Human leukocyte antigen class II genotype in patients with recurrent fetal miscarriage who are positive for anticardiolipin antibody

Size: px
Start display at page:

Download "Human leukocyte antigen class II genotype in patients with recurrent fetal miscarriage who are positive for anticardiolipin antibody"


1 FERTILITY AND STERILITY VOL. 70, NO. 5, NOVEMBER 1998 Copyright 1998 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Human leukocyte antigen class II in patients with recurrent fetal miscarriage who are positive for anticardiolipin antibody Isao Hataya, M.D., Koichi Takakuwa, M.D., and Kenichi Tanaka, M.D. Department of Obstetrics and Gynecology, Niigata University School of Medicine, Asahimachi-dori, Niigata, Japan Objective: To elucidate the relationship between human leukocyte antigen (HLA) class II s and patients with recurrent fetal miscarriage who are positive for anticardiolipin antibody. Design: Prospective clinical study. Setting: Institutional practice at the outpatient clinic for infertility, Niigata University Medical Hospital. Patient(s): with recurrent fetal miscarriage who were positive for anticardiolipin antibody and normal fertile women. Intervention(s): Genomic DNA was extracted from peripheral mononuclear cells. Main Outcome Measure(s): Human leukocyte antigen class II was determined using a polymerase chain reaction restriction fragment length polymorphism method. Result(s): The frequencies of DRB1*0403 and DRB1*0410 were significantly higher in the patient group than in the control group. The frequency of DRB1*04 also was significantly higher in the patient group. As for HLA-DQ, the frequency of HLA-DQB1*0501 was significantly lower in the patient group. Conclusion: Human leukocyte antigen systems appear to be involved in the genesis of antiphospholipid syndrome. (Fertil Steril 1998;70: by American Society for Reproductive Medicine.) Key Words: Anticardiolipin antibody, antiphospholipid syndrome,, HLA class II, PCR-RFLP Received March 13, 1998; revised and accepted June 26, Reprint requests: Isao Hataya, M.D., Department of Obstetrics and Gynecology, Niigata University School of Medicine, 1-757, Asahimachi-dori, Niigata, , Japan (FAX: ) /98/$19.00 PII S (98) It has recently been suggested that autoimmune mechanisms are involved in the genesis of fetal miscarriage, including spontaneous abortion and intrauterine fetal demise. The concept of a new disease, the antiphospholipid syndrome or the reproductive autoimmune failure syndrome, has been proposed (1 4) and has been supported by several clinical reports (5 11), in which patients have diverse reproductive failures. These include recurrent fetal miscarriage, intrauterine fetal growth retardation, and preeclampsia, in connection with positivity for antiphospholipid antibodies. The abnormal generation of autoantibodies, such as those directed against phospholipids, in these patients is thought to suggest aberrations in immune regulation. The immunologic background of this disease entity, however, has not yet been analyzed fully. The human leukocyte antigen (HLA) systems are useful in examining the immunogenetic basis of some diseases because these systems control both the immune response to natural antigens and the susceptibility or resistance to several diseases, especially autoimmune diseases (12). It is also possible that HLA antigen systems are associated with recurrent fetal miscarriage in patients who are positive for antiphospholipid antibodies. Several reports based on serologic HLA typing have pointed out the positive association between patients with recurrent fetal miscarriage who are positive for antiphospholipid antibodies and specific HLA alleles (13, 14). A molecular genetic approach for determining HLA class II genes, however, has not yet been taken to analyze the association between the patients and specific HLA alleles. Polymerase chain reaction (PCR) in combination with restriction fragment length poly- 919

2 TABLE 1 Polymerase chain reaction primers for amplification of DRB1, DQB1, and DPB1 genes. Gene Primer Sequences (5 to 3 ) No. of base pairs Denaturing Annealing Extension DRB1 for DR2 5 primer 5 R2 TTCCTGTGGCAGCCTAAGAGG C 60 C 72 C for DR4 5 primer 5 R4 GTTTCTTGGAGCAGGTTAAAC C 60 C 72 C for DR1 5 primer 5 R1 GGTTGCTGGAAAGATGCATCT C 55 C 72 C for DR7 5 primer 5 R7 AGTTCCTGGAAAGACTCTTCT C 60 C 72 C for DR10 5 primer 5 R10 GGTTGCTGGAAAGACGCGTCC C 60 C 72 C for DR3 5 primer 5 R3568 ACGTTTCTTGGAGTACTCTACG C 60 C 72 C DR5 DR6 DR8 3 primer 3 R* CCGCTGCACTGTGAAGCTCT for DR9 5 primer 5 R9 GGACGGAGCGGGTGCGGTATC C 63 C 72 C 3 primer CCGTAGTTGTGTCTGCACACGG DQB1 for DQ1 5 primer GH28NL GCATGTGCTACTTCACCAACG C 55 C 72 C 3 primer QB202 CACCTGCAGATCCCGCGGTACGCCACCTC for DQ2 5 primer GH28NL GCATGTGCTACTTCACCAACG C 55 C 72 C DQ3 3 primer QB204 CACCTGCAGTGCGGAGCTCCAACTGGTA DQ4 DPB1 5 primer DPB101N GTGAAGCTTTCCCCGCAGAGAATTAC C 62 C 72 C 3 primer DPB201 CACCTGCAGTCACTCACCTCGGCGCTG * Common for DRB1 alleles except DR9 allele. morphism (RFLP) recently has become available for use in typing HLA class II genes at the nucleotide sequence level, thus enabling us to determine accurately two alleles of HLA class II genes in individuals (15 17). In this study, the frequency of s of HLA-DR, HLA-DQ, and HLA-DP antigens was evaluated by means of the PCR- RFLP method. This was done to clarify the role of the HLA class II antigens in patients positive for anticardiolipin antibody who repeatedly have fetal miscarriages. MATERIALS AND METHODS Fifty-six patients who experienced two or more recurrent abortions or fetal deaths and who were positive for anticardiolipin antibodies were enrolled in this study; all patients gave informed consent. with autoimmune disease, such as systemic lupus erythematosus (SLE), were excluded from the study. The control group consisted of 76 women who had not had recurrent fetal miscarriage and who had had at least two normal deliveries; these women were examined for HLA class II s after informed consent was obtained. All women in the control group were negative for anticardiolipin antibody. All individuals were Japanese women, and the difference between the mean age of the individuals in the two groups was not statistically significant. Measurement of Anticardiolipin Antibody Levels of anticardiolipin antibody were determined with use of an ELISA according to the modified method of Loizou et al. (18). Details of the method have been described elsewhere (9). GPL units in the test serum were estimated according to the standard curve drawn from the titration of control serum, and the cutoff value was 20 GPL units of the anticardiolipin antibody. Analyses of HLA Class II Genotypes Analyses of HLA-DRB1 s, HLA-DQB1 s, and HLA-DPB1 s were performed with use of the PCR-RFLP method. Primers used in this study are listed in Table 1, and endonucleases are listed in Table 2. TABLE 2 Restriction endonucleases for genotyping of DRB1, DQB1, and DPB1 alleles. Allele Antigen Restriction endonuclease DRB1 DR1 AvaII, PstI DR2 FokI, Cfr13I, HphI DR3, DR5, DR6, DR8 AvaII, FokI, KpnI, HaeII, Cfr13I, SfaNI, SacII, BsaJI, ApaI, HphI, RsaI DR4 Sac II, AvaII, HinfI, HaeII, HphI, MnlI DQB1 DQ1 FokI, ApaI, HaeII, StaNI, BssHII, HphI DQ2, DQ3, DQ4 FokI, BglI, SacI, AcyI, HpaII DPB1 Bsp1286I, FokI, DdeI, BsaJI, BssHII, Cfr13I, RsaI, EcoNI, AvaII 920 Hataya et al. HLA class II and antiphospholipid syndrome Vol. 70, No. 5, November 1998

3 Genomic DNA extracted from peripheral lymphocytes was amplified by the PCR procedure. The second exon of DRB1 genes for DR2, DR4, DR1, DR7, DR10, DR3, DR5, DR6, and DR8 was amplified using one of six group-specific 5 primers along with the common 3 primer. The second exon of the DRB1 gene for DR9 was amplified using a specific 5 primer and a 3 primer (15). A 241 base pair fragment from the second exon of the HLA-DQB1 gene was amplified by using DQ1 group-specific primers, and a 237 base pair fragment was amplified using DQ2, DQ3, and DQ4 group-specific primers, according to the methods described by Nomura et al. (16). A 299 base pair fragment from the second exon of the HLA- DPB1 gene was amplified with use of PCR primers according to the methods described by Ota et al. (17). After amplification, aliquots of the reaction mixture were digested by allele-specific restriction endonucleases. The samples were subjected to electrophoresis in a minigel apparatus (AE6450; Atto Corporation, Tokyo, Japan). HLA- DRB1 gene, HLA-DQB1 gene, and HLA-DPB1 gene types were determined by comparing the patterns of RFLP obtained in tested individuals with those of amplified DRB1, DQB1, and DPB1 genes, as reported by Ota et al. (15), Nomura et al. (16) and Ota et al. (17), respectively. Institutional review board approval was obtained for this study. Statistical Analysis The relative risk (RR) was calculated with a 95% confidence interval (CI) to analyze whether there was a statistically significant difference between the frequency of a certain HLA in the patient group and that in the control group. RESULTS The frequencies of DRB1*0403 and DRB1*0410 were significantly higher in the patient group than in the control group (RR 4.44, 95% CI ; and RR 8.55, 95% CI , respectively). The frequency of DRB1*04 also was significantly higher in the patient group (RR 2.44, 95% CI ) (Table 3). As for HLA-DQ, the frequency of DQB1*0501 was significantly lower in the patient group (RR 0.21, 95% CI ). The frequencies of other s of HLA-DQ antigens were not significantly different between the groups (Table 4). No statistically significant difference in the frequency of HLA-DP s was observed between the groups (Table 5). DISCUSSION In studying the immunologic background of the patients with recurrent fetal miscarriage who were positive for anticardiolipin antibody, we found that the frequency of certain TABLE 3 Frequency of HLA-DRB1 in patients and DRB1 Percentage of indicated * (no. of loci with indicated ) HLA class II s in the patient group was significantly different from that in the normal fertile female population. It has recently been suggested that autoimmune factors, especially newly defined autoantibodies such as antiphospholipid antibodies, are implicated in such adverse outcomes of pregnancy as spontaneous abortion, fetal death, fetal growth retardation, and preeclampsia. Hughes et al. (1) first described the antiphospholipid syndrome, in which patients had general thrombosis and recurrent fetal miscarriage and showed positivity for antiphospholipid antibodies. Gleicher and colleagues (2 4) postulated a reproductive autoimmune failure syndrome in which autoimmune factors, such as lupus anticoagulant or antiphospholipid antibodies, are implicated in the genesis of unexplained recurrent fetal miscarriage. It has recently been shown that most autoimmune dis- RR 95% CI (1) 6.6 (10) (2) 2.0 (3) (12) 2.6 (4) (1) (10) 8.6 (13) (3) 0.7 (1) (1) (6) 0.7 (1) (2) (1) (2) 5.3 (8) (8) 8.6 (13) (14) 13.2 (20) (1) 0.7 (1) (2) 0.7 (1) (4) 2.6 (4) (1) 2.0 (3) (3) 5.3 (8) (6) 7.9 (12) (6) 2.6 (4) (1) 0.7 (1) (6) (1) (4) 3.9 (6) (1) (8) 5.9 (9) (14) 11.2 (17) (4) (34) 15.1 (23) Note: All values for the RR and 95% CI were not statistically significant, with the exception of those indicated. FERTILITY & STERILITY 921

4 TABLE 4 Frequency of HLA-DQB1 in patients and DQB1 Percentage of indicated * (no. of loci with indicated ) eases have a significant relationship with the HLA antigen system; in particular, HLA class II antigens were found to be related closely to diseases. For example, Badenhoop et al. (19) noted the association of DQA1*0201/*0301 heterozygotes and Hashimoto s disease. They also demonstrated the involvement of the HLA-DQ gene in the genesis of a typical endocrine autoimmune disease, type I diabetes mellitus, and Graves disease using the PCR and sequence-specific oligonucleotide hybridization method (20). RR 95% CI (1) 0.7 (1) (8) 9.9 (15) (16) 10.5 (16) (16) 12.5 (19) (10) 7.9 (12) (8) 2.6 (4) (2) 7.9 (12) (4) 4.6 (7) (7) 4.6 (7) (25) 17.8 (27) (9) 11.2 (17) (6) 9.9 (15) Note: All values for the RR and 95% CI were not statistically significant, with the exception of those indicated. TABLE 5 Frequency of HLA-DPB1 in patients and DPB1 Percentage of indicated * (no. of loci with indicated ) (29) 22.4 (34) (3) 3.3 (5) (9) 2.6 (4) (2) 4.6 (7) (9) 9.2 (14) (39) 38.8 (59) (1) 2.0 (3) (11) 9.9 (15) (2) 0.7 (1) (5) 2.6 (4) (1) 1.3 (2) (2) (1) 1.3 (2) Note: The RR with 95% CI of each HLA-DP was not significant. In this study, we investigated the s of HLA class II antigens HLA-DR, HLA-DQ, and HLA-DP using the PCR-RFLP method in patients with recurrent fetal miscarriage who were positive for anticardiolipin antibody. The frequencies of DRB1*0403 and DRB1*0410 were significantly higher in patients than in the control group. As for HLA-DQ, the frequency of HLA-DQB1*0501 was significantly lower in the patient group. Granados et al. (13) reported that Mexican patients with SLE who were positive for anticardiolipin antibody had significantly increased corrected frequencies of the HLA- DR3, HLA-DR7, and HLA-DQ2 antigens. Sebastiani et al. (14) reported that the antiphospholipid antibody and the lupus anticoagulant occurred in families carrying haplotypes that contain HLA-DR4, HLA-DR7, and HLA-DR53. In this study, the relationship between the HLA-DR3 and HLA-DR7 antigens and patients with the anticardiolipin antibody was not detected because these antigens are rare in the Japanese population. The known higher frequency of HLA-DR4 is reflected in the findings of our study. The finding of a significantly lower frequency of HLA- DQB1*0501 is unique to our study. Although recent investigation has indicated the critical role of specific HLA-DQ polymorphisms in establishing the nature of bound antigens, thereby influencing the potential immune repertoire (21), the mechanisms behind the significantly lower frequency of HLA-DQB1*0501 in patients with this disease have not been understood. The etiologic agent that triggers the generation of the anticardiolipin antibody in susceptible individuals has not been identified. The possibility of direct involvement of the non-hla gene, which is linked strongly to the class II region, cannot be excluded in the generation of the anticardiolipin antibody in these patients. Recent genetic analysis by van Endert et al. (22) demonstrated that the genes in the class II region are involved in the processing of antigenic proteins for presentation by major histocompatibility complex class I molecules. The analysis indicated a strong linkage disequilibrium between TAP (the transporter associated with antigen processing) genes and LMP (the low-molecular-mass polypeptide) genes and class II regions. Their allelic polymorphism should be studied in patients positive for anticardiolipin antibody to determine the primary locus within the class II region that is responsible for genetic susceptibility to disease. There is also the possibility that patients become positive for anticardiolipin antibodies because of amino acid residues in DRB1 molecules. It is also possible that a specially processed epitope on a foreign or self-triggered antigen may have a specific, unusual affinity for the DRB1 molecule with DR4 specificities, leading to the generation of the anticardiolipin antibody in these patients. Examination of amino acid residues from the DRB1 al- 922 Hataya et al. HLA class II and antiphospholipid syndrome Vol. 70, No. 5, November 1998

5 leles has shown that histidine at position 13 is specific to DR4, the frequency of which was increased in our patients. The first hypervariable region (amino acid residues at positions 9 to 13) is located on the beta-strands of the sheet at the bottom of the antigen binding groove described by Brown et al. (23, 24); amino acids residing at positions 9, 11, and 13 display a high degree of polymorphism. Therefore, it seems likely that histidine at position 13 contributed to the predisposition toward production of the anticardiolipin antibody in our patients. References 1. Hughes GRV, Harris EN, Gharavi AE. The anticardiolipin syndrome. J Rheumatol 1986;13: Gleicher N, El-Roeiy A. The reproductive autoimmune failure syndrome. Am J Obstet Gynecol 1988;159: Gleicher N. Antiphospholipid antibodies and reproductive failure: what they do and what they do not do; how to, and how not to treat. Hum Reprod 1997;1: Gleicher N, Harlow L, Zilberstein M. Regulatory effect of antiphospholipid antibodies on signal transduction: a possible model for autoantibody-induced reproductive failure. Am J Obstet Gynecol 1992;167: Lubbe WF, Butler WS, Palmer SJ, Liggins GC. Fetal survival after prednisone suppression of maternal lupus-anticoagulant. Lancet 1983; 1: Branch DW, Scott JR, Kochenour NK, Hershgold E. Obstetric complications associated with the lupus anticoagulant. N Engl J Med 1985; 313: Hasegawa I, Takakuwa K, Goto S, Yamada K, Kanazawa K, Tanaka K, et al. Effectiveness of prednisolone/aspirin therapy for recurrent aborters with antiphospholipid antibodies. Hum Reprod 1992;7: Takakuwa K, Asano K, Arakawa M, Yasuda M, Hasegawa I, Tanaka K. Chromosome analysis of aborted conceptuses of recurrent aborters positive for anticardiolipin antibody. Fertil Steril 1997;68: Yasuda M, Takakuwa K, Tokunaga A, Tanaka K. Prospective studies of the association between anticardiolipin antibody and outcome of pregnancy. Obstet Gynecol 1995;86: Yasuda M, Takakuwa K, Higashino M, Ishii S, Kazama Y, Tanaka K, et al. A typical case of reproductive autoimmune failure syndrome in which a patient experienced recurrent abortion, preeclampsia, and intrauterine growth retardation. Am J Reprod Immunol 1993;29: Takakuwa K, Yasuda M, Hataya I, Tamura M, Arakawa M, Tanaka K, et al. Treatment for patients with recurrent abortion with positive antiphospholipid antibodies using a traditional Chinese herbal medicine. J Perinat Med 1996;24: Thomson G. Human HLA genetics and disease associations. In: Weir DM, ed. Handbook of experimental immunology. Vol. 3. Genetics and molecular immunology. Oxford: Blackwell Scientific, 1986: Granados J, Vargas-Alarcon G, Drenkard C, Andrade F, Melin-Aldana H, Alcocer-Varela J, et al. Relationship between anticardiolipin antibodies and antiphospholipid syndrome to HLA-DR7 in Mexican patients with systemic lupus erythematosus (SLE). Lupus 1997;6: Sebastiani GD, Galeazzi M, Morozzi G, Marcolongo R. The immunogenetics of the antiphospholipid syndrome, anticardiolipin antibodies, and lupus anticoagulant. Semin Arthritis Rheum 1996;25: Ota M, Seki T, Fukushima H, Tsuji K, Inoko H. HLA-DRB1 genotyping by modified PCR-RFLP method combined with group-specific primers. Tissue Antigens 1992;39: Nomura N, Ota M, Tsuji K, Inoko H. HLA-DQB1 genotyping by a modified PCR-RFLP method combined with group-specific primers. Tissue Antigens 1991;38: Ota M, Seki T, Nomura N, Sugimura K, Mizuki N, Fukushima H, et al. Modified PCR-RFLP method for HLA-DPB1 and -DQA1 genotyping. Tissue Antigens 1991;38: Loizou S, MacCrea JD, Rudge AC. Measurement of anticardiolipin antibodies by an enzyme-linked immunosorbent assay (ELISA). Clin Exp Immunol 1985;62: Badenhoop K, Schwarz G, Walfish PG, Drummond V, Usadel KH, Bottazzo GF. Susceptibility to thyroid autoimmune disease: molecular analysis of HLA-D region genes identifies new markers for goitrous Hashimoto s thyroiditis. J Clin Endocrinol Metab 1990;71: Badenhoop K, Walfish PG, Rau H, Fischer S, Nicolay A, Bogner U, et al. Susceptibility and resistance alleles of human leukocyte antigen (HLA) DQA1 and HLA DQB1 are shared in endocrine autoimmune disease. J Clin Endocrinol Metab 1995;80: Kwok WW, Nepom GT, Raymond FC. HLA-DQ polymorphisms are highly selective for peptide binding interactions. J Immunol 1995;155: van Endert PM, Lopez MT, Patel SD, Monaco JJ, McDevitt HO. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes. Proc Natl Acad Sci USA 1992;89: Brown JH, Jardetzky TS, Saper MA, Samraoui B, Bjorkman PJ, Wiley CD. A hypothetical model of the foreign antigen binding site of class II histocompatibility molecules. Nature 1988;332: Brown JH, Jardetzky TS, Gorga JC, Stern LJ, Urban RG, Strominger JL, et al. Three dimensional structure of the human class II histocompatibility antigen HLA-DR1. Nature 1993;364:33 9. FERTILITY & STERILITY 923

Key words: antiphospholipid syndrome, trombosis, pathogenesis

Key words: antiphospholipid syndrome, trombosis, pathogenesis 26. XI,. 4/2011,.,..,..,., -..,,. 2GPI. -,.,,., -,, -, -,,,,, IL-1, IL-2, IL-6, IL-8, IL-12, IL-10, TNF, INF-. :,, N. Stoilov, R. Rashkov and R. Stoilov. ANTIPHOSPHOLIPID SYNDROME HISTORICAL DATA, ETI-

More information

The Human Major Histocompatibility Complex

The Human Major Histocompatibility Complex The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure

More information

HLA. 4. Ebstein. 6. lumbo-sacral radicul opathy 7. HRT

HLA. 4. Ebstein. 6. lumbo-sacral radicul opathy 7. HRT 2003 15 ( ) 1. 29 196 202 2. 52 355 359 3. HLA HLA 55 12 1323 1329 4. Ebstein 70 10 1415 1420 5. 13 1 4 6. lumbo-sacral radicul opathy 43 1 2 26 30 7. HRT 52 5 593 598 8. 55 7 83 88 9. Paget Laser excision

More information

Anti-Caspase-8 Autoantibody Response in Silicosis Patients is Associated with HLA-DRB1, DQB1 and DPB1 Alleles

Anti-Caspase-8 Autoantibody Response in Silicosis Patients is Associated with HLA-DRB1, DQB1 and DPB1 Alleles J Occup Health 2005; 47: 61 67 Journal of Occupational Health Anti-Caspase-8 Autoantibody Response in Silicosis Patients is Associated with HLA-DRB1, DQB1 and DPB1 Alleles Ayako UEKI 1, Yumika ISOZAKI

More information

FONS Nové sekvenační technologie vklinickédiagnostice?

FONS Nové sekvenační technologie vklinickédiagnostice? FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables

More information



More information

Relationship Between HLA-DMA, DMB Alleles and Type 1 Diabetes in Chinese

Relationship Between HLA-DMA, DMB Alleles and Type 1 Diabetes in Chinese HK J Paediatr (new series) 2005;10:20-25 Relationship Between HLA-DMA, DMB Alleles and Type 1 Diabetes in Chinese YM SANG, C YAN, C ZHU, GC NI, YM HU Abstract Key words The Human Leucocyte Antigen (HLA)-DMA

More information


AG MHC HLA APC Ii EPR TAP ABC CLIP TCR !! AG MHC HLA APC Ii EPR TAP ABC CLIP TCR Antigen Major Histocompartibility Complex Human Leukocyte Antigen Antigen Presenting Cell Invariant Chain Endoplasmatic Reticulum Transporters Associated with

More information

Significance of the MHC

Significance of the MHC CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

Profiling HLA motifs by large scale peptide sequencing Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009

Profiling HLA motifs by large scale peptide sequencing Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009 Profiling HLA motifs by large scale peptide sequencing 2009 Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009 HLA Background The human leukocyte antigen system (HLA) is the

More information

PD Dr. med. habil. Michaela Jaksch, Consultant Laboratory Medicine, Medical Director, Freiburg Medical Laboratory ME LLC, Dubai, UAE

PD Dr. med. habil. Michaela Jaksch, Consultant Laboratory Medicine, Medical Director, Freiburg Medical Laboratory ME LLC, Dubai, UAE Autoimmune Disorders in Gynecology/Obstetrics PD Dr. med. habil. Michaela Jaksch, Consultant Laboratory Medicine, Medical Director, Freiburg Medical Laboratory ME LLC, Dubai, UAE Abstract The spectrum

More information

Association of HLA-DRB alleles and pulmonary tuberculosis in North Chinese patients

Association of HLA-DRB alleles and pulmonary tuberculosis in North Chinese patients Association of HLA-DRB alleles and pulmonary tuberculosis in North Chinese patients G.L. Shi, X.L. Hu, L. Yang, C.L. Rong, Y.L. Guo and C.X. Song Department of Clinical Immunology Laboratory, Beijing Tuberculosis

More information

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page. The handle   holds various files of this Leiden University dissertation. Cover Page The handle holds various files of this Leiden University dissertation. Author: Heide, A. van der Title: Unravelling narcolepsy : from pathophysiology to measuring

More information

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

More information

HLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma

HLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma HLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma Arezou Sayad 1, Mohammad Taghi Akbari 2**, Mahshid Mehdizadeh 3,4, Mohammad Taheri 1, Abbas Hajifathali 3* 1 Department of Medical

More information

Lack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population

Lack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population Lack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population J. Zhu 1 *, F. He 2 *, D.D. Zhang 2 *, J.Y. Yang 2, J. Cheng 1, R. Wu 1, B. Gong 2, X.Q. Liu

More information

Completing the CIBMTR Confirmation of HLA Typing Form (Form 2005)

Completing the CIBMTR Confirmation of HLA Typing Form (Form 2005) Completing the CIBMTR Confirmation of HLA Typing Form (Form 2005) Stephen Spellman Research Manager NMDP Scientific Services Maria Brown Scientific Services Specialist Data Management Conference 2007 1

More information

Cellular Pathology of immunological disorders

Cellular Pathology of immunological disorders Cellular Pathology of immunological disorders SCBM344 Cellular and Molecular Pathology Witchuda Payuhakrit, Ph.D (Pathobiology) Objectives Describe the etiology of immunological

More information

the HLA complex Hanna Mustaniemi,

the HLA complex Hanna Mustaniemi, the HLA complex Hanna Mustaniemi, 28.11.2007 The Major Histocompatibility Complex Major histocompatibility complex (MHC) is a gene region found in nearly all vertebrates encodes proteins with important

More information

Autoimmune diseases. Autoimmune diseases. Autoantibodies. Autoimmune diseases relatively common

Autoimmune diseases. Autoimmune diseases. Autoantibodies. Autoimmune diseases relatively common Autoimmune diseases Fundamental abnormality: the adaptive immune system is triggered by self antigens to initiate a sustained immune response against self molecules that results in tissue injury Specificity

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

Human leukocyte antigen (HLA) system

Human leukocyte antigen (HLA) system Is HLA a determinant of prognosis or therapeutic response to cytokines, IFN and anti-ctla4 blocking antibodies in melanoma? Helen Gogas, M.D. Ass. Professor in Medical Oncology 1st Department of Medicine,

More information

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

More information

Supplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles

Supplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles Supplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles (green) of (A) HLA-A, HLA-B, (C) HLA-C, (D) HLA-DQA1,

More information

Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women

Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women Volume 13(5) Hypothesis Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women Maniraja Jesintha

More information

IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois

IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois FERTILITY AND STERILITY VOL. 80, NO. 4, OCTOBER 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A. CASE REPORTS Preimplantation

More information

Patient Consult Report

Patient Consult Report Patient Consult Report Clinical History Currently 36 years old History of firstborn son now about 5 years old followed by secondary recurrent pregnancy loss with 9 losses (all between 6 and 11 weeks) over

More information

ZHANG Qin, YANG Yun-mei, LV Xue-ying

ZHANG Qin, YANG Yun-mei, LV Xue-ying Zhang et al. / J Zhejiang Univ SCIENCE B 2006 7(11):887-891 887 Journal of Zhejiang University SCIENCE B ISSN 1673-1581 (Print); ISSN 1862-1783 (Online); E-mail:

More information

Antigen Presentation to T lymphocytes

Antigen Presentation to T lymphocytes Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman Office hours by arrangement Antigen processing: How are

More information

Anti β 2. -Glycoprotein I and Antiphosphatidylserine Antibodies Are Predictors of Arterial Thrombosis in Patients With Antiphospholipid Syndrome

Anti β 2. -Glycoprotein I and Antiphosphatidylserine Antibodies Are Predictors of Arterial Thrombosis in Patients With Antiphospholipid Syndrome Coagulation and Transfusion Medicine / PREDICTIVE VALUE OF ANTIPHOSPHOLIPID ANTIBODIES Anti β -Glycoprotein I and Antiphosphatidylserine Antibodies Are Predictors of Arterial Thrombosis in Patients With

More information

Allele and Haplotype Frequencies of Human Leukocyte Antigen-A, -B, -C, -DRB1, and -DQB1 From Sequence- Based DNA Typing Data in Koreans

Allele and Haplotype Frequencies of Human Leukocyte Antigen-A, -B, -C, -DRB1, and -DQB1 From Sequence- Based DNA Typing Data in Koreans Original Article Diagnostic Immunology Ann Lab Med 2015;35:429-435 ISSN 2234-3806 eissn 2234-3814 Allele and Haplotype Frequencies of Human Leukocyte Antigen-A,

More information

Human Leukocyte Antigens and donor selection

Human Leukocyte Antigens and donor selection Human Leukocyte Antigens and donor selection Duangtawan Thammanichanond, MD. PhD. Histocompatibility and Immunogenetics Laboratory, Faculty of Medicine Ramathibodi Hospital, Mahidol University Outline

More information


DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS The definitions below are intended as general concepts. There will be exceptions to these general definitions. These definitions do not imply any specific

More information

Patient and Partner Consult Report

Patient and Partner Consult Report Patient and Partner Consult Report Clinical History History of primary infertility for a period of about 2 years o Including 6 failed IUI cycles and 3 failed IVF cycles Low success rate of embryos surviving

More information

The major histocompatibility complex (MHC) is a group of genes that governs tumor and tissue transplantation between individuals of a species.

The major histocompatibility complex (MHC) is a group of genes that governs tumor and tissue transplantation between individuals of a species. Immunology Dr. John J. Haddad Chapter 7 Major Histocompatibility Complex The major histocompatibility complex (MHC) is a group of genes that governs tumor and tissue transplantation between individuals

More information

Validation of the MIA FORA NGS FLEX Assay Using Buccal Swabs as the Sample Source

Validation of the MIA FORA NGS FLEX Assay Using Buccal Swabs as the Sample Source S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. Introduction

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) - MHC molecules were initially discovered during studies aimed

More information

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmunity Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmune disease can be caused to primary defects in B cells, T cells and possibly

More information

IMMUNOLOGY. Elementary Knowledge of Major Histocompatibility Complex and HLA Typing

IMMUNOLOGY. Elementary Knowledge of Major Histocompatibility Complex and HLA Typing IMMUNOLOGY Elementary Knowledge of Major Histocompatibility Complex and HLA Typing Tapasya Srivastava and Subrata Sinha Department of Biochemistry All India Institute of Medical Sciences New Delhi - 110029

More information

The Major Histocompatibility Complex (MHC)

The Major Histocompatibility Complex (MHC) The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens

More information



More information

Diversity and Frequencies of HLA Class I and Class II Genes of an East African Population

Diversity and Frequencies of HLA Class I and Class II Genes of an East African Population Open Journal of Genetics, 2014, 4, 99-124 Published Online April 2014 in SciRes. Diversity and Frequencies of HLA Class I and

More information

HLA and disease association

HLA and disease association J Headache Pain (2000) 1:S109 S113 Springer-Verlag 2000 Simonetta Trabace HLA and disease association S. Trabace ( ) Section of Medical Genetics, Department of Experimental Medicine and Pathology, Department

More information

BDC Keystone Genetics Type 1 Diabetes. Immunology of diabetes book with Teaching Slides

BDC Keystone Genetics Type 1 Diabetes.  Immunology of diabetes book with Teaching Slides BDC Keystone Genetics Type 1 Diabetes Immunology of diabetes book with Teaching Slides PRACTICAL Trailnet screens relatives and new onset patients for autoantibodies and HLA

More information

The MHC and Transplantation Brendan Clark. Transplant Immunology, St James s University Hospital, Leeds, UK

The MHC and Transplantation Brendan Clark. Transplant Immunology, St James s University Hospital, Leeds, UK The MHC and Transplantation Brendan Clark Transplant Immunology, St James s University Hospital, Leeds, UK Blood Groups Immunofluorescent staining has revealed blood group substance in the cell membranes

More information

The Major Histocompatibility Complex of Genes

The Major Histocompatibility Complex of Genes The Major Histocompatibility Complex of Genes Topic 4 The Major Histocompatibility Complex Outline of Lectures The immunological reasons for transplant rejection How the MHC was discovered using inbred

More information

Major Histocompatibility Complex (MHC) and T Cell Receptors

Major Histocompatibility Complex (MHC) and T Cell Receptors Major Histocompatibility Complex (MHC) and T Cell Receptors Historical Background Genes in the MHC were first identified as being important genes in rejection of transplanted tissues Genes within the MHC

More information

Alleles: the alternative forms of a gene found in different individuals. Allotypes or allomorphs: the different protein forms encoded by alleles

Alleles: the alternative forms of a gene found in different individuals. Allotypes or allomorphs: the different protein forms encoded by alleles Nomenclature Alleles: the alternative forms of a gene found in different individuals Allotypes or allomorphs: the different protein forms encoded by alleles Genotype: the collection of genes in an individual,

More information

Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT

Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT Stephen Spellman, MBS Director, Immunobiology and Observational Research Assistant Scientific Director CIBMTR,

More information

Current View of the Treatment of Antiphospholipid Syndrome

Current View of the Treatment of Antiphospholipid Syndrome GROUPE HOSPITALIER PITIE SALPETRIERE Current View of the Treatment of Antiphospholipid Syndrome Pr Zahir AMOURA Department of Internal Medicine French National Reference center for SLE and APS Hôpital

More information

TCR-p-MHC 10/28/2013. Disclosures. Rheumatoid Arthritis, Psoriatic Arthritis and Autoimmunity: good genes, elegant mechanisms, bad results

TCR-p-MHC 10/28/2013. Disclosures. Rheumatoid Arthritis, Psoriatic Arthritis and Autoimmunity: good genes, elegant mechanisms, bad results Rheumatoid Arthritis, Psoriatic Arthritis and Autoimmunity: good genes, elegant mechanisms, bad results The meaning and significance of HLA associations Disclosures No relevant commercial relationships

More information

HLA Antigen Expression in Autoimmune Endocrinopathies

HLA Antigen Expression in Autoimmune Endocrinopathies Physiol. Res. 53: 191-197, 2004 HLA Antigen Expression in Autoimmune Endocrinopathies P. HRDÁ 1,2, I. ŠTERZL 1,2, P. MATUCHA 2, F. KORIOTH 3, A. KROMMINGA 3 1 Institute of Immunology and Microbiology First

More information

Historical definition of Antigen. An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen.

Historical definition of Antigen. An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen. Historical definition of Antigen An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen. Historical definition of Antigen An antigen is a foreign

More information

Differential association of HLA with three subtypes of type 1 diabetes: fulminant, slowly progressive and acute-onset

Differential association of HLA with three subtypes of type 1 diabetes: fulminant, slowly progressive and acute-onset Diabetologia (2009) 52:2513 2521 DOI 10.1007/s00125-009-1539-9 ARTICLE Differential association of HLA with three subtypes of type 1 diabetes: fulminant, slowly progressive and acute-onset Y. Kawabata

More information

10/18/2012. A primer in HLA: The who, what, how and why. What?

10/18/2012. A primer in HLA: The who, what, how and why. What? A primer in HLA: The who, what, how and why What? 1 First recognized in mice during 1930 s and 1940 s. Mouse (murine) experiments with tumors Independent observations were made in humans with leukoagglutinating

More information

Topic (Final-03): Immunologic Tolerance and Autoimmunity-Part II

Topic (Final-03): Immunologic Tolerance and Autoimmunity-Part II Topic (Final-03): Immunologic Tolerance and Autoimmunity-Part II MECHANISMS OF AUTOIMMUNITY The possibility that an individual s immune system may react against autologous antigens and cause tissue injury

More information

Investigation of Programmed Cell Death-1 (PD-1) Gene Variations at Positions PD1.3 and PD1.5 in Iranian Patients with Non-small Cell Lung Cancer

Investigation of Programmed Cell Death-1 (PD-1) Gene Variations at Positions PD1.3 and PD1.5 in Iranian Patients with Non-small Cell Lung Cancer Original Article Middle East Journal of Cancer; January 2018; 9(1): 13-17 Investigation of Programmed Cell Death-1 (PD-1) Gene Variations at Positions PD1.3 and PD1.5 in Iranian Patients with Non-small

More information

Analysis of HLA-A, HLA-B and HLA-DRB1 alleles in Chinese patients with lung cancer

Analysis of HLA-A, HLA-B and HLA-DRB1 alleles in Chinese patients with lung cancer Analysis of HLA-A, HLA-B and HLA-DRB1 alleles in Chinese patients with lung cancer L. Yang 1, L.J. Wang 3, G.L. Shi 2, L. Ni 3, C.X. Song 2, Z.X. Zhang 3 and S.F. Xu 1 1 Department of Thoracic Surgeon,

More information

A HLA-DRB supertype chart with potential overlapping peptide binding function

A HLA-DRB supertype chart with potential overlapping peptide binding function A HLA-DRB supertype chart with potential overlapping peptide binding function Arumugam Mohanapriya 1,2, Satish Nandagond 1, Paul Shapshak 3, Uma Kangueane 1, Pandjassarame Kangueane 1, 2 * 1 Biomedical

More information

Histocompatibility Evaluations for HSCT at JHMI. M. Sue Leffell, PhD. Professor of Medicine Laboratory Director

Histocompatibility Evaluations for HSCT at JHMI. M. Sue Leffell, PhD. Professor of Medicine Laboratory Director Histocompatibility Evaluations for HSCT at JHMI M. Sue Leffell, PhD Professor of Medicine Laboratory Director JHMI Patient Population Adults Peds NMDP data >20,000 HSCT JHMI HSCT Protocols Bone marrow

More information

What is Autoimmunity?

What is Autoimmunity? Autoimmunity What is Autoimmunity? Robert Beatty MCB150 Autoimmunity is an immune response to self antigens that results in disease. The immune response to self is a result of a breakdown in immune tolerance.

More information

What is Autoimmunity?

What is Autoimmunity? Autoimmunity What is Autoimmunity? Robert Beatty MCB150 Autoimmunity is an immune response to self antigens that results in disease. The immune response to self is a result of a breakdown in immune tolerance.

More information

Basic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction

Basic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Basic Immunology Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Molecular structure of MHC, subclasses, genetics, functions. Antigen presentation and MHC restriction.

More information

The Major Histocompatibility Complex

The Major Histocompatibility Complex The Major Histocompatibility Complex Today we will discuss the MHC The study of MHC is necessary to understand how an immune response is generated. And these are the extra notes with respect to slides

More information

Transplantation. Immunology Unit College of Medicine King Saud University

Transplantation. Immunology Unit College of Medicine King Saud University Transplantation Immunology Unit College of Medicine King Saud University Objectives To understand the diversity among human leukocyte antigens (HLA) or major histocompatibility complex (MHC) To know the

More information

Ancestral and recombinant 16-locus HLA haplotypes in the Hutterites

Ancestral and recombinant 16-locus HLA haplotypes in the Hutterites Immunogenetics (1999) 49: 491 497 Q Springer-Verlag 1999 ORIGINAL PAPER Lowell R. Weitkamp 7 Carole Ober Ancestral and recombinant 16-locus HLA haplotypes in the Hutterites Received: 1 May 1998 / Revised:

More information

Fetal-Maternal HLA Relationships and Autoimmune Disease. Giovanna Ibeth Cruz. A dissertation submitted in partial satisfaction of the

Fetal-Maternal HLA Relationships and Autoimmune Disease. Giovanna Ibeth Cruz. A dissertation submitted in partial satisfaction of the Fetal-Maternal HLA Relationships and Autoimmune Disease By Giovanna Ibeth Cruz A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Epidemiology

More information

Nomenclature. HLA genetics in transplantation. HLA genetics in autoimmunity

Nomenclature. HLA genetics in transplantation. HLA genetics in autoimmunity Nomenclature Alleles: the alternative forms of a gene found in different individuals Allotypes or allomorphs: the different protein forms encoded by alleles During pregnancy the mother tolerates the expression

More information

25/10/2017. Clinical Relevance of the HLA System in Blood Transfusion. Outline of talk. Major Histocompatibility Complex

25/10/2017. Clinical Relevance of the HLA System in Blood Transfusion. Outline of talk. Major Histocompatibility Complex Clinical Relevance of the HLA System in Blood Transfusion Dr Colin J Brown PhD FRCPath. October 2017 Outline of talk HLA genes, structure and function HLA and immune complications of transfusion TA-GVHD

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

J Jpn Coll Angiol, 2009, 49: collagen disease, genetic polymorphism, MRL mice, recombinant inbred strains, Cd72. MRL/Mp-lpr/lpr MRL/ lpr

J Jpn Coll Angiol, 2009, 49: collagen disease, genetic polymorphism, MRL mice, recombinant inbred strains, Cd72. MRL/Mp-lpr/lpr MRL/ lpr Online publication June 24, 2009 1, 2 1 J Jpn Coll Angiol, 2009, 49: 11 16 collagen disease, genetic polymorphism, MRL mice, recombinant inbred strains, Cd72 SNPs case-control study MHC Fcγ NO MRL/Mp-lpr/lpr

More information

Immunogenetics of Episcleritis in Leprosy

Immunogenetics of Episcleritis in Leprosy Immunogenetics of Episcleritis in Leprosy Satoru Joko, * Jiro Numaga, * Yujiro Fujino, * S. M. M. Islam, * Kanjiro Masuda * and Hiroo Maeda * Department of Ophthalmology, University of Tokyo School of

More information

HLA and atopic dermatitis with high serum IgE levels

HLA and atopic dermatitis with high serum IgE levels HLA and atopic dermatitis with high serum IgE levels Hidehisa Saeki, MD, a Shoji Kuwata, MD, b Hidemi Nakagawa, MD, a Takafumi Etoh, MD, a Masami Yanagisawa, BS, b Mitsuko Miyamoto, BS, b Katsushi Tokunaga,

More information

Antiphospholipid Syndrome ( APS)

Antiphospholipid Syndrome ( APS) Antiphospholipid Syndrome ( APS) Edward John Walter Bowie, MD Mayo Medical School the first to identify APS as an acquired thrombophilia Graham Robert Vivian Hughes MD FRCP Unit Rayne Institute St Thomas

More information

J. Lee Nelson, MD Fred Hutchinson Cancer Research Ctr & University of Washington, Seattle, Washington, USA

J. Lee Nelson, MD Fred Hutchinson Cancer Research Ctr & University of Washington, Seattle, Washington, USA MICROCHIMERISM IN SPACE AND OVER TIME (OUR INTERSTELLAR MOVIE) J. Lee Nelson, MD Fred Hutchinson Cancer Research Ctr & University of Washington, Seattle, Washington, USA Microchimerism (Mc): a small number

More information

HLA haplotype A33-B58-Cw10 may modulate radiographic development of bamboo spine in Taiwanese patients with primary ankylosing spondylitis

HLA haplotype A33-B58-Cw10 may modulate radiographic development of bamboo spine in Taiwanese patients with primary ankylosing spondylitis Disease Markers 26 (2009) 93 96 93 DOI 10.3233/DMA-2009-0619 IOS Press HLA haplotype A33-B58-Cw10 may modulate radiographic development of bamboo spine in Taiwanese patients with primary ankylosing spondylitis

More information

HLA class II DRB1 and DQB1 allelic polymorphism and sclerosing lymphocytic lobulitis of the breast

HLA class II DRB1 and DQB1 allelic polymorphism and sclerosing lymphocytic lobulitis of the breast J Clin Pathol 1999;52:445 449 445 Department of Histopathology, Southampton University Hospitals, Southampton, UK A C Bateman J M Theaker Wessex Histocompatibility Laboratory, Southampton University Hospitals

More information

An association analysis of the HLA gene region in latent autoimmune diabetes in adults

An association analysis of the HLA gene region in latent autoimmune diabetes in adults Diabetologia (2007) 50:68 73 DOI 10.1007/s00125-006-0513-z SHORT COMMUNICATION An association analysis of the HLA gene region in latent autoimmune diabetes in adults M. Desai & E. Zeggini & V. A. Horton

More information

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response Ivana FELLNEROVÁ E-mail:, mob. 732154801 Basic immunogenetic terminology innate and adaptive immunity specificity and polymorphism immunoglobuline gene superfamily immunogenetics MHC

More information

criterion (positive lupus anticoagulant or

criterion (positive lupus anticoagulant or FERTILITY AND STERILITY Vol. 66, No.4, October 1996 Copyright 1996 American Society for Reproductive Medicine Printed on acid~free paper in U. s. A. Antiphospholipid antibody panels and recurrent pregnancy

More information

Key Concept B F. How do peptides get loaded onto the proper kind of MHC molecule?

Key Concept B F. How do peptides get loaded onto the proper kind of MHC molecule? Location of MHC class I pockets termed B and F that bind P and P9 amino acid side chains of the peptide Different MHC alleles confer different functional properties on the adaptive immune system by specifying

More information

B F. Location of MHC class I pockets termed B and F that bind P2 and P9 amino acid side chains of the peptide

B F. Location of MHC class I pockets termed B and F that bind P2 and P9 amino acid side chains of the peptide Different MHC alleles confer different functional properties on the adaptive immune system by specifying molecules that have different peptide binding abilities Location of MHC class I pockets termed B

More information

Handling Immunogenetic Data Managing and Validating HLA Data

Handling Immunogenetic Data Managing and Validating HLA Data Handling Immunogenetic Data Managing and Validating HLA Data Steven J. Mack PhD Children s Hospital Oakland Research Institute 16 th IHIW & Joint Conference Sunday 3 June, 2012 Overview 1. Master Analytical

More information

Antiphospholipid Syndrome

Antiphospholipid Syndrome Antiphospholipid Syndrome EliA Cardiolipin and EliA β2-glycoprotein I Fully Automated Testing for Antiphospholipid Syndrome (APS) Testing for APS according to classification criteria determination of anti-β2-glycoprotein

More information

Lupus anticoagulant and anticardiolipin antibodies in SLE with secondary Antiphospholipid Antibody Syndrome

Lupus anticoagulant and anticardiolipin antibodies in SLE with secondary Antiphospholipid Antibody Syndrome Turk J Hematol 2007; 24:69-74 Turkish Society of Hematology RESEARCH ARTICLE Lupus anticoagulant and anticardiolipin antibodies in SLE with secondary Antiphospholipid Antibody Syndrome Shveta Garg, Annamma

More information

Dr. Yi-chi M. Kong August 8, 2001 Benjamini. Ch. 19, Pgs Page 1 of 10 TRANSPLANTATION

Dr. Yi-chi M. Kong August 8, 2001 Benjamini. Ch. 19, Pgs Page 1 of 10 TRANSPLANTATION Benjamini. Ch. 19, Pgs 379-399 Page 1 of 10 TRANSPLANTATION I. KINDS OF GRAFTS II. RELATIONSHIPS BETWEEN DONOR AND RECIPIENT Benjamini. Ch. 19, Pgs 379-399 Page 2 of 10 II.GRAFT REJECTION IS IMMUNOLOGIC

More information

specific PCR-based HLA class II typing

specific PCR-based HLA class II typing 288 28 Clin Pathol 1997;50:288-293 Department of Histopathology, Southampton General Hospital, Southampton, United Kingdom A C Bateman J M Theaker Wessex Histocompatibility Laboratory, Southampton, United

More information

The Major Histocompatibility Complex (MHC)

The Major Histocompatibility Complex (MHC) Advanced molecular immunology-2011 The Major Histocompatibility Complex (MHC) Youmin Kang 2011.04.06 Activation IFN-g IL-4 IL-2 YYYYYY YYYYY B cells MHC class II pathway Discovery of MHC MHC Class I pathway

More information

HLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute

HLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute HLA Mismatches Professor Steven GE Marsh HLA Mismatches HLA Genes, Structure, Polymorphism HLA Nomenclature HLA Mismatches in HSCT Defining a mismatch HLA Mismatches HLA Genes, Structure, Polymorphism

More information

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012.

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012. HLA and more Ilias I.N. Doxiadis Geneva 03/04/2012 HLA and more HLA and more / Doxiadis 2 Topic of the day Compatibility testing is a type of testing used to ensure compatibility of the system/application/website

More information

HLA AND DISEASE. M. Toungouz Nevessignsky. Erasme Hospital Brussels, Belgium EFI - ULM 2009

HLA AND DISEASE. M. Toungouz Nevessignsky. Erasme Hospital Brussels, Belgium EFI - ULM 2009 HLA AND DISEASE M. Toungouz Nevessignsky Université Libre de Bruxelles (ULB) Erasme Hospital Brussels, Belgium HLA and disease: pioneer studies 1972: Falcuk et al HLA B8 and coeliac disease 1972: Russell

More information

Research: Genetics HLA class II gene associations in African American Type 1 diabetes reveal a protective HLA-DRB1*03 haplotype

Research: Genetics HLA class II gene associations in African American Type 1 diabetes reveal a protective HLA-DRB1*03 haplotype Research: Genetics HLA class II gene associations in African American Type 1 diabetes reveal a protective HLA-DRB1*03 haplotype J. M. M. Howson 1,2, M. S. Roy 3, L. Zeitels 1, H. Stevens 1 and J. A. Todd

More information

patients with fetal loss

patients with fetal loss Annals of the Rheumatic Diseases 1991; 50: 553-557 553 Department of Internal Medicine (Division of Immunopathology), University Hospital Utrecht, H J Out M van Vliet R H W M Derksen Department of Obstetrics

More information

Short communication. Abstract

Short communication. Abstract Diabetologia (1999) 42: 574±578 Short communication Ó Springer-Verlag 1999 Immunological abnormalities in islets at diagnosis paralleled further deterioration of glycaemic control in patients with recent-onset

More information

Genome-wide association studies for human narcolepsy and other complex diseases

Genome-wide association studies for human narcolepsy and other complex diseases ETHZ-JST Joint WS Sept. 15-16, 2008 Genome-wide association studies for human narcolepsy and other complex diseases Katsushi Tokunaga Department of Human Genetics Graduate School of Medicine The University

More information

Part XI Type 1 Diabetes

Part XI Type 1 Diabetes Part XI Type 1 Diabetes Introduction Åke Lernmark Epidemiology Type 1 diabetes is increasing worldwide and shows epidemic proportions in several countries or regions [1]. There is evidence to suggest that

More information

Manifestation of Antiphospholipid Syndrome among Saudi patients :examining the applicability of sapporo Criteria

Manifestation of Antiphospholipid Syndrome among Saudi patients :examining the applicability of sapporo Criteria Manifestation of Antiphospholipid Syndrome among Saudi patients :examining the applicability of sapporo Criteria Farjah H AlGahtani Associate professor,md,mph Leukemia,Lymphoma in adolescent,thromboembolic

More information

Lack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims

Lack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims Kobe J. Med. Sci., Vol. 53, No. 4, pp. 151-155, 2007 Lack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims KAORU SAKURAI 1, NAOKI NISHIGUCHI 2, OSAMU SHIRAKAWA 2,

More information

HLA-DR, HLA-DQB1 and PTPN22 gene polymorphism: association with age at onset for autoimmune diabetes

HLA-DR, HLA-DQB1 and PTPN22 gene polymorphism: association with age at onset for autoimmune diabetes Clinical research HLA-DR, HLA-DQB1 and PTPN22 gene polymorphism: association with age at onset for autoimmune diabetes Anna Okruszko, Barbara Szepietowska, Natalia Wawrusiewicz-Kurylonek, Maria Górska,

More information

MHC class I MHC class II Structure of MHC antigens:

MHC class I MHC class II Structure of MHC antigens: MHC class I MHC class II Structure of MHC antigens: MHC class I antigens consist of a transmembrane heavy chain (α chain) that is non-covalently associated with β2- microglobulin. Membrane proximal domain

More information