The diagnosis and clinical manifestations of activated protein C resistance: a case report and review of the literature

Transcription

1 Vascular Medicine 1996; 1: The diagnosis and clinical manifestations of activated protein C resistance: a case report and review of the literature Howard Daniel Hoerl", Aldo Tabares" and Kandice Kottke-Marchant" Abstract: Activated protein C resistance (APCR) is a recently discovered, medically important cause of venous thrombosis. More than 95% of cases are due to factor V Leiden (FVLl, a mutated form of factor V that is resistant to degradation by activated protein C. The prevalence of this disorder, which is inherited in an autosomal dominant fashion, is approximately 5% among asymptomatic people of European heritage. In addition, 20 to 60% of patient cohorts with previous thrombosis demonstrate APCR, making it the most common known genetic cause of abnormal thrombophilia. Current laboratory techniques available for diagnosis include functional assays, such as the APC ratio, as well as DNA-based tests that detect the specific genetic anomaly responsible for FVL. A case report is presented, along with a review of the literature highlighting epidemiology, pathogenesis, clinical features and methods for laboratory diagnosis. Key words: activated protein C resistance; factor V Leiden; hypercoagulable state; thromboembolism Introduction The advent of the twenty-first century promises many significant discoveries in the field of medicine. One of the most exciting is a major advance in understanding the pathogenesis of thrombotic disorders. Although a common problem, affecting approximately one in every thousand individuals, I the evaluation of venous thrombosis has, to date, been less than satisfactory. Despite knowledge of several well-described entities, including deficiencies of antithrombin III (ATIll), heparin cofactor II, and proteins C and S, known inheritable disorders collectively account for less than 10% of cases. I Considering all possible causes, a laboratory diagnosis is achieved in fewer than one-third of patients," Many people will have known, acquired risk factors for thrombosis, including surgery, pregnancy, oral contraceptive use, malignancy or immobility. Unfortunately, these cannot explain the fact that up to 45% of patients in some cohorts will have a positive family history for thrombosis.' This finding has led investigators to look for other, yet undiscovered, genetic causes of thrombophilia, an endeavor that most recently has been concentrated on resistance to activated protein C. Case presentation An interesting patient who typifies this disorder was seen at the Cleveland Clinic Foundation several times between "Division of Pathology and Laboratory Medicine and "Department of Vascular Medicine, The Cleveland Clinic Foundation, Cleveland. OH. USA Address for correspondence: Kandice Kottke-Marchant, The Cleveland Clinic Foundation, Section of Laboratory Hematology Euclid Avenue, Cleveland, OH 44195, USA and LW is a 48-year-old White male who complained of no coagulation problems prior to In September of that year, the patient developed a deep venous thrombosis of the right lower extremity (confirmed by duplex ultrasound) after a prolonged car trip to Maine. This was complicated by bilateral pleuritic chest pain. which was thought to be secondary to showering small pulmonary emboli, although this was not able to be confirmed on lung scan. The past medical history was significant for chronic atrial fibrillation of unknown duration, hypercholesterolemia and a remote history of smoking. No family history of thrombophilia was identified, and the patient denied previous surgery. Upon release, the patient was treated with a combination of oral anticoagulation and elastic support stockings, although compliance with the medical regimen was not felt to be optimal. Over the next several years the patient experienced multiple thrombotic episodes, including superficial thrombophlebitis of the right leg in 1992, and deep venous thrombosis of the left leg (confirmed by duplex ultrasound) in This was treated with a combination of heparin and sodium warfarin (Coumadin). Reportedly. the prothrombin time (PT) and activated partial thromboplastin time (aptt) were within the normal