The factor V Leiden mutation: Spectrum of thrombotic events and laboratory evaluation

Transcription

1 The factor V Leiden mutation: Spectrum of thrombotic events and laboratory evaluation Franklin A. Bontempo, MD, Andrea Cortese Hassett, PhD, Hawazin Faruki, DrPH, David L. Steed, MD, Marshall W. Webster, MD, and Michel S. Makaroun, MD, Pittsburgh, Pa. Purpose" This study aims to describe the spectrum of clinical thrombotic events and to compare the methods of laboratory evaluation for the newly described prothrombotic factor V Leiden mutation. Methods: Specimens from 1376 patients with thrombotic events or their relatives were tested for the factor V Leiden mutation by polymerase chain reaction plus restriction digest from Jan. 1, 1995, to Mar. 31, Activated protein C (APC) resistance test data was available for 554 of these patients. Clinical information was available for 166 patients with the mutation. Results: Of 1376 patients tested for factor V Leiden mutation, 270 (19.6%) were positive, with 12 homozygotes and 258 heterozygotes. Of 554 patients for whom APC resistance data was available, 221 (39.9%) had low APC resistance ratios (-<2.4); of these only 97 (43.9%) were factor V Leiden-positive. Among 333 samples with normal or elevated APC resistance ratios, 19 (5.7%) were later identified with the factor V Leiden mutation, despite the normal screening test. One hundred fourteen of 166 patients (68.7%) with the mutation had at least one thrombotic event, most commonly deep venous thrombosis and pulmonary embolus. Arterial cerebrovascular thrombotic events occurred in 11 patients (10%), and myocardial infarctions in eight (7%). The mean age of all patients with arterial thrombotic events was 45.4 years. Conclusions: The factor V mutation is a common cause of venous thromboses but may also be associated with the early presentation of arterial thrombotic events. The APC resistance test is a sensitive screening assay but has limitations of its specificity in clinical practice. (J Vase Surg 1997;25:271-6.) Resistance to activated protein C (APC) that resuits in a defective anticoagulant response has recently been shown to be inherited and found in 30% to 40% of patients with idiopathic thrombotic disease3 In the majority of patients, APC resistance has been shown to be the result of a single base pair substitution in the gene coding sequence of clotting factor V, designated factor V Leiden. 2 This mutation From the Divisions of Hematology and Vascular Surgery, University of Pittsburgh School of Medicine, and the Institute for Transfusion Medicine. Presented at the Forty-fourth Scientific Meeting of the International Society for Cardiovascular Surgery, North American Chapter, Chicago, Ill., June 9-10, Reprint requests: Franklin A. Bontempo, MD, c/o Coagulation Laboratory, Institute for Transfusion Medicine, 3636 Blvd. of the Allies, Pittsburgh, PA Copyright 1997 by The Society for Vascular Surgery and International Society for Cardiovascular Surgery, North American Chapter /97/$ /6/77410 alters the APC cleavage site of factor V and produces a mutant molecule that cannot be properly inactivated by APC. This discovery has led to the development of a screening assay for the mutation based on the degree of prolongation of the activated partial thromboplastin time (APTT) after the addition of APC, designated the APC resistance test. A confirmatory test is direct testing for the mutation by polymerase chain reaction (PCR). The factor V gene mutation is present in 6% of the general U.S. population, maldng this defect at least ten times as prevalent as other known genetic defects that predispose to thrombosis. 3 The manifestation of APC resistance is similar to other inherited coagulation disorders and presents as venous thromboembolism. 4 Except for isolated case reports, 5-8 no studies that encompassed large numbers of patients have shown a clear association of APC resistance and arterial thrombosis. In this study we report the clini- 271

