The Effects of the Novel Reproductive Peptide Phoenixin-20 Amide on GnRH and Kisspeptin Hypothalamic Cell Models

Transcription

1 The Effects of the Novel Reproductive Peptide Phoenixin-20 Amide on GnRH and Kisspeptin Hypothalamic Cell Models by Alice K. Treen A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Physiology University of Toronto Copyright by Alice Treen 2014

2 The Effects of the Novel Reproductive Peptide Phoenixin-20 Amide on GnRH and Kisspeptin Hypothalamic Cell Models Alice K. Treen Master of Science Department of Physiology University of Toronto 2014 Abstract Reproductive function is coordinated by the actions of specific neuropeptides and hormones, which converge on GnRH neurons in the hypothalamus. Phoenixin-20 amide (PNX-20) is a recently described peptide that increases GnRH-stimulated LH secretion and upregulates GnRH receptor mrna in the anterior pituitary. However, to date no studies have looked at the role of PNX-20 in the hypothalamus, where it is most highly expressed. Using cell lines representative of GnRH and kisspeptin neurons, the effects of PNX-20 in the hypothalamic cells were explored. PNX-20 increases GnRH mrna expression, protein levels and secretion in a GnRH cell model and Kiss-1 mrna in anteroventral periventricular and arcuate nuclei kisspeptin cell models. PNX-20 also activates the adenylyl cyclase and MAPK pathways. Furthermore, we report that kisspeptin increases gene expression of the PNX precursor protein, SMIM20. These results indicate that PNX-20 may be involved in the regulation of reproduction at the level of the hypothalamus. ii

3 Acknowledgements I would like to thank my supervisor Dr. Denise Belsham for welcoming me to her lab and providing continuous support and guidance over the past two years. She has been an excellent role model and taught me about the importance of hard work, critical thinking and organization in the research environment. Thank you for providing me with this fulfilling learning opportunity and helping me to grow as a scientist. I would like to thank the members of my advisory committee Dr. Ted Brown and Dr. Mark Palmert for their ongoing input and for always asking interesting and provocative questions. Your guidance in our meetings was essential to the development of my project. I also wish to acknowledge the tremendous support of all the Belsham lab who have become a second family to me. In particular I would like to acknowledge our lab technician Jennifer Chalmers for always providing helpful insight for my experiments, Dr. Leigh Wellhauser for providing tips on improving my research techniques and for writing this thesis, Dr. Joëlle Oosterman and Chloé Berland, the two spirited European exchange students, for always being supportive and encouraging, Dr. Prasad Dalvi for sharing his wisdom and stories in the lab and Dean Tran for providing his helpful suggestions with this thesis. It has been a real pleasure working with such kind, hardworking, intelligent, and inspirational colleagues. Outside of the lab I have had the wonderful support of my friends within the department, on GASP and friends outside of physiology. Thanks for making these years so memorable. In particular I must acknowledge the help of Blerta Meraj and Christian Somody. Last but not least, to my loving family for their kindness and encouragement. In particular, I would like to thank my Nana (herself a lab tech!) for inspiring me to pursue a scientific career and supporting me throughout my studies and my grandfather for passing on his curious and inquisitive nature. I must thank my two brothers Harold and Oliver for continuously providing IT support (and comedic relief) during my Master s and my inspiring parents, Peter and Darlene, for fostering such a motivating, creative and caring environment at home; I am truly fortunate to have such a supportive family. iii

4 Table of Contents List of Tables and Figures vii List of Abbreviations. ix Chapter 1: Introduction General Introduction The Hypothalamic-Pituitary-Gonadal Axis Gonadotropin-releasing hormone (GnRH) neurons Discovery of GnRH Development and anatomy of GnRH neurons Function of GnRH neurons in the HPG axis GnRH-R and GnRH signalling mechanisms GnRH gene Regulation of GnRH Neurons Gonadal Steroids Estrogens Androgens Progesterone Stress and the HPG axis Nutritional status and insulin Kisspeptin neurons Discovery of Kisspeptin and Kiss-1R (GPR54) Kisspeptin gene and protein Kisspeptin and GPR54 anatomical expression Arcuate kisspeptin neurons, KNDy neurons RP3V(AVPV/PeN) kisspeptin neurons Function of Kisspeptin neurons in the HPG axis Function of Kisspeptin neurons in puberty Gonadal steroidal feedback to kisspeptin neurons Negative feedback of estrogen Positive feedback of estrogen Signalling pathways activated by kisspeptin Phoenixin Bioinformatic Discovery...20 iv

5 1.5.2 Isolation and Localization Function of PNX in the HPG axis PNX Structure, Processing and Cellular Localization PNX Signalling Mechanisms PNX in the Spinal Cord for the Modulation of Pain Hypothalamic cell models for the study of neuroendocrine function Immortalized adult, non-clonal GnRH cell model (mhypoa-gnrh/gfp) Immortalized adult, non-clonal kisspeptin cell model (mhypoa-kiss/gfp-3 and mhypoa-kiss/gfp-4) Immortalized adult clonal cell models (mhypoa-xx) Study Hypotheses and Aims Chapter 2: Materials and Methods Cell Culture and Reagents Phoenixin-20 Amide, Kisspeptin, Steroid and Insulin Treatments cdna synthesis and Quantitative RT-PCR (qrt-pcr) Protein Isolation, SDS-PAGE and Western Blotting GnRH Enzyme-Linked Immunoassay (EIA) In Silico Analysis Statistical Analysis Chapter 3: Results PNX-20 induces neuronal activation in the mhypoa-gnrh/gfp cell model PNX-20 increases GnRH but not SMIM20 mrna expression in mhypoa- GnRH/GFP cell model PNX-20 increases GnRH secretion and protein synthesis in mhypoa-gnrh/gfp cell model PNX-20 increases Kiss-1 mrna expression in mhypoa-kiss/gfp-3 and 4 cell models PNX-20 increases phosphorylation of CREB and ERK1/2 in mhypoa-gnrh/gfp and CREB in mhypoa-kiss/gfp-3 and 4 cells In silico analysis of the SMIM20 promoter using Alibaba 2.1 and PROMO transcription factor binding analysis programs v

6 3.7 Kisspeptin increases SMIM20 gene expression in the mhypoa-gnrh/gfp cell model Neither insulin nor dexamethasone regulate SMIM20 gene expression in the mhypoa-gnrh/gfp cell line β-estradiol does not appear to regulate SMIM20 mrna expression in the mhypoa-kiss/gfp-4 or mhypoa-50 cell models at 4 and 24 hours Chapter 4: Discussion General discussion Regulation of GnRH neuronal models by PNX Regulation of kisspeptin neuronal models by PNX Signal transduction pathways activated by PNX Regulation of SMIM20 gene expression Study limitations Future directions Conclusions References vi

