alleles. Allele Antigen Restriction endonuclease DRB1 DR1 AvaII, PstI DR2 FokI, Cfr13I, HphI DR3, DR5, DR6, DR8 AvaII, FokI, KpnI, HaeII, Cfr13I, SfaNI, SacII, BsaJI, ApaI, HphI, RsaI DR4 Sac II, AvaII, HinfI, HaeII, HphI, MnlI DQB1 DQ1 FokI, ApaI, HaeII, StaNI, BssHII, HphI DQ2, DQ3, DQ4 FokI, BglI, SacI, AcyI, HpaII DPB1 Bsp1286I, FokI, DdeI, BsaJI, BssHII, Cfr13I, RsaI, EcoNI, AvaII 920 Hataya et al. HLA class II and antiphospholipid syndrome Vol. 70, No. 5, November 1998

3 Genomic DNA extracted from peripheral lymphocytes was amplified by the PCR procedure. The second exon of DRB1 genes for DR2, DR4, DR1, DR7, DR10, DR3, DR5, DR6, and DR8 was amplified using one of six group-specific 5 primers along with the common 3 primer. The second exon of the DRB1 gene for DR9 was amplified using a specific 5 primer and a 3 primer (15). A 241 base pair fragment from the second exon of the HLA-DQB1 gene was amplified by using DQ1 group-specific primers, and a 237 base pair fragment was amplified using DQ2, DQ3, and DQ4 group-specific primers, according to the methods described by Nomura et al. (16). A 299 base pair fragment from the second exon of the HLA- DPB1 gene was amplified with use of PCR primers according to the methods described by Ota et al. (17). After amplification, aliquots of the reaction mixture were digested by allele-specific restriction endonucleases. The samples were subjected to electrophoresis in a minigel apparatus (AE6450; Atto Corporation, Tokyo, Japan). HLA- DRB1 gene, HLA-DQB1 gene, and HLA-DPB1 gene types were determined by comparing the patterns of RFLP obtained in tested individuals with those of amplified DRB1, DQB1, and DPB1 genes, as reported by Ota et al. (15), Nomura et al. (16) and Ota et al. (17), respectively. Institutional review board approval was obtained for this study. Statistical Analysis The relative risk (RR) was calculated with a 95% confidence interval (CI) to analyze whether there was a statistically significant difference between the frequency of a certain HLA in the patient group and that in the control group. RESULTS The frequencies of DRB1*0403 and DRB1*0410 were significantly higher in the patient group than in the control group (RR 4.44, 95% CI ; and RR 8.55, 95% CI , respectively). The frequency of DRB1*04 also was significantly higher in the patient group (RR 2.44, 95% CI ) (Table 3). As for HLA-DQ, the frequency of DQB1*0501 was significantly lower in the patient group (RR 0.21, 95% CI ). The frequencies of other s of HLA-DQ antigens were not significantly different between the groups (Table 4). No statistically significant difference in the frequency of HLA-DP s was observed between the groups (Table 5). DISCUSSION In studying the immunologic background of the patients with recurrent fetal miscarriage who were positive for anticardiolipin antibody, we found that the frequency of certain TABLE 3 Frequency of HLA-DRB1 in patients and DRB1 Percentage of indicated * (no. of loci with indicated ) HLA class II s in the patient group was significantly different from that in the normal fertile female population. It has recently been suggested that autoimmune factors, especially newly defined autoantibodies such as antiphospholipid antibodies, are implicated in such adverse outcomes of pregnancy as spontaneous abortion, fetal death, fetal growth retardation, and preeclampsia. Hughes et al. (1) first described the antiphospholipid syndrome, in which patients had general thrombosis and recurrent fetal miscarriage and showed positivity for antiphospholipid antibodies. Gleicher and colleagues (2 4) postulated a reproductive autoimmune failure syndrome in which autoimmune factors, such as lupus anticoagulant or antiphospholipid antibodies, are implicated in the genesis of unexplained recurrent fetal miscarriage. It has recently been shown that most autoimmune dis- RR 95% CI (1) 6.6 (10) (2) 2.0 (3) (12) 2.6 (4) (1) (10) 8.6 (13) (3) 0.7 (1) (1) (6) 0.7 (1) (2) (1) (2) 5.3 (8) (8) 8.6 (13) (14) 13.2 (20) (1) 0.7 (1) (2) 0.7 (1) (4) 2.6 (4) (1) 2.0 (3) (3) 5.3 (8) (6) 7.9 (12) (6) 2.6 (4) (1) 0.7 (1) (6) (1) (4) 3.9 (6) (1) (8) 5.9 (9) (14) 11.2 (17) (4) (34) 15.1 (23) Note: All values for the RR and 95% CI were not statistically significant, with the exception of those indicated. FERTILITY & STERILITY 921

