Expression of mrnas encoding tumor necrosis factor-α and its receptor I in buffalo ovary

Transcription

1 Indian Journal of Experimental Biology Vol. 45, August 2007, pp Expression of mrnas encoding tumor necrosis factor-α and its receptor I in buffalo ovary G P Madhusudan, R Dev, M K Sharma* & Dheer Singh Molecular Endocrinology Laboratory, Division of Animal Biochemistry National Dairy Research Institute, Karnal , India Received 16 October 2006; revised 17 April 2007 The tumor necrosis factor-α (TNF-α) plays an important role in ovarian follicular development and ovulation process and acts through its receptor (TNFRI). The present investigation describes the expression of mrnas encoding TNF-α and TNFRI in relation to glyceraldehyde-3-phosphate dehydrogenase (G3PDH) and β-actin as control genes, using RT-PCR, in granulosa cells, intact follicles and luteal tissues from buffalo ovary. There was significant higher expression of mrnas encoding TNF-α in granulosa cells from medium follicles and TNFRI expression increased with increase in size of follicles. Post-ovulatory structures (corpus luteum and corpus albicans) exhibited significantly higher expression of TNFRI mrnas as compared to that obtained in intact follicles suggesting its immediate and critical role just after ovulation, for mediating TNF-α action on these tissues. Though the expression of TNF-α mrna was stimulated by treatment of granulosa cells with FSH during culture, the expression of TNFRI mrna did not change. The FSH alongwith IGF-I did not exert any effect. These results suggested an important role of TNF-α and its receptor in buffalo ovarian functions. Keywords: Expression, mrna, TNF-α, TNFRI, RT-PCR, Ovary, Buffalo In mammalian ovary, the follicular development, atresia, ovulation, corpus luteum (CL) development and its regression, are important events during reproductive cycle. In addition to gonadotropins, certain growth factors regulate steroidogenesis 1,2 and other processes in the ovary. The tumor necrosis factor- α (TNF-α), a non-glycosylated cytokine was reported to play important roles in ovarian functions. The high levels of TNF-α in follicular fluid from bovine 3 and human 4, its effect on enhanced ovulation rate in rat perfused ovary 5 and blocked ovulation by TNF-α antibody in sheep 6 suggested active involvement of TNF-α in ovulation process. The evidences show that TNF-α directly inhibits basal and gonadotropin-induced progesterone production in 7,8 luteal cells and this effect is mediated by PGF 2α which in turn regulates the expression of steroid acute regulatory (StAR) protein 9. The modulation of steroidogenesis and protein secretion by TNF-α in granulosa and theca cells was demonstrated in bovine 10. It has also been reported that locally produced TNF-α may induce CL apoptosis 11 and *Correspondent author Tel: , Fax: mks_scientist@yahoo.com follicular atresia 12. In whole CL culture model, apoptosis was induced by TNF-α as demonstrated by dose dependent DNA fragmentation 13. The presence of TNF-α mrna was reported in a number of cell types within ovary, such as macrophage, oocyte, granulosa cells and luteal cells from different species 14,15. TNF-α exerts its effect by binding to cell membrane receptors. The bovine granulosa and theca cells were shown to contain TNFα receptors (TNFRI and TNFRII) by radioreceptor assay 15,16 and found the expression of mrna encoding TNFRI in bovine CL during estrous cycle. The regulatory in vitro effect of gonadotropins on TNF-α receptors differed among porcine Sertoli cells 17 and bovine theca cells 16. TNF-α increased granulosa cell proliferation via TNFRI in mouse 18. In view of the significant roles of TNF-α in ovarian functions and major reproductive problem existing in buffalo, the present investigation describes the finding on expression of mrna encoding TNF- α and TNFRI in granulosa cells, intact follicles and luteal tissues from buffalo ovary. Materials and Methods Eagle s Minimum Essential Medium (MEM) with Hepes, fetal bovine serum (FBS), diethylpyrocarbonate (DEPC), agarose, chloroform, insulin-like

2 670 INDIAN J EXP BIOL, AUGUST 2007 growth factor-i(igf-i), trypan blue and ethidium bromide were purchased from Sigma-Aldrich Chem. Co., St.. Louis, MO (USA). RT-PCR kits, 100 bp DNA ladder and specific primers were purchased from Bangalore Genei Pvt. Ltd., Bangalore (India). Plasticwares were purchased from Tarsons Pvt. Ltd. Kolkata (India) and were properly treated with DEPC before use. The culture multi-well plates were from Costar Corp., Cambridge, MA (USA). FSH was a generous gift from Dr. A. F. Parlow, National Hormone and Pituitary Program, Harbour-UCLA Medical Centre, Torrance, California. Streptomycin and penicillin were purchased from Sarabhai Chemicals, Mumbai (India) and Alembic Chemicals Works Ltd, Mumbai (India). All other reagents used were of analytical grade. Buffalo ovaries and separation of follicles The buffalo ovaries were collected from Delhi (India) slaughter house in chilled normal saline. These were properly washed and extra tissue was removed by trimming. The follicles were mechanically isolated from these ovaries with surgical blade and scissor. Based on morphological appearances and size, nonatretic follicles were pooled and grouped in three categories as small (<5 mm), medium (5-9 mm) and large (>9 mm), representing different stages of follicular development, according to standard method 19. The post-ovulatory structures viz. corpus luteum (CL) and corpus albicans (CA, regressing CL) were isolated and classified based on morphological appearance, extent of vascularity, presence and absence of blood colour and overall appearance of ovary. Luteal tissues The luteal tissue was excised from active corpus luteum (CL) and regressing CL (corpus albicans) and transferred to homogenizer in ice for isolation of total RNA. Isolation and culturing of granulosa cells The granulosa cells (GC) were isolated by aspiration of follicular fluid from small, medium and large follicles and pooled separately. The fluid was centrifuged at 2000 rpm for 20 min and cell pellet was used for isolation of total RNA. The GC were isolated from another lot of medium and large follicles by aspiration, pooled and washed with plain MEM supplemented with penicillin (100 U/ml) and streptomycin (100 µg/ml). The cell viability was determined by trypan blue exclusion method and was in the range of 60-70%. The GC were cultured in 6- well plate containing cells/well/2 ml of MEM supplemented 20 with penicillin and streptomycin. Isolation of total RNA from follicles, granulosa cells and luteal tissues The total RNA was isolated by single step method 21, using acid guanidinium thiocyanate-phenol-chloroform extraction. Standard TRI reagent (Molecular Research Centre Inc. # TR 118) was used in the present study. The identical steps were followed for extraction of RNA from luteal tissues; isolated GC and GC culture monolayer except that whole tissues were homogenized. In general, 1 ml of TRI reagent was added to pellet of GC obtained from 2 ml of follicular fluid. The tissues ( mg) from corpus luteum and corpus albicans were immersed in 1 ml of TRI reagent. Similarly, the intact small (7-8), medium (3-4) and large (1-2) follicles were homogenized separately in 1 ml of TRI reagent, with 8-10 strokes in Dounce homogenizer. The homogenate was kept for 10 min on the ice, followed by centrifugation at 12, 000 rpm for 15 min at 4 C, to remove debris. The supernatant was transferred to a fresh sterile Eppendorf tube and 0.2 ml of chloroform for each 1 ml of TRI reagent was added. The content was mixed vigorously for 15 sec, allowed to stand at room temperature for 15 min and centrifuged at rpm/15 min/4 C. The clear aqueous phase was transferred to fresh sterile Eppendorf tube and 0.5 ml of isopropanol for each ml of TRI reagent was added to precipitate RNA. The content was again allowed to set at room temperature for 10 minutes and centrifuged at rpm/15 min/4 C. The RNA pellet so obtained, was washed with 1 ml of 75% ethanol for each ml of TRI reagent and centrifuged at 7500 rpm/5 min/ 4 