7 List of Tables and Figures Table 1.1 Characterization of gene expression profiles for the mhypoa-gnrh/gfp, mhypoa-kiss/gfp-3, mhypoa-kiss/gfp-4, mhypoa-50 and mhypoa-55 cell lines. 27 Table 2.1 List of primers used for real time RT-PCR Figure 1.1 Schematic illustrations of SMIM20 and the protein products PNX-20 and PNX Figure 1.2 Schematic representation of the immortalization of cell lines from GnRH/GFP and Kiss/GFP mice Figure 1.3 Schematic representation of the HPG axis and thesis general hypothesis Figure 3.1 PNX-20 mediated regulation of c-fos mrna expression in the mhypoa- GnRH/ GFP neuronal cell line Figure 3.2 PNX-20 mediated regulations of GnRH and SMIM20 mrna expression in the mhypoa-gnrh/gfp neuronal cell line Figure 3.3 PNX-20 mediated regulation of GnRH secretion in the mhypoa-gnrh/gfp neuronal cell model Figure 3.4 PNX-20 mediated regulations of Kiss-1 mrna expression in the (A) mhypoa-kiss/gfp-3 and (B) mhypoa-kiss/gfp-4 neuronal cell lines Figure 3.5 PNX-20 mediated regulations of Kiss-1 mrna expression in the (A) mhypoa-50 and (B) mhypoa-55 neuronal cell lines Figure 3.6 PNX-20 increases phosphorylation of CREB and ERK1/2 in the mhypoa- GnRH/GFP neuronal cell line at 5 min Figure 3.7 PNX-20 increases phosphorylation of CREB but not ERK1/2 in the mhypoa- Kiss/ GFP-3 and mhypoa-kiss/gfp-4 neuronal cell lines at 5 min...49 Figure 3.8 In silico promoter analysis of the 5 flanking region of the SMIM20 mus musculus gene Figure 3.9 Kiss-10 mediated regulation of SMIM20 mrna expression in the mhypoa- GnRH/GFP neuronal cell line Figure 3.10 Insulin mediated regulation of SMIM20 mrna expression in the mhypoa- GnRH/GFP neuronal cell line vii

8 Figure 3.11 Dexamethasone mediated regulation of SMIM20 mrna expression in the mhypoa-gnrh/gfp neuronal cell line Figure β-estradiol mediated regulation of Kiss-1 and SMIM20 mrna expression in the mhypoa-kiss/gfp-4 and mhypoa-50 neuronal cell lines Figure 4.1 Representative model summarizing the regulation of the HPG axis by PNX Figure 4.2 Schematic illustration of the positive feedback loop between kisspeptin and PNX to generate the GnRH/LH surge Figure 4.3 Schematic illustration of the proposed role for PNX in the Arc GnRH pulse generator...69 Figure 4.4 Representative model summarizing the proposed pathways activated by PNX Figure 4.5 Representative model summarizing the proposed mechanisms involved in the regulation of GnRH neuron activity by PNX-20 in mhypoa-gnrh/gfp cell model Figure 4.6 Representative model summarizing the proposed mechanisms involved in the regulation of kisspeptin neuron activity by PNX-20 in mhypoa-kiss/gfp-3 and -4 cell models viii

9 List of Abbreviations AC Act D ACTH AMPK ANOVA adenylyl cyclase actinomycin D adrenocorticotropic hormone 5 adenosine monophosphate-activated protein kinase analysis of variance AP-1 activator protein 1 AR Arc AVPV BBB BSA bp camp cgmp ChIP CHX CNS CNTF CRE CREB CRH Crt-1 androgen receptor arcuate nucleus anteroventral periventricular nucleus blood-brain barrier bovine serum albumin base pair cyclic adenosine monophosphate cyclic guanosine monophosphate chromatin immunoprecipitation cyclohexamide central nervous system ciliary neurotrophic factor camp response element camp response element-binding protein corticotropin-releasing hormone CREB-1 regulated transcription co-activator-1 ix

10 DAG DHT DNA DRB Dyn E 2 EIA EPac ER ERα ERβ ERK1/2 FBS FSH GABA GC GnRH GnRH-R GFP GPCR GR GT1 GTP diacylglycerol dihydrotestosterone deoxyribonucleic acid 5,6-Dichlorobenzimidazole riboside dynorphin A 17β-estradiol enzyme immunoassay camp-guanadine exchange factor endoplasmic reticulum estrogen receptor alpha estrogen receptor beta extracellular signal-regulated kinase ½ fetal bovine serum follicle-stimulating hormone γ-aminobutyric acid glucocorticoid gonadotropin-releasing hormone gonadotropin-releasing hormone receptor green fluorescence protein G-protein coupled receptor glucocorticoid receptor GnRH T-antigen guanosine 5 -triphosphate x

11 HH HPA HPG ICC ICV IP 3 hypogonadotropic hypogonadism hypothalamic-pituitary-adrenal axis hypothalamic-pituitary-gonadal axis immunocytochemistry intracerebroventricular inositol (1,4,5)-triphosphate JAK2 Janus kinase 2 kda K ir Kiss-1 KNDy KO LH MAPK ME MEK mirna mpoa mrna NKB NPY Oct-1 Otx kilodaltons inwardly rectifying potassium channel kisspeptin gene kisspeptin/neurokinin B/dynorphin A neuron knockout luteinizing hormone mitogen-activated protein kinase median eminence mitogen-activated protein kinase kinase microrna medial preoptic area messenger RNA neurokinin B neuropeptide Y Octamer binding transcription factor-1 orthodenticle homeobox xi

12 OVLT OVX P 4 PAM PBS PCR PeN PIP 2 PKA PKC PLC PNX PNX-14 PNX-20 POA PR qrt-pcr RNA RP3V sirna SMART organum vasculosum of lamina terminalis ovarioectomized progesterone peptidyl-alpha-amidating monooxygenase phosphate buffer solution polymerase chain reaction periventricular nucleus phosphatidylinositol 4,5-bisphosphate protein kinase A protein kinase C phospholipase C phoenixin phoenixin-14 amide phoenixin-20 amide preoptic area progesterone receptor quantitative reverse transcription polymerase chain reaction ribonucleic acid rostral periventricular area of the third ventricle small interfering ribonucleic acid simple modular architecture research tool SMIM20 small integral membrane protein 20 SNP sodium nitroprusside xii

13 SV40 simian virus 40 T-Ag TBST TF TH T Antigen Tris buffered saline + Tween-20 transcription factor tyrosine hydroxylase xiii