4 TABLE 4 Frequency of HLA-DQB1 in patients and DQB1 Percentage of indicated * (no. of loci with indicated ) eases have a significant relationship with the HLA antigen system; in particular, HLA class II antigens were found to be related closely to diseases. For example, Badenhoop et al. (19) noted the association of DQA1*0201/*0301 heterozygotes and Hashimoto s disease. They also demonstrated the involvement of the HLA-DQ gene in the genesis of a typical endocrine autoimmune disease, type I diabetes mellitus, and Graves disease using the PCR and sequence-specific oligonucleotide hybridization method (20). RR 95% CI (1) 0.7 (1) (8) 9.9 (15) (16) 10.5 (16) (16) 12.5 (19) (10) 7.9 (12) (8) 2.6 (4) (2) 7.9 (12) (4) 4.6 (7) (7) 4.6 (7) (25) 17.8 (27) (9) 11.2 (17) (6) 9.9 (15) Note: All values for the RR and 95% CI were not statistically significant, with the exception of those indicated. TABLE 5 Frequency of HLA-DPB1 in patients and DPB1 Percentage of indicated * (no. of loci with indicated ) (29) 22.4 (34) (3) 3.3 (5) (9) 2.6 (4) (2) 4.6 (7) (9) 9.2 (14) (39) 38.8 (59) (1) 2.0 (3) (11) 9.9 (15) (2) 0.7 (1) (5) 2.6 (4) (1) 1.3 (2) (2) (1) 1.3 (2) Note: The RR with 95% CI of each HLA-DP was not significant. In this study, we investigated the s of HLA class II antigens HLA-DR, HLA-DQ, and HLA-DP using the PCR-RFLP method in patients with recurrent fetal miscarriage who were positive for anticardiolipin antibody. The frequencies of DRB1*0403 and DRB1*0410 were significantly higher in patients than in the control group. As for HLA-DQ, the frequency of HLA-DQB1*0501 was significantly lower in the patient group. Granados et al. (13) reported that Mexican patients with SLE who were positive for anticardiolipin antibody had significantly increased corrected frequencies of the HLA- DR3, HLA-DR7, and HLA-DQ2 antigens. Sebastiani et al. (14) reported that the antiphospholipid antibody and the lupus anticoagulant occurred in families carrying haplotypes that contain HLA-DR4, HLA-DR7, and HLA-DR53. In this study, the relationship between the HLA-DR3 and HLA-DR7 antigens and patients with the anticardiolipin antibody was not detected because these antigens are rare in the Japanese population. The known higher frequency of HLA-DR4 is reflected in the findings of our study. The finding of a significantly lower frequency of HLA- DQB1*0501 is unique to our study. Although recent investigation has indicated the critical role of specific HLA-DQ polymorphisms in establishing the nature of bound antigens, thereby influencing the potential immune repertoire (21), the mechanisms behind the significantly lower frequency of HLA-DQB1*0501 in patients with this disease have not been understood. The etiologic agent that triggers the generation of the anticardiolipin antibody in susceptible individuals has not been identified. The possibility of direct involvement of the non-hla gene, which is linked strongly to the class II region, cannot be excluded in the generation of the anticardiolipin antibody in these patients. Recent genetic analysis by van Endert et al. (22) demonstrated that the genes in the class II region are involved in the processing of antigenic proteins for presentation by major histocompatibility complex class I molecules. The analysis indicated a strong linkage disequilibrium between TAP (the transporter associated with antigen processing) genes and LMP (the low-molecular-mass polypeptide) genes and class II regions. Their allelic polymorphism should be studied in patients positive for anticardiolipin antibody to determine the primary locus within the class II region that is responsible for genetic susceptibility to disease. There is also the possibility that patients become positive for anticardiolipin antibodies because of amino acid residues in DRB1 molecules. It is also possible that a specially processed epitope on a foreign or self-triggered antigen may have a specific, unusual affinity for the DRB1 molecule with DR4 specificities, leading to the generation of the anticardiolipin antibody in these patients. Examination of amino acid residues from the DRB1 al- 922 Hataya et al. HLA class II and antiphospholipid syndrome Vol. 70, No. 5, November 1998

5 leles has shown that histidine at position 13 is specific to DR4, the frequency of which was increased in our patients. The first hypervariable region (amino acid residues at positions 9 to 13) is located on the beta-strands of the sheet at the bottom of the antigen binding groove described by Brown et al. (23, 24); amino acids residing at positions 9, 11, and 13 display a high degree of polymorphism. Therefore, it seems likely that histidine at position 13 contributed to the predisposition toward production of the anticardiolipin antibody in our patients. References 1. Hughes GRV, Harris EN, Gharavi AE. The anticardiolipin syndrome. J Rheumatol 1986;13: Gleicher N, El-Roeiy A. The reproductive autoimmune failure syndrome. Am J Obstet Gynecol 1988;159: Gleicher N. Antiphospholipid antibodies and reproductive failure: what they do and what they do not do; how to, and how not to treat. Hum Reprod 1997;1: Gleicher N, Harlow L, Zilberstein M. Regulatory effect of antiphospholipid antibodies on signal transduction: a possible model for autoantibody-induced reproductive failure. Am J Obstet Gynecol 1992;167: Lubbe WF, Butler WS, Palmer SJ, Liggins GC. Fetal survival after prednisone suppression of maternal lupus-anticoagulant. Lancet 1983; 1: Branch DW, Scott JR, Kochenour NK, Hershgold E. Obstetric complications associated with the lupus anticoagulant. N Engl J Med 1985; 313: Hasegawa I, Takakuwa K, Goto S, Yamada K, Kanazawa K, Tanaka K, et al. Effectiveness of prednisolone/aspirin therapy for recurrent aborters with antiphospholipid antibodies. Hum Reprod 1992;7: Takakuwa K, Asano K, Arakawa M, Yasuda M, Hasegawa I, Tanaka K. Chromosome analysis of aborted conceptuses of recurrent aborters positive for anticardiolipin antibody. Fertil Steril 1997;68: Yasuda M, Takakuwa K, Tokunaga A, Tanaka K. Prospective studies of the association between anticardiolipin antibody and outcome of pregnancy. Obstet Gynecol 1995;86: Yasuda M, Takakuwa K, Higashino M, Ishii S, Kazama Y, Tanaka K, et al. A typical case of reproductive autoimmune failure syndrome in which a patient experienced recurrent abortion, preeclampsia, and intrauterine growth retardation. Am J Reprod Immunol 1993;29: Takakuwa K, Yasuda M, Hataya I, Tamura M, Arakawa M, Tanaka K, et al. Treatment for patients with recurrent abortion with positive antiphospholipid antibodies using a traditional Chinese herbal medicine. J Perinat Med 1996;24: Thomson G. Human HLA genetics and disease associations. In: Weir DM, ed. Handbook of experimental immunology. Vol. 3. Genetics and molecular immunology. Oxford: Blackwell Scientific, 1986: Granados J, Vargas-Alarcon G, Drenkard C, Andrade F, Melin-Aldana H, Alcocer-Varela J, et al. Relationship between anticardiolipin antibodies and antiphospholipid syndrome to HLA-DR7 in Mexican patients with systemic lupus erythematosus (SLE). Lupus 1997;6: Sebastiani GD, Galeazzi M, Morozzi G, Marcolongo R. The immunogenetics of the antiphospholipid syndrome, anticardiolipin antibodies, and lupus anticoagulant. Semin Arthritis Rheum 1996;25: Ota M, Seki T, Fukushima H, Tsuji K, Inoko H. HLA-DRB1 genotyping by modified PCR-RFLP method combined with group-specific primers. Tissue Antigens 1992;39: Nomura N, Ota M, Tsuji K, Inoko H. HLA-DQB1 genotyping by a modified PCR-RFLP method combined with group-specific primers. Tissue Antigens 1991;38: Ota M, Seki T, Nomura N, Sugimura K, Mizuki N, Fukushima H, et al. Modified PCR-RFLP method for HLA-DPB1 and -DQA1 genotyping. Tissue Antigens 1991;38: Loizou S, MacCrea JD, Rudge AC. Measurement of anticardiolipin antibodies by an enzyme-linked immunosorbent assay (ELISA). Clin Exp Immunol 1985;62: Badenhoop K, Schwarz G, Walfish PG, Drummond V, Usadel KH, Bottazzo GF. Susceptibility to thyroid autoimmune disease: molecular analysis of HLA-D region genes identifies new markers for goitrous Hashimoto s thyroiditis. J Clin Endocrinol Metab 1990;71: Badenhoop K, Walfish PG, Rau H, Fischer S, Nicolay A, Bogner U, et al. Susceptibility and resistance alleles of human leukocyte antigen (HLA) DQA1 and HLA DQB1 are shared in endocrine autoimmune disease. J Clin Endocrinol Metab 1995;80: Kwok WW, Nepom GT, Raymond FC. HLA-DQ polymorphisms are highly selective for peptide binding interactions. J Immunol 1995;155: van Endert PM, Lopez MT, Patel SD, Monaco JJ, McDevitt HO. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes. Proc Natl Acad Sci USA 1992;89: Brown JH, Jardetzky TS, Saper MA, Samraoui B, Bjorkman PJ, Wiley CD. A hypothetical model of the foreign antigen binding site of class II histocompatibility molecules. Nature 1988;332: Brown JH, Jardetzky TS, Gorga JC, Stern LJ, Urban RG, Strominger JL, et al. Three dimensional structure of the human class II histocompatibility antigen HLA-DR1. Nature 1993;364:33 9. FERTILITY & STERILITY 923