2 272 Bontempo et al. February 1997 Normal Allele 67 bp 37 bpl Leiden Mutant Allele 116 bp 67 bp 153 bp Fig. 1. Site of cleavage (arrow) of the 220bp segment of the normal and mutant factor V gene. cal spectrum of thrombotic events found in a population of thrombotic patients and their relatives with the factor V Leiden mutation who underwent testing at a coagulation reference laboratory and discuss the tests used to evaluate them in arriving at the diagnosis. MATERIALS AND METHODS All patients who were tested at the Coagulation Laboratory of the Institute for Transfusion Medicine for the factor V Leiden mutation between Jan. 1, 1995, and Mar. 31, 1996, were included. Clinical history of the type of thrombotic event was obtained by one of the authors (FAB) by phone contact with ordering physicians, direct interview of the patient, or both. APC resistance testing. Specimens for APC resistance testing were performed on an ACL 3000 (Instrument Laboratories, Milan, Italy) using a APTT-based commercial assay (Coatest APC-Resistance, Chromogenix, Molndal, Sweden). Briefly, citrated plasma was incubated with the APTT reagent for 5 minutes. Coagulation is initiated by the addition of CaC12 in the absence and presence of APC, and the time for clot formation is recorded. The test is expressed as APC ratios of the two clotting time determinations. A ratio of 2.4 or less is a low response to activated protein C and is reported as positive for APC resistance. This cutoff value was determined from tests on 50 normal healthy donors following the recommendations of the manufacturer. Abnormally prolonged APTTs (>45 seconds) caused by circulating inhibitors or intrinsic factor deficiencies invalidate the APC resistance functional assay and are not reportable. Factor V Leiden mutation methods (lymphocytes). DNA was extracted from venous blood (acid citrate dextrose [ACD] anticoagulated) buffy coats using QIAamp spin columns (Qiagen, Chatsworth, Calif.). A 220 bp fragment, from exon 10/intron 10 of the Factor V (FV) gene, containing the FV Leiden mutation site (nucleotide position 1,691, G--~A sub - stitution) was amplified. The 220 bp fragment was amplified using primers 5' TGCCCAGTGCTTAA- CAAGACCA3' (nt 1,581-1,602 in exon 10) 2 and 5'CTTGAAGGAAATGCCCCATTA3'( -79 to -100 in intron 10). 9 A 30-cycle PCR reaction was performed with 50 to 500 ng ofgenomic DNA in a 50 t*1 reaction mixture containing 1% BSA, 2.5 mmol/l Mg +2, 4 mmol/l of each deoxynucleotide 5' triphosphate (dntp), 2.5 U Taq DNA polymerase (Perkin Elmer Cetus, Norwalk, Conn.), 10 mmol/l Tris-HC1, 50 mmol/l KC1, and 20 pg of each primer. Cycles consisted of denaturation of 94 C for 15 seconds, annealing at 55 C for 15 seconds, and extension at 72 C for 30 seconds in a 9600 Perkin Elmer thermal cycler (Norwalk, Conn.). Amplified DNA was digested with 5 U of Mnl I (New England Biolabs, Beverly, Mass.) at 37 C for 1 hour. Enzyme digest fragments were separated by electrophoresis in a 3.5% Metaphor agarose gel (FMC Bioproducts, Rocland, Me.) and ethidium bromide stained. The 220 bp product of a normal FV allele is cleaved by Mnl I into fragments of 37, 67, and 116 bp. Digestion of the FV Leiden allele results in fragments of 67 and 153 bp (Fig. 1). Heterozygotic mutants show the 153, 116, 67, and 37 bp fragments. All extractions and amplifications were performed in a molecular diagnostic facility where there was complete separation of pre- and post-amplification manipulations. In addition, water-negative controls were included in each run to assure the absence of amplicon contamination. RESULTS Factor V mutation testing. One thousand three hundred seventy-six patients were tested for the factor V Leiden mutation by PCR. Of these, 270 (19.6%) were positive for the mutation and 1106 were negative; 258 (95.6%) were heterozygotes and 12 (4.4%) were homozygous mutants. APC resistance. Of the 1376 patients tested for the factor V mutation, APC resistance testing was requested on 655 but could not be performed on 101 patients because of the presence of a long APTT. Of the 554 remaining specimens on which APC resistance testing was done, 221 (39.9%) had a low ratio (abnormal) and 333 (60.1%) had a normal response.