range. The patient was seen in peripheral vascular medicine clinic in February of A duplex ultrasound confirmed remote deep venous thrombosis of the right distal external iliac, common femoral, superficial femoral and popliteal veins, as well as remote thrombosis of the left popliteal vein, but no new disease. At this time a hypercoagulation profile was obtained. This revealed normal-range values for the PT (10.7 s. normal ), international normalized ratio (0.97. normal ), aptt (25.4 s, normal ) and fibrinogen level (276 mg/dl, normal 20D-400). In addition, functional studies for ATIII (116%, normal ), heparin cofactor II (123%, normal 60-I60) and plasminogen (123%, normal Arnold 1996

2 276 HD Hoerl et al ) were all within normal limits. Immunologic protein S levels (total 111%, normal and free 89%, normal ) were also normal. The patient was noted to have high positive IgG (13.0; normal < to) and IgA (14.0; normal < to) anticardiolipin antibodies, as well as an elevated protein C level (168%; normal %), all of which were of doubtful significance. More importantly, the patient was noted to have an elevated plasma homocysteine level of 18.5 nmol/ml (normal range ). Subsequent evaluation of the patient's plasma with the APC resistance test (see below) yielded an APC ratio of 1.6 (normal range ), indicating resistance to the function of activated protein C. Protein C and hemostasis Before one can understand activated protein C resistance, it is first necessary to review the role of protein C in hemostasis. The blood coagulation system depends on the co-ordinated function of several important elements, including endothelial cells, platelets, coagulation proteins, fibrinolytic proteins, and inhibitors. Under normal circumstances, procoagulant and anticoagulant mechanisms are delicately balanced, limiting hemostasis to those sites where it is needed. Unfortunately, this balance may be upset by a number of different disorders, inherited or acquired, leading to either bleeding or inappropriate thrombus formation. Figure I depicts the coagulation cascade, a series of plasma proteins that interact in an exponential, enzymatic fashion to generate thrombin (FIla). Thrombin subsequently cleaves fibrinogen to fibrin, an essential component for effective hemostasis. As demonstrated, a number of inhibitors work to regulate the activity of this system. Physiologically important anticoagulant systems include protein C and S. Protein C is a vitamin K dependent plasma protein (along with factors II, VII, IX and X and protein S) that works by degrading activated factors VIlla and Va, with protein S functioning as a cofactor in this process." The degradation of VIlla and Va inhibits the function of the tenase (factors X, IXa and VIlla) and prothrombinase (factors Xa, Va and II) complexes, respectively. In vivo, INfRINSIC PATHWAY XII hwnia.. XII. HMW~ + eat:" r.: "1-_.., ~""~..._.mm. EXTRINSIC PATHWAY VII _-+-TFMIa Figure 1 The coagulation cascade (a = activated; Hell = heparin cofactor II; HMWK = high molecular weight kininogen; ProC/S = protein C or S; TF = tissue factor; TFPI = tissue factor protein inhibitor) XI ~ PraCJ8 ~)4-...I--.I..~ Pl..2,< Ca~x..~ m"", """"",m,.. ATIIVHCII... Fibrinogen ~Fibrin PraCJ8 FpA protein C becomes activated on the surface of endothelial cells by a complex of thrombin and the intrinsic membrane protein thrombomodulin. Thrombomodulin alters the substrate specificity of thrombin from fibrinogen to protein C. This results in a small peptide fragment being cleaved from the N-terminus of the protein C heavy chain, producing activated protein C (APC). Epidemiology and pathogenesis Given the pivotal role that APC plays in anticoagulation, Dr Bjorn Dahlback and his colleagues" at Lund University, Malmo, Sweden, postulated that abnormalities in this pathway might play a significant role in patients with recurrent venous thrombosis. They reasoned that, since endogenous APC degrades VIlla and Va, adding exogenous APC to a patient's plasma ought to increase the measured aptt, which is dependent in part on the function of these proteins. In general, this was found to be true; however, in one patient with a history of multiple thrombotic events the addition of APC to his plasma did not result in prolongation of the clotting time as