Key words: antiphospholipid syndrome, trombosis, pathogenesis

Key words: antiphospholipid syndrome, trombosis, pathogenesis 26. XI,. 4/2011,.,..,..,., -..,,. 2GPI. -,.,,., -,, -, -,,,,, IL-1, IL-2, IL-6, IL-8, IL-12, IL-10, TNF, INF-. :,, N. Stoilov, R. Rashkov and R. Stoilov. ANTIPHOSPHOLIPID SYNDROME HISTORICAL DATA, ETI-

More information

The Human Major Histocompatibility Complex

The Human Major Histocompatibility Complex The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure

More information

Significance of the MHC

Significance of the MHC CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

Relationship Between HLA-DMA, DMB Alleles and Type 1 Diabetes in Chinese

Relationship Between HLA-DMA, DMB Alleles and Type 1 Diabetes in Chinese HK J Paediatr (new series) 2005;10:20-25 Relationship Between HLA-DMA, DMB Alleles and Type 1 Diabetes in Chinese YM SANG, C YAN, C ZHU, GC NI, YM HU Abstract Key words The Human Leucocyte Antigen (HLA)-DMA

More information

AG MHC HLA APC Ii EPR TAP ABC CLIP TCR

AG MHC HLA APC Ii EPR TAP ABC CLIP TCR !! AG MHC HLA APC Ii EPR TAP ABC CLIP TCR Antigen Major Histocompartibility Complex Human Leukocyte Antigen Antigen Presenting Cell Invariant Chain Endoplasmatic Reticulum Transporters Associated with

More information

Profiling HLA motifs by large scale peptide sequencing Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009

Profiling HLA motifs by large scale peptide sequencing Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009 Profiling HLA motifs by large scale peptide sequencing 2009 Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009 HLA Background The human leukocyte antigen system (HLA) is the

More information

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

More information

the HLA complex Hanna Mustaniemi,

the HLA complex Hanna Mustaniemi, the HLA complex Hanna Mustaniemi, 28.11.2007 The Major Histocompatibility Complex Major histocompatibility complex (MHC) is a gene region found in nearly all vertebrates encodes proteins with important

More information

Autoimmune diseases. Autoimmune diseases. Autoantibodies. Autoimmune diseases relatively common

Autoimmune diseases. Autoimmune diseases. Autoantibodies. Autoimmune diseases relatively common Autoimmune diseases Fundamental abnormality: the adaptive immune system is triggered by self antigens to initiate a sustained immune response against self molecules that results in tissue injury Specificity

More information

Sustained adaptive immune response to self antigens may or may not result in tissue injury according to particular host genetics

Sustained adaptive immune response to self antigens may or may not result in tissue injury according to particular host genetics Autoimmune diseases Fundamental abnormality: the adaptive immune system is triggered by self antigens to initiate a sustained immune response against self molecules that results in tissue injury Specificity

More information

Autoimmunity and Pregnancy ANASTASIOS E. GERMENIS

Autoimmunity and Pregnancy ANASTASIOS E. GERMENIS Autoimmunity and Pregnancy ANASTASIOS E. GERMENIS Immune homeostasis Immunity against pathogens Autoreactivity Collateral damage The Clonal Selection Theory Central tolerance Anti-self CTL clones in the

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women

Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women www.bioinformation.net Volume 13(5) Hypothesis Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women Maniraja Jesintha