3 Volume 25, Number 2 Bontempo et al. 273 Table I. APC resistance test results versus DNA analysis for factor V mutation in 554 patients Mutant Normal APC ratio n factor V factor V % Mutant >4.1 (elevated) % 2.5 to 4.1 (normal) % 2.2 to 2.4 (low) % 1.8 to 2.1 (low) % <1.8 (low) % Total Correlation of APC resistance test to the presence of the factor V Leiden mutation. The correlation of the APC resistance test with the factor V Leiden mutation is shown in Table I. No patient with an APC resistance test ratio greater than 4.1 had the mutation. There were 19 factor V Leiden-positive patients with APC resistance tests in the normal range (2.5 to 4.1), for an overall false negative rate of 5.7%. Of 221 total patients with low APC ratios, only 97 (43.9%) were factor V Leiden-positive and 124 (56.1%) were factor V Leiden-negative. All 12 factor V Leidcn homozygous mutants had APC ratios less than 1.8. Thrombotic events in patients with factor V Leiden mutation. Clinical information was obtained on 166 patients identified with the factor V Leiden mutation. Fifty-two had no documented thrombotic event, and many of these patients had been tested because of a family history of thrombosis. The spectrum of thromboses reported in the remaining 114 patients is shown in Table II. Similar thrombotic episodes in a single patient were counted only once. Clinical aspects. Multiple events were frequent and were observed in 54 of 114 patients (47%). Deep venous thrombosis (DVT) and pulmonary embolus (PE) were the most common events, occurring in 66% and 33% of the patients respectively with 25 (21.9%) experiencing both DVT and PE. In 13 patients (11.4%) a thrombotic event was associated with the concomitant use of oral contraceptives. The age distribution of patients is shown in Fig. 2. The mean age at the time of diagnosis of 107 patients for whom the information was available was 42 years, with a range of 10 to 77 years. Seventy-nine patients with venous thromboses had a mean age of 40.5 years. Arterial events in patients with factor V mutation. Clinical arterial thrombotic events were noted in the cerebral circulation in 11 patients and the coronary circulation in eight patients. The mean age of patients with arterial strokes was 45.2 years (range, 30 to 58 years); the eight patients with myocardial infarctions had a mean age of 46.6 (range, 27 to 72 years). Table II. Types of thrombotic events in 114 patients with factor V Leiden mutation Event No. of patients (%) DVT 75 (66%) PE 31 (31%) Stroke/TIA 11 (10%) Superficial venous thrombosis 9 (8%) Myocardial infarction 8 (7%) Retinal vascular occlusion 8 (7%) Mesenteric vascular occlusion 5 (6%) Other 7* (4%) *Includes one patient with each of." superior vena caval syndrome, renal infarct, cavernous sinus thrombosis, transverse sinus thrombosis, lower extremity thromboemboli, and two access graft occlusions. DISCUSSION The factor V Leiden mutation is the most common congenital prothrombotic disorder yet described. The molecular basis for the prothrombotic tendency is a point mutation in the APC cleavage site of the factor V molecule that renders it less susceptible to the natural anticoagulant action ofapc.~ This decreased inactivation of factor V leads to a prothrombotic state, resulting in a seven- to tenfold increase in the risk of thrombosis for heterozygotes and a 79-fold increase in risk compared with the general population. 2,4,9,~ This increased risk may only be present if other contributing risk factors are also present, because it has been observed that many individuals with APC resistance remain asymptom- atic. Although the analysis of the factor V gene mutation definitively determines whether a given patient is normal, heterozygous, or homozygous, it is not suitable as a screening assay; DNA technology is costly ($100 to $200), laborious, and not routinely available to many clinical laboratories. The advantages of the APC resistance test are cost ($20 to $75) and ease of performance. The assay is sensitive for APC resistance caused by the factor V mutation but may also be positive in cases of APC resistance of other cause. Our investigation has shown that the APC resistance test has a 94.3% negative predictive