measured by the aptt assay. This patient had no known thrombotic disorder, but further investigation revealed that four of the proband's relatives had a history of venous thrombosis, all of whom demonstrated a similar, poor response to APC. This heretofore unrecognized phenomenon was termed 'activated protein C resistance' (APCR).5 APCR might have remained nothing more than a laboratory curiosity except that further research found it to be relatively common. Several investigators have reported a prevalence among the European population of approximately 5% (range 2_7%) Family studies by Dahlback and others 1 have indicated an apparent autosomal dominant model of inheritance; heterozygotes have a 5- to to-fold increased risk for venous thrombosis, while homozygotes are 50 to 100 times more likely to experience an adverse thrombotic event. In one series by Samaha,'? 23 patients were identified with APC resistance. Among these, 12 presented with deep venous thrombosis alone, three had deep venous thrombosis plus pulmonary embolism, five had pulmonary embolism alone, two had superficial thrombophlebitis, one developed thrombosis of an intracerebral vessel and one suffered retinal vein occlusion.'? Interestingly, there does not appear to be an association with premature arterial disease, including myocardial infarction, stroke, peripheral vascular disease and arterial thrombosis.i':'? Given its relatively high prevalence, some authors have speculated that the heterozygous state of APCR may have conferred a slight survival advantage in the past - perhaps being slightly hypercoagulable reduced postpartum hemorrhage, or decreased bleeding following trauma." Among other nationalities, APCR has been detected in only a small percentage of people from Asia Minor, and no cases have been described in Asians, Africans, Australians or natives of the Middle East." The prevalence in the American black population has been reported to be approximately 1.4%.13 When only patients with a previous history of thrombosis are considered, the prevalence of APCR increases dramatically, with reported percentages ranging between 20 and 60%.1 This makes APCR by far the most common known genetic cause for inherited thrombophilia. Vascular Medicine 1996; 1:

3 Activated protein C resistance 277 In 1994, Bertina et al 14 at University Hospital Leiden, The Netherlands, identified the gene defect that is responsible for more than 95% of cases of APCR. Their group found that the abnormality in these patients is a point mutation at nucleotide position 1691 in the gene for factor V (located on chromosome number I), resulting in a switch from guanine to adenine. This base-pair change results in a substitution of glutamine for arginine at amino acid position 506 in the factor V protein. This mutated factor V molecule was named factor V Leiden (FVL) by these investigators.!" The mechanism of abnormal thrombophilia with FVL is shown in Figure 2. In the normal state, arginine at position 506 is the site at which APC initiates degradation of Va, followed by cleavage at positions 306 and 679. When glutamine is substituted for arginine, the breakdown of Va by APC occurs only slowly; however, the mutation does not affect the coagulative function of FVL, which is normal." Thus the entire prothrombinase complex (Xa, FVL and II) remains active, generating thrombin (IIa), which in turn ( I) generates fibrin from fibrinogen, and (2) activates new molecules of both factor VIII and factor V. APCR and other causes of thrombophilia Most patients with APCR remain asymptomatic.' Similar findings have been reported for patients with other inheritable causes of thrombophilia. It has been demonstrated that only about 50% of patients with deficiencies of ATIII, protein C and protein S experience abnormal thrombosis. IS Because of this, investigators have attempted to elucidate a correlation between the presence of APCR and other known causes of thrombophilia, theorizing that symptomatic patients may have multiple risk factors for thrombosis. The results of these studies have been somewhat contradictory. Both Koeleman et ap6 and Zoller et ap7 independently found APCR to be highly prevalent in symptomatic patients with protein S deficiency. Similar findings were reported by Gandrille et