C. Finally, the RNA pellet was air dried and re-suspended in appropriate volume of sterile water. The RNA was quantified using spectrophotometer (Specord 200, Analytica Jena) at 260 nm and RNA purity factor (A 260 /A 280 ) was found between for all RNA preparations which were stored at -70 C till further use. The integrity of RNA was evaluated using agarose (1%) gel electrophoresis 22. Design of primers All the primers used in the present study were got synthesized from Bangalore Genei Pvt. Ltd., Bangalore (India) (Table 1). Reverse transcription-polymerase chain reactions (RT-PCR) RT-PCR was carried out using RT-PCR kit from Bangalore Genei. The RT reaction mixture contained 1 μl (1 μg) RNA, 8 μl of sterile water, 1 μl of random hexamer. The content was incubated in thermocycler at 65 C for 30 min and kept at room

3 MADHUSUDAN et. al.: EXPRESSION OF mrnas ENCODING TNFα 671 Table 1 Primers used for amplification during PCR Name of gene product Forward primer(5 / 3 / ) Reverse primer(5 / 3 / ) cdna product size (bp) TNF-α AGGTCAACATCCTGTCTGCC GGCGATGATCCCAAAGTAGA 200 TNF-α Receptor-I CCCGACCTTCAACTGGTAAA GGAATGGAGACAGGACTGGA 274 β-actin CGTGGGCCGCCCTAGGCACCA TTGGCCTTAGGGTTCAGGGGGG 243 G-3-PDH AAACCCATCACCATCTTCCAG AGGGGCCATCCACAGTCTTCT 360 temperature for 2 min. Subsequently 1.5 μl of sterile water, 4 μl RT buffer (5 ), 2 μl dntp mix (30 mm), 1 μl 0.1 M DTT and 1 μl RNase inhibitor were added in mixture. After brief spin of content, 0.5 μl M-MuLV reverse transcriptase was added. In control (RT minus) 0.5 μl of sterile water was added. The resulting mixture (20 μl each) were incubated in thermocycler (Biometra) at 37 C for 1 hr, 95 C for 5 min and 4 C with pause. The PCR reaction mixture (total volume 50 μl) consisted of 5 μl of PCR assay buffer (10 ), 1 μl dntp mix (30 mm), 1 μl Taq DNA polymerase (1unit/μl), 2 μl RT (cdna) product and 1 μl gene specific primers (final conc μm). The resulting mixture was was kept in thermocycler at 95 C for 2 min (denaturation of RT enzyme), 95 C for 1 min (denaturation of RT product), 60 C for 1 min (annealing), 72 C for 1 min (extension). The amplification of RT product was done for 35 cycles, followed by final template extension at 72 C for 7 min. The PCR products were analyzed on 2% agarose gel, using 100 bp DNA ladder and stained with ethidium bromide. Optimization of PCR The optimization of PCR was done with respect to MgCl 2 concentration (1.0, 1.5, 2.0 and 3.0 mm), PCR cycle numbers (20, 25, 30 and 35 cycles, respectively) and primer concentration (0.05, 0.10, 0.15 and 0.20 μm) since these factors greatly influence the success of PCR. Relative RT-PCR The relative RT-PCR was done using 1 μl each of forward and reverse primers for β- actin and glyceraldehydes-3-phosphate dehydrogenase (G3PDH) as control (house keeping genes) together with target genes specific primers. The mrnas for both target and control genes were reverse transcribed and amplified in same reaction sample. The PCR products were analyzed on 2% agarose gel and stained with ethidium bromide (0.5 μg/ml). Effect of FSH and IGF-I on expression of mrnas encoding TNF-α and TNFRI The granulosa cells, pooled from medium and large size follicles, were cultured in MEM supplemented with FBS and antibiotics as described earlier. After initial 24 hr, the spent medium was discarded and granulosa cells were further cultured with plain MEM without FBS. At this stage, appropriate concentrations of FSH alone and FSH with IGF-I were added in culture medium at the rate of 100 ng/ml each. After another 24 hr, the spent media was again discarded and 400 μl of TRI reagent was added in each well to extract total cellular RNA and processed as described. The RT-PCR was performed on these RNA samples to detect the comparative expression of mrnas encoding TNF- α, TNFRI and control genes (G3PDH and β-actin). Gel quantitation The intensity of individual bands on agarose gel was measured by using GelQuant Software. The results were expressed in the form of ratio obtained by dividing the band intensity of target gene with that of control