4 274 Bontempo et al February 1997 # of Patients El All Patients [] Arterial events [ i 23 f i 21 J 24 m~ J f i J >60 AGE Fig. 2. Age distribution at diagnosis of 107 patients with factor V Leiden mutation and thrombotic events (entire column) and the 17 patients with myocardial infarction or stroke/ transient ischemic attack (shaded part). value but only a 43.9% positive predictive value for the Leiden mutation. Previous reports have shown a much higher positive predictive value of the APC resistance test for the mutation, 2 probably as a result of a high incidence of familial thrombosis in their populations. Despite the relatively low specificity in our study of the APC resistance test for the factor V mutation, the APC resistance may still be useful as a screening test, especially in a healthy patient population with a lower incidence of the mutation. It should be noted that the APC resistance assay is accurate when certain criteria arc met, that is, the patient is not on any anticoagulant or estrogen preparation, the sample is properly handled, and no lupus anticoagulant or other preexisting coagulopathy is present. These conditions may be difficult to meet in many clinical situations where a thrombotic event has occurred, as was often the case in many of our patients. In these instances, the direct DNA analysis may be necessary. Alternately, a modification of the A_PC resistance test can be performed that normalizes the concentrations of other plasma proteins involved in the formation of thrombin. This allows the analysis of plasma from patients who are on oral anticoagulats. This modification of the APC resistance test is presently for research use only. 11 Thrombotic events seen in patients with the factor V Leiden defect were mostly DVT and PE, simi- lar to other reports. To date, however, there have been no definitive studies that indicate an association of the factor V Leiden mutation and arterial events. Halbmeyer et al.12 documented APC resistance in 17% of 30 patients with juvenile or recurrent stroke, and isolated case reports have associated arterial disease and APC resistance. Ouriel et al. 13 recently suggested that APC resistance was relatively common in patients with peripheral vascular disease (11.6%) and may play a significant role in bypass graft failures. These patients only had APC resistance testing; no confirmatory DNA testing for the factor V Leiden gene was performed. Because the functional assay may be less specific, no firm conclusions can be made. Results reported in our study showed that 7% of the patients with the factor V mutation and a history of thrombotic events had a myocardial infarction and 10% had a stroke or transient ischemic attack. This finding of the factor V Leiden mutation in association with serious arterial thrombotic events may indicate a cofactor relationship, especially because many of the patients were younger than would be expected for the development of atherosclerotic disease. Further studies of this select group are indicated. The clear association of the factor V mutation with an increased risk of thrombosis, together with the high prevalence of the mutation in the general

5 Volume 25, Number 2 Bontempo et al. 275 population, raises the possibility that it may be worthwhile to perform screening for the mutation with the APC resistance test in association with oral contraception, surgery, pregnancy, and other circumstantial risk factors for thrombosis. Studies have shown that the risk of thrombosis in women with the factor V mutation who use oral contraceptives is approximately 3 5 times higher than the general population? 4,1s The finding in this report of 13 women on concomitant oral contraceptives at the time of a thrombotic event suggests that screening for the factor V mutation before the start of contraceptive therapy may be of value. The management of patients with factor V Leiden mutation remains controversial and is hampered by the lack of studies that evaluate outcomes to date. Clearly, known carriers of the factor V mutation should be counselled about the risk of thrombosis, and avoidance of oral contraceptives should be recommended. In addition, known adult carriers should receive DVT prophylaxis for major surgical procedures regardless of their age. Vascular bypass procedures in such carriers may carry a higher failure rate, 13 and a more prolonged period of anticoagulation may be beneficial. Relatives of known carriers should be screened so they may be similarly counseled. Life-long anticoagulation should be recommended in patients with the factor V Leiden mutation and two or more thrombotic episodes and for selected patients after one episode depending on the clinical situation. The issue of whether anticoagulant therapy is necessary in carriers of the mutation who only had a thrombotic event in the presence of a second acquired risk factor which has subsequently been removed, that is, oral contraceptives, the postoperative state, or immobilization as a result of trauma or an orthopedic cast, has not yet been addrcssed and awaits further investigation. REFERENCES 1. Svensson PJ, Dahlb/ick B. Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med 1994;330:517-22, 2. Bertina RM, Koeleman BPC, Koster T, Rosendaal FR, Dirven RJ, de Ronde H, et al. Mutation in blood coagulation factor V associated with resistance to activated protein C [letter]. Nature 1994;369:64-7.,. 3. Ridker PM, Hennekens CH, Lindpainter K, Stampfer MJ, Eisenberg PR, Miletich JP. Mutation in the gene coding for coagulation factor V and the risk of myocardial infarction, stroke, and venous thrombosis in apparently healthy men. N Engl J Med 1995;332: Koster T, Rosendaal FR, De Ronde H, Briet E, Vandenbroucke JP, Bertina RM. Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden thrombophilia study. Lancet 1993;342: M~irz W, Seydewitz H, Winkelmann B, Chen M, Nanck M, Witt J. Mutation in coagulation factor V associated with resistance to activated protein C in patients with coronary artery disease [letter]. Lancet 1995;345:526~7. 6. Lindblad B, Svensson PJ, Dahlb~ick B. Arterial and venous thromboembolism with fatal outcome and resistance to activated protein C [letter]. Lancet 1994;343: Simioni P, de Ronde H, Prandoni P, Saladini M,,Bertina RM, Girolami A. Ischemic stroke in young patients with activated protein C resistance. Stroke 1995;26: Kontula K, Ylikorkala A, Miettinen H, Vuorio A, Kauppinen- M~elin R, H/im/il~iinen L, et al. Arg506Gln factor V mutation (factor V Leiden) in patients with ischaemic cerebrovascular disease and survivors of myocardial infarction. Thromb Haemost 1995;73: Koeleman BPC, Reitsma PH, Allaart CF, Bertina RM. Activated protein C resistance as an additional risk factor for thrombosis in protein C-deficient families. Blood i994;84: Rosendaal B, Koster T, Vandenbroucke JP, Reitsma PH. High risk of thrombosis in patients homozygous for factor V Leiden (activated protein C resistance). Blood 1995;85: Trosseert M, Conrad J, Horellou MH, Samama MM, Ireland H, Bayston TA, et al. Modified APC resistance assay for patients on oral anticoagulants [letter]. Lancet 1994;344: i Halbmeyer WM, Haushofer A, Schon R, Fischer M. The prevalence of poor anticoagulant response to activated protein C among patients suffering from stroke or venous thrombosis and among healthy subjects. Blood Coagul Fibrinolysis 1994;5: Ouriel K, Green RM, Deweese JA, Cimino C. Activated protein C resistance: prevalence and implications in peripheral vascular disease. J Vase Surg 1996;23: Vanderbroucke JP, Koster T, Briet E, Reitsma PH, Bertina RM, Rosendaal FR. Increased risk of venous thrombosis in oral contraceptive users who are carriers of factor V Leiden mutation. Lancet 1994;344: Bloemenkamp KWM, Rosendaal FR, Helmerhorst FM, Buller HR, Vandenbroucke JP. Enhancement by factor V Leiden mutation of risk of deep venous thrombosis associated with oral contraceptives containing a third generation progestagen. Lancet 1995;346: Submitted June 14, 1996; accepted Aug. 17, 1996.

6 276 Bontempo et al. February 1997 DISCUSSION Dr. Donald Silver (Columbia, Mo.). The prevalence of inherited anticoagulant protein deficiencies in patients with DVT and arterial thromboembolism ranges as high as 40%. One of the more common hypercoagulable syndromes in patients with venous disorders is that of resistance to APC. Recently, APC has also been described in patients with arterial occlusive disease. APC resistance, with a prevalence of 3% to 7% in the general population, is most often caused by mutation of the factor V gene, during which ARG506 is replaced with GLN, thus making activated factor V resistant to digestion by APC. Patients with additional risk factors, such as protein C deficiency, in addition to APC resistance are at even greater risk for venous thrombosis. The authors reviewed data collected "from thrombotic patients and their relatives..." during a 14-month period. One thousand three hundred seventy-six samples were assayed for the factor V mutation. Almost 20% of the "thrombotic patients" had the Leiden mutation--96% were heterozygotic and 4% homozygotic. Five hundred fifty-four of the patients were also tested for APC resistance. Forty percent were found to be APC-resistant; 43% of those who were APC-resistant had the Leiden factor. Only 6% of the patients who did not have APC resistance had the Leiden factor. Approximately one third of the patients who were Leiden mutation-positive were asymptomatic. I have several questions for the authors. What is the risk of thrombosis for the 52 asymptomatic patients who were Leiden mutation-positive? What percent of the 114 symptomatic patients with the Leiden mutation had secondary risk factors that contributed to their thrombosis? When should a "thrombotic patient" with a negative APC resistance be tested for the Leiden factor? What tests are currently included in your hypercoagulable screen? And finally, have you initiated a prospective study of APC resistance and/or factor V Leiden mutation prevalence in vascular surgery patients? I wish to thank the authors for presenting their results. It has become increasingly clear during the last couple of decades that congenital and acquired hypercoagulable disorders are prevalent and contribute to venous and arterial thromboembolism and, to a lesser degree, to arterial reconstructive failures. Dr. Michel S. Makarotm. In response to your first question, the 52 asymptomatic patients were mostly heterozygotes, and the risk is estimated to be about sevenfold higher than the normal population in terms of venous thrombotic risk. Of the 114 symptomatic patients, there were some additional secondary contributing risk factors in about 20 patients. There was one patient with malignancy, 13 patients were taking birth control pills, and several patients were in the postoperative state or postpartum. There were three patients with lupus anticoagulant and, I believe, one patient with protein S deficiency. The majority of the patients had no other secondary contributing risk factor. As far as thrombotic patients who have negative APC resistance tests, because some of these patients still can test positive for the mutation, we would recommend that they undergo the DNA analysis in cases where the patient is very young or has had multiple events or in unusual clinical situations where the thrombosis cannot be explained easily. In our hypercoagulable screen we currently test for antithrombin III, protein C level, protein S level, lupus anticoagulant, and APC resistance. We did initiate a prospective study of APC resistance in conjunction with the Veterans Administration Cooperative Study #362. And we are initiating in the next month three other studies locally in Pittsburgh, in other vascular surgery patients and other patients with atherosclerotic disease, not necessarily vascular surgery patients. Dr. Samuel S. Aim (Los Angeles, Calif.). In this day of cost containment and HMOs, how practical is it to screen patients? How much is the testing? How available are the tests in most hospitals? Dr. Makaroun. The APC resistance test is very available and actually relatively cheap. It's a standard partial thromboplastin time test with the addition of APC. The cost is less than $50. It's widely available. The DNA analysis obviously is not widely available, and the facility in Pittsburgh was probably one of the first to start testing for the DNA mutation. The cost analysis has not been accurately performed; but if you identify patients and can prevent the development of costly PE or multiple DVTs in the future, the $150 that it costs for the DNA test can be easily justified. Dr. Barry B. Rubin (Toronto, Ontario, Canada). There were a large number of patients you had with a positive APC screen who did not have the mutation at 506. I was wondering whether you could comment on the possibility that there are other genetic mutations that the DNA-cleaving enzyme that you used would have missed but could still be contributing to APC resistance? Dr. Makaroun. The enzyme digest happens to be located to splice the 220 base pair fragment at exactly the APC cleavage site. The gene and the protein are obviously much longer. And there is considerable work now on two other sites on the factor V that could contain different mutations that might affect the APC resistance. Nothing has been described yet, and it is possible that this might be identified in the future. Dr. Michael Sobel (Richmond, Va.). I rise to support your research in this area, particularly in arterial disease, and to remind clinicians that a large number of the patients you see who have postpartum DVT, or who develop venous thromboembolism while on birth control pills, probably have this genetic mutation. Dr. Makaroun. I agree with that.