Expression of mrnas encoding tumor necrosis factor-α and its receptor I in buffalo ovary
|
|
- Garry Moody
- 5 years ago
- Views:
Transcription
1 Indian Journal of Experimental Biology Vol. 45, August 2007, pp Expression of mrnas encoding tumor necrosis factor-α and its receptor I in buffalo ovary G P Madhusudan, R Dev, M K Sharma* & Dheer Singh Molecular Endocrinology Laboratory, Division of Animal Biochemistry National Dairy Research Institute, Karnal , India Received 16 October 2006; revised 17 April 2007 The tumor necrosis factor-α (TNF-α) plays an important role in ovarian follicular development and ovulation process and acts through its receptor (TNFRI). The present investigation describes the expression of mrnas encoding TNF-α and TNFRI in relation to glyceraldehyde-3-phosphate dehydrogenase (G3PDH) and β-actin as control genes, using RT-PCR, in granulosa cells, intact follicles and luteal tissues from buffalo ovary. There was significant higher expression of mrnas encoding TNF-α in granulosa cells from medium follicles and TNFRI expression increased with increase in size of follicles. Post-ovulatory structures (corpus luteum and corpus albicans) exhibited significantly higher expression of TNFRI mrnas as compared to that obtained in intact follicles suggesting its immediate and critical role just after ovulation, for mediating TNF-α action on these tissues. Though the expression of TNF-α mrna was stimulated by treatment of granulosa cells with FSH during culture, the expression of TNFRI mrna did not change. The FSH alongwith IGF-I did not exert any effect. These results suggested an important role of TNF-α and its receptor in buffalo ovarian functions. Keywords: Expression, mrna, TNF-α, TNFRI, RT-PCR, Ovary, Buffalo In mammalian ovary, the follicular development, atresia, ovulation, corpus luteum (CL) development and its regression, are important events during reproductive cycle. In addition to gonadotropins, certain growth factors regulate steroidogenesis 1,2 and other processes in the ovary. The tumor necrosis factor- α (TNF-α), a non-glycosylated cytokine was reported to play important roles in ovarian functions. The high levels of TNF-α in follicular fluid from bovine 3 and human 4, its effect on enhanced ovulation rate in rat perfused ovary 5 and blocked ovulation by TNF-α antibody in sheep 6 suggested active involvement of TNF-α in ovulation process. The evidences show that TNF-α directly inhibits basal and gonadotropin-induced progesterone production in 7,8 luteal cells and this effect is mediated by PGF 2α which in turn regulates the expression of steroid acute regulatory (StAR) protein 9. The modulation of steroidogenesis and protein secretion by TNF-α in granulosa and theca cells was demonstrated in bovine 10. It has also been reported that locally produced TNF-α may induce CL apoptosis 11 and *Correspondent author Tel: , Fax: mks_scientist@yahoo.com follicular atresia 12. In whole CL culture model, apoptosis was induced by TNF-α as demonstrated by dose dependent DNA fragmentation 13. The presence of TNF-α mrna was reported in a number of cell types within ovary, such as macrophage, oocyte, granulosa cells and luteal cells from different species 14,15. TNF-α exerts its effect by binding to cell membrane receptors. The bovine granulosa and theca cells were shown to contain TNFα receptors (TNFRI and TNFRII) by radioreceptor assay 15,16 and found the expression of mrna encoding TNFRI in bovine CL during estrous cycle. The regulatory in vitro effect of gonadotropins on TNF-α receptors differed among porcine Sertoli cells 17 and bovine theca cells 16. TNF-α increased granulosa cell proliferation via TNFRI in mouse 18. In view of the significant roles of TNF-α in ovarian functions and major reproductive problem existing in buffalo, the present investigation describes the finding on expression of mrna encoding TNF- α and TNFRI in granulosa cells, intact follicles and luteal tissues from buffalo ovary. Materials and Methods Eagle s Minimum Essential Medium (MEM) with Hepes, fetal bovine serum (FBS), diethylpyrocarbonate (DEPC), agarose, chloroform, insulin-like
2 670 INDIAN J EXP BIOL, AUGUST 2007 growth factor-i(igf-i), trypan blue and ethidium bromide were purchased from Sigma-Aldrich Chem. Co., St.. Louis, MO (USA). RT-PCR kits, 100 bp DNA ladder and specific primers were purchased from Bangalore Genei Pvt. Ltd., Bangalore (India). Plasticwares were purchased from Tarsons Pvt. Ltd. Kolkata (India) and were properly treated with DEPC before use. The culture multi-well plates were from Costar Corp., Cambridge, MA (USA). FSH was a generous gift from Dr. A. F. Parlow, National Hormone and Pituitary Program, Harbour-UCLA Medical Centre, Torrance, California. Streptomycin and penicillin were purchased from Sarabhai Chemicals, Mumbai (India) and Alembic Chemicals Works Ltd, Mumbai (India). All other reagents used were of analytical grade. Buffalo ovaries and separation of follicles The buffalo ovaries were collected from Delhi (India) slaughter house in chilled normal saline. These were properly washed and extra tissue was removed by trimming. The follicles were mechanically isolated from these ovaries with surgical blade and scissor. Based on morphological appearances and size, nonatretic follicles were pooled and grouped in three categories as small (<5 mm), medium (5-9 mm) and large (>9 mm), representing different stages of follicular development, according to standard method 19. The post-ovulatory structures viz. corpus luteum (CL) and corpus albicans (CA, regressing CL) were isolated and classified based on morphological appearance, extent of vascularity, presence and absence of blood colour and overall appearance of ovary. Luteal tissues The luteal tissue was excised from active corpus luteum (CL) and regressing CL (corpus albicans) and transferred to homogenizer in ice for isolation of total RNA. Isolation and culturing of granulosa cells The granulosa cells (GC) were isolated by aspiration of follicular fluid from small, medium and large follicles and pooled separately. The fluid was centrifuged at 2000 rpm for 20 min and cell pellet was used for isolation of total RNA. The GC were isolated from another lot of medium and large follicles by aspiration, pooled and washed with plain MEM supplemented with penicillin (100 U/ml) and streptomycin (100 µg/ml). The cell viability was determined by trypan blue exclusion method and was in the range of 60-70%. The GC were cultured in 6- well plate containing cells/well/2 ml of MEM supplemented 20 with penicillin and streptomycin. Isolation of total RNA from follicles, granulosa cells and luteal tissues The total RNA was isolated by single step method 21, using acid guanidinium thiocyanate-phenol-chloroform extraction. Standard TRI reagent (Molecular Research Centre Inc. # TR 118) was used in the present study. The identical steps were followed for extraction of RNA from luteal tissues; isolated GC and GC culture monolayer except that whole tissues were homogenized. In general, 1 ml of TRI reagent was added to pellet of GC obtained from 2 ml of follicular fluid. The tissues ( mg) from corpus luteum and corpus albicans were immersed in 1 ml of TRI reagent. Similarly, the intact small (7-8), medium (3-4) and large (1-2) follicles were homogenized separately in 1 ml of TRI reagent, with 8-10 strokes in Dounce homogenizer. The homogenate was kept for 10 min on the ice, followed by centrifugation at 12, 000 rpm for 15 min at 4 C, to remove debris. The supernatant was transferred to a fresh sterile Eppendorf tube and 0.2 ml of chloroform for each 1 ml of TRI reagent was added. The content was mixed vigorously for 15 sec, allowed to stand at room temperature for 15 min and centrifuged at rpm/15 min/4 C. The clear aqueous phase was transferred to fresh sterile Eppendorf tube and 0.5 ml of isopropanol for each ml of TRI reagent was added to precipitate RNA. The content was again allowed to set at room temperature for 10 minutes and centrifuged at rpm/15 min/4 C. The RNA pellet so obtained, was washed with 1 ml of 75% ethanol for each ml of TRI reagent and centrifuged at 7500 rpm/5 min/ 4 C. Finally, the RNA pellet was air dried and re-suspended in appropriate volume of sterile water. The RNA was quantified using spectrophotometer (Specord 200, Analytica Jena) at 260 nm and RNA purity factor (A 260 /A 280 ) was found between for all RNA preparations which were stored at -70 C till further use. The integrity of RNA was evaluated using agarose (1%) gel electrophoresis 22. Design of primers All the primers used in the present study were got synthesized from Bangalore Genei Pvt. Ltd., Bangalore (India) (Table 1). Reverse transcription-polymerase chain reactions (RT-PCR) RT-PCR was carried out using RT-PCR kit from Bangalore Genei. The RT reaction mixture contained 1 μl (1 μg) RNA, 8 μl of sterile water, 1 μl of random hexamer. The content was incubated in thermocycler at 65 C for 30 min and kept at room
3 MADHUSUDAN et. al.: EXPRESSION OF mrnas ENCODING TNFα 671 Table 1 Primers used for amplification during PCR Name of gene product Forward primer(5 / 3 / ) Reverse primer(5 / 3 / ) cdna product size (bp) TNF-α AGGTCAACATCCTGTCTGCC GGCGATGATCCCAAAGTAGA 200 TNF-α Receptor-I CCCGACCTTCAACTGGTAAA GGAATGGAGACAGGACTGGA 274 β-actin CGTGGGCCGCCCTAGGCACCA TTGGCCTTAGGGTTCAGGGGGG 243 G-3-PDH AAACCCATCACCATCTTCCAG AGGGGCCATCCACAGTCTTCT 360 temperature for 2 min. Subsequently 1.5 μl of sterile water, 4 μl RT buffer (5 ), 2 μl dntp mix (30 mm), 1 μl 0.1 M DTT and 1 μl RNase inhibitor were added in mixture. After brief spin of content, 0.5 μl M-MuLV reverse transcriptase was added. In control (RT minus) 0.5 μl of sterile water was added. The resulting mixture (20 μl each) were incubated in thermocycler (Biometra) at 37 C for 1 hr, 95 C for 5 min and 4 C with pause. The PCR reaction mixture (total volume 50 μl) consisted of 5 μl of PCR assay buffer (10 ), 1 μl dntp mix (30 mm), 1 μl Taq DNA polymerase (1unit/μl), 2 μl RT (cdna) product and 1 μl gene specific primers (final conc μm). The resulting mixture was was kept in thermocycler at 95 C for 2 min (denaturation of RT enzyme), 95 C for 1 min (denaturation of RT product), 60 C for 1 min (annealing), 72 C for 1 min (extension). The amplification of RT product was done for 35 cycles, followed by final template extension at 72 C for 7 min. The PCR products were analyzed on 2% agarose gel, using 100 bp DNA ladder and stained with ethidium bromide. Optimization of PCR The optimization of PCR was done with respect to MgCl 2 concentration (1.0, 1.5, 2.0 and 3.0 mm), PCR cycle numbers (20, 25, 30 and 35 cycles, respectively) and primer concentration (0.05, 0.10, 0.15 and 0.20 μm) since these factors greatly influence the success of PCR. Relative RT-PCR The relative RT-PCR was done using 1 μl each of forward and reverse primers for β- actin and glyceraldehydes-3-phosphate dehydrogenase (G3PDH) as control (house keeping genes) together with target genes specific primers. The mrnas for both target and control genes were reverse transcribed and amplified in same reaction sample. The PCR products were analyzed on 2% agarose gel and stained with ethidium bromide (0.5 μg/ml). Effect of FSH and IGF-I on expression of mrnas encoding TNF-α and TNFRI The granulosa cells, pooled from medium and large size follicles, were cultured in MEM supplemented with FBS and antibiotics as described earlier. After initial 24 hr, the spent medium was discarded and granulosa cells were further cultured with plain MEM without FBS. At this stage, appropriate concentrations of FSH alone and FSH with IGF-I were added in culture medium at the rate of 100 ng/ml each. After another 24 hr, the spent media was again discarded and 400 μl of TRI reagent was added in each well to extract total cellular RNA and processed as described. The RT-PCR was performed on these RNA samples to detect the comparative expression of mrnas encoding TNF- α, TNFRI and control genes (G3PDH and β-actin). Gel quantitation The intensity of individual bands on agarose gel was measured by using GelQuant Software. The results were expressed in the form of ratio obtained by dividing the band intensity of target gene with that of control gene. Statistical analysis The statistical analysis was done using Systat Software. Results Purity of RNA preparations from follicles, follicular cells and luteal tissues The purity of total RNA preparations was checked by measuring the absorbance at 260 and 280 nm and then the ratio of A 260 /A 280 was found in range of for all RNA preparations. The integrity of these RNAs was also confirmed by denaturation of RNA with glyoxal and DMSO and agarose gel electrophoresis. Optimization of RT-PCR The first strand cdna was synthesized using total RNA from all samples by reverse transcription and further amplified as per standard procedures. The optimization was also done for the concentrations of primers (forward and reverse) and MgCl 2 and cycle numbers for appropriate amplification in presence of control genes (G3PDH and β-actin). In cases of both TNF-α and TNFRI the concentration of primers (forward and reverse) as 0.15 mμ was found appropriate to get optimum amplified products Τhe amplified cdnas exhibited 1.5 mm MgCl 2 as optimum for proper amplification. Regarding the cycle numbers, 35 cycles produced cdna product with highest intensity. This is routine
4 672 INDIAN J EXP BIOL, AUGUST 2007 exercise done during the study of any gene expression, therefore, the results are not shown. Relative expression of mrnas encoding TNF-α, TNFRI, G3PDH and β-actin in granulosa cells (GC) isolated from different sizes of buffalo follicles The experiment was designed to find out the pattern of mrnas encoding TNF-α and house keeping gene (G3DH) in GC isolated from buffalo follicles of different stages of growth. The profile of TNF-α with amplified product size of 200 bp and that of G3PDH (360 bp) is clearly shown in Fig. 1A as indicated by 100 bp DNA ladder (lane 1). There was significantly (P< 0.01) higher expression of TNF-α mrna in GC from medium follicles (lane A3) as compared to that in GC from small and large follicles. The expression of TNFRI mrna increased significantly (P< 0.01) with increase in size of follicles where β-actin was used as control gene (Figs.1B and 1). Relative expression of mrnas encoding TNF-α, TNFRI, G3PDH and β-actin in follicles and luteal tissues In earlier experiments, the expression of mrnas encoding TNF-α, its receptor (TNFRI) and control genes was found out in GC isolated from follicles of different sizes. The study was also done to find out the relative expression of these genes in intact follicles (small, medium and large size) and luteal tissues (active and regressing). The results shown (Fig. 2) exhibited significantly higher (P< 0.01) expression of TNF-α (200 bp) in small and medium size follicles than that obtained in large follicles, being highest in medium follicles. There was higher expression of TNF-α in corpus albicans than that obtained in corpus luteum. The expression patterns of TNFRI (274 bp) with β- actin (243 bp) have been shown in Fig. 3. There was a Fig. 2 Expression pattern of mrna encoding TNF-α (200 bp) in relation to G3PDH (360 bp), in intact follicles of different sizes and luteal tissues. SF, small follicle; MF, medium follicle; LF, large follicle, CL, corpus luteum; CA, corpus albicans. Different superscript differ significantly (P<0.01). Fig. 1 Expression pattern of mrna encoding TNF-α (200 bp) and TNFRI (274 bp) in relation to G3PDH (360 bp) and β-actin (243 bp) in granulosa cells (GC), isolated from different sizes of follicles. RT-PCR was carried out as described. The size of follicles (small, medium and large) represented various stages of growth and thereby of GC. Lanes A5 & B1, RT control; lanes A2 and B4, GC small; lanes A3 and B3, GC medium; A4 and B2, GC large; lanes A1 and B5, 100 bp DNA ladder. Different superscript differ significantly (P< 0.01). Fig. 3 Expression pattern of mrna encoding TNFRI (274 bp) in relation to β-actin (243 bp) in intact follicles of different sizes and luteal tissues. SF, small follicle; MF, medium follicle, LF, large follicle; CL, corpus luteum, CA, corpus albicans. Different superscript differ significantly (P<0.01).
5 MADHUSUDAN et. al.: EXPRESSION OF mrnas ENCODING TNFα 673 Fig. 4 Effect of FSH alone and with IGF-I on expression of TNF-α (200 bp) and TNFRI (274 bp) in relation to β-actin (243 bp) as control gene, in cultured granulosa cells (GC). Lanes 2 and 5, control GC; Lanes 3 and 6, GC treated with FSH; lanes 4 and 7, GC treated with FSH and IGF-I together; lane 1, 100 bp DNA ladder. Different superscript differ significantly (P<0.01). similar expression of β-actin in intact follicles of all sizes and luteal tissues. However, there was good amount of variation in expression of TNFRI mrna. The luteal tissues showed significantly (P< 0.01) higher expression of TNFRI than that found in intact follicles. Among follicles, small and medium follicles showed better expression than that obtained in large follicles. Effect of FSH and IGF-I on expression of mrnas encoding TNF-α and TNFRI in GC during culture In order to find out the effect of FSH and IGF-I, the RNA was isolated from control and treated GC. The RT-PCR was done for TNF-α, TNFRI and β- actin mrnas. The electrophoretic pattern (Fig. 4) exhibited similar expression of β-actin (243 bp) in control (lanes 2 and 5) as well as treated GC (lanes 3, 4, 6, 7). When the cells were treated with FSH alone, there was significantly (P< 0.01) higher expression of TNF-α (lane 3) whereas the treatment of GC with FSH and IGF-I together did not stimulate the expression (lane 4) and remained similar to that obtained for control GC (lane 2). There was no significant change in the expression of TNFRI in GC treated either with FSH alone (lane 6) or FSH and IGF-I together (lane 7) as compared to that in control (lane 5). Discussion The tumor necrosis factor-α (TNF-α) significantly participates in the regulation of follicular development, ovulation, formation and regression of corpus luteum (CL) in animals. The functions of TNF-α are accomplished through its receptor (TNFRI). TNF-α being an important cytokine, has dual role of regulating the proliferation of cells and apoptotic functions in the ovary. The results of the present study exhibited the presence of TNF-α and TNFRI transcripts in GC isolated from small, medium and large follicles, indicating the expression patter of these molecules at varying stages of GC growth and development. It was suggested that bovine and rat GC are as a source and target organ for TNF-α 3, where its concentration increases as ovulation approaches. Its presence has also been reported in human follicular fluid 23 and in GC by immunohistochemistry 4. The expression of TNF-α and TNFRI was studied in relation to expression of control genes (G3PDH and β-actin). The conditions were standardized for optimum expression of control genes when studied together with target genes (TNF-α and TNFRI). There was almost consistent and similar expression of these house keeping genes in GC from all the three sizes of follicles, intact follicles and luteal tissues. In some of the experiments involving β-actin, a non-specific minor band corresponding to 200 bp was also observed. This kind of observation was reported 24 with an explanation that there is presence of pseudogenes for β-actin which results in an additional band (200 bp). As observed in granulosa cells and intact follicles, there was increased expression of TNF-α mrna with increase in size of follicles. This suggested more active involvement of TNF-α during follicular development. However, the lower level of TNF-α mrνα expression in large follicles indicated that these follicles might be in a state of moving towards atretic pathway instead of might have become atretic. The lower mrna expression may also suggest that though these follicles may form a pool of large follicles but may remain as subordinate and not dominant to become future preovulatory. The active involvement of TNF-α has been reported in preovulatory stage in bovine since increased amount of TNF-α was detected in follicular fluid collected from such stage. The important role of TNF-α during ovulation process has been established by several workers 5,25,26. Though the theca cells from cow 16 and human 27 preovulatory follicles were reported to express TNF-α but its additional expression was not observed in intact follicles from buffalo ovary. There was an increased expression of TNFRI in GC with increase in size of buffalo follicles, indicating its developmental role by mediating the action of TNF-α
6 674 INDIAN J EXP BIOL, AUGUST 2007 in follicular phase of ovary where primordial follicles enter the growth cycle and some of them becoming predominant. The luteal phase of ovary begins with development of CL after ovulation, followed by its regression. The significantly higher expressions of TNFRI mrna in these post-ovulatory structures (CL and CA) in buffalo, suggested its immediate and critical requirement to mediate action of ligand (even present in normal level). The ovary enters the luteal phase just after ovulation which is of very short period, comparative to follicular phase. The development of CL is required for maintenance of pregnancy, however, in absence of pregnancy, the CL will get regressed so that ovary enters another cycle. Similar observations were also reported 11 in cattle. It has been demonstrated 28 that TNF-α production is regulated by rate limiting steps involving transcription, translation, membrane insertion and ultimate secretion. The post-translational processing of TNF-α may be controlled by an unknown factor resulting in regulated secretion at different stages while the levels of mrna expression remaining the same. The presence of TNF-α and TNFRI expressions in GC, intact follicles and luteal tissues strongly suggest that these molecules have important role in reproductive (estrous) cycle of buffalo. The expressions of TNF-α and TNFRI have been reported to be regulated by gonadotropins. In the present study, there was increased expression of TNFα mrna in GC treated with FSH whereas FSH and IGF-I together did not show any effect. Though FSH and IGF-I have been reported 29 to stimulate the steroid hormones production by granulosa cells during culture, the reason for no such effect of FSH with IGF-I together on TNF-α mrna is not clear. Under similar treatment of GC, expression of TNFRI mrna did not change. It was demonstrated 3 that FSH-treated human GC produce more TNF-α, however, FSH had no effect on TNF-α receptor. In porcine 17 Sertoli cells, FSH increased the number of TNF-α binding sites and TNFα receptor mrna. This suggested that there is a tissuespecific regulation of TNF-α receptors in Sertoli cells and GC. In cattle, insulin was found to reduce TNFα receptor in GC but had no effect on TNF-α receptor in thecal cells 16 suggesting that TNF-α receptors are differentially regulated in GC and theca cells. It is concluded that there is increased expression of mrnas encoding TNF-α and TNFRI in GC isolated from small, medium and large follicles of buffalo. However, their expression in post-ovulatory structures (CL and CA) in much more as compared to that in intact follicles. The results of the present study indicate an active role of TNF-α and its receptor during development of buffalo follicles as well as CL and its regression. FSH stimulates TNF-α mrna expression in vitro in buffalo GC, however, TNFRI mrna expression did not change. The further studies on factors/modulators involved in regulating the dual activity of TNF-α may enrich the understanding of the mechanism of TNF-α action since it participates in proliferation and apoptotic processes, during ovarian functions. Acknowledgement The financial assistance of Institute Fellowship to G.P. Madhusudan is thankfully acknowledged. References 1 Taneja R, Bansal P, Sharma M K & Singh D, Albumin fractions from different species stimulate in vitro progesterone production by granulosa cells in buffalo, Asian- Aust J Anim Sci, 15 (2002) Vinze M, Sharma M K & Singh D, Effect of follicular fluid proteins and gonadotropins on progesterone secretion by buffalo granulosa cells in vitro, Asian Aust J Anim Sci, 17 (2004) Zolti M, Meirom R, Shimesh M, Wollach D, Moschiach S, Shore L & Rafael R B, Granulosa cells as source and target organ for tumor necrosis factor-α, FBES Lett, 261 (1990) Wang L, Brannstrom M, Robertson S A & Norman R J, Tumor necrosis factor- α in the human ovary: Presence in follicular fluid and effects on cell proliferation and prostaglandin production, Fertil Steril, 58 (1992) Brannstrom M, Bonella N, Wang L J & Norman R J, Effects of tumor necrosis factor-α on ovulation in the rat ovary, Reprod Fertil, 7 (1995) Murdoch W J, Colgin D C & Ellis J A, Effects of tumor necrosis factor-α on ovulation in the rat ovary, J Anim. Sci, 75 (1997) Adashi E Y, Resnick C E, Packman J N, Hurwitz A & Payne D W, Cytokine mediated regulation of ovarian function: Tumor necrosis factor-α inhibits gonadotropin supported progesterone accumulation by differentiating and luteinized murine granulosa cells, Am J Obstet Gynaecol, 162 (1990) Benyo D F & Pate J L, Tumor necrosis factor-α alters bovine luteal cell synthetic capacity and viability, Endocrinology, 130 (1992) Pescador N, Soumano K, Stocco D M, Price C A & Murphy B D, Steroidogenic acute regulatory protein in bovine corpora lutea, Biol Reprod, 55 (1996) Spicer L J & Alpizar E, Effects of cytokines on FSH-induced estradiol production by bovine granulosa cells in vitro: Dependence on size of follicle, Domest Anim Endocrinol, 11 (1994) 25.
7 MADHUSUDAN et. al.: EXPRESSION OF mrnas ENCODING TNFα Friedman A, Weiss S, Levy N & Meidan R, Role of tumor necrosis factor-α and its type 1 receptor in luteal regression: Induction of programmed cell death in bovine corpus luteumderived endothelial cells, Biol Reprod, 63 (2000) Morrison L J & Marcinkiewicz J L, Tumor necrosis factor-α enhances oocyte/follicle apoptosis in neonatal rat ovary, Biol Reprod, 66 (2002) Abdo M, Hisheh S & Dharmarajan A, Role of tumor necrosis factor-α and modulating effect of caspases in rat corpus luteum apoptosis, Biol Reprod, 68 (2003) Marcinkiewicz J L, Krishna A, Cheung C M Y & Terranova P F, Oocyte changes in the concentration of prostaglandins in rat Graffian follicle, Prostaglandins, 9 (1994) Sakumoto R, Berisha N, Schams D & Okuda K, Tumor necrosis factor-α and its receptor in bovine corpus luteum throughout the estrous cycle, Biol Reprod, 62 (2000) Spicer L J, Receptors for insulin growth factor-1 and tumor necrosis factor-α are hormonally regulated in bovine granulose and thecal cells, Anim Reprod Sci, 67 (2001) Maudit C, Besset V, Caussanel V & Benahmed M, Tumor necrosis factor-α receptor P 55 is under hormonal (follicle stimulating hormone) control in testicular Sertoli cells, Biochem Biophys Res Commun, 224 (1996) Son D, Arai K J, Roby K F & Terranova PF, Tumor necrosis factor-α increases granulosa cell proliferation: Dependence on C-Jun and TNF receptor type 1, Endocrinology, 145 (2004) Soumano K & Price C A, Ovarian follicular steroidogenic acute regulatory protein, low density lipoprotein receptor and cytochrome P 450 side chain messenger ribonucleic acids in cattle undergoing super ovulation, Biol Reprod, 56 (1997) Balasubramanian K, Lavoie H A, Garney J C, Stocco D M & Veldhius J D, Regulation of porcine granulosa cell steroidogenic acute regulatory protein(star) by insulin-like growth factor-1: Synergism with follicle stimulating hormone or protein kinase A agonist, Endocrinology, 138 (1997) Chomczynski P & Sacchi N, Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal Biochem, 162 (1987) McMaster G & Carmichael G G, Analysis of single and double stranded nucleic acids on polyacrylmide and agarose gels using glyoxal and acridine orange, Proc Natl Acad Sci,USA, 74 (1977) Roby K F & Terranova P F, Effects of tumor necrosis factorα in vitro on steroidogenesis of healthy and atretic follicles of the rat: Theca as target, Endocrinology, 126 (1990) Dirhofer S, Berger C, Untergasser G, Geley S & Berger P, Human β-actin retropseudogenesis interfere with RT-PCR, Trend Genet, 11 (1995) Klebanoff S.J, Vadas M A, Harlan J M & Walterdorph A M, Stimulation of neutrophils by tumor necrosis factor, J Immunol, 136 (1986) Espey L L, Ovulation as an inflammatory process-a hypothesis, Biol Reprod, 22 ( 1980) Chen H L, Marcinkiewicz J L, Sancho-Tello M, Hunt J S & Terranova P F, Tumor necrosis factor-α gene expression in mouse oocytes and follicular cells, Biol Reprod, 48 (1993) Beutler B, Han J, Kruys V & Giroir B P, Coordinate regulation of TNF biosynthesis at level of transcription and translation: Pattern of TNF expression in vivo: In Tumor necrosis factors (Raven Press, New York) 1992, Spicer L J, Alpizar E & Echternkamp S E, Effect of insulin, insulin-like growth factor-i and gonadotropins on bovine granulosa cell proliferation, progesterone, estradiol production and (or) insulin-like growth factor-i production in vitro, J Anim Sci, 71 (1993) 1232.
Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions
Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array
More informationEVALUATION OF FOLLICULAR ATRESIA AND ELECTROPHORETIC PATTERN OF FOLLICULAR FLUID PROTEINS IN ACYCLIC BUFFALO (Bubalus bubalis)
Original Article Buffalo Bulletin (December 2013) Vol.32 No.4 EVALUATION OF FOLLICULAR ATRESIA AND ELECTROPHORETIC PATTERN OF FOLLICULAR FLUID PROTEINS IN ACYCLIC BUFFALO (Bubalus bubalis) F.A. Khan 1,*,
More informationAlbumin Fractions from Different Species Stimulate In Vitro Progesterone Production by Granulosa Cells in Buffalo
1559 Albumin Fractions from Different Species Stimulate In Vitro Progesterone Production by Granulosa Cells in Buffalo R. Taneja, P. Bansal, M. K. Sharma* and D. Singh Division of Animal Biochemistry,
More informationThe role of growth factors in regulating cellular events during ovarian follicular development Leon J. Spicer
The role of growth factors in regulating cellular events during ovarian follicular development Leon J. Spicer Department of Animal Science, Oklahoma State University, Stillwater, OK USA SESSION #54 EAAP
More informationEffect of Resistin on Granulosa and Theca Cell Function in Cattle
1 Effect of Resistin on Granulosa and Theca Cell Function in Cattle D.V. Lagaly, P.Y. Aad, L.B. Hulsey, J.A. Grado-Ahuir and L.J. Spicer Story in Brief Resistin is an adipokine that has not been extensively
More informationTwo important cells in female are the theca cells and the granulose cells. Granulosa cells are affected by the two gonadotropin hormones; FSH and LH.
1 UGS physiology sheet #13 lecture 3 Dr.Saleem Khresha. Now we will start discussing the female reproductive system Ovarian Steroids Two important cells in female are the theca cells and the granulose
More informationREPRODUCTIVE CYCLE OF FEMALE MAMMAL
REPRODUCTIVE CYCLE OF FEMALE MAMMAL Fig. 8-12 Secondary follicles growing follicles increase in number of layers of granulosa cells Tertiary follicles maturing follicles antrum formation fluid filled space
More informationCASE 41. What is the pathophysiologic cause of her amenorrhea? Which cells in the ovary secrete estrogen?
CASE 41 A 19-year-old woman presents to her gynecologist with complaints of not having had a period for 6 months. She reports having normal periods since menarche at age 12. She denies sexual activity,
More informationLH (Bovine) ELISA Kit
LH (Bovine) ELISA Kit Catalog Number KA2280 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationProduct Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4
INSTRUCTION MANUAL Quick-RNA Midiprep Kit Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationOVARY The surface of the ovary is covered with surface epithelium
OVARY Cow The ovary, or female gonad, is: 1. an exocrine gland, producing oocytes 2. an endocrine gland, secreting hormones, i.e., estrogen and progesterone OVARY OVARY The surface of the ovary is covered
More informationProduct Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..
INSTRUCTION MANUAL Quick-RNA MidiPrep Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationManual (Second edition)
Reagent for RNA Extraction ISOGENⅡ Manual (Second edition) Code No. 311-07361 Code No. 317-07363 NIPPON GENE CO., LTD. Table of contents I Product description 1 II Product content 1 III Storage 1 IV Precautions
More informationNutritional and metabolic mechanisms. in the ovarian follicle
Nutritional and metabolic mechanisms in the ovarian follicle Joëlle Dupont Team Leader : «Interaction Metabolism and Reproduction» Unit of Physiology of Reproduction and Behaviors UMR 6175 INRA/CNRS/Université
More informationEndocrinology laboratory Department of Zoology Kalyani University Kalyani, West Bengal India
Epidermal growth factor (EGF) promotes ovarian steroidogenesis and epidermal growth factor receptor (EGFR) signaling is required for gonadotropin-induced steroid production in common carp Cyprinus carpio
More informationIN OVARIAN ANTRAL FOLLICULAR FLUID OF BUFFALOES*
Indian J. Anim. Res., 41 (2): 106-110, 2007 i.exeenzymatic PROFILES OF ACID AND ALKALINE PHOSPHATASES IN OVARIAN ANTRAL FOLLICULAR FLUID OF BUFFALOES* G.P. Kalmath and J.P. Ravindra 1 ** Department of
More informationGlobal Histone H3 Acetylation Assay Kit
Global Histone H3 Acetylation Assay Kit Catalog Number KA0633 96 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle
More informationLH (Rodent) ELISA Kit
LH (Rodent) ELISA Kit Catalog Number KA2332 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationGENERAL SUMMARY Corpus luteum is a transient endocrine structure formed from the ruptured ovarian follicle. Its main function is to secrete P 4, a pro
Corpus luteum is a transient endocrine structure formed from the ruptured ovarian follicle. Its main function is to secrete P 4, a pro-gestational hormone, essential for establishment and maintenance of
More informationEffects of Catecholamines and Dibenamine on Ovulation in the Perfused Fowl Ovary
Effects of Catecholamines and Dibenamine on Ovulation in the Perfused Fowl Ovary Tomoki HIGUCHI, Tomoki SOH, Frank HERTELENDY* and Kousaku TANAKA Faculty of Agriculture, Kyushu University, Higashi-ku,
More informationAbstracts for the KSAR and JSAR Joint Symposium. Fertility control in female domestic animals: From basic understanding to application
Abstracts for the KSAR and JSAR Joint Symposium Fertility control in female domestic animals: From basic understanding to application Current Research Orientation in Livestock Reproduction in Korea Choong-Saeng
More informationEPIGENTEK. EpiQuik Global Histone H3 Acetylation Assay Kit. Base Catalog # P-4008 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Histone H3 Acetylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Histone H3 Acetylation Assay Kit is suitable for specifically measuring global
More informationPRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature
PRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature PRODUCT DESCRIPTION. RNAzol BD is a reagent for isolation of total RNA from whole blood, plasma or serum of human
More informationREPRODUCTION & GENETICS. Hormones
REPRODUCTION & GENETICS Hormones http://www.youtube.com/watch?v=np0wfu_mgzo Objectives 2 Define what hormones are; Compare and contrast the male and female hormones; Explain what each hormone in the mail
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationWhy Cycle Control?" Manipulating Ovulation and Estrous Synchronization" Manipulating Ovulation" Cattle" Principle of PGF 2α Use"
Why Cycle Control?" Manipulating Ovulation and Estrous Synchronization" John Parrish 1. Group females for parturition: " a) Decrease labor, calving period Reduce calving season" b) More uniform weaning
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationAnnals of Oncology Advance Access published January 10, 2005
Annals of Oncology Advance Access published January 10, 2005 Original article Annals of Oncology doi:10.1093/annonc/mdi077 Expression of survivin and bax/bcl-2 in peroxisome proliferator activated receptor-g
More informationLevels of heat shock protein transcripts in normal follicles and ovarian follicular cysts
Vol. 11, No. 3 276 SHORT COMMUNICATION Levels of heat shock protein transcripts in normal follicles and ovarian follicular cysts Melisa M.L. Velázquez 2,3, Natalia S. Alfaro 2,3, Natalia R.Salvetti 2,3,
More informationABSTRACT. Key words: ovulation, ovary, human, follicle, collagen, MMP and TIMP. ISBN-10: ISBN-13:
HUMAN OVULATION Studies on collagens, gelatinases and tissue inhibitors of metalloproteinases Anna Karin Lind Department of Obstetrics and Gynecology Institute of Clinical Sciences Sahlgrenska University
More informationSuperovulation of Beef Heifers with Follicle Stimulating Hormone or Human Menopausal Gonadotropin: Acute Effects on Hormone Secretion
Superovulation of Beef Heifers with Follicle Stimulating Hormone or Human Menopausal Gonadotropin: Acute Effects on Hormone Secretion A.S. Leaflet R1362 Acacia A. Alcivar, graduate research assistant,
More informationThe intra-follicular molecular biology mandating advancement of egg retrieval in some women
The intra-follicular molecular biology mandating advancement of egg retrieval in some women David H. Barad, USA Director of Assisted Reproductive Technology, The Center for Human Reproduction New York
More informationEffect of the Dominant Follicle Aspiration before or after Luteinizing Hormone Surge on the Corpus Luteum Formation in the Cow
Journal of Reproduction and Development, Vol. 52, No. 1, 2006 Research Note Effect of the Dominant Follicle Aspiration before or after Luteinizing Hormone Surge on the Corpus Luteum Formation in the Cow
More informationEPIGENTEK. EpiQuik Global Histone H4 Acetylation Assay Kit. Base Catalog # P-4009 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Histone H4 Acetylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Histone H4 Acetylation Assay Kit is suitable for specifically measuring global
More informationcapacitation hyperactivation acrosome hyperactivation AR bovine serum albumin BSA non-genomic effect isothiocyanate; FITC PR mrna P hyperactivation HA
17 2 47 54 2002 P PRP total RNA cdna PCR primer set PR mrna P hyperactivation HA AR Ca PR P HA AR P Ca PR mrna P DNA C PR PR P P HA AR Ca mrna capacitation hyperactivation acrosome reaction; AR hyperactivation
More informationJSAR Young Investigator Award. Studies of Follicular Vascularity Associated with Follicle Selection and Ovulation in Cattle
Journal of Reproduction and Development, Vol. 53, No. 1, 2007 JSAR Young Investigator Award Studies of Follicular Vascularity Associated with Follicle Selection and Ovulation in Cattle Tomas J. ACOSTA
More informationAbraxis Progesterone (bovine) ELISA Kit
Abraxis Progesterone (bovine) ELISA Kit Enzyme immunoassay for the quantitative determination of progesterone in bovine milk/serum/plasma samples PN5081M 96 Tests For Research Use Only. Not for use in
More informationOvarian Characteristics, Serum Hormone Concentrations, and Fertility in Lactating Dairy Cows in Response to Equine Chorionic Gonadotropin
Ovarian Characteristics, Serum Hormone Concentrations, and Fertility in Lactating Dairy Cows in Response to quine Chorionic Gonadotropin S. L. Pulley, L. D. Wallace, H. I. Mellieon, and J. S. Stevenson
More informationHepatitis B Virus Genemer
Product Manual Hepatitis B Virus Genemer Primer Pair for amplification of HBV Viral Specific Fragment Catalog No.: 60-2007-10 Store at 20 o C For research use only. Not for use in diagnostic procedures
More informationAnimal Science 434! Tonic and Preovulatory Surge of GnRH! Tonic and Preovulatory Surge of GnRH! Lecture 11: The Follicular Phase of the Estrous Cycle!
Tonic and Preovulatory Surge of GnRH! Animal Science 434! Lecture 11: The Follicular Phase of the Estrous Cycle!! (-)! Hypothalamus! GnRH! Estradiol! (-)! Tonic and Preovulatory Surge of GnRH! Anterior!
More informationFSH (Rodent) ELISA Kit
FSH (Rodent) ELISA Kit Catalog Number KA2330 96 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationIN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS
CHAPTER 3 IN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS 3. INTRODUCTION Plants are the basic source of knowledge of modern medicine. Almost all the parts of the plant, namely
More informationPRODUCT INFORMATION & MANUAL
PRODUCT INFORMATION & MANUAL Mitochondrial Extraction Kit NBP2-29448 Research use only. Not for diagnostic or therapeutic procedures www.novusbio.com P: 303.760.1950 P: 888.506.6887 F: 303.730.1966 technical@novusbio.com
More informationProceedings, The Applied Reproductive Strategies in Beef Cattle Workshop, September 5-6, 2002, Manhattan, Kansas
20 10 0 Proceedings, The Applied Reproductive Strategies in Beef Cattle Workshop, September 5-6, 2002, Manhattan, Kansas REVIEW OF FOLLICULAR GROWTH AND THE BOVINE ESTROUS CYCLE Milo C. Wiltbank Department
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationWork-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples:
Dr. Sanjeeva Srivastava IIT Bombay Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples: Sample preparation for serum proteome analysis Sample
More informationValidation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1
I. Objectives Validation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1 1. To ensure stability of RNA (highly thermolabile and degradatively
More informationLH (Canine) ELISA Kit
LH (Canine) ELISA Kit Catalog Number KA2292 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationSuperovulation of Beef Heifers with Follicle Stimulating Hormone or Human Menopausal Gonadotropin: Acute Effects on Hormone Secretion
Beef Research Report, 1996 Animal Science Research Reports 1997 Superovulation of Beef Heifers with Follicle Stimulating Hormone or Human Menopausal Gonadotropin: Acute Effects on Hormone Secretion Acacia
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationTransfection of Sf9 cells with recombinant Bacmid DNA
Transposition Bacmid DNA Mini Culturing baculo cells Transfection of Sf9 cells with recombinant Bacmid DNA Amplification of the virus Titration of baculo stocks Testing the expression Transposition 1.
More informationDEVELOPMENT OF A NOVEL DIAGNOSTIC TEST USING PODOCYTURIA AS A BIOMARKER FOR DETECTION OF KIDNEY DAMAGE. An Undergraduate Research Scholars Thesis
DEVELOPMENT OF A NOVEL DIAGNOSTIC TEST USING PODOCYTURIA AS A BIOMARKER FOR DETECTION OF KIDNEY DAMAGE An Undergraduate Research Scholars Thesis by EESHA FAROOQI Submitted to Honors and Undergraduate Research
More informationThe reproductive lifespan
The reproductive lifespan Reproductive potential Ovarian cycles Pregnancy Lactation Male Female Puberty Menopause Age Menstruation is an external indicator of ovarian events controlled by the hypothalamicpituitary
More informationSynchronization of Ovulation and Fixed-Time Insemination for Improvement of Conception Rate in Dairy Herds with Poor Estrus Detection Efficiency
Journal of Reproduction and Development, Vol. 45, No. 1, 1999 Synchronization of Ovulation and Fixed-Time Insemination for Improvement of Conception Rate in Dairy Herds with Poor Estrus Detection Efficiency
More informationEndocrinology of the Female Reproductive Axis
Endocrinology of the Female Reproductive Axis girlontheriver.com Geralyn Lambert-Messerlian, PhD, FACB Professor Women and Infants Hospital Alpert Medical School at Brown University Women & Infants BROWN
More informationProcaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk
A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationClinical Assisted Reproduction. Shiuh Y. Chang, 1,2,3 Meng-Yin Tsai, 1,2 Fu-Jen Huang, 1,2 and Fu-Tsai Kung 1,2 INTRODUCTION
( C 2002) Clinical Assisted Reproduction Expression of Insulin-Like Growth Factor (IGF), IGF Receptor, and IGF-Binding Protein Messenger Ribonucleic Acids in Luteinized Granulosa Cells from Different Size
More informationOriginal Article. Masafumi TETSUKA 1), Hiromi NISHIMOTO 1), Akio MIYAMOTO 2), Kiyoshi OKUDA 3) and Seizo HAMANO 4)
Journal of Reproduction and Development, Vol. 56, No. 6, 2010, 10-019K Original Article Gene Expression of 11 -HSD and Glucocorticoid Receptor in the Bovine (Bos taurus) Follicle During Follicular Maturation
More informationWhy Cycle Control? Manipulating Ovulation and Estrous Synchronization. Manipulating Ovulation. Cattle. Principle of PGF 2a Use
Why Cycle Control? Manipulating and Estrous Synchronization John Parrish 1. Group females for parturition: a) Decrease labor, calving period Reduce calving season b) More uniform weaning weights. 2. Reduce
More informationPRODUCT INFORMATION & MANUAL
PRODUCT INFORMATION & MANUAL Nuclear Extraction Kit NBP2-29447 Research use only. Not for diagnostic or therapeutic procedures. www.novusbio.com - P: 888.506.6887 - technical@novusbio.com Novus kits are
More informationReproductive Endocrinology. Isabel Hwang Department of Physiology Faculty of Medicine University of Hong Kong Hong Kong May2007
Reproductive Endocrinology Isabel Hwang Department of Physiology Faculty of Medicine University of Hong Kong Hong Kong May2007 isabelss@hkucc.hku.hk A 3-hormone chain of command controls reproduction with
More informationM. Irfan-ur-Rehman Khan, M. A. Rana and N. Ahmad. Department of Theriogenology, University of Veterinary and Animal Sciences, Lahore, Pakistan
82 ULTRASONIC MONITORING OF FOLLICLES AND CORPORA LUTEA DURING SYNCHRONIZATION IN SUMMER ANOESTROUS NILI RAVI BUFFALOES AND THEIR SUBSEQUENT SUPEROVULATORY RESPONSE M. Irfan-ur-Rehman Khan, M. A. Rana
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationInvestigation: The Human Menstrual Cycle Research Question: How do hormones control the menstrual cycle?
Investigation: The Human Menstrual Cycle Research Question: How do hormones control the menstrual cycle? Introduction: The menstrual cycle (changes within the uterus) is an approximately 28-day cycle that
More informationInfluence of large follicles on oestrus induction and ovulation after embryo collection in superovulated Japanese Black cows
J. Reprod. Engineer. 2015; 17: 1 5. http://sreprod.jp/contents.htm = Original Article = Journal of REPRODUCTION ENGINEERING Influence of large follicles on oestrus induction and ovulation after embryo
More informationTotal Histone H3 Acetylation Detection Fast Kit (Colorimetric)
Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Catalog Number KA1538 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...
More informationAbstract ZORRILLA, LEAH M. Control of Luteolytic Sensitivity in the Porcine Corpus Luteum. (Under the direction of Dr. John E. Gadsby).
Abstract ZORRILLA, LEAH M. Control of Luteolytic Sensitivity in the Porcine Corpus Luteum. (Under the direction of Dr. John E. Gadsby). The porcine corpus luteum (CL) is unusual in that it does not show
More informationPinpoint Slide RNA Isolation System II Catalog No. R1007
INSTRUCTION MANUAL Pinpoint Slide RNA Isolation System II Catalog No. R1007 Highlights Allows for the isolation of total RNA from paraffin-embedded tissue sections on glass slides Simple procedure combines
More informationTheriogenology Department, Faculty of Veterinary Medicine, Beni Suef University, Egypt 2
Theriogenology Insight: 3(1):11-16. April, 2013 Ultrasonic monitoring and biometry of ovaries and ovarian structures during superovulation following transvagianl follicle ablation in Murrah buffaloes S.M.
More informationChapter 27 The Reproductive System. MDufilho
Chapter 27 The Reproductive System 1 Figure 27.19 Events of oogenesis. Before birth Meiotic events 2n Oogonium (stem cell) Mitosis Follicle development in ovary Follicle cells Oocyte 2n Primary oocyte
More informationFSH (Human) ELISA Kit
FSH (Human) ELISA Kit Catalog Number KA0213 96 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationXCF TM COMPLETE Exosome and cfdna Isolation Kit (for Serum & Plasma)
XCF TM COMPLETE Exosome and cfdna Isolation Kit (for Serum & Plasma) Cat# XCF100A-1 User Manual Store kit components at +4ºC and +25ºC Version 1 2/2/2017 A limited-use label license covers this product.
More informationRole of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
More informationINSTRUCTION MANUAL. RNA Clean & Concentrator -5 Catalog Nos. R1015 & R1016. Highlights. Contents
INSTRUCTION MANUAL Catalog Nos. R1015 & R1016 Highlights Quick (5 minute) method for cleaning and concentrating RNA. Ideal for purification of RNA from aqueous phase following an acid phenol extraction.
More informationKit for assay of thioredoxin
FkTRX-02-V2 Kit for assay of thioredoxin The thioredoxin system is the major protein disulfide reductase in cells and comprises thioredoxin, thioredoxin reductase and NADPH (1). Thioredoxin systems are
More informationFemale Reproductive System. Lesson 10
Female Reproductive System Lesson 10 Learning Goals 1. What are the five hormones involved in the female reproductive system? 2. Understand the four phases of the menstrual cycle. Human Reproductive System
More informationEpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
More informationab65311 Cytochrome c Releasing Apoptosis Assay Kit
ab65311 Cytochrome c Releasing Apoptosis Assay Kit Instructions for Use For the rapid, sensitive and accurate detection of Cytochrome c translocation from Mitochondria into Cytosol during Apoptosis in
More informationHuman Follicle-Stimulation Hormone ELISA Kit
Catalog No: IRAPKT2001 Human Follicle-Stimulation Hormone ELISA Kit Lot No: SAMPLE INTENDED USE For the quantitative determination of follicle-stimulation hormone (FSH) concentration in human serum. FOR
More informationEPIGENTEK. EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric)
More informationMethodology for the Extraction of Brain Tissue Protein. Learning Objectives:
Proteomics Extraction of Brain Tissue Protein Methodology for the Extraction of Brain Tissue Protein Extraction of the entire protein from the sample requires optimized protocol and many protocols have
More informationTable S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon
More informationCHAPTER 7: REAGENTS AND SOLUTIONS
7.1. ANALYSIS OF MODULATION OF SOD ENZYME Acetic acid (cat. no. 11007, Glaxo Qualigen, India): Bovine Serum Albumin stock solution (BSA, 1mg/ml): 1 mg of standard bovine serum albumin (cat. no. A2153,
More informationHuman ipsc-derived Ventricular Cardiomyocytes. Protocol version 3.1
Human ipsc-derived Ventricular Cardiomyocytes Protocol version 3.1 Protocol version 3.1 Table of Contents Product Information 2 Recommendations 2 Preparing Cardiomyocyte Maintenance Medium 3 Cardiomyocyte
More informationMidi Plant Genomic DNA Purification Kit
Midi Plant Genomic DNA Purification Kit Cat #:DP022MD/ DP022MD-50 Size:10/50 reactions Store at RT For research use only 1 Description: The Midi Plant Genomic DNA Purification Kit provides a rapid, simple
More informationIGF-1.
1006 2 *1 1 2 sisaas33@gmail.com.... IGF-1.. - -.. LH LH GnRH.. :.......(1).(2) in vitro 1007..(3) (6) (5) (4).. in vitro. (7)... ) 50. (9) (8) ( 10 (3). (10).(11)...(12).(13) IGF-1. IGF-1..(14).(16).(15)
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationOvarian follicular development in cattle
Ovarian follicular development in cattle John P Kastelic Professor of Theriogenology Head, Department of Production Animal Health University of Calgary Calgary, Alberta, Canada Overview Prenatal development
More informationREPRODUCCIÓN. La idea fija. Copyright 2004 Pearson Education, Inc., publishing as Benjamin Cummings
REPRODUCCIÓN La idea fija How male and female reproductive systems differentiate The reproductive organs and how they work How gametes are produced and fertilized Pregnancy, stages of development, birth
More informationValidation & Assay Performance Summary
Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation
More informationNorgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information
More informationFREE-ROAMING HORSE AND BURRO FERTILITY CONTROL WORKSHOP Albuquerque, NM November 8, 2018
FREE-ROAMING HORSE AND BURRO FERTILITY CONTROL WORKSHOP Albuquerque, NM November 8, 2018 Current Contraceptive Use pzp GonaCon Porcine Zona Pellucida Antibodies to ZP3 Cons: Requires boosters Continuous
More informationNorgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended
More informationDeficient Proliferation and Apoptosis in the Granulosa and Theca Interna Cells of the Bovine Cystic Follicle
Journal of Reproduction and Development, Vol. 53, No. 5, 2007 Research Note Deficient Proliferation and Apoptosis in the Granulosa and Theca Interna Cells of the Bovine Cystic Follicle Naoki ISOBE 1) and
More informationTumor necrosis factor a. in the human ovary: presence in follicular fluid and effects on cell proliferation and prostaglandin production*
FERTILITY AND STERILITY Vol. 58, No.5, November 1992 Copyright C> 1992 The American Feltility Society Printed on ocui-free paper in U.S.A. Tumor necrosis factor a. in the human ovary: presence in follicular
More informationConcentrations of Luteinizing Hormone and Ovulatory Responses in Dairy Cows Before Timed Artificial Insemination
Concentrations of Luteinizing Hormone and Ovulatory Responses in Dairy Cows Before Timed Artificial Insemination S. L. Pulley, D. H. Keisler, S. L. Hill, and J. S. Stevenson Summary The objective of this
More informationMICROWELL ELISA LUTEINIZING HORMONE (LH) ENZYMEIMMUNOASSAY TEST KIT LH ELISA. Cat # 4225Z
DIAGNOSTIC AUTOMATION, INC. 23961 Craftsman Road, Suite D/E/F, Calabasas, CA 91302 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com See external
More information