al," who reported a significant rate of APCR in symptomatic patients with protein C deficiency. Nevertheless, Simioni et ai's failed to find a single case of APCR among 113 individuals from 23 separate families with deficiencies of ATIII, protein C or protein S. Selection criteria may explain this discrepancy. Those studies that found a positive correlation initially identified subjects having clinically significant thrombosis, whereas those A I -J06 A2 Normal + Thrombin FV FV Leiden Ar,:10601a A I /12 FVa Slow degrad ati on Figure 2 Diagramatic representation of the mechanism for APe resistance due to FV Leiden (FVi = inactivated factor V) with negative results did not specifically investigate symptomatic individuals. Taken together, these studies suggest that patients with one thrombotic disorder are not necessarily at an increased risk for a second abnormality. However, if a person has APCR plus another disord er (protein C deficiency, etc.), the y are more likely to have clinical thrombophilia. This has been referred to as a 'double hit' that more than one abnormality may be necessary in order for an individual to have a thrombotic tendency. Research along these lines has continued; recently Mandel et al'" reported that six of II patients with homocystinuria who developed clinically significant thrombosis had concurrent APCR, underscoring the importance of multiple risk factors in disease expression. This may appl y to the patient presented herein, as he had both APCR and elevated plasma homocysteine levels. Clinical presentation The clinical presentation of patients with APC resistance does not differ significantly from other inherited hypercoagulable syndromes." Venous thromboembolism is by far the most common clinical presentation of this condition. accounting for more than 90% of all thrombotic epi sodes in these individuals. In approximately half of these patients, risk factors for venous thrombosis such as pregnancy, surgery or prolonged immobilization are identified.' Thrombosis in unusual sites such as the sagittal sinus. hepatic vein and retinal vein have also been reported.":'>' Despite this, the prevalence of APCR in patients with these unu sual thrombotic conditions remains unknown. APCR does not appear to increase the risk for acute arterial thrombotic events, either acute myocardial infarction or cerebrovascular accidents.ur" Thrombosis-free survival at the age of 45 has been calculated to be 59% in APC-resistant individuals and 97% for relatives without the defect.' Management The management of patients with APCR is challenging owing to its high prevalence both in the general population and in patients with venous thromboembolism, and the relative lack of information about its natural history. In general. patients with venous thromboembolism have an increased risk for recurrence, but this risk declines 3 to 6 months after the acute thrombotic event. Current recommendations for the treatment of patients with venous thromboembolism include initial therapy with heparin followed by a period of 3 to 6 months of oral anticoagulants." It is presumed that this approach minimizes the risk of bleeding while decreasing the risk of recurrent thromboembolism. ~ 7 However, in symptomatic patients with inherited thrombophilic syndromes such as ATIll, protein S and protein C deficiency, it is usual practice to continue oral anticoagulant therapy beyond 6 months. because it is assumed that in these individuals the risk of recurrent thrombosis is high.?" Retrospective studies have shown that prolonged anticoagulant therapy and prophylaxis of deep venous thrombosis decrease the risk of recurrent thrombotic events in patients with abnormalities of the natural anticoagulant proteins.s '-" Vascular Medicine 1996: 1:

4 278 HD Hoerl et al Currently, no recommendations have been issued concerning the duration and intensity of oral anticoagulant treatment in patients with APCR. One important question is whether or not these patients are at an increased risk for recurrent thromboembolism compared with patients without the defect. In a recent retrospective study, Rintelen et ai29 have shown that the recurrence rate was highest among patients with homozygous FVL, but was similar in patients with heterozygous FVL and controls. Until more information about the natural history of the disease is gathered, it seems reasonable to treat patients with APCR who present with acute venous thromboembolism with an initial course of intravenous heparin, followed by 6 months of oral anticoagulants to achieve a therapeutic international normalized ratio (INR) of 2 to Patients with recurrent episodes of venous thromboembolism (two or more) or with permanent risk factors for thrombosis should be considered candidates for lifelong oral anticoagulation.p-v-" Other possible indications for long-term oral anticoagulation include: homozygosity for FVL, thrombosis at unusual sites, or the association with lupus anticoagulants or other inherited thrombophilic defects." Asymptomatic individuals with documented APCR should not be considered for primary prophylaxis. However, prophylaxis for venous thrombosis should be implemented during exposure to risk factors for thrombosis such as pregnancy, surgery or immobilization.'? Similarly, females with this phenotype should be advised about the greatly increased risk of thromboembolism with oral contraceptive use," and alternative forms of contraception should be offered to these women. Laboratory testing The functional test for APCR is relatively straightforward to perform (Figure 3). A standardized amount of aptt reagent plus calcium chloride is added to patient plasma, and the time to clot is measured (normally about 30 s). The assay is then repeated, but with the addition of a known amount of APC. In patients without APCR, the degradation of factors Va and Villa will increase the time to clot (typically to more than 60 s). In individuals with APCR, the aptt will not be as prolonged. I Thus, the ratio of the aptt with added APC to the apti without added APC Plasma aptt reagent+apc I..~ Normal: clotting time ~ 60 s Md~C~ APC~:croumgtime<6Os aptt reagent I..~ Add CaC4 APCRATIO aw+apc aptt-apc NL>2.0 APCR<2.0 Clotting time =30 s Figure 3 APC ratio determination in normal and APC resistant patients will be significantly lower in those patients with APCR (usually < 2.0) than in people without the disorder (usually> 2.0).3.5 The mutation that results in hypercoagulability in patients with FVL is also the basis for the DNA assay used to detect the disorder (Figure 4). This method depends on polymerase chain reaction (PCR) amplification of the DNA of interest, followed by restriction enzyme digestion. Using the primers shown, a 287 base-pair product (which contains nucleotide position 1691) is produced using standard PCR techniques. This fragment is subjected to enzymatic degradation by Mnl I, with the product being electrophoresed and stained. The results are straightforward: people with normal FV will have three DNA fragments, which are 157,93, and 37 base pairs in length. In patients with FVL, however, the point mutation results in loss of one Mnl I digestion site such that, instead of the 93 and 37 base-pair fragments, a 130 base-pair chain is produced. In the heterozygous state, this results in four nucleotide chains being generated, of 157, 93 and 37 (representing the normal allele), and 130 (representing FVL) base pairs in length. Homozygotes have two abnormal alleles, and therefore have only the 157 and 130 base-pair fragments. I Several studies have confirmed the utility of the APC ratio for detecting APCR due to the presence of FVL.3,9.33 All have defined an abnormal APC ratio as any value two or more standard deviations below the mean normal value for that laboratory. In most laboratories, a normal APC ratio is > 2.0. When implementing these criteria, reported sensitivities for detecting patients with FVL have ranged from 73 to 90%, with specificities between 87 and 99%.1.8 If one accepts the highest reported sensitivity and specificity for the test and a disease prevalence of 5%, then the calculated predictive value of a positive test is 81%, By the same standards, the predictive value of a negative test is 99%. Problems arise when one attempts to test for APCR via the APC ratio in patients with an elevated basal aptt. The reason is obvious; the APC ratio determination is based on measuring the increased time to clot with APC, as opposed to the time to clot without it, with measured ratios being higher in normal patients than