14 Chapter 1 Introduction 1

15 1.1 General Introduction Reproductive function is tightly regulated by a myriad of factors at the level of the hypothalamus. The hypothalamus is at the peak of the hypothalamic pituitary gonadal (HPG) axis where it secretes gonadotropin-releasing hormone (GnRH) to promote the transcription and secretion of luteinizing hormone (LH) and follicle stimulating hormone (FSH) [1]. LH and FSH are important hormones for the growth of the gonads, ovulation, production of steroid hormones and puberty. Determining how central and peripheral signals regulate these neuronal populations is critical for a full understanding of reproductive physiology. It is thought that there are peptides, yet to be identified, that play important roles in the regulation of the reproductive axis [2]. Using information from the Human Genome Project and a bioinformatic approach, a novel reproductive peptide named Phoenixin (PNX) was recently described [3]. PNX is highly conserved across species and was detected at highest levels in the hypothalamus. Expression was also found in the median eminence and pituitary, suggesting PNX may be released into the hypophyseal portal vessel and transported to the anterior pituitary to exert its effects. In rat primary pituitary cultures, PNX increased GnRH-stimulated LH release and increased GnRH receptor (GnRH-R) mrna levels. Endogenously compromising PNX using small interfering RNA (sirna) in female cycling rats delayed the onset of the next estrus cycle and caused a reduction in GnRH-R mrna in the anterior pituitary. From these initial studies, it has been hypothesized that PNX is a pituitary-priming factor that helps stimulate reproductive function and may help initiate the GnRH/LH surge [3]. The abundance of PNX in multiple regions of the hypothalamus and in the periphery suggests that PNX has other unidentified functions beyond those in pituitary gonadotropes [3]. In particular, PNX may act at the level of the hypothalamus to control reproductive function. Neuropeptides that act on the anterior pituitary commonly have receptors in the hypothalamus. PNX may therefore have feedback loops within the hypothalamus to complement its stimulatory action on the gonadotropes. PNX is expressed in the arcuate (Arc) and anteroventral periventricular (AVPV) nuclei, regions containing kisspeptin neurons [4], which contact GnRH neurons in the medial preoptic area [5,6], raising the possibility that PNX may stimulate GnRH neurons. PNX could also 2

16 act upstream on kisspeptin neurons through autocrine mechanisms or connections with other PNX-expressing neurons of the hypothalamus. However, the roles of PNX in the hypothalamus, the molecular pathways that it activates and the regulatory mechanisms for its synthesis and secretion have yet to be explored. To address this, the central aim of this thesis was to determine a hypothalamic function of PNX, specifically on the GnRH and kisspeptin neuronal populations, and also to examine the molecular pathways PNX activates and other hormones or neuropeptides that may regulate PNX. As the hypothalamus is a highly heterogeneous region with a complex architecture, it is difficult to investigate these specific nuclei in vivo [7]. However, using several specific cell lines, representing GnRH, Arc kisspeptin and AVPV kisspeptin neurons, the effects of PNX on GnRH and kisspeptin neurons could be studied. 1.2 The Hypothalamic-Pituitary-Gonadal Axis Reproductive function is carefully orchestrated by interactions between the hypothalamus, pituitary and gonads, which comprise the reproductive axis. The hypothalamus is situated at the pinnacle of the HPG axis, where it integrates environmental cues to regulate reproductive function [7]. Hypothalamic neurons secrete the reproductive decapeptide, GnRH, in pulses from nerve terminals in the median eminence (ME) into the hypophyseal portal vessels for transport to the anterior pituitary. In pituitary gonadotropes, GnRH stimulates the synthesis and secretion of the gonadotropins LH and FSH [8]. LH pulsatile release is tightly correlated with GnRH secretion patterns [1]. The gonadotropins, LH and FSH, are both essential for normal reproductive function and regulate folliculogenesis and ovulation in females and spermatogenesis in males [9]. These hormones also trigger the production of estrogens, progesterins and androgens in the gonads [9]. These steroid hormones are required for gametogenesis and the feedback loops up the HPG axis for the dynamic regulation of GnRH and gonadotropins [10]. 3

17 1.3 Gonadotropin-Releasing Hormone (GnRH) Neurons GnRH is considered to be the key regulator of reproductive function in the hypothalamus. It is the final output from the hypothalamic neuronal network that feeds down to regulate reproductive function. GnRH pulsatile release is determined by integration of multiple environmental and internal factors at the level of the GnRH neuron [11]. The GnRH neuron is a critical component of the HPG axis and therefore has been the focus of reproductive neuroendocrine research Discovery of GnRH The idea of a hypothalamic exciter of gonadotrophs was first proposed in 1950 [12]; however, as the hypothalamus contains such low amounts of the decapeptide, it was difficult to isolate [13]. It was not until over 20 years later, in 1970, that the two independent research groups of Andrew Schally and Roger Guillemin eventually isolated and characterized the master regulator of reproductive function, GnRH [14,15]. Originally, GnRH was thought to only be a hypophysiotropic factor important for the regulation of LH and FSH; however, in the four decades that have followed, our understanding of the GnRH system has grown substantially [16] Development and Anatomy of GnRH Neurons As GnRH neurons are essential for reproductive viability in mammals, they undergo a precisely orchestrated developmental pattern that is unusual when compared to nearly all other neurons in the brain [8]. GnRH neurons emerge from the olfactory placode and migrate along the vomeronasal nerves across the nasal septum. These embryonic neurons then cross into the median forebrain and terminate in the preoptic area and medial septum of the hypothalamus [17,18]. The olfactory placode origins of GnRH neurons helped explain the phenotype of Kallmann s syndrome, a genetic disease characterized by hypogonadotropic hypogonadism (HH) and anosmia [8,19]. In these patients, abnormal olfactory development disrupts GnRH neuronal migration, leading to HH [19,20]. This disease is due to mutations in genes encoding proteins for GnRH neural migration. 4

18 Once fully developed, GnRH neurons are found in a small heterogeneous population of neurons in the medial preoptic area (mpoa) of the hypothalamus. These neurons have dense projections to the ME [21,22,23], and studies with retrograde tracers reveal that about 70% of GnRH neurons terminate in the ME [24,25], leaving 30% with their axons projecting to alternative regions including the amygdala, hippocampus, striatum and other hypothalamic nuclei [26,27,28,29]. Studies have also demonstrated that GnRH neurons can terminate in the organum vasculosum of the lamina terminalis (OVLT) [30,31,32,33], a region with highly permeable fenestrated endothelial cells that make up a brain-peripheral interface, found outside the blood brain barrier (BBB) [34,35]. Herde et al. demonstrated that, in the OVLT, GnRH dendrites, rather than axons, projected outside the BBB, where they sense peripheral signals to regulate GnRH neuronal activity [36]. These projections could serve as an interface between the central nervous system (CNS) and periphery to regulate reproductive function based on the homeostatic status of an individual [37] Function of GnRH Neurons in the HPG Axis Reproductive capacity requires the pulsatile release of GnRH from the hypothalamus, a process initiated at puberty. Puberty is an extended developmental phase that culminates with the first ovulation in females and production of sperm in males [8]. Female rhesus monkeys given pulsatile GnRH infusions developed precocious puberty, providing the first evidence that GnRH stimulates puberty [38]. GnRH pulses are low in amplitude and frequency after birth until the onset of puberty [39,40,41]. They gradually increase in frequency and amplitude during the prepubertal phase until they peak and plateau at the time of adulthood [42,43,44,45,46]. This rise in GnRH is paralleled by a subsequent rise in LH and FSH release from the anterior pituitary to stimulate the gonads. Pulsatile GnRH infusions are administered to sexually mature children with delayed puberty [47] and are used to treat patients with hypogonadotropic hypogonadism [48]. This episodic nature of the GnRH neuron is necessary for reproductive function during adulthood [49]. The frequency of GnRH release ranges from every 30 to 120 minutes, depending on the species and, in females, the phase of the menstrual cycle [50,51]. Constant infusion of exogenous GnRH in rhesus monkeys with hypothalamic 5

19 lesions fails to reestablish gonadotropin secretion; however, administration once per hour restores normal function [52]. Interestingly, GT1-7 cells, an immortalized mouse clonal cell line representative of GnRH neurons, also have the intrinsic rhythmic release of GnRH in vitro and these neurons may be synchronized by cell-to-cell contacts [53]. In the female menstrual cycle, the rise in estrogen from the developing follicles during the follicular phase triggers a GnRH surge, comprised of a large release of the peptide [8]. In turn, this surge of GnRH stimulates the gonadotrophs to increase LH and FSH release, known as the pre-ovulatory LH surge [54,55,56] GnRH-R and GnRH Signalling Mechanisms GnRH signals through a G q/11 -type G protein coupled receptor (GPCR), GnRH- R, that activates phospholipase C (PLC) and subsequently protein kinase C (PKC). This cellular response mobilizes calcium stores to increase LH and FSH secretion while increasing the activity of mitogen-activated protein kinase (MAPK) pathways to regulate the transcription of multiple genes, including gonadotrophin subunits [57,58,59]. The density of GnRH-R determines the sensitivity of the pituitary to GnRH and is regulated by GnRH itself, estrogen, progesterone (P 4 ), GnRH and other neuropeptides, such as the novel peptide PNX [60]. GnRH-R expression is highest during the GnRH surge to ensure the LH surge is elicited from the pituitary for normal ovulation [60]. Elevated estrogen levels increase the levels of GnRH-R on gonadotropes prior to the GnRH/LH surge, while P 4 reduces expression during the luteal phase [61]. However, the most potent stimulator of GnRH-R mrna expression is GnRH itself [60]. Treatment of pituitary gonadotropes with GnRH antagonists or GnRH antiserum dramatically reduces the number of receptors [62,63]. Regular pulsatile secretion is required to maintain the full complement of GnRH-Rs on gonadotropes. Continuous release of GnRH desensitizes the pituitary and causes internalization of GnRH-Rs [64] GnRH Gene As GnRH is critical for reproductive success and the evolutionary transfer of genes to the next generation, it is one of the most phylogenetically conserved peptides and present in all invertebrates and vertebrates [16]. For example, a paralogue of the 6

20 GnRH gene in yeast, functioning as a pheromone, shares 50% similarity with those in vertebrates [16,65]. All mammals, with the exception of the guinea pig, share an identical amino acid sequence for the GnRH peptide [8]. In mammals, two GnRH genes exist, GnRH-I and GnRH-II, each consisting of four exons encoding for the signal peptide, the mature GnRH peptide and gene (GnRH) associated peptide [66,67,68]. GnRH-I was the first to be discovered and is responsible for the regulation of the gonadotropes [16], while GnRH-II is more evolutionarily conserved than GnRH-I [69] and, in humans, is expressed in every structure of the brain stem and hypothalamus as well as in regions of the periphery [70]. Although a hypophysiotropic has not been demonstrated, in mammals, GnRH-II has been implicated in the regulation of reproductive behaviours [71,72]. In particular, GnRH-II stimulates reproductive function based on energy status and reduces food intake [71,73,74]. Interestingly, food restriction decreases the transcription and protein synthesis of GnRH- II [75], suggesting that GnRH-II may mediate a balance between energy status and reproduction [76] by stimulating reproductive function only if sufficient energy stores are available [77] Regulation of GnRH Neurons GnRH neuronal circuits are regulated by a range of factors including steroid hormones, neurotransmitters and peptide hormones, all of which are crucial for the fine homeostatic regulation of reproductive function in the organism. Although this system may seem redundant, each input plays an important role for relaying information about the internal and external environment [8] Gonadal Steroids The role of gonadal steroids in the positive and negative feedback regulation of the HPG axis is well established and a key regulatory mechanism. Pulsatile release of LH and FSH from the pituitary leads to steroidogenesis in the gonads [78]. There are three main classes of sex steroids that feedback from the gonads to directly or indirectly regulate GnRH neurons: estrogens, progesterones, and androgens. 7

21 Estrogens Estrogens are essential for the regulation of GnRH synthesis and secretion as well as for sexual differentiation of the mammalian brain. Three main estrogens are produced in the gonads: estrone, estradiol, which can be classified as 17β-estradiol or 17αestradiol, and estriol [79]. Estrogens are synthesized by the aromatization of androgen precursors. The production of the precursor androstenedione from cholesterol first occurs in the theca cells of the ovaries. Androstenedione can then cross into neighbouring granulosa cells, which harbour the enzyme P450 aromatase, for the production of estrone. Estradiol can then be generated from estrone by the enzyme 17β-hydroxysteroid dehydrogenase [79]. 17β-estradiol (E 2 ) is the most potent and predominant form of estrogen in the reproductive system and the most commonly used estrogen in research. E 2 has been established as a bimodal regulator of the hypothalamus, exerting both inhibitory and stimulatory effects on GnRH neurons [80]. Basal levels inhibit GnRH mrna expression and secretion in vivo [81,82,83,84,85,86], and in vitro experiments have demonstrated inhibition of GnRH promoter activity with E 2 treatment [87,88,89,90]. Reduction in GnRH mrna levels was observed in both the GT1-7 cell line and another immortalized GnRH hypothalamic cell model, the GN11cell line [91,92]. In females, there is also a stimulatory effect that occurs before the GnRH and LH pre-ovulatory surge, in the late follicular phase, where the rise in E 2 induces a surge of GnRH to induce ovulation [11,93,94,95,96]. Although there is consensus that E 2 acts in a differential manner throughout the estrous cycle, the cellular and molecular mechanisms by which it regulates GnRH neurons is debated [80]. Classical estrogen signalling involves E 2 binding and the dimerization of nuclear receptors, estrogen receptor α (ERα) and estrogen receptor β (ERβ) [97]. Both isoforms bind with similar affinity to consensus estrogen responsive elements (EREs) on the promoters of target genes to regulate their transcription [98,99,100]. ERα can also act in a non-classical way by tethering to other transcription factors such as activator protein-1 (AP-1) [101]. A membrane receptor, GPR30, is also activated by E 2, causing rapid activation of adenylyl cyclase (AC) and MAPK pathways, which results in the mobilization of Ca 2+ [102,103,104]. 8

22 ERα is widely expressed throughout the HPG axis in the hypothalamus, pituitary, gonads and uterus. ERα knockout mice (ERαKO) are infertile and display high circulating levels of gonadotropins, suggesting that the negative feedback from the gonads is disrupted in these animals and that ERα is necessary for this process [105,106,107,108]. ERαKO were also unable to generate the pre-ovulatory surge, suggesting ERα is also critical for the positive feedback of estrogen [109]. Interestingly, ERβKO exhibited subfertility, although their gonadotropin levels were not affected. A double knockout mouse did have greater circulating gonadotropin levels than ERαKO alone, suggesting that ERβ may be moderately involved in the negative feedback [110,111,112]. There has been contention over whether GnRH neurons themselves express steroid receptors and can respond to steroids hormones, or whether steroidal regulation is via upstream neurons that synapse on GnRH cells [8]. The prevalent hypothesis is that E 2 acts through presynaptic afferents that express ERs, although there is still evidence that E 2 could act directly on GnRH neurons. Multiple in vivo double-labelling immunohistochemical studies failed to detect ERα receptors in GnRH neurons [113,114,115,116], but the approach may not have been sufficiently sensitive to detect a small population of ERs, or the levels may have been hampered by castration [80]. In vitro, ERα and/or ERβ expression has been observed in various GnRH-expressing hypothalamic cell lines [91,117,118,119,120,121], and more recent immunocytochemical studies have revealed co-expression of ERβ with GnRH, including in human tissue samples [122,123,124]. In support of the hypothesis for a direct effect of estrogen on GnRH neurons, in vitro studies have demonstrated that E 2 directly represses GnRH mrna expression through ERα-mediated mechanisms [91,125], activates the GnRH promoter through a functional ERE [89] and induces Ca 2+ oscillations [126]. Together, this mounting evidence suggests that E 2 likely signals through a combination of direct and indirect mechanisms to regulate GnRH neurons in the preoptic region. These processes have yet to be determined; however, E 2 may act through ERβ or GPR30 to affect GnRH synthesis and secretion. 9

23 Androgens Proper androgen signalling is critical for sexual differentiation, spermatogenesis and gonadotropin function [127]. Testosterone and dihydrotestosterone (DHT) are the two main androgen steroid hormones synthesized in the Leydig cells of the testis, and, in females, small amounts of testosterone are produced in the ovaries [128]. 5α-reductase type 1 or 2 enzyme converts testosterone into the more potent androgen DHT, the form that is hypothesized to exert the majority of effects [129]. Androgens are involved in the negative feedback loops from the gonads and reduce GnRH mrna expression and secretion from the hypothalamus and limit the release of gonadotropins from the pituitary in vivo [130,131,132,133]. In vitro studies corroborate these, demonstrating a repressive effect on GnRH gene transcription in the GT1-7 cell line and direct binding of androgen receptor (AR) to the 5 promoter region of the GnRH gene via Oct-1 transcription factor binding sites [127,134,135]. Androgens signal through the AR superfamily of nuclear receptors, and, although they have not been localized to GnRH neurons in vivo [113], studies have found expression in GnRH-expressing cell lines [129,134]. The low expression of ARs, heterogeneity and scarcity of GnRH neurons in the hypothalamus in vivo [127] could explain why ARs have not been co-localized to date. From in vitro studies, androgens appear to regulate GnRH neurons directly; however, the molecular mechanisms involved remain to be elucidated Progesterone P 4 is the steroid hormone elevated during the luteal phase of the estrous cycle. The rise in P 4 reduces GnRH pulsatility and LH secretion frequency to prevent the onset of a second GnRH/LH surge by the fluctuating levels of estrogens [136,137,138,139,140]. Experiments have demonstrated direct binding of P 4 nuclear receptors (PR) to the GnRH promoter, resulting in a decrease in GnRH mrna expression [130,141]. This reduction is dependent on prior estrogen exposure, which elevates PR expression [142,143]. As with the other gonadal steroids, the mechanisms of P 4 signalling in GnRH neurons are still under investigation. Experiments using the PR antagonist RU486 completely abolished P 4 -mediated suppression of GnRH secretion [140]. In contradiction, in vivo studies have been unable to locate PR in native GnRH 10

24 neurons [144], and PR knockout mice exhibit normal responses to P 4 [145], suggesting another receptor may be responsible for the inhibitory effects of P 4 in GnRH neurons. Interestingly, GnRH neuronal explants responded to P 4 through the P 4 -receptor membrane component 1 (PgRMC1). P 4 reduced Ca 2+ oscillations and inhibited GnRH neuronal firing, independent of PRs and gamma-aminobutyric acid (GABA) ergic or glutamatergic inputs [146]. It was hypothesized that PgRMC1 mediates the immediate effects on the GnRH pulse generator, while PR may be involved with the longer-term effects of P 4, such as regulating GnRH gene transcription. In summary, there may be a combinatorial effect of both types of P 4 receptors; however, more research will be required to elucidate these precise mechanisms [146] Stress and the HPA Axis Stress, defined as any factor that disrupts homeostasis in an organism [147], inhibits reproductive function and the HPG axis [147]. Stress-related disorders and high levels of cortisol are associated with reduced GnRH and LH in females [148,149]. The stress response involves the activation of the hypothalamic-pituitary-adrenal (HPA) axis, which stimulates the release of corticotropin-releasing hormone (CRH) from the hypothalamus and, subsequently, adrenocorticotropic hormone (ACTH) from the pituitary. ACTH is released into circulation, where it acts on the adrenal glands to cause the release of glucocorticoids (GCs). GCs, along with CRH, feed back to the hypothalamus and pituitary to inhibit GnRH and gonadotropin biosynthesis and secretion [150,151,152,153,154,155,156,157], which reduces output to the gonads. GCs signal through glucocorticoid receptors (GRs), nuclear receptors that dimerize and translocate to the nucleus, where they exert effects on the promoters of target genes [158]. Both in vivo [159,160] and in vitro models [151] have confirmed the presence of GRs on GnRHexpressing cells and gonadotropes, suggesting that GCs may directly act to repress GnRH neuronal function Nutritional Status and Insulin Reproductive capacity is a costly biological process that is heavily dependent on the nutritional status of an organism. For instance, food restriction and insufficient energy 11

25 stores, in anorexia nervosa, can inhibit the reproductive axis, causing dysrhythmic GnRH release, amenorrhea and infertility [161,162]. The hypothalamus regulates both reproduction and energy-balance processes to ensure the survival of the organism and relies heavily on metabolic signals, like insulin, to regulate the two processes properly. Insulin is not only important for glucose homeostasis in the body, but also involved in satiety signalling to the hypothalamus, which, in turn, regulates reproductive function [163,164]. Women with insulin-dependent diabetes mellitus exhibit an impairment in GnRH secretion [165], and neuron-specific insulin receptor knockout mice show diminished fertility as well as a reduction in circulating LH [163], implicating a role for insulin in the central regulation of reproduction. Insulin stimulates GnRH biosynthesis and secretion in primary GnRH neuronal cultures [166] and activates GnRH promoter activity in both the GT1-7 and GN11 cell lines via a MAPK-dependent pathway [167]. However, recent studies have shown GnRH-specific insulin receptor knockout mice did not have compromised reproductive function [168], and the induction of the MAPK pathway upon insulin stimulation could not be reproduced in vivo [169]. These findings raise questions about the direct action of insulin on GnRH neurons. Instead, afferents that feed into GnRH neurons may be regulated by insulin [169] such as NPY or POMC neurons [170]. 1.4 Kisspeptin Neurons In the past decade, kisspeptin has emerged as a critical player in the regulation of the reproductive axis, particularly of GnRH neurons. Kisspeptin is a 54 amino acid product encoded by the Kiss-1 gene [171,172,173]. Kisspeptin administration stimulates gonadotropin secretion [174] and, in GnRH neurons, increases c-fos expression and GnRH secretion via the Kiss1R [175,176,177,178] Discovery of Kisspeptin and the Kiss-1R (GPR54) The discovery of the kisspeptin family of peptides and their connection with reproductive physiology was revolutionary for the field of reproductive endocrinology and helped build on our understanding of the pathophysiology of reproductive diseases. Kisspeptin was first identified in 1996 and originally named metastin for its anti- 12

26 metastatic properties in melanoma cell lines [179]. The gene was termed KiSS-1 as tribute to the city in which it was discovered, Hershey, Pennsylvania, the birthplace of Hershey s Chocolate Kisses [179]. After the discovery, research was primarily focussed on the metastatic properties of metastin in cancer biology [180,181]. In 2001, four research groups independently identified GPR54 as the receptor for the metastin ligand. At this time, the metastin peptides were also given the alternative name kisspeptins [171,172,173,182]. In 2003, the kisspeptin-gpr54 system came to the attention of reproductive physiologists when two separate groups simultaneously reported that disabling mutations to the kisspeptin receptor were associated with hypogonadotropic hypogonadism and disrupted pubertal progression in their patients [183,184]. Targeted deletion of GPR54 in rodents produced the same phenotype as in humans [184,185], and thus the kisspeptin GPR54 system emerged as a vital component of the HPG axis and has spurned a decade of intense research into its role in reproductive physiology Kisspeptin Gene and Protein The kisspeptin peptides are derived from the same 154-residue precursor protein product of the Kiss-1 gene and are highly conserved across species. The initial product cleaved is a 54 amino acid protein, kisspeptin-54 [186], thought to be produced by furin or prohormone convertases [171]. Shorter peptides can then be cleaved from kisspeptin- 54 (kisspeptin-10, -13 and -14). All four kisspeptins are part of the arginine phenylalanine-amide (RF-amide) related peptide family of proteins containing an arginine-phenylalanine-nh 2 motif at their carboxy-terminus [187] and exhibit the same affinity for GPR54 [171] Kisspeptin and GPR54 Anatomical Expression The distribution of kisspeptin neurons has been studied in a variety of species [188], and, in mammals, there are two distinct populations of kisspeptin neurons in the diencephalon. The largest population is in the Arc (infundibular nucleus, in humans), followed by a population in the rostral periventricular area of the third ventricle (RP3V), which encompasses the AVPV and periventricular nucleus (PeN) in rodents [188]. There 13

27 are also clusters of Kiss1-expressing cells outside of the hypothalamus, including a population in the medial nucleus of the amygdala and a few cell bodies in the bed nucleus of the stria terminalis [4]. Kisspeptin may mediate these structures involvement in the pheromonal control of sexual behavior and neuroendocrine function [188]. From multiple observations, it is now clear that kisspeptin directly stimulates GnRH neurons [189]. First, double-label in situ hybridization has shown that the majority of GnRH neurons co-express GPR54 [175,190,191,192], and IHC has shown that kisspeptin-positive cells form close appositions with GnRH cell bodies and dendrites [193,194,195,196,197]. Most recently, evidence from direct electron microscopy shows axo-dendritic and axo-somatic contacts between kisspeptin fibers and GnRH neurons in the preoptic area [198]. In addition to contacts with the GnRH cell bodies, kisspeptin fibers also form appositions with GnRH neuron axon terminals in the ME [199,200,201,202]. Kisspeptin may act via diffusion in this region to regulate GnRH release or through intermediary cells in the ME, such as glial cells [188]. Confocal studies have also confirmed that GnRH neurons have reciprocal afferent connections to kisspeptin cells [196,203]. These reciprocal inputs may serve as part of a large circuitry important for the synchronization of a coherent GnRH pulse [188] comprised of GnRH neurons in the POA and kisspeptin neurons in the Arc and RP3V. Although the anatomical distribution of kisspeptin is relatively similar between males and females, females possess a nearly 10-fold greater number of kisspeptin cell bodies in the RP3V [204]. These sex differences likely result from hormonal influences during development [205]. This larger population is necessary for stimulating the GnRH pre-ovulatory surge in females [206], where as it is not necessary in males [207]. There is also sexual dimorphism in the number of kisspeptin fibers that form appositions to GnRH neurons in the preoptic area. In 2006, Clarkson and Herbison observed that 40% of GnRH neurons were in contact with kisspeptin fibers in the female mouse, compared to only 10% in the male [193]. Kisspeptin neurons in both the Arc and RP3V play an important role in the steroid feedback control to GnRH neurons, and, therefore, both populations highly express nuclear receptors for gonadal sex steroids. The majority of Arc and RP3V cells express estrogen receptor-alpha (ERα), with co-expression in the Arc ranging from 70 90%, 14

28 compared to 50 99% in the RP3V [207,208,209,210,211,212]. The percentage of kisspeptin cells co-expressing estrogen receptor-beta (ERβ) is only 11 25% in the Arc and 21 31% in the RP3V in rodents [208,213]. Although both populations are highly regulated by estrogens, each region has distinct responses and unique characteristics Arc Kisspeptin Neurons, KNDy Neurons The majority of Arc kisspeptin neurons co-express the peptides Neurokinin B (NKB) and Dynorphin A (Dyn), giving them the name KNDy neurons [214]. Interestingly, both NKB and Dyn contribute to the control of GnRH secretion [215,216]. NKB mediates the positive steroid feedback [217,218,219], and Dyn mediates the negative P 4 feedback to GnRH neurons [220,221]. KNDy neurons have high coexpression with the gonadal steroid hormone receptors ERα, PR and AR to facilitate these processes [214]. KNDy neurons form reciprocal KNDy KNDy connections with each other [201,222]. They send stimulatory (NKB) and inhibitory (Dyn) projections to GnRH neurons in the POA [201,202,223]. KNDy Arc neurons may orchestrate GnRH pulses with this network of connections [214,224,225,226]. Consistent with this notion, the ablation of KNDy neurons prevents the serum rise in LH, which indicates their importance in the GnRH pulse generator [227] RP3V (AVPV/PeN) Kisspeptin Neurons Rodent RP3V kisspeptin neurons do not express NKB or Dyn. However, a subset of rodent AVPV neurons express tyrosine hydroxylase (TH) [228], an enzyme involved in the biosynthesis of dopamine, suggesting these neurons may co-release dopamine. It is hypothesized that RP3V (AVPV/PeN) neurons are important for GnRH neuron activation during the pre-ovulatory surge and for puberty onset in females [229,230,231] Function of Kisspeptin Neurons in the HPG axis Since the connection between kisspeptins and reproduction was made in 2003 [183,184], there has been an explosion in kisspeptin research to determine how 15

29 kisspeptins interact with the HPG axis and how loss of the kisspeptin GPR54 system causes HH. These initial observations implicated the kisspeptins as essential components for the initiation of gonadotropin secretion at puberty and for supporting the reproductive axis in adulthood. Intraperitoneal or intracerebroventricular injections of kisspeptin-10 or kisspeptin- 54 stimulated LH and FSH secretion in mice, rats, sheep, monkeys and even humans [4,174,177,232,233,234,235]. GnRH antagonist acyline could block kisspeptin-induced gonadotropin secretion, demonstrating that it is dependent on the release of GnRH from the hypothalamus rather than kisspeptin action on the pituitary [4,174,190]. In addition, blockage of local kisspeptin action in the POA of ovariectomized rats (OVX) using an antimetastin antibody prevents the pre-ovulatory surge and inhibited estrus cyclicity [236]. In vitro, kisspeptins directly depolarize and increase the firing rate of GnRH neurons, which complements in vivo research [175,216,237]. In GT1-7 and GN11 cells, kisspeptin increases both GnRH secretion and GnRH mrna transcription [238]. Kisspeptins play a central role in the regulation of GnRH pulsatility, which governs reproductive function, influencing both puberty and the estrus cycle Kisspeptin Neurons in Puberty Kisspeptin is able to activate GnRH neurons from their quiescent state and initiate pubertal development. Both rodents and humans with loss of function mutations in the kisspeptin receptor fail to enter puberty [183,184]. At the onset of puberty in many species, Kiss1 and Kiss1r gene expression increases [174,175,239,240,241,242,243]. In addition, the number of RP3V Kiss1 neurons increases dramatically between birth and puberty onset [243], and this increase depends on E 2. Female aromatase KO mice, which cannot produce estrogen, do not express kisspeptin in the RP3V [243]. Furthermore, central kisspeptin administration to juvenile female rats increased LH secretion and advanced vaginal opening, resulting in precocious puberty [242]. Peripheral administration of kisspeptin to prepubertal rats also induced ovulation and increased gonadotropin secretion [177]. In rhesus monkeys, kisspeptin release increased in amplitude during pubertal development [244]. 16

30 Terasawa et al. have proposed that kisspeptin neurons are critical for puberty onset because they control GnRH pulsatility, not because they innately control puberty timing [245]. The timing of puberty may be controlled by upstream neuronal signals that project afferents onto kisspeptin neurons to inhibit them before puberty. In primates, neuronal components responsible for central inhibition of GnRH pulsatility before puberty might include GABAergic inputs to kisspeptin neurons [246,247,248] or NPY afferents [249]. Future studies need to characterize the precise mechanisms and afferents that initiate puberty and how they might influence kisspeptin neurons [245] Gonadal Steroidal Feedback to Kisspeptin Neurons Kisspeptin neurons are known to be important mediators of the steroidal feedback from the gonads to GnRH neurons [250,251]. They mediate both inhibitory and positive feedback because of their high expression of ERα, AR and PR [208,213], which are not highly expressed on GnRH neurons [114,115,144]. E 2 plays a central role in the regulation of kisspeptins by inhibiting them in the Arc and stimulating their expression the RP3V. This dual regulation by E 2 produces two outcomes: normal GnRH pulsatility (negative estrogen feedback) [194,213,252] and the generation of the GnRH/LH surge (positive estrogen feedback) Negative Feedback of Estrogen Gonadal steroids are involved in the inhibition of kisspeptin neurons in the Arc of a variety of species to regulate GnRH pulsatility [253]. In males, following castration, there is a significant increase in Kiss1 mrna, specifically in the Arc. This increase can be reversed by the sex steroids E 2, testosterone or DHT [190,232,254,255]. The increase in Kiss1 mrna coincides with a rise in GnRH and gonadotropin secretion, indicating the removal of negative feedback [255]. Kisspeptin antagonists can prevent secretion of GnRH, LH and FSH, demonstrating the importance of kisspeptin for normal pulsatile GnRH and gonadotropin secretion [256]. During the majority of the female estrus cycle, negative feedback of estrogen predominates, and GnRH secretion is kept under control through kisspeptin action. Kisspeptin levels fluctuate in the Arc during the estrus cycle, with levels at their lowest 17

31 when estrogen is highest [213], while ovariectomy induces Kiss1 mrna expression [194,208,211,232,257,258,259]. This loss of kisspeptin can be overcome with estradiol treatment [194,208,211,213,232,257,258]. Deletions of GPR54 prevent the postovariectomy rise in gonadotropins, despite the rise in Kiss1 mrna levels, demonstrating the requirement for kisspeptin signalling for normal GnRH pulsatility [258]. As mentioned previously, the neurons in the Arc are often referred to as KNDy neurons for their co-expression of NKB and Dyn [214]. It has been proposed that NKB and Dyn neurons coordinate the pulsatile release of kisspeptin from the Arc, with NKB stimulating and Dyn suppresing the release. KNDy are in close contact with other KNDy neurons, creating an interconnected neural network [201,222,223,224] that can both stimulate and repress kisspeptin release. Kisspeptin fibers form close contacts to the GnRH terminals in the ME and, therefore, act as output for the pulse generator. Gonadal steroid feedback also regulates Dyn and NKB expression. P 4 is a strong stimulator of Dyn and causes a reduction in frequency of action potentials from KNDy neurons [221,260,261]. Dyn signalling may be essential in determining the refractory period between bursts in KNDy neurons [261]. E 2 reduces both kisspeptin [208,210,211,257] and NKB expression to dampen the amplitude of GnRH pulses [219,262,263]. E 2 may also reduce neuronal excitability and the frequency of GnRH pulses by altering cell membrane properties [264]. As NKB and Dyn appear to play central roles in the GnRH pulse generator, NKB agonists or Dyn antagonists hold promise as novel therapeutic targets for improving gonadal activity in reproductive disorders by stimulating GnRH pulsatility [261] Positive Feedback of Estrogen The GnRH/LH surge during proestrus (in rodents) or in the late follicular phase (in primates) is triggered by a rise in E 2 and is necessary for stimulating ovulation. The AVPV is positively regulated by E 2 and mediates the positive feedback onto GnRH neurons [109,252,265]. Kisspeptin neurons in the rodent AVPV act directly on GnRH neurons to stimulate the GnRH/LH surge [109,266]. Lesions to the AVPV or infusions of kisspeptin antagonists to the AVPV blocked the GnRH/LH surge [210,236,267,268]. 18

32 Targeted deletion of ERα specifically in kisspeptin cells also prevented the GnRH/LH surge in mice [269]. At the time of the GnRH/LH surge, Kiss1 mrna expression in the rat AVPV is highest in the estrous cycle and the AVPV expresses Fos [210,213]. Mice lacking functional GPR54 were unable to produce a clear LH surge, and they did not exhibit Fos expression in GnRH neurons after E 2 and P 4 treatment [212]. Interestingly, the human female response to kisspeptin injections is stronger during the pre-ovulatory phase than during the early follicular or luteal phases [270,271,272]. Similarly, in rats and sheep, the strongest response to kisspeptin occurs just before ovulation [273,274]. High E 2 levels during the pre-ovulatory surge enhance kisspeptin stimulation of GnRH neurons [238,275,276]. Together, these experiments provide compelling evidence that the positive feedback of E 2 to AVPV kisspeptin neurons is critical for the generation of the pre-ovulatory surge [253] Signalling Pathways Activated by Kisspeptin The activation of GPR54, a G q/11 -type GPCR by kisspeptin results in the activation of phospholipase C (PLC) [171,172,277,278,279] and subsequent hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP 2 ) into the secondary messengers inositol (1,4,5)-triphosphate (IP 3 ) and diaglycerol (DAG). IP 3, in turn, triggers a massive release of intracellular Ca 2+ from the endoplasmic reticulum (ER) into the cytosol to activate Ca 2+ -dependent pathways, while DAG activates protein kinase C (PKC) [277,279]. It is hypothesized that DAG and Ca 2+ activate transient receptor potential canonical (TRPC) like channels and inhibit inwardly rectifying potassium channels (K ir ) to stimulate the secretion of GnRH [187,216]. PKC, in turn, phosphorylates the extracellular signalregulated kinases 1 and 2 (ERK1/2) and the p38-mitogen-activated protein kinase (p38- MAPK) transcription factors, which are also required for proper GnRH secretion [172,173,280]. The signalling pathways activated by kisspeptins are dependent on the cell type being stimulated. 1.5 Phoenixin Although many neuropeptides responsible for reproductive function have been identified, it is thought that there are unidentified peptides that regulate the reproductive 19

33 axis [2,3]. In 2012, Yosten et al. identified a novel reproductive peptide known as phoenixin using a bioinformatic approach [3] Bioinformatic Discovery Phoenixin was discovered by a bioinformatic algorithm previously used to predict neuropeptides, including the novel peptide neuronostatin [281]. Using information from the Human Genome Project, the algorithm searches for previously unidentified, secreted peptides with high evolutionary conservation [3]. It uses several databases to narrow down potential peptides. The Simple Modular Architecture Research Tool (SMART) database [282,283] first excludes any potential peptides with a transmembrane domain, then the SignalP database [284,285] eliminates any peptides without a signal peptide. All sequences encoding known proteins are removed, and the BioRegEx database identifies remaining sequences with dibasic cleavage sites. The final step involves screening using NCBI BLAST to identify highly conserved peptide sequences Isolation and Localization The sequence for phoenixin was synthesized and antibodies were developed so that the endogeneous peptide could be detected and purified from rat tissue [3]. PNX immunoreactivity was detected in multiple tissues, including the heart, thymus, stomach and spleen; however, the highest expression was in the hypothalamus. Within the hypothalamus, PNX is most significantly expressed in the paraventricular and supraoptic nuclei; however, there is also immunoreactivity in the periventricular, Arc, perifornical and dorsomedial nuclei, and the ventromedial hypothalamus. Positive labelling was also found in the ME and pituitary, suggesting there may be PNX release into the hypophyseal portal vessel and transport to the anterior pituitary. Other brain regions expressing PNX included the substantia nigra reticulate, Edinger-Westphal nucleus and nucleus of the solitary tract/dorsal motor nucleus of the vagus. As the hypothalamus and heart were found to contain the highest expression, the endogeneous peptide was isolated from these tissues and peptide sizes determined using mass spectrometry. In the hypothalamus, the 20

34 major product was a 20 amino acid amidated peptide (2182 Da), while, in the heart, it was a 14 amino acid amidated peptide ( Da) Function of PNX in the HPG Axis PNX localization in the ME suggested it might act on the anterior pituitary. PNX alone did not change the basal secretion of LH, ACTH, prolactin, growth hormone or thyroid-stimulating hormone in primary pituitary cells [3]. However, in female primary pituitary cultures, 24-hour PNX pre-treatment increased GnRH stimulated LH release. PNX alone increased GnRH-R mrna concentrations in female pituitary cultures and the alpha T3-1 immortalized gonadotroph cell line [3]. This increased abundance of GnRH-R on pituitary cells likely sensitized the pituitary to GnRH and enhanced the amount of LH secreted from the cells. To test the physiological relevance of PNX in vivo, ICV injections of sirna directed against PNX were given to female cycling rats [3]. The endogenous compromise of PNX delayed the onset of the next estrus cycle by 2.3 days. This coincided with a reduction in GnRH-R mrna in the anterior pituitary, further demonstrating that PNX regulates GnRH-R mrna expression in the pituitary [3]. These initial experiments have highlighted a role for PNX in the regulation of female pituitary gonadotrophs. PNX appears to be critical for normal ovarian cyclicity and may influence the cycle by sensitizing the pituitary to GnRH [3]. From these initial studies, it has been hypothesized that PNX is a pituitary priming factor that helps stimulate reproductive function and may help initiate the pre-ovulatory surge [3] PNX Structure, Processing and Cellular Localization PNX may be cleaved from the precursor protein, small integral membrane protein 20 (SMIM20), into two major products of 14 and 20 amino acid residues in length. In rodents, SMIM20 contains 69 amino acids (Figure 1.1) while in humans there are two isoforms of 67 and 168 amino acids. The PNX sequence contains a C-terminal glycine residue for amidation by peptidyl-alpha-amidating monooxygenase (PAM), and SMIM20 has multiple dibasic residues for cleavage [3]. PNX is highly conserved across species and PNX-20 is 100% homologous between humans and rodents. The 20 amino acid 21

35 Figure 1.1 Schematic illustrations of the rodent SMIM20 homolog and the protein products PNX-20 and PNX-14. The initial protein from the SMIM20 gene is SMIM20, a 69 amino acid protein in rodents. It is predicted to be a type 2 transmembrane protein with the TM domain indicated in green. SMIM20 may be cleaved and then amidated at the C-terminus to produce PNX-20 and PNX-14, 20-amino acid and 14-amino acid products, respectively. There are multiple dibasic residues in SMIM20 that are potential cleavage sites. 22

36 product (PNX-20) was the most abundant SMIM20 product in the hypothalamus and, therefore, is the focus of this thesis. The online topology prediction program Phobius [286] detects a transmembrane domain in SMIM20 and predicts it is a type-2 transmembrane protein with the C-terminus in the extracellular domain. To date, no studies have explored the cellular localization of PNX. PNX may be cleaved from SMIM20 in the secretory pathway by prohormone convertase 2 and carboxypeptidase E enzymes and then stored in vesicles. However, as it is located on the extracellular domain of the SMIM20 transmembrane protein, PNX may alternatively be released from SMIM20 by a process known as ectodomain shedding. Ectodomain shedding consists of the proteolytic cleavage by metalloproteinase enzymes and release of the extracellular domain of a transmembrane protein. This process occurs at the cell membrane to regulate a diverse number of molecules [287] PNX Signalling Mechanism Currently, the receptor and mechanisms involved in PNX signal transduction are unknown and remain to be elucidated. The patent data for PNX indicates that 100 nm PNX-14 or PNX-20 treatment increases camp levels from 2- to 3-fold in rat pituitary adenoma cells [288]. This suggests PNX activates the AC/cAMP pathway that is often stimulated through a G s G-protein coupled receptor. Many reproductive neuropeptides, including GnRH, kisspeptin, gonadotropin-inhibitory hormone and neuropeptide Y (NPY), signal through GPCRs [64,171,289,290]. Therefore, it is likely that PNX operates in a similar nature. PNX may stimulate one of the 150 orphan GPCRs that are of unknown function [291] PNX in the Spinal Cord and the Modulation of Pain Studies by Lyu et al. recently showed PNX, primarily PNX-14, is highly expressed in all spinal segments of the superficial dorsal horn of the spinal