gene. Statistical analysis The statistical analysis was done using Systat Software. Results Purity of RNA preparations from follicles, follicular cells and luteal tissues The purity of total RNA preparations was checked by measuring the absorbance at 260 and 280 nm and then the ratio of A 260 /A 280 was found in range of for all RNA preparations. The integrity of these RNAs was also confirmed by denaturation of RNA with glyoxal and DMSO and agarose gel electrophoresis. Optimization of RT-PCR The first strand cdna was synthesized using total RNA from all samples by reverse transcription and further amplified as per standard procedures. The optimization was also done for the concentrations of primers (forward and reverse) and MgCl 2 and cycle numbers for appropriate amplification in presence of control genes (G3PDH and β-actin). In cases of both TNF-α and TNFRI the concentration of primers (forward and reverse) as 0.15 mμ was found appropriate to get optimum amplified products Τhe amplified cdnas exhibited 1.5 mm MgCl 2 as optimum for proper amplification. Regarding the cycle numbers, 35 cycles produced cdna product with highest intensity. This is routine

4 672 INDIAN J EXP BIOL, AUGUST 2007 exercise done during the study of any gene expression, therefore, the results are not shown. Relative expression of mrnas encoding TNF-α, TNFRI, G3PDH and β-actin in granulosa cells (GC) isolated from different sizes of buffalo follicles The experiment was designed to find out the pattern of mrnas encoding TNF-α and house keeping gene (G3DH) in GC isolated from buffalo follicles of different stages of growth. The profile of TNF-α with amplified product size of 200 bp and that of G3PDH (360 bp) is clearly shown in Fig. 1A as indicated by 100 bp DNA ladder (lane 1). There was significantly (P< 0.01) higher expression of TNF-α mrna in GC from medium follicles (lane A3) as compared to that in GC from small and large follicles. The expression of TNFRI mrna increased significantly (P< 0.01) with increase in size of follicles where β-actin was used as control gene (Figs.1B and 1). Relative expression of mrnas encoding TNF-α, TNFRI, G3PDH and β-actin in follicles and luteal tissues In earlier experiments, the expression of mrnas encoding TNF-α, its receptor (TNFRI) and control genes was found out in GC isolated from follicles of different sizes. The study was also done to find out the relative expression of these genes in intact follicles (small, medium and large size) and luteal tissues (active and regressing). The results shown (Fig. 2) exhibited significantly higher (P< 0.01) expression of TNF-α (200 bp) in small and medium size follicles than that obtained in large follicles, being highest in medium follicles. There was higher expression of TNF-α in corpus albicans than that obtained in corpus luteum. The expression patterns of TNFRI (274 bp) with β- actin (243 bp) have been shown in Fig. 3. There was a Fig. 2 Expression pattern of mrna encoding TNF-α (200 bp) in relation to G3PDH (360 bp), in intact follicles of different sizes and luteal tissues. SF, small follicle; MF, medium follicle; LF, large follicle, CL, corpus luteum; CA, corpus albicans. Different superscript differ significantly (P<0.01). Fig. 1 Expression pattern of mrna encoding TNF-α (200 bp) and TNFRI (274 bp) in relation to G3PDH (360 bp) and β-actin (243 bp) in granulosa cells (GC), isolated from different sizes of follicles. RT-PCR was carried out as described. The size of follicles (small, medium and large) represented various stages of growth and thereby of GC. Lanes A5 & B1, RT control; lanes A2 and B4, GC small; lanes A3 and B3, GC medium; A4 and B2, GC large; lanes A1 and B5, 100 bp DNA ladder. Different superscript differ significantly (P< 0.01). Fig. 3 Expression pattern of mrna encoding TNFRI (274 bp) in relation to β-actin (243 bp) in intact follicles of different sizes and luteal tissues. SF, small follicle; MF, medium follicle, LF, large follicle; CL, corpus luteum, CA, corpus albicans. Different superscript differ significantly (P<0.01).

5 MADHUSUDAN et. al.: EXPRESSION OF mrnas ENCODING TNFα 673 Fig. 4 Effect of FSH alone and with IGF-I on expression of TNF-α (200 bp) and TNFRI (274 bp) in relation to β-actin (243 bp) as control gene, in cultured granulosa cells (GC). Lanes 2 and 5, control GC; Lanes 3 and 6, GC treated with FSH; lanes 4 and 7, GC treated with FSH and IGF-I together; lane 1, 100 bp DNA ladder. Different superscript differ significantly (P<0.01). similar expression of β-actin in intact follicles of all sizes and luteal tissues. However, there was good amount of variation in expression of TNFRI mrna. The luteal tissues showed significantly (P< 0.01) higher expression of TNFRI than that found in intact follicles. Among follicles, small and medium follicles showed better expression than that obtained in large follicles. Effect of FSH and IGF-I on expression of mrnas encoding TNF-α and TNFRI in GC during culture In order to find out the effect of FSH and IGF-I, the RNA was isolated from control and treated GC. The RT-PCR was done for TNF-α, TNFRI and β- actin mrnas. The electrophoretic pattern (Fig. 4) exhibited similar expression of β-actin (243 bp) in control (lanes 2 and 5) as well as treated GC (lanes 3, 4, 6, 7). When the cells were treated with FSH alone, there was significantly (P< 0.01) higher expression of TNF-α (lane 3) whereas the treatment of GC with FSH and IGF-I together did not stimulate the expression (lane 4) and remained similar to that obtained for control GC (lane 2). There was no significant change in the expression of TNFRI in GC treated either with FSH alone (lane 6) or FSH and IGF-I together (lane 7) as compared to that in control (lane 5). Discussion The tumor necrosis factor-α (TNF-α) significantly participates in the regulation of follicular development, ovulation, formation and regression of corpus luteum (CL) in animals. The functions of TNF-α are accomplished through its receptor (TNFRI). TNF-α being an important cytokine, has dual role of regulating the proliferation of cells and apoptotic functions in the ovary. The results of the present study exhibited the presence of TNF-α and TNFRI transcripts in GC isolated from small, medium and large follicles, indicating the expression patter of these molecules at varying stages of GC growth and development. It was suggested that bovine and rat GC are as a source and target organ for TNF-α 3, where its concentration increases as ovulation approaches. Its presence has also been reported in human follicular fluid 23 and in GC by immunohistochemistry 4. The expression of TNF-α and TNFRI was studied in relation to expression of control genes (G3PDH and β-actin). The conditions were standardized for optimum expression of control genes when studied together with target genes (TNF-α and TNFRI). There was almost consistent and similar expression of these house keeping genes in GC from all the three sizes of follicles, intact follicles and luteal tissues. In some of the experiments involving β-actin, a non-specific minor band corresponding to 200 bp was also observed. This kind of observation was reported 24 with an explanation that there is presence of pseudogenes for β-actin which results in an additional band (200 bp). As observed in granulosa cells and intact follicles, there was increased expression of TNF-α mrna with increase in size of follicles. This suggested more active involvement of TNF-α during follicular development. However, the lower level of TNF-α mrνα expression in large follicles indicated that these follicles might be in a state of moving towards atretic pathway instead of might have become atretic. The lower mrna expression may also suggest that though these follicles may form a pool of large follicles but may remain as subordinate and not dominant to become future preovulatory. The active involvement of TNF-α has been reported in preovulatory stage in bovine since increased amount of TNF-α was detected in follicular fluid collected from such stage. The important role of TNF-α during ovulation process has been established by several workers 5,25,26. Though the theca cells from cow 16 and human 27 preovulatory follicles were reported to express TNF-α but its additional expression was not observed in intact follicles from buffalo ovary. There was an increased expression of TNFRI in GC with increase in size of buffalo follicles, indicating its developmental role by mediating the action of TNF-α

6 674 INDIAN J EXP BIOL, AUGUST 2007 in follicular phase of ovary where primordial follicles enter the growth cycle and some of them becoming predominant. The luteal phase of ovary begins with development of CL after ovulation, followed by its regression. The significantly higher expressions of TNFRI mrna in these post-ovulatory structures (CL and CA) in buffalo, suggested its immediate and critical requirement to mediate action of ligand (even present in normal level). The ovary enters the luteal phase just after ovulation which is of very short period, comparative to follicular phase. The development of CL is required for maintenance of pregnancy, however, in absence of pregnancy, the CL will get regressed so that ovary enters another cycle. Similar observations were also reported 11 in cattle. It has been demonstrated 28 that TNF-α production is regulated by rate limiting steps involving transcription, translation, membrane insertion and ultimate secretion. The post-translational processing of TNF-α may be controlled by an unknown factor resulting in regulated secretion at different stages while the levels of mrna expression remaining the same. The presence of TNF-α and TNFRI expressions in GC, intact follicles and luteal tissues strongly suggest that these molecules have important role in reproductive (estrous) cycle of buffalo. The expressions of TNF-α and TNFRI have been reported to be regulated by gonadotropins. In the present study, there was increased expression of TNFα mrna in GC treated with FSH whereas FSH and IGF-I together did not show any effect. Though FSH and IGF-I have been reported 29 to stimulate the steroid hormones production by granulosa cells during culture, the reason for no such effect of FSH with IGF-I together on TNF-α mrna is not clear. Under similar treatment of GC, expression of TNFRI mrna did not change. It was demonstrated 3 that FSH-treated human GC produce more TNF-α, however, FSH had no effect on TNF-α receptor. In porcine 17 Sertoli cells, FSH increased the number of TNF-α binding sites and TNFα receptor mrna. This suggested that there is a tissuespecific regulation of TNF-α receptors in Sertoli cells and GC. In cattle, insulin was found to reduce TNFα receptor in GC but had no effect on TNF-α receptor in thecal cells 16 suggesting that TNF-α receptors are differentially regulated in GC and theca cells. It is concluded that there is increased expression of mrnas encoding TNF-α and TNFRI in GC isolated from small, medium and large follicles of buffalo. However, their expression in post-ovulatory structures (CL and CA) in much more as compared to that in intact follicles. The results of the present study indicate an active role of TNF-α and its receptor during development of buffalo follicles as well as CL and its regression. FSH stimulates TNF-α mrna expression in vitro in buffalo GC, however, TNFRI mrna expression did not change. The further studies on factors/modulators involved in regulating the dual activity of TNF-α may enrich the understanding of the mechanism of TNF-α action since it participates in proliferation and apoptotic processes, during ovarian functions. Acknowledgement The financial assistance of Institute Fellowship to G.P. Madhusudan is thankfully acknowledged. References 1 Taneja R, Bansal P, Sharma M K & Singh D, Albumin fractions from different species stimulate in vitro progesterone production by granulosa cells in buffalo, Asian- Aust J Anim Sci, 15 (2002) Vinze M, Sharma M K & Singh D, Effect of follicular fluid proteins and gonadotropins on progesterone secretion by buffalo granulosa cells in vitro, Asian Aust J Anim Sci, 17 (2004) Zolti M, Meirom R, Shimesh M, Wollach D, Moschiach S, Shore L & Rafael R B, Granulosa cells as source and target organ for tumor necrosis factor-α, FBES Lett, 261 (1990) Wang L, Brannstrom M, Robertson S A & Norman R J, Tumor necrosis factor- α in the human ovary: Presence in follicular fluid and effects on cell proliferation and prostaglandin production, Fertil Steril, 58 (1992) Brannstrom M, Bonella N, Wang L J & Norman R J, Effects of tumor necrosis factor-α on ovulation in the rat ovary, Reprod Fertil, 7 (1995) Murdoch W J, Colgin D C & Ellis J A, Effects of tumor necrosis factor-α on ovulation in the rat ovary, J Anim. Sci, 75 (1997) Adashi E Y, Resnick C E, Packman J N, Hurwitz A & Payne D W, Cytokine mediated regulation of ovarian function: Tumor necrosis factor-α inhibits gonadotropin supported progesterone accumulation by differentiating and luteinized murine granulosa cells, Am J Obstet Gynaecol, 162 (1990) Benyo D F & Pate J L, Tumor necrosis factor-α alters bovine luteal cell synthetic capacity and viability, Endocrinology, 130 (1992) Pescador N, Soumano K, Stocco D M, Price C A & Murphy B D, Steroidogenic acute regulatory protein in bovine corpora lutea, Biol Reprod, 55 (1996) Spicer L J & Alpizar E, Effects of cytokines on FSH-induced estradiol production by bovine granulosa cells in vitro: Dependence on size of follicle, Domest Anim Endocrinol, 11 (1994) 25.

7 MADHUSUDAN et. al.: EXPRESSION OF mrnas ENCODING TNFα Friedman A, Weiss S, Levy N & Meidan R, Role of tumor necrosis factor-α and its type 1 receptor in luteal regression: Induction of programmed cell death in bovine corpus luteumderived endothelial cells, Biol Reprod, 63 (2000) Morrison L J & Marcinkiewicz J L, Tumor necrosis factor-α enhances oocyte/follicle apoptosis in neonatal rat ovary, Biol Reprod, 66 (2002) Abdo M, Hisheh S & Dharmarajan A, Role of tumor necrosis factor-α and modulating effect of caspases in rat corpus luteum apoptosis, Biol Reprod, 68 (2003) Marcinkiewicz J L, Krishna A, Cheung C M Y & Terranova P F, Oocyte changes in the concentration of prostaglandins in rat Graffian follicle, Prostaglandins, 9 (1994) Sakumoto R, Berisha N, Schams D & Okuda K, Tumor necrosis factor-α and its receptor in bovine corpus luteum throughout the estrous cycle, Biol Reprod, 62 (2000) Spicer L J, Receptors for insulin growth factor-1 and tumor necrosis factor-α are hormonally regulated in bovine granulose and thecal cells, Anim Reprod Sci, 67 (2001) Maudit C, Besset V, Caussanel V & Benahmed M, Tumor necrosis factor-α receptor P 55 is under hormonal (follicle stimulating hormone) control in testicular Sertoli cells, Biochem Biophys Res Commun, 224 (1996) Son D, Arai K J, Roby K F & Terranova PF, Tumor necrosis factor-α increases granulosa cell proliferation: Dependence on C-Jun and TNF receptor type 1, Endocrinology, 145 (2004) Soumano K & Price C A, Ovarian follicular steroidogenic acute regulatory protein, low density lipoprotein receptor and cytochrome P 450 side chain messenger ribonucleic acids in cattle undergoing super ovulation, Biol Reprod, 56 (1997) Balasubramanian K, Lavoie H A, Garney J C, Stocco D M & Veldhius J D, Regulation of porcine granulosa cell steroidogenic acute regulatory protein(star) by insulin-like growth factor-1: Synergism with follicle stimulating hormone or protein kinase A agonist, Endocrinology, 138 (1997) Chomczynski P & Sacchi N, Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal Biochem, 162 (1987) McMaster G & Carmichael G G, Analysis of single and double stranded nucleic acids on polyacrylmide and agarose gels using glyoxal and acridine orange, Proc Natl Acad Sci,USA, 74 (1977) Roby K F & Terranova P F, Effects of tumor necrosis factorα in vitro on steroidogenesis of healthy and atretic follicles of the rat: Theca as target, Endocrinology, 126 (1990) Dirhofer S, Berger C, Untergasser G, Geley S & Berger P, Human β-actin retropseudogenesis interfere with RT-PCR, Trend Genet, 11 (1995) Klebanoff S.J, Vadas M A, Harlan J M & Walterdorph A M, Stimulation of neutrophils by tumor necrosis factor, J Immunol, 136 (1986) Espey L L, Ovulation as an inflammatory process-a hypothesis, Biol Reprod, 22 ( 1980) Chen H L, Marcinkiewicz J L, Sancho-Tello M, Hunt J S & Terranova P F, Tumor necrosis factor-α gene expression in mouse oocytes and follicular cells, Biol Reprod, 48 (1993) Beutler B, Han J, Kruys V & Giroir B P, Coordinate regulation of TNF biosynthesis at level of transcription and translation: Pattern of TNF expression in vivo: In Tumor necrosis factors (Raven Press, New York) 1992, Spicer L J, Alpizar E & Echternkamp S E, Effect of insulin, insulin-like growth factor-i and gonadotropins on bovine granulosa cell proliferation, progesterone, estradiol production and (or) insulin-like growth factor-i production in vitro, J Anim Sci, 71 (1993) 1232.