in those with APCR. If one begins with an abnormally elevated aptt (i.e. before the addition of APC), the calculated APC ratio will be reduced and will therefore be useless to identify patients with the disorder. Common causes of an elevated basal aptt include both heparin and Coumadin therapy, as well as the presence of a lupus anticoagulant. Since patients with abnormal venous thrombosis are frequently given antico- PCR amplification: 2 primers - 5"GGAACAACACCATGATCAGAGCA3' - S"TAGCCAGGAGACCTAACATGTIC3' 287 bp amplified product subjected to Mnl I digestion Normal Heterozygote Homozygote Figure 4 DNA testing: PCR analysis in normal and APC resistant patients 130 Vascular Medicine 1996; 1:

5 Activated protein C resistance 279 agulant therapy, and the lupus anticoagulant is a fairly common cause of hypercoagulability, an elevated basal aptt is no small problem for evaluating the presence of APCR in a patient with thrombophilia. Various modifications have been developed to test for APCR in the presence of a prolonged basal aptt. For a patient on heparin therapy, the solution is relatively straightforward: one simply neutralizes the heparin in the sample with a reagent such as polybrene or Hepsorb. Coumadin, on the other hand, presents a more difficult challenge, requiring use of a modified APCR test. Coumadin functions as an anticoagulant by antagonizing the action of vitamin K. This leads to a functional deficiency of vitamin K dependent plasma proteins, such as factors II, VII, IX and X and proteins C and S. Because of the reduced levels of these factors in an individual on Coumadin therapy, the aptt is often prolonged. A modification of the APCR test was designed to correct this problem where the subject's sample is diluted fivefold with factor V deficient plasma. The rationale behind this manipulation is that the factor V deficient plasma will replace the missing vitamin K dependent factors without affecting the behavior of endogenous factor V. Studies by several investigators have proved this method to be reliable for identifying APCR patients on Coumadin therapy The other major group of patients with a prolonged basal apty, and therefore uninterpretable APC ratios, are those with a lupus anticoagulant. Lupus anticoagulants are antiphospholipid immunoglobulins that predispose to both arterial and venous thrombosis. Individuals with a lupus anticoagulant have a prolonged basal apti because the immunoglobulin inhibits the activation of prothrombin by the prothrombinase complex. A modification of the APC ratio based on the PT assay shows promise for detecting APCR in patients with a lupus anticoagulant" although some authors report that APCR is not common in patients with antiphospholipid syndrome. 37 Why not simply perform DNA testing on all patients suspected of having APCR, avoiding the difficulties associated with the determination of APC ratios? PCR/restriction enzyme analysis has the advantage of providing a distinct result (normal, heterozygote or homozygote for FVL), has no problem with borderline values and experiences no interference from heparin, Coumadin or the lupus anticoagulant. However, it is more laborious, requiring a fair amount of expertise, and demands meticulous attention to detail in order to avoid sample contamination. In addition, DNA analysis tells nothing of disease severity, and fails to detect those patients with APCR secondary to causes other than FVL. The APC ratio, on the other hand, is relatively cheap, easy to perform, and does give an indication of disease severity. Furthermore, it has the added advantage of detecting patients with APCR without the FVL mutation. I The reality, therefore, is that both tests have advantages and disadvantages, and are best viewed as complimentary rather than exclusionary. Considering the relative expense and ease of performance, a practical approach is to delegate the APC ratio as the primary test for APCR, reserving DNA analysis for confirmation of borderline results and diagnosis in those patients in whom an APC ratio cannot be performed. Screening for APe resistance Given the high prevalence of APCR in the European population, there is interest in screening patients for this disorder. However, experience dictates that the majority of people with APCR never suffer an abnormal thrombotic event. It appears that additional risk factors, acquired or genetic, are required for disease expression. I Therefore, since most individuals with APCR remain asymptomatic, general screening is not appropriate. The question remains. however, as to whether screening is useful in certain patients with other risk factors for thrombosis, especially pregnancy and oral contraceptive use. This is potentially important, as Dahlback found a 34-fold increased probability of venous thrombosis for women with APCR on oral contraceptives, as compared with those with neither genetic nor circumstantial risk.'-" Testing in this situation may have merit, as it is relatively inexpensive, particularly when compared with the cost of treating a thrombotic event. In addition, the assay has a reasonable sensitivity and specificity, and furthermore has the potential to impact significantly on the health of the patient. The decision whether or not to screen for APCR is best left to the judgment of the individual clinician, assessing its worth on a case by case basis. Summary ~n conclusion, APCR is a re~e.ntly discovered, medically Important cause of thrombophilia, The disorder has a high prevalence in the European population, and is in fact the most common known genetic cause of the hypercoagulable state. Over 95% of cases are due to factor V Leiden, a mutated form. of factor ~ that is resi~tant to degradation by APC. All patients suffering from episodes of inappropriate venous thrombosis should be tested for APC. This is usually accomplished by performing an APC ratio, but in some cases one mu~t reso~ to PCR/restriction enzyme analysis for accurate diagnosis. Although general screening for the disorder is inappropriate, as most patients remain asymptomatic, there may be some merit in testing individuals with other risk factors for thrombosis, such as pregnancy or oral contraceptive use. The discovery of APCR represents a major advance in the understanding of thrombotic disorders, and stands as tribute to the impact that insightful observation and quality research can have on the health and well-being of patients. References 1 Dahlback B. Resistance to activated protein C. the arg?" til gin mutation in the factor V gene, and venous thrombosis; functional tests and DNA-based assays, pros and cons. Thromb Haemost 1995; 73: Rodgers OM. Activated protein C resistance and inherited thrombosis. Am J Clin Pat/wi 1995; 103: Svensson Pl. Dahlhack B. Resistance to activated protein C as a basis for venous thrombosis. N Eng/ J Med 1994; 330: Suzuki K. Protein C. In: High KA, Roberts HR eds. Molecular basis ofthrombosis and hemostasis. New York: Dekker, 1995: , 5 Dahlback B. Carlsson M, Svensson Pl. Familial thrombophilia due to Vascular Medicine 1996: 1:

6 280 HD Hoerl et al a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: prediction of a cofactor to activated protein e. Proc Natl. AcadSci USA 1993; 90: Rees OC. Cox M, Clegg lb. World distribution of factor V Leiden. Lancet 1995; 346: Kirschbaum NE, Foster P. The polymerase chain reaction with sequence specific primers for the detection of the factor V mutation associated with activated protein resistance. Thromb Haemost 1995; 74: Aillaud MF. Stucco E, Alessi MC et al. Resistance to activated protein C - diagnostic strategy in a laboratory of haemostasis. Thromb Haemost 1995; 74: de Ronde H, Bertina RM. Laboratory diagnosis of APC-Resistance: a critical evaluation of the test and the development of diagnostic criteria. Thromb Haemost 1994; 72: Samaha M, Trossaert M, Conard 1, Horrellou MH, Elalamy I, Samama MM. Prevalence and patient profile in activated protein C resistance. Am ] Clin Pathol 1995; 104: II Kontula K, Ylikorkala A, Miettinen H et al. Arg506Gln factor V mutation (factor V Leiden) in patients with ischaemic cerebrovascular disease and survivors of myocardial infarction. Thromb Haemost 1995; 73: 558~. 12 Cushman M, Bhushan F. Bovill E, Tracy R. Plasma resistance to activated protein C in venous and arterial thrombosis. Thromb Haemost 1994; 72: Pottinger P, Sigurdsson I. Berliner N. Detection of the factor V Leiden mutation in a nonselected black population. B/ood 1996; 87: Bertina RM, Koeleman BPC, Koster T et al. Mutation in blood coagulation factor V associated with resistance to activated protein e. Nature 1994; 369: 64-{)7. 15 Simioni P, Prandoni P, Girolami A. Patients with AT III, protein C, or protein S defects show no associated hereditary APC-resistance. Thromb Haemost 1994; 72: Koeleman BPC, van Rumpt D, Hamulyak K. Reitsma PH, Bertina RM. Factor V Leiden: an additional risk factor for thrombosis in protein S deficient families? Thromb Haemost 1995; 74: Zoller B, Berntsdotter A, de Frutos PG, Dahlback B. Resistance to activated protein C as an additional genetic risk factor in hereditary deficiency of protein S. Blood 1995; 85: Gandrille S, Greengard IS. Alhenc-Gelas M et al. Incidence of activated protein C resistance caused by the ARG 506 GLN mutation in factor V in 113 unrelated symptomatic protein C-deficient patients. Blood 1995; 86: Mandel H, Brenner B. Berant M et al. Coexistence of hereditary homocystinuria and factor V Leiden - effect on thrombosis. N Eng! J Med 1996; 334: De Stefano V, Leone G. Mastrangelo S. Tripodi A et al. Clinical manifestations and management of inherited thrombophilia: retrospective analysis and follow-up after diagnosis of 238 patients with congenital deficiency of antithrombin III, protein C, protein S. Thromb Haemost 1994; 72: Tosetto A, Rodeghiero F. Diagnosis of APC resistance in patients on oral anticoagulant therapy. Thromb Haemost 1995; 73: Denninger MH. Beldjord K, Durand F. Denic: C, Valla C. Guillin Me. Budd-Chiari syndrome and factor V Leiden mutation. Lancet 1995; 345: Martinelli I, Landi G. Meratti G, Cella R. Tosetto A. Mannucci PM. Factor V gene mutation is a risk factor for cerebral venous thrombosis. Thromb Haemost 1996; 75: Dhote R, Bachmeyer C. Horellou MH, Toulon P, Christoforov B. Central retinal vein thrombosis associated with resistance to activated protein C. Am] Ophtha/mol 1995; 120: Ridker PM, Hennekens CH, Lindpaintner K, Stamper MJ. Eisenberg PR, Miletich IP. Mutation in the gene coding for coagulation factor V and the risk of myocardial infarction, stroke, and venous thrombosis in apparently healthy men. N Engl ] Med 1995; 332: Myers TM. Hull RD, Weg IG. Antithrombotic therapy for venous thromboembolic disease. Chest 1995; 108: 335S-35IS. 27 Sarasin FP, Bounameaux H. Duration of oral anticoagulant therapy after proximal deep vein thrombosis: a decision analysis. Thromb Haemost 1994; 71: Michiels JJ, Stibbe J, Bertina R, Broekmans A. Effectiveness of longterm oral anticoagulation treatment in preventing venous thrombosis in hereditary protein S deficiency. BM] 1987; 295: Rintelen C. Pabinger 1, Knobl P, Lechner K. Mannhalter CH. Probability of recurrence of thrombosis in patients with and without factor V Leiden. Thromb Haemost 1996; 75: De Stefano V, Finazzi G, Mannucci PM. Inherited thrombophilia: pathogenesis, clinical syndromes, and management. Blood 1996; 87: Research Committee of the British Thoracic Society. Optimum duration of anticoagulation for deep vein thrombosis and pulmonary embolism. Lancet 1992; 340: Bauer KA. Management of patients with hereditary defects predisposing to thrombosis including pregnant women. Thromb Haemost 1995; 74: Rosen S, Johansson K. Lindberg B, Dahlback B. Multicenter evaluation of a kit for activated protein C resistance on various coagulation instruments using plasmas from healthy individuals. Thromb Haemost 1994; 72: 255~. 34 Jorquera 11,Montoro JM, Fernandez MA, Aznar la, Aznar J. Modified test for activated protein C resistance. Lancet 1994; 344: Trossaert M, Conrad J. Horellou MH et al. Modified APC resistance assay for patients on oral anticoagulants. Lancet 1994; 344: Le DT, Griffin IH, Greengard JS, Mujumdar V, Rapaport SI. Use of a generally applicable tissue factor-dependent factor V assay to detect activated protein C-resistant factor Va in patients receiving warfarin and in patients with a lupus anticoagulant. B/ood 1995; 85: Dizon-Townson D. Hutchinson C, Silver R, Ware-Branch D, Ward K. The factor V Leiden mutation which predisposes to thrombosis is not common in patients with antiphospholipid syndrome. Thromb Haemost 1995; 74: Vanderbroucke JP. Koster T, Briet E, Reitsma PH. Bertina RM. Rosendaal FR. Increased risk of venous thrombosis in oral-contraceptive users who are carriers of factor V Leiden mutation. Lancet 1994; 344: Vascular Medicine 1996; 1: