SUCCESSFUL PRODUCTION OF PIGLETS DERIVED FROM MATURE OOCYTES

Transcription

1 CryoLetters 36 (1), 8-18 (2015) CryoLetters, SUCCESSFUL PRODUCTION OF PIGLETS DERIVED FROM MATURE OOCYTES VITRIFIED USING OPS METHOD Barbara Gajda 1*, Marzena Skrzypczak-Zielińska 2, Barbara Gawrońska 3, Ryszard Słomski 2,3 and Zdzisław Smorąg 1 1 Department of biotechnology of Animal Reproduction, National Research Institute of Animal Production, Krakowska 1, Balice/Kraków, Poland. 2 Institute of Human Genetics, Polish Academy of Sciences, Strzeszyńska 32, Poznań, Poland 3 Department of Biochemistry and Biotechnology, University of Life Sciences, Dojazd 11, Poznań, Poland *Corresponding author barbara.gajda@izoo.krakow.pl Abstract OBJECTIVE: Examination of effect of vitrification solution with or without foetal calf serum (FCS) on the in vitro and in vivo survival of matured pig oocytes. MATERIALS AND METHODS: Exp. 1: oocytes were exposed to vitrification solutions: VSa (15% DMSO, 15% EG, 0.5 M sucrose dissolved in TCM-199 with FCS) or VSb (VSa without FCS). Exp. 2: oocytes were vitrified in VSa or VSb using OPS. A fraction of vitrified oocytes were transferred to 6 synchronised and inseminated recipients.. RESULTS: Survival rate after exposure and vitrification was the same for VSa and VSb. Transfer of 48 oocytes vitrified in VSb resulted with two pregnancies and 12 live piglets. Molecular analysis results: eight piglets originated from the surrogate mother s oocytes, four piglets from vitrified oocytes.. CONCLUSION: The use of DMSO and EG as cryoprotectants without serum supplementation was advantageous for the in vivo development of vitrified mature porcine oocytes. Keywords: pig, oocyte, OPS vitrification, serum, in vivo, viability INTRODUCTION Recently, considerable progress has been made in the vitrification of porcine oocytes and embryos, although no previous studies have reported the birth of offspring from vitrified oocytes in this species. Porcine oocytes and embryos have considerably high cytoplasmic lipid contents, which are correlated with their cryopreservation success rates. The presence of a large number of intracytoplasmic lipid droplets reduces the cryotolerance of oocytes and embryos and causes irreversible damage to the membrane structure. The development of the delipation technique confirmed that intracellular lipids are linked to hypothermic sensitivity (31). However, in several studies, the in vitro and in vivo survival rates of delipated, vitrified embryos have been fairly low (7, 11, 13, 28). The reduction of an embryo s cytoplasmic lipid content using phenazine ethosulfate (PES) (5), a compound that oxidises NADPH, improved the cryotolerance of bovine embryos (4) but had limited effects on porcine embryos after vitrification (15). To improve the survival of cryopreserved porcine oocytes and embryos, several permeating and non-permeating cryoprotectants and modified vitrification technologies have been investigated. Today, the most common permeating cryoprotectant used to cryopreserve oocytes and embryos is based on a mixture of DMSO and ethylene glycol (24). Modified vitrification technologies such as the solid-surface vitrification (SSV), cryoloop, microdrop, cryotop, electron microscopy grids or nylon mesh, and open-pulled-straw (OPS) or small open-pulled straw (SOPS) techniques have been used to cryopreserve porcine oocytes and embryos (6, 15, 16, 17, 18, 22, 23, 29, 37, 38, 41). Moreover, the effects of serum supplementation with culture medium or serumfree freezing medium on the increased sensitivity of oocytes and embryos to cryopreservation have been investigated (2, 19, 26, 34 ). 8

2 Although there are problems with the cryopreservation of both mature and immature oocytes, mature porcine oocytes (MII stage) have been reported to tolerate cryopreservation better than immature (GV stage) oocytes (36). Vitrified mature porcine oocytes exhibit poor developmental competence as a result of the ultrastructural and physiological changes that may occur during or after cryopreservation (43). Although cryopreserved IVP embryos derived from oocytes that have been matured and fertilised in vitro have resulted in the birth of healthy piglets (25, 28, 32, 38), no live piglets have been produced from vitrified mature porcine oocytes. The objective of the present study was to examine the effects of oocyte exposure to vitrification solution with or without foetal calf serum (FCS) and vitrification using the OPS method on the in vitro and in vivo survival of matured pig oocytes. MATERIALS AND METHODS This study was performed using mature porcine oocytes collected from superovulated gilts. After vitrification, the oocytes were cultured in vitro or transplanted to synchronous recipients. All experiments were approved by The Local Bioethics Commission of Institute of Pharmacology Polish Academy of Sciences. Oocyte donors Six-month-old gilts weighing approximately kg were used as donors. Gilts became superovulated by an intramuscular injection of 1500 IU of PMSG (Serogonadotropin; Biowet, Poland) followed by a second injection 72 h later of 1000 IU of hcg (Chorulon; Biowet, Poland). After 24 h, signs of oestrus were checked and oocytes were recovered after h. Matured oocyte collection Oocytes were obtained surgically under general anaesthesia by flushing both oviducts with PBS (Sigma Chemical Company, St. Louis, MO, USA) supplemented with 20% FCS (Sigma Chemical Company, St. Louis, MO, USA) at 30 C. Recovered oocytes were examined morphologically under a stereomicroscope in a laminar chamber at 30 C. Exposure to vitrification solution Oocytes were first exposed to equilibration solution consisting of 10% dimethyl sulfoxide (DMSO) and 10% ethylene glycol (EG) (Sigma Chemical Company, St. Louis, MO, USA), diluted in HEPES-buffered TCM-199 (Sigma Chemical Company, St. Louis, MO, USA) for 3 min and then transferred to VSa (15% DMSO, 15% EG and 0.5 M sucrose dissolved in HEPES-buffered TCM-199 with 20% FCS) or VSb (15% DMSO, 15% EG and 0.5 M sucrose dissolved in HEPES-buffered TCM-199 without FCS) vitrification solution for 1 min in room temperature. The oocytes were subsequently rinsed in thawing solution 1 (TCM-199 and 0.5 M sucrose) for 1 min, thawing solution 2 (TCM- 199 and 0.5 M sucrose) for 5 min, and thawing solution 3 (TCM-199 and 0.25 sucrose) for 5 min and washed in manipulation solution (TCM- 199). Vitrification and warming procedure Oocytes were vitrified using the openpulled-straw (OPS) method described by Vajta et al. (39) with modifications (15). Oocytes of good quality were equilibrated in TCM medium for 1 min followed by equilibration solution for 3 min. Oocytes (5 6) with a minimum volume (approximately 2 µl) of vitrification solution (VSa or VSb) were loaded into the narrow end of a 0.1 ml OPS. After 1 min, the straw was plunged into liquid nitrogen. For storage (approximately 2 months) in liquid nitrogen, the OPS was placed in a 0.5 ml pre-cooled straw. For warming, the OPS was quickly removed from the 0.5 ml straw, and the narrow end of the OPS was directly immersed in dilution solution 1 for 1 min in 30 o C temperature. The oocytes were then transferred into dilution solution 2 for 5 min followed by incubation in dilution solution 3 for 5 min. The oocytes were warmed in thawing solutions 1, 2 and 3 and then rinsed in TCM-199 at approximately 38 C according to the procedure described above. Then, the oocytes were morphologically evaluated under a stereomicroscope. Activation of oocytes Before activation, untreated, intact oocytes from toxicity and vitrified groups were washed three times in HEPES-buffered TCM-199, activated with a single electric impulse of 63 V/cm, and incubated in 5 µg/ml cytochalasin B and 10 µg/ml cycloheximide for 4 h (11). 9

3 In vitro culture North Carolina State University culture medium (NCSU-23) (33) was prepared in our laboratory; its components (Sigma Chemical Company, St. Louis, Mo, USA) were dissolved in water (Sigma Chemical Company, St. Louis, MO, USA), and the ph was adjusted to 7.2. The medium was filtered using a Millipore 0.22 µm filter (Millex-GS, France) prior to use, stored at 4 C and used for a 3-week period (14). After activation, the oocytes assigned for culture (non-treated, toxicity and vitrified groups) were washed in culture medium and transferred into plastic 4-well dishes (Nunc, Denmark) for culture. These dishes contained approximately 0.8 ml of medium, and approximately 10 oocytes were placed in each well. The cultured oocytes were placed in a CO 2 incubator (5% CO 2 in air at 39 C). The survival and cleavage of the parthenogenetically activated oocytes were evaluated on day 2 (day 0 = day of activation). Oocyte recipient Prepubertal gilts weighing approximately 90 kg were synchronised with 750 IU of PMSG (Serogonadotropin; Biowet, Poland) followed by the administration of 500 IU of hcg (Chorulon; Biowet, Poland) 72 h later. After h, the oocytes were transferred and the recipients were inseminated twice regardless of signs of oestrus. Oocyte transfer Under general anaesthesia, the oocytes were transferred surgically into a single oviduct in each synchronised recipient (14). Each gilt received matured oocytes vitrified in VSa or VSb solution. Pregnancy diagnosis and parturition On day 28 30, the diagnosis of pregnancy via oocyte transfer was performed by ultrasonography. The pregnant recipients were observed until parturition, and the total number of piglets born within individual litters was determined. A description of the molecular analysis used to determine the bloodlines of piglets born as a result of the transfer and fertilisation of vitrified oocytes (excluding piglets born after the fertilisation of oocytes from a recipientsurrogate mother) is described below. DNA sample collection After farrowing, peripheral blood samples were collected from a recipient (mother surrogate), boar (father) and piglets from the litter. Genomic DNA was obtained from blood cells according to standard procedures using guanidine isothiocyanate (GTC). After precipitation, the DNA pellet was diluted in sterile water and stored at -20 C. Amplification of microsatellite loci Eight sets of primers were used to amplify microsatellite fragments of the genomic DNA. The oligonucleotides were designed based on sequences deposited in the GenBank database and information contained at (20, 21). Forward primers were labelled with the fluorescent dye 6- FAM (Metabion International AG, Martinsried, Germany). The primer sequences and microsatellite markers used are shown in Table 1. Amplification was performed in a volume of 20 µl containing 0.75 U of AmpliTaq 360 DNA Polymerase, 2 µl of 10 PCR buffer, 1.2 µl of MgCl 2 (25 mm), 2 µl of dntp mix (2 mm), 0.8 µl of each primer (5 pmol/µl), and 100 ng of DNA. All PCR reagents were purchased from Applied Biosystems (Foster City, CA, USA), with the exception of dntps (Sigma-Aldrich Inc., St. Louis, MO, USA). The following PCR method was used: initial denaturation at 95 C for 3 min; 32 cycles of denaturation at 95 C for 30 s, annealing at 61 C for 30 s and extension at 72 C for 1 min; and a final extension step at 72 C for 7 min using the TGradient Thermocycler (Whatman s Biometra, Göttingen, Germany). Amplification results were observed by electrophoresis in a 1.6% agarose gel (Serva, Heidelberg, Germany). PCR products were purified by ethanol precipitation and dissolved in 10 µl of sterile water. Analysis by capillary electrophoresis Analysis was performed on a 5 µl mixture containing 2 µl of purified PCR product, 2.75 µl of MegaBACE TM loading solution (GE Healthcare Life Sciences, Buckinghamshire, UK) and 0.25 µl of MegaBACE ET550-R Size Standard. The sample was heated for 3 min at 95 C, cooled on ice for 3 min and subjected to capillary electrophoresis on a MegaBACE TM 1000 DNA Analysis System. The data were analysed using MegaBACE Fragment Profiler v

4 Table 1. Genetic microsatellite markers used to determine kinship between sow and offspring Marker GenBank Repeat type and motif SW413 AF dinucleotide (CA) S0355 L dinucleotide (CA) KVL9205 EU trinucleotide (CTG) KVL9275 EU trinucleotide (ATT) KVL9218 EU tetranucleotide (ATCT) KVL9237 EU tetranucleotide (CTTT) KVL9684 EU tetranucleotide (ATGG) KVL9364 EU pentanucleotide (AGAATA) Sequence of forward (f) and reverse primers (r) (5 3 ) Size of PCR product (bp) Observed no. of alleles Observed Heterozygosity f cagacacacaccccagtgtc r aggtccaaccctcctgatg f tctggctcctacactccttcttgatg r ttgggtgggtgctgaaaaatagga f ggggatgtcaggtgctggcg r tgcagctgatatgaggaaatgtcgtg f agtattcaaagggctaggtgagcca r gtgaggacttcatgaggaaagtggca f tgggacgcaatttcacagagtggc r tgacggggctcagatgaatgga f gaccaatacctaaagcctgcaatggt r actgccatgggggaatcccttgt f ccttttcctggcacaggcagaata r cactgctgtgtgaggagcagca f gcttcagccattgtaagctttgacca r tgctaggcagtggcgtggtg 11

5 Experimental design Experiment 1. To determine the effects of vitrification solution on oocyte survival and parthenogenetic development, freshly collected matured oocytes were exposed to equilibration solution and then VSa or VSb. The oocytes were subsequently rinsed in dilution solutions 1, 2 and 3 and washed three times in manipulation solution. Control oocytes were treated in the same manner without being exposed to equilibration and vitrification solutions. Next, oocytes from the experimental and control groups were activated and cultured in vitro. Experiments were performed in triplicate for each group. Experiment 2. To determine the effects of vitrification on oocyte survival in vitro and parthenogenetic development, freshly collected matured oocytes were cryopreserved in OPS straws in vitrification solution (VSa or VSb). After warming, the intact oocytes were activated and cultured in vitro. The experiments were performed in triplicate. Experiment 3. To determine the effects of vitrification on oocyte survival in vivo, freshly collected, matured oocytes were cryopreserved in vitrification solution (VSa or VSb). After warming, the oocytes were transferred to six synchronised recipients (Fig. 1). Statistical analysis In vitro development of the oocytes of the experimental groups were compared with the developmental of the oocytes of the control group. The differences between means were evaluated by chi-square test. RESULTS The results are summarised in Tables 2 5. Morphological changes were observed in 19.2% (VSb) to 23.3% (VSa) of the matured pig oocytes after exposure to the vitrification solutions; however, no significant differences were observed between the VSa and VSb solutions. The proportion of parthenogenetic embryos from the oocytes exposed to VSa and VSb varied from 57.6% to 60.5%, respectively, and the differences were not statistically significant. At the same time, the percentage of parthenogenetic embryos in the control group was 90.0%, which is statistically significant compared to those of the oocytes exposed to the Figure 1. An example of porcine mature vitrified-warmed oocyte with homogenous cytoplasm, intact membrane and zona pellucida before transfer to the recipient. VSa (P < 0.005) and VSb (P < 0.01) solutions (Table 2). Results of in vitro survival matured pig oocytes after vitrification in different media are presented in the Table 3. No differences were observed between the number of surviving oocytes (morphologically normal) after vitrification in VSa and VSb. The parthenogenetic activation of vitrified, morphologically normal oocytes showed that a higher percentage of oocytes developed in VSb than in VSa (33.4% versus 20.0%, respectively); however, this result was not statistically significant (Table 3). Pregnancy was not achieved after transplantation of 127 oocytes vitrified in VSa into four synchronised recipients. After 48 oocytes vitrified in VSb were transplanted into two synchronised recipients, both recipients became pregnant and delivered a total of 12 live piglets (Table 4). All of the piglets were subjected to molecular genetic analysis to verify their bloodlines. Eight microsatellite markers SW413, S0355, KVL9205, KVL9275, KVL9218, KVL9237, KVL9684 and KVL9364 were analysed to verify the bloodlines of the live piglets. Based on previous studies on pig populations, these markers cover 2 12 alleles and have high levels of heterozygosity, which is useful in verifying bloodlines. Capillary electrophoresis with MegaBACE TM 1000 DNA was used to separate the alleles, enabling the determination of the size of the alleles within ± 1 base pair accuracy. The results were analysed 12

6 using MegaBACE Fragment Profiler v2.2 software. The absence of the maternal allele was assumed to be a pig bloodline from a vitrified oocyte. Four of these piglets were identified, and the genotyping results for the eight microsatellite markers are presented in Table 5. Microsatellite analysis showed that eight piglets originated from motherrecipient oocytes and four piglets were derived from vitrified oocytes. Four piglets were obtained from vitrified oocytes in the two litters delivered by recipients no. 624 and 625. Figure 2 shows a differentiating chart indicating how the piglets originated from a vitrified oocyte (A) or mother (B). DISCUSSION In the present study, we used a combination of two cryoprotectants DMSO and ethylene glycol (EG) in vitrification solution to cryopreserve in vivo-matured porcine oocytes. Although EG is an effective cryoprotectant with low toxicity and high permeability during the vitrification of mature porcine oocytes (18, 36), a combination of DMSO and EG has been shown to increase survival rates compared to EG alone (42). Here, we investigated vitrification solutions consisting of DMSO, EG, and sucrose diluted in TCM with (VSa) or without (VSb) serum. Abe and Hoshi (1) reported that bovine embryos developed from in vitro-matured and fertilised oocytes cultured in serumsupplemented medium contain numerous cytoplasmic lipid droplets. The accumulation of cytoplasmic lipids in embryos developed in serum-containing medium may result from the incorporation of the lipoproteins in the serum. Additionally, the survival rates of embryos produced in serum-free media during post-thaw culture were higher than those of embryos produced in serum-containing medium, suggesting that an abnormal accumulation of cytoplasmic lipids in embryos may have negative effects on the sensitivity of embryos to chilling and freezing (1, 3). The negative effects on the cryotolerance of bovine embryos are accompanied by deviations in the relative abundance of developmentally important gene transcripts (34). Moreover, Ohboshi et al. (32) suggested that the survival of bovine embryos developed in medium with BSA is superior to that of embryos developed in medium containing calf serum. However, Men et al. (26) demonstrated that serum supplementation during the in vitro production of porcine embryos is beneficial for blastocysts to survive cryopreservation. To date, the impact of serum supplementation on the production of oocytes and embryos and their subsequent ability to survive cryopreservation has not been investigated. Foetal calf serum (FCS) is a natural mix of growth factor, hormones and nutrients supporting cell survival. FCS also contains many uncharacterised components that may be hazardous to the recipients of cryopreserved oocytes and embryos. Moreover, antibodies against FFCS components have been reportedly produced in recipient serum (44). Thus, further studies are needed to evaluate the effects of serum in combination with cryoprotectants on the cryopreservation of porcine oocytes and embryos. Porcine embryos have a considerably higher lipid content than embryos of other mammalian embryos. The success rates of the cryopreservation of porcine oocytes and embryos appear to be highly correlated with cytoplasmic lipid content. Therefore, we investigated 1) the toxicity of vitrification solution (experiment 1) consisting of DMSO, EG and sucrose with (VSa) or without (VSb) serum and 2) the effects of these two vitrification media (experiment 2) on the parthenogenetic development of porcine oocytes. Our results showed that exposure of mature porcine oocytes to vitrification solution with (VSa) or without (VSb) serum partially reduced the survival rates of treated oocytes in comparison to those of non-treated control oocytes. This reduction was independent of the type of vitrification solution (VSa or VSb). Rojas et al. (35) examined the effects of the permeating addition and removal steps of cryoprotectants on porcine oocytes. In their study, only 14% of treated oocytes underwent cleavage after fertilisation. In the present study, the in vitro development of oocytes activated parthenogenetically after exposure to VSa or VSb solution was significantly decreased compared to the development of the control oocytes. Based on the low toxicity of permeable cryoprotectants, we speculate that the decreased ability of vitrified oocytes to develop in vitro is caused by the combination of stress associated with cryoprotectant toxicity and osmotic shock. Moreover, the treatment of mature porcine oocytes with EG has been reported to increase the proportion of abnormal spindles and cytoskeletal disruption, decreasing cleavage 13

7 Table 2. Effects of the vitrification solutions on the parthenogenetic development of matured porcine oocytes Vitrification solution No. of oocytes exposed/ replicates No. of surviving oocytes No. of parthenogenetically developed oocytes VSa 43 / 3 33 (76.7) a 19 (57.6) d VSb 47 / 3 38 (80.8) b 23 (60.5) e non-exposed (control) 30 / 3 30 (100) c 27 (90.0) f a and c, d and f, P < 0.005; b and c, e and f, P <0.01 Table 3. Effects of the two vitrification solutions on the parthenogenetic development of matured porcine oocytes No. of vitrified Vitrification oocytes/ medium replicates No. of oocytes recovered after warming No. of surviving oocytes No. of oocytes parthenogenetically developed VSa 48 / 3 45 (93.7) 25 (55.6) 9 (20.0) VSb 50 / 3 47 (94.0) 27 (57.4) 5 (33.4) Table 4. Results of the transfer of mature porcine oocytes cryopreserved in the two vitrification solutions and fertilised in vivo Vitrification solution No. of recipients No. of oocytes transferred No. of recipients pregnant No. of piglets born No. of piglets verified VSa VSb (100)

8 Table 5. Analysis of kinship for 8 microsatellite loci using PCR and fluorescent fragment length analysis* SW413 KVL9684 KVL9237 KVL9218 KVL9275 KVL9205 S0355 KVL9364 allele allele allele allele allele allele allele allele Pig No Piglet No Piglet No Piglet No Pig No Piglet No *The sizes of the alleles were determined by capillary electrophoresis. Alleles marked in bold italic belong to sow No. 624 and sow No Alleles highlighted in grey indicate the offspring that did not come from the biological mother, indicating that piglets originated from vitrified oocytes. 15

9 Figure 2. Electropherogram of three microsatellite markers: dinucleotide SW413, tetranucleotide KVL9218 and pentanucleotide KVL9364. An example of obtained results for A) piglets originating from vitrified oocytes, B) piglets derived from the biological mother and C) recipient pigs (surrogate mother); bp - base pairs, represent alleles that were not inherited from foster mother, - represent alleles originating from biological mother according to Mendelian Inheritance Laws rates after in vitro fertilisation (35). However, our results on the vitrification of matured oocytes in VSa or VSb solution were worse. Only 20.0% (VSa) to 33.4% (VSb) of oocytes were able to develop parthenogenetically in vitro. These results were similar to those of Gupta and colleagues (18), who reported lower cleavage rates (20 26%) of mature oocytes vitrified by solid surface vitrification (SSV) compared to those of non-vitrified controls. Numerous studies have reported low rates of developmental competence of vitrified oocytes after activation. The ability of vitrified oocytes to undergo the first cleavage step is highly reduced, suggesting serious cryoinjury, even in oocytes that retain the integrity of the plasma membrane (37). However, several factors may be responsible for the decreased developmental potential of vitrified oocytes, including DNA damage, mitochondrial dysfunction (37) or damage to microtubules and microfilaments (35). We used the open-pulled-straw (OPS) method to vitrify porcine oocytes. This cryopreservation method was originally described by Vajta and colleagues (39) to be successful for early stage bovine embryos produced in vitro. Using the OPS method, the first piglets produced from vitrified compacted morulae (7) and blastocysts (6, 8) were reported. In addition to the OPS method, several different devices have been used to vitrify porcine oocytes. Fernandez-Reyez et al. (13) suggested that SOPS (small-open-pulled-straw) and cryotop were more efficient techniques for vitrification than BES (modified straw with bevelled edge) based upon the increased rates of actin filament presence in porcine oocytes. Moreover, these authors concluded that a minimal volume of medium and the rapid placement of oocytes into devices improved the process of cryopreservation. However, other studies (16) have suggested that cryotop vitrification significantly reduced the proportion of oocytes undergoing fertilisation after IVF compared to those in toxicity and untreated controls and does not solve the problem of porcine oocyte cryopreservation (29). In the present experiment, two recipients became pregnant and gave natural birth to 12 healthy piglets following the transfer of mature porcine oocytes vitrified in VSb (serum-free) solution. Four piglets originated from vitrified oocytes transferred into the inseminated recipients. Our new established molecular microsatellite analysis was highly sensitive and effective in determining the bloodlines of the piglets obtained from vitrified oocytes. However, this methodological approach may also be used to determine other bloodlines and verify related animal models as well as potential frauds in pig meat production analogously to the previously described investigations (9, 10). 16

10 The low productivity of vitrified oocytes after transfer may be due to the small number of surviving embryos within the uterus or the decreased viability of the vitrified oocytes (28). However, to the best of our knowledge, the present study is the first to report piglets produced from in vivo-matured oocytes vitrified using the OPS method. In conclusion, matured porcine oocytes vitrified in OPS after transfer to inseminated recipients can be used to produce piglets. Using DMSO and EG as cryoprotectants without serum supplementation was advantageous for the development of mature vitrified porcine oocytes. Acknowledgements: This research was funded as part of National Research Institute of Animal Production statutory activity, project no REFERENCES 1. Abe H, Hoshi H (2003) J Reprod Dev 49, Abeydeera LR, Wang W, Prather RS, Day BN (1998) Biol Reprod 58, Barcello-Fimbres M, Seidel GJr (2006) Reprod Fertil Dev 18, Barcelo-Fimbres M, Seidel GJr (2007) Mol Reprod Dev 74, Barcelo-Fimbres M, Seidel GJr (2007) Mol Reprod Dev 74, Berthelot F, Martinat-Botte F, Perreau C, Terqui M (2000) Cryobiology 41, Berthelot F, Martinat-Botte F, Perreau C, Terqui M (2001) Reprod Nutr Dev 41, Cameron RD, Beebe LF, Blackshaw AW, Higgins A, Nottle MB (2000) Aust Vet J 78, Cherel P, Glénisson J, Pires J (2011) Anim Genet. 42(6), Conyers CM, Allnutt TR, Hird HJ, Kaye J, Chisholm J (2012) J Agric Food Chem. 60(13), Du Y, Li J, Kragh PM, Zhang Y, Schmidt M, Bogh IB, Zhang X, Purup S, Kuwayama M, Jorgensen AL, Pedersen AM, Villemoes K, Yang H, Bolund L, Vajta G (2007) Cloning Stem Cells 9(4), Du Y, Pribenszky CS, Molnar M, Zhang X, Yang H, Kuwayama M, Pedersen AM, Villemoes K, Bolund L, Vajta G (2008) Reproduction 135, Fernandez-Reyez F, Ducolomb Y, Romo S, Casas E, Salazar Z, Betancourt M (2012) Cryobiology 64, Gajda B, Smorąg Z, Wieczorek J (2004) Medycyna Wet 60 (4), Gajda B, Romek M, Krzysztofowicz E, Grad I, Bryła M, Smorąg Z (2011) CryoLett 32, Galeati G, Spinaci M, Vallorani C, Bucci D, Porcu E, Tamanini C (2011) Anim Reprod Sci 127, Gomis J, Cuello C, Sanchez-Osorio J, Gil MA, Parrilla I, Angel MA, Vazquez JM, Roca J, Martinez EA (2013) Cryobiology 66, Gupta MK, Uhm SJ, Lee HT (2007) Theriogenology 67, Isobe T, Ikebata Y, Onitsuka T, Kim Do LT, Sato Y, Taniguchi M, Otoi T (2013) Cryobiology 67, Karlskov-Mortensen P, Hu ZL, Gorodkin J, Reecy JM, Fredholm M (2007) Anim Genet 38(4), Karlskov-Mortensen P, Hu ZL, Reecy JM, Fredholm M (2008) Anim Genet 39(1), Kawakami M, Kato Y, Tsunoda Y (2008) Anim Reprod Sci 106, Kuwayama M (2007) Theriogenology 67, Li R, Murphy CN, Spate L, Wax D, Isom C, Rieke A, Walters EM, Samuel M, Prather RS (2009) Biol Reprod 80, Men H, Agca Y, Critser ES, Critser JK (2005) Theriogenology 64, Men H, Monson RI, Parrish JJ, Rutledge JJ (2003) Mol Reprod Dev 64, Men H, Zhao C, Si W, Murphy CN, Spate L, Liu Y, Walters EM, Samuel MS, Prather RS, Critser JK (2011) Theriogenology 76, Misumi K, Suzuki M, Sato S, Saito N (2003) Theriogenology 60, Mullen SF, Fahy GM (2012) Theriogenology 78, Nagashima H, Hiruma K, Saito H, Tomii R, Ueno S, Nakayama N, Matsunari H, Kurome M (2007) Biol Reprod 76, Nagashima H, Kashiwazaki N, Ashman RJ, Grupen CG, Seamark RF, Nottle MB, (1994) Biol Reprod 51,

11 32. Ohboshi S, Etoh T, Sakamoto K, Fujihara N, Yoshida T, Tomogane H (1997) Theriodenology, 47, Petters RM, Wells KD (1993) J Reprod Fertil Suppl 48, Rizos D, Gutiérrez-Adán A, Perez- Garnelo S, de la Fuente J, Boland MP, Lonergan P (2003) Biol Reprod 68, Rojas C, Palomo MJ, Albarracin JL, Mogas T (2004) Cryobiology 49, Somfai T, Dinnyes A, Sage D, Marosan M, Camwath JW, Ozawa M, Kikuchi K, Niemann H (2006) Theriogenology 66, Somfai T, Ozawa M, Noguchi J, Kaneko H, Kuriani Karja NW, Farhudin M, Dinnyes A, Nagai T, Kikuchi K (2007) Cryobiology 55(2), Somfai T, Ozawa M, Noguchi J, Kaneko H, Nakai M, Maedomari N, Ito J, Kashiwazaki N, Nagai T, Kikuchi K (2009) Biol Reprod 80, Vajta G, Holm P, Greve T, Callesen H (1997) Acta Vet Scand 38, Vajta G, Levis IM, Kuwayama M, Greve T, Callesen H (1998) Cryolett 19, Vallorani C, Spinaci M, Bucci D, Porcu E, Tamanini C, Galeati G (2012) Anim Reprod Sci 135, Vicente JS, Garcia-Ximenez F (1994) Theriogenology 42, Wu G, Jia B, Mo X, Liu C, Fu X, Zhu S, Hou Y (2013) Cryobiology 67, Zeisberger SM, Schulz JC, Mairhofer M, Ponsaerts P, Wouters G, Doerr D, Katsen-Globa, Ehrbar M, Hescheler J, Hoerstrup SP, Zisch AH, Kolbus A, Zimmermann M (2011) Cell Transplant 20 (8),