More information

IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois

IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois FERTILITY AND STERILITY VOL. 80, NO. 4, OCTOBER 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A. CASE REPORTS Preimplantation

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) - MHC molecules were initially discovered during studies aimed

More information

The Major Histocompatibility Complex (MHC)

The Major Histocompatibility Complex (MHC) The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens

More information

DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS

DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS The definitions below are intended as general concepts. There will be exceptions to these general definitions. These definitions do not imply any specific

More information

Antigen Presentation to T lymphocytes

Antigen Presentation to T lymphocytes Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antigen processing: How are

More information

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmunity Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmune disease can be caused to primary defects in B cells, T cells and possibly

More information

BDC Keystone Genetics Type 1 Diabetes. Immunology of diabetes book with Teaching Slides

BDC Keystone Genetics Type 1 Diabetes.  Immunology of diabetes book with Teaching Slides BDC Keystone Genetics Type 1 Diabetes www.barbaradaviscenter.org Immunology of diabetes book with Teaching Slides PRACTICAL Trailnet screens relatives and new onset patients for autoantibodies and HLA

More information

Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT

Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT Stephen Spellman, MBS Director, Immunobiology and Observational Research Assistant Scientific Director CIBMTR,

More information

Historical definition of Antigen. An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen.

Historical definition of Antigen. An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen. Historical definition of Antigen An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen. Historical definition of Antigen An antigen is a foreign

More information

Alleles: the alternative forms of a gene found in different individuals. Allotypes or allomorphs: the different protein forms encoded by alleles

Alleles: the alternative forms of a gene found in different individuals. Allotypes or allomorphs: the different protein forms encoded by alleles Nomenclature Alleles: the alternative forms of a gene found in different individuals Allotypes or allomorphs: the different protein forms encoded by alleles Genotype: the collection of genes in an individual,

More information

10/18/2012. A primer in HLA: The who, what, how and why. What?

10/18/2012. A primer in HLA: The who, what, how and why. What? A primer in HLA: The who, what, how and why What? 1 First recognized in mice during 1930 s and 1940 s. Mouse (murine) experiments with tumors Independent observations were made in humans with leukoagglutinating

More information

The Major Histocompatibility Complex

The Major Histocompatibility Complex The Major Histocompatibility Complex Today we will discuss the MHC The study of MHC is necessary to understand how an immune response is generated. And these are the extra notes with respect to slides

More information

HLA Antigen Expression in Autoimmune Endocrinopathies

HLA Antigen Expression in Autoimmune Endocrinopathies Physiol. Res. 53: 191-197, 2004 HLA Antigen Expression in Autoimmune Endocrinopathies P. HRDÁ 1,2, I. ŠTERZL 1,2, P. MATUCHA 2, F. KORIOTH 3, A. KROMMINGA 3 1 Institute of Immunology and Microbiology First

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

Fetal-Maternal HLA Relationships and Autoimmune Disease. Giovanna Ibeth Cruz. A dissertation submitted in partial satisfaction of the

Fetal-Maternal HLA Relationships and Autoimmune Disease. Giovanna Ibeth Cruz. A dissertation submitted in partial satisfaction of the Fetal-Maternal HLA Relationships and Autoimmune Disease By Giovanna Ibeth Cruz A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Epidemiology

More information

Lupus anticoagulant and anticardiolipin antibodies in SLE with secondary Antiphospholipid Antibody Syndrome

Lupus anticoagulant and anticardiolipin antibodies in SLE with secondary Antiphospholipid Antibody Syndrome Turk J Hematol 2007; 24:69-74 Turkish Society of Hematology RESEARCH ARTICLE Lupus anticoagulant and anticardiolipin antibodies in SLE with secondary Antiphospholipid Antibody Syndrome Shveta Garg, Annamma

More information

Basic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction

Basic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Basic Immunology Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Molecular structure of MHC, subclasses, genetics, functions. Antigen presentation and MHC restriction.

More information

Nomenclature. HLA genetics in transplantation. HLA genetics in autoimmunity

Nomenclature. HLA genetics in transplantation. HLA genetics in autoimmunity Nomenclature Alleles: the alternative forms of a gene found in different individuals Allotypes or allomorphs: the different protein forms encoded by alleles During pregnancy the mother tolerates the expression

More information

criterion (positive lupus anticoagulant or

criterion (positive lupus anticoagulant or FERTILITY AND STERILITY Vol. 66, No.4, October 1996 Copyright 1996 American Society for Reproductive Medicine Printed on acid~free paper in U. s. A. Antiphospholipid antibody panels and recurrent pregnancy

More information

Antiphospholipid Syndrome

Antiphospholipid Syndrome Antiphospholipid Syndrome EliA Cardiolipin and EliA β2-glycoprotein I Fully Automated Testing for Antiphospholipid Syndrome (APS) Testing for APS according to classification criteria determination of anti-β2-glycoprotein

More information

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012.

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012. www.ebmt.org HLA and more Ilias I.N. Doxiadis Geneva 03/04/2012 HLA and more HLA and more / Doxiadis 2 Topic of the day Compatibility testing is a type of testing used to ensure compatibility of the system/application/website

More information

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response Ivana FELLNEROVÁ E-mail: fellneri@hotmail.com, mob. 732154801 Basic immunogenetic terminology innate and adaptive immunity specificity and polymorphism immunoglobuline gene superfamily immunogenetics MHC

More information

B F. Location of MHC class I pockets termed B and F that bind P2 and P9 amino acid side chains of the peptide

B F. Location of MHC class I pockets termed B and F that bind P2 and P9 amino acid side chains of the peptide Different MHC alleles confer different functional properties on the adaptive immune system by specifying molecules that have different peptide binding abilities Location of MHC class I pockets termed B

More information

DISCLOSURE. Relevant relationships with commercial entities none. Potential for conflicts of interest within this presentation none

DISCLOSURE. Relevant relationships with commercial entities none. Potential for conflicts of interest within this presentation none AUTOIMMUNITY DISCLOSURE Relevant relationships with commercial entities none Potential for conflicts of interest within this presentation none Steps taken to review and mitigate potential bias N/A MODULE

More information

Handling Immunogenetic Data Managing and Validating HLA Data

Handling Immunogenetic Data Managing and Validating HLA Data Handling Immunogenetic Data Managing and Validating HLA Data Steven J. Mack PhD Children s Hospital Oakland Research Institute 16 th IHIW & Joint Conference Sunday 3 June, 2012 Overview 1. Master Analytical

More information

HLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute

HLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute HLA Mismatches Professor Steven GE Marsh HLA Mismatches HLA Genes, Structure, Polymorphism HLA Nomenclature HLA Mismatches in HSCT Defining a mismatch HLA Mismatches HLA Genes, Structure, Polymorphism

More information

Research: Genetics HLA class II gene associations in African American Type 1 diabetes reveal a protective HLA-DRB1*03 haplotype

Research: Genetics HLA class II gene associations in African American Type 1 diabetes reveal a protective HLA-DRB1*03 haplotype Research: Genetics HLA class II gene associations in African American Type 1 diabetes reveal a protective HLA-DRB1*03 haplotype J. M. M. Howson 1,2, M. S. Roy 3, L. Zeitels 1, H. Stevens 1 and J. A. Todd

More information

Clinical Relevance of the HLA System in Blood Transfusion. Dr Colin J Brown PhD FRCPath. October 2017

Clinical Relevance of the HLA System in Blood Transfusion. Dr Colin J Brown PhD FRCPath. October 2017 Clinical Relevance of the HLA System in Blood Transfusion Dr Colin J Brown PhD FRCPath. October 2017 Outline of talk HLA genes, structure and function HLA and immune complications of transfusion TA-GVHD

More information

MHC class I MHC class II Structure of MHC antigens:

MHC class I MHC class II Structure of MHC antigens: MHC class I MHC class II Structure of MHC antigens: MHC class I antigens consist of a transmembrane heavy chain (α chain) that is non-covalently associated with β2- microglobulin. Membrane proximal domain

More information

2-Glycoprotein 1 as a marker of antiphospholipid syndrome in women with recurrent pregnancy loss

2-Glycoprotein 1 as a marker of antiphospholipid syndrome in women with recurrent pregnancy loss FERTILITY AND STERILITY VOL. 73, NO. 3, MARCH 2000 Copyright 2000 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. 2-Glycoprotein 1 as

More information

Targeting the Trimolecular Complex for Immune Intervention. Aaron Michels MD

Targeting the Trimolecular Complex for Immune Intervention. Aaron Michels MD Targeting the Trimolecular Complex for Immune Intervention Aaron Michels MD Disclosures Research Grant from Novartis. Research Grant from NovoNordisk. Take Home Points Type 1 diabetes is an immunologic

More information

Association of HLA-DQ Genotype in Autoantibody-Negative and Rapid-Onset Type 1 Diabetes

Association of HLA-DQ Genotype in Autoantibody-Negative and Rapid-Onset Type 1 Diabetes Pathophysiology/Complications O R I G I N A L A R T I C L E Association of HLA-DQ Genotype in Autoantibody-Negative and Rapid-Onset Type 1 Diabetes SHOICHIRO TANAKA, MD 1,2 TETSURO KOBAYASHI, MD 1 KOJI

More information

AUTOIMMUNITY CLINICAL CORRELATES

AUTOIMMUNITY CLINICAL CORRELATES AUTOIMMUNITY CLINICAL CORRELATES Pamela E. Prete, MD, FACP, FACR Section Chief, Rheumatology VA Healthcare System, Long Beach, CA Professor of Medicine, Emeritus University of California, Irvine Colonel

More information

AUTOIMMUNITY TOLERANCE TO SELF

AUTOIMMUNITY TOLERANCE TO SELF AUTOIMMUNITY CLINICAL CORRELATES Pamela E. Prete, MD, FACP, FACR Section Chief, Rheumatology VA Healthcare System, Long Beach, CA Professor of Medicine, Emeritus University of California, Irvine Colonel

More information

THYROID DISORDERS ARE more common in women

THYROID DISORDERS ARE more common in women 0021-972X/04/$15.00/0 The Journal of Clinical Endocrinology & Metabolism 89(11):5810 5814 Printed in U.S.A. Copyright 2004 by The Endocrine Society doi: 10.1210/jc.2004-1049 Thyroid Fetal Male Microchimerisms

More information

DQA1 and DQB1 Promoter diversity and linkage disequilibrium with class II haplotypes in Mexican Mestizo population

DQA1 and DQB1 Promoter diversity and linkage disequilibrium with class II haplotypes in Mexican Mestizo population (2001) 2, 216 221 2001 Nature Publishing Group All rights reserved 1466-4879/01 $15.00 www.nature.com/gene DQA1 and DQB1 Promoter diversity and linkage disequilibrium with class II haplotypes in Mexican

More information

HLA Genetic Discrepancy Between Latent Autoimmune Diabetes in Adults and Type 1 Diabetes: LADA China Study No. 6

HLA Genetic Discrepancy Between Latent Autoimmune Diabetes in Adults and Type 1 Diabetes: LADA China Study No. 6 ORIGINAL ARTICLE HLA Genetic Discrepancy Between Latent Autoimmune Diabetes in Adults and Type 1 Diabetes: LADA China Study No. 6 Shuoming Luo,* Jian Lin,* Zhiguo Xie,* Yufei Xiang, Peilin Zheng, Gan Huang,

More information

Antigen Receptor Structures October 14, Ram Savan

Antigen Receptor Structures October 14, Ram Savan Antigen Receptor Structures October 14, 2016 Ram Savan savanram@uw.edu 441 Lecture #8 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Today): Structural features of the BCR and TCR Janeway Chapter

More information

Graves' disease and HLA association

Graves' disease and HLA association ISSN: 2319-7706 Volume 3 Number 1 (2014) pp. 155-159 http://www.ijcmas.com Review Article Graves' disease and HLA association Batool Mutar Mahdi* Director of HLA Typing Research Unit, Depatment of Microbiology,

More information

Immune responses in autoimmune diseases

Immune responses in autoimmune diseases Immune responses in autoimmune diseases Erika Jensen-Jarolim Dept. of Pathophysiology Medical University Vienna CCHD Lecture January 24, 2007 Primary immune organs: Bone marrow Thymus Secondary: Lymph

More information

[AUTOIMMUNITY] July 14, 2013

[AUTOIMMUNITY] July 14, 2013 This sheet includes only the extra notes. Slide 5,6: [AUTOIMMUNITY] July 14, 2013 Autoimmunity is the condition or case where the immune system is activated by self antigensand when the immune system no

More information

Recurrent Early Pregnancy Loss

Recurrent Early Pregnancy Loss Recurrent Early Pregnancy Loss and the Role of Ultrasound Charles J. Lockwood, M.D. Dean, of the College of Medicine and Vice President for Health Sciences, The Ohio State University Introduction Recurrent

More information

SALSA MLPA KIT P050-B2 CAH

SALSA MLPA KIT P050-B2 CAH SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to

More information

Association of anti-mcv autoantibodies with SLE (Systemic Lupus Erythematosus) overlapping with various syndromes

Association of anti-mcv autoantibodies with SLE (Systemic Lupus Erythematosus) overlapping with various syndromes International Journal of Medicine and Medical Sciences Vol. () pp. 21-214, June 211 Available online http://www.academicjournals.org/ijmms ISSN 2-972 211 Academic Journals Full Length Research Paper Association

More information

Minimal Requirements for Histocompatibility & Immunogenetics Laboratory

Minimal Requirements for Histocompatibility & Immunogenetics Laboratory Minimal Requirements for Histocompatibility & Immunogenetics Laboratory The 4 th WBMT Congress and Workshop Riyadh, KSA - January 15-17, 2017 HLA Discovery, 1958 The Nobel Prize in Physiology or Medicine

More information

Staging of Type 1 Diabetes: Clinical Implications. April Deborah Hefty, MN, RN, CDE.

Staging of Type 1 Diabetes: Clinical Implications. April Deborah Hefty, MN, RN, CDE. Staging of Type 1 Diabetes: TT Clinical Implications April 2016 Deborah Hefty, MN, RN, CDE dhefty@benaroyaresearch.org BRI s major contributions to type 1 diabetes research Identified type 1 diabetes susceptibility

More information

Use of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing of Patients with Narcolepsy

Use of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing of Patients with Narcolepsy Original Article Woo HI, et al. Diagnostic Immunology Ann Lab Med 2012;32:57-65 ISSN 2234-3806 eissn 2234-3814 Use of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing

More information

Autoimmunity. By: Nadia Chanzu, PhD Student, UNITID Infectious Minds Presentation November 17, 2011

Autoimmunity. By: Nadia Chanzu, PhD Student, UNITID Infectious Minds Presentation November 17, 2011 Molecular Mechanisms of Autoimmunity By: Nadia Chanzu, PhD Student, UNITID Infectious Minds Presentation November 17, 2011 Introduction 3m Pick an organ, any organ... Autoimmunity can affect ANY organ/organ

More information

The Adaptive Immune Response. T-cells

The Adaptive Immune Response. T-cells The Adaptive Immune Response T-cells T Lymphocytes T lymphocytes develop from precursors in the thymus. Mature T cells are found in the blood, where they constitute 60% to 70% of lymphocytes, and in T-cell

More information

Association of HLA-DRB1 Alleles with Juvenile-onset Systemic Lupus Erythematosus (SLE) in Iranian Children

Association of HLA-DRB1 Alleles with Juvenile-onset Systemic Lupus Erythematosus (SLE) in Iranian Children http:// ijp.mums.ac.ir Original Article (Pages: 555-560) Association of HLA-DRB1 Alleles with Juvenile-onset Systemic Lupus Erythematosus (SLE) in Iranian Children Shirin Farivar 1, *Masoud Dehghan Tezerjani

More information

HLA TYPING AND EXPRESSION: POTENTIAL MARKER FOR IDENTIFYING EARLY DYSPLASIA AND STRATIFYING THE RISK FOR IBD-CANCER

HLA TYPING AND EXPRESSION: POTENTIAL MARKER FOR IDENTIFYING EARLY DYSPLASIA AND STRATIFYING THE RISK FOR IBD-CANCER HLA TYPING AND EXPRESSION: POTENTIAL MARKER FOR IDENTIFYING EARLY DYSPLASIA AND STRATIFYING THE RISK FOR IBD-CANCER Megan Garrity, S. Breanndan Moore, M.D., William Sandborn, M.D., Vernon Pankratz, Ph.D.,

More information

HLA class I and II alleles may influence susceptibility to adult dermatomyositis in a Mexican mestizo population

HLA class I and II alleles may influence susceptibility to adult dermatomyositis in a Mexican mestizo population International Journal of Clinical Rheumatology HLA class I and II alleles may influence susceptibility to adult dermatomyositis in a Mexican mestizo population Objective: To investigate the possible association

More information

Autoimmunity and Principles of Transplantation Immunology

Autoimmunity and Principles of Transplantation Immunology Module Code: Module Title: IMM III Autoimmunity and Principles of Transplantation Immunology Module Convenors: Emeritus Professor Jennifer Rolland and Dr Karla Lemmert Discipline: Professor Allan Cripps

More information

Tuberculosis (TB) is still an important world

Tuberculosis (TB) is still an important world Human Leukocyte Antigen-Associated Susceptibility to Pulmonary Tuberculosis* Molecular Analysis of Class II Alleles by DNA Amplification and Oligonucleotide Hybridization in Mexican Patients David Terán-Escandón,

More information

Class I Ag processing. TAP= transporters associated with antigen processing Transport peptides into ER

Class I Ag processing. TAP= transporters associated with antigen processing Transport peptides into ER Antigen processing Class I Ag processing TAP= transporters associated with antigen processing Transport peptides into ER Proteosome degrades cytosolic proteins Large, multi-subunit complex Degrades foreign

More information

Genotyping of HLA-class-I by PCR-SSP of Iraqi Breast Cancer Patients

Genotyping of HLA-class-I by PCR-SSP of Iraqi Breast Cancer Patients Genotyping of HLA-class-I by PCR-SSP of Iraqi Breast Cancer Patients Ahmed A.Al-Hassan 1 PhD, Nidhal Abdul Muhymen 1 MSc;PhD,Ala'a Ghany Hussien 2 FICMS, Ameera J. Al-Nema 3 MBChB. Abstract Background:

More information

The Relationship between Minor Histocompatibility Antigens and Graft Versus Host Disease in Unrelated Peripheral Blood Stem Cell Transplants

The Relationship between Minor Histocompatibility Antigens and Graft Versus Host Disease in Unrelated Peripheral Blood Stem Cell Transplants mhags and GVHD Page 1 The Relationship between Minor Histocompatibility Antigens and Graft Versus Host Disease in Unrelated Peripheral Blood Stem Cell Transplants Running Title: mhags and GVHD Conflict

More information

Systemic lupus erythematosus in 50 year olds

Systemic lupus erythematosus in 50 year olds Postgrad Med J (1992) 68, 440-444 The Fellowship of Postgraduate Medicine, 1992 Systemic lupus erythematosus in 50 year olds I. Domenech, 0. Aydintug, R. Cervera, M. Khamashta, A. Jedryka-Goral, J.L. Vianna

More information

Introduction to Genetics

Introduction to Genetics Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist

More information

T-cell receptor feature. Antibody/antigen interaction. Major Histocompatibility Complex. Antigen processing. Antigen presentation

T-cell receptor feature. Antibody/antigen interaction. Major Histocompatibility Complex. Antigen processing. Antigen presentation ntibody/antigen interaction Major Histocompatibility Complex ntigen processing ntigen presentation PC/T-cell interaction T-cell receptor feature CD4+ T-Cell HL/peptide/TCR complex CD8+ T-Cell Proteasome

More information

Correlation between MTHFR gene methylation and pre-eclampsia, and its clinical significance

Correlation between MTHFR gene methylation and pre-eclampsia, and its clinical significance Correlation between MTHFR gene methylation and pre-eclampsia, and its clinical significance J. Ge, J. Wang, F. Zhang, B. Diao, Z.F. Song, L.L. Shan, W. Wang, H.J. Cao and X.Q. Li General Hospital of Shenyang

More information

Silent mutations in the phenylalanine hydroxylase

Silent mutations in the phenylalanine hydroxylase 6866 Med Genet 1991; 28: 686-690 Silent mutations in the phenylalanine hydroxylase gene as an aid to the diagnosis of phenylketonuria L Kalaydjieva, B Dworniczak, C Aulehla-Scholz,M Devoto, G Romeo, M

More information

ASHI Proficiency Testing Program Summary Report. Survey 2013-HT1 / HLA Typing

ASHI Proficiency Testing Program Summary Report. Survey 2013-HT1 / HLA Typing ASHI Proficiency Testing Program Summary Report Survey 2013-HT1 / HLA Typing Shipping Date: February 26,2013 / Results Due Date:April 5,2013 / Report Date: May 17,2013 The ASHI HT proficiency testing survey

More information

Ultrastructural Studies on Plasmodium vivax

Ultrastructural Studies on Plasmodium vivax Characterization of Human Malaria Parasites Ultrastructural Studies on Plasmodium vivax For the first time a detailed ultrastructural study was carried out on P. vivax. Fine structural analysis of growth

More information

Distribution of HLA Antigens Class I and II in Iraqi Arab population

Distribution of HLA Antigens Class I and II in Iraqi Arab population Distribution of HLA s Class I and II in Iraqi Arab population *Ahmed A.A. Al-Hassan, MSc, Immunology ; **Sana a Al-Naseri, MD, ph.d, immunopathology *** Batool H. Al-Ghurabi, ph.d, Immunology **** Mohammed

More information

Chromosomal Structural Abnormalities among Filipino Couples with Recurrent Pregnancy Losses

Chromosomal Structural Abnormalities among Filipino Couples with Recurrent Pregnancy Losses ORIGINAL CASE REPORT ARTICLE Chromosomal Structural Abnormalities among Filipino Couples with Recurrent Pregnancy Losses Eva Maria Cutiongco-dela Paz,,2 April Grace Dion-Berboso, Edsel Allan G. Salonga

More information

Use of Serological markers for evaluation of patients with Rheumatoid arthritis

Use of Serological markers for evaluation of patients with Rheumatoid arthritis ISSN: 2319-7706 Volume 4 Number 9 (2015) pp. 61-66 http://www.ijcmas.com Original Research Article Use of Serological markers for evaluation of patients with Rheumatoid arthritis G. Sucilathangam*, G.

More information

The role of HLA in Allogeneic Hematopoietic Stem Cell Transplantation and Platelet Refractoriness.

The role of HLA in Allogeneic Hematopoietic Stem Cell Transplantation and Platelet Refractoriness. The role of HLA in Allogeneic Hematopoietic Stem Cell Transplantation and Platelet Refractoriness. Robert Liwski, MD, PhD, FRCPC Medical Director HLA Typing Laboratory Department of Pathology Dalhousie

More information

HLA class III region and susceptibility to rheumatoid arthritis

HLA class III region and susceptibility to rheumatoid arthritis Hypothalamus-pituitary-adrenocortical and -gonadal axis in RA Colour / M. Cutolo Doppler sonography in knee joint synovitis / W.A. EDITORIAL Schmidt et al. HLA class III region and susceptibility to rheumatoid

More information

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters,

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, Immunology T-Lymphocytes 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, karin.peters@rub.de The role of T-effector cells in the immune response against microbes cellular immunity humoral immunity

More information

MicroRNA and Male Infertility: A Potential for Diagnosis

MicroRNA and Male Infertility: A Potential for Diagnosis Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic

More information

Infection of autoreactive B lymphocytes with EBV, causing chronic autoimmune diseases

Infection of autoreactive B lymphocytes with EBV, causing chronic autoimmune diseases 584 Infection of autoreactive B lymphocytes with EBV, causing chronic autoimmune diseases Michael P. Pender Department of Medicine, The University of Queensland, Clinical Sciences Building, Royal Brisbane

More information

IMMUNOWELL CARDIOLIPIN ANTIBODY (IGM) TEST

IMMUNOWELL CARDIOLIPIN ANTIBODY (IGM) TEST IMMUNOWELL CARDIOLIPIN ANTIBODY (IGM) TEST Product No. 3100 For In Vitro Diagnostic Use SEE CALIBRATION VALUES, TABLE 2, PAGE 3 INTENDED USE The ImmunoWELL Cardiolipin Antibody (IgM) Test is an enzyme

More information

SNP array-based analyses of unbalanced embryos as a reference to distinguish between balanced translocation carrier and normal blastocysts

SNP array-based analyses of unbalanced embryos as a reference to distinguish between balanced translocation carrier and normal blastocysts J Assist Reprod Genet (2016) 33:1115 1119 DOI 10.1007/s10815-016-0734-0 TECHNOLOGICAL INNOVATIONS SNP array-based analyses of unbalanced embryos as a reference to distinguish between balanced translocation

More information

Evgenija Homšak,M.Ph., M.Sc., EuSpLM. Department for laboratory diagnostics University Clinical Centre Maribor Slovenia

Evgenija Homšak,M.Ph., M.Sc., EuSpLM. Department for laboratory diagnostics University Clinical Centre Maribor Slovenia Evgenija Homšak,M.Ph., M.Sc., EuSpLM. Department for laboratory diagnostics University Clinical Centre Maribor Slovenia 14th EFLM Continuing Postgraduate Course in Clinical Chemistry and Laboratory Medicine

More information

How T cells recognize antigen. How T cells recognize antigen -concepts

How T cells recognize antigen. How T cells recognize antigen -concepts Adaptive immunity How T cells recognize antigen Starting point: 2. Diversity in antigen recognition is accomplished, in part, by rearrangements in the TCR loci. This occurs in the thymus 3. The T cell

More information

7.1 Molecular Characterization of Fragile X Syndrome

7.1 Molecular Characterization of Fragile X Syndrome 7 GENETIC DISORDERS Advances in knowledge of molecular genetics, cytogenetics and biochemical genetics have led to availability of diagnostic tests for various genetic disorders. The most important application

More information

HLA class I alleles tag HLA-DRB1*1501 haplotypes for differential risk in multiple sclerosis susceptibility

HLA class I alleles tag HLA-DRB1*1501 haplotypes for differential risk in multiple sclerosis susceptibility HLA class I alleles tag HLA-DRB1*1501 haplotypes for differential risk in multiple sclerosis susceptibility Michael J. Chao, Martin C. N. M. Barnardo, Matthew R. Lincoln, Sreeram V. Ramagopalan, Blanca

More information

α chain β chain C N C N β 2 α 1 β 1 α 2

α chain β chain C N C N β 2 α 1 β 1 α 2 a α chain c β chain C N C N β 2 m α chain b d N C N C β 1 α 2 Supplemental Figure 1 Major histocompatibility complex (MHC) class I and class II structures. (a, b)representation of the structure of the

More information

Sesh Kamal Sunkara Aberdeen Fertility Centre Aberdeen Maternity Hospital University of Aberdeen Aberdeen, UK

Sesh Kamal Sunkara Aberdeen Fertility Centre Aberdeen Maternity Hospital University of Aberdeen Aberdeen, UK Sesh Kamal Sunkara Aberdeen Fertility Centre Aberdeen Maternity Hospital University of Aberdeen Aberdeen, UK Declared no potential conflict of interest Genetic aetiology of poor and hyper responders Sesh

More information

Immunology Lecture 4. Clinical Relevance of the Immune System

Immunology Lecture 4. Clinical Relevance of the Immune System Immunology Lecture 4 The Well Patient: How innate and adaptive immune responses maintain health - 13, pg 169-181, 191-195. Immune Deficiency - 15 Autoimmunity - 16 Transplantation - 17, pg 260-270 Tumor

More information

MHC Class II. Alexandra López Laura Taberner Gemma Vilajosana Ilia Villate. Structural Biology Academic year Universitat Pompeu Fabra

MHC Class II. Alexandra López Laura Taberner Gemma Vilajosana Ilia Villate. Structural Biology Academic year Universitat Pompeu Fabra MHC Class II Alexandra López Laura Taberner Gemma Vilajosana Ilia Villate Structural Biology Academic year 2012-2013 Universitat Pompeu Fabra Index - Introduction - Peptide binding to MHC class II - pockets

More information

Phase of immune response

Phase of immune response Antigen and antigen recognition by lymphocytes Antigen presentation to T lymphocytes Sanipa Suradhat Department of Veterinary Microbiology Faculty of Veterinary Science Phase of immune response 1 Phase

More information

Antibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity

Antibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity Antibodies and T Cell Receptor Genetics 2008 Peter Burrows 4-6529 peterb@uab.edu Generation of Antigen Receptor Diversity Survival requires B and T cell receptor diversity to respond to the diversity of

More information

Autoimmunity Origins. Horror autotoxicus: Literally, the horror of self-toxicity.

Autoimmunity Origins. Horror autotoxicus: Literally, the horror of self-toxicity. Autoimmunity Autoimmunity Origins Horror autotoxicus: Literally, the horror of self-toxicity. A term coined by the German immunologist Paul Ehrlich (1854-1915) to describe the body's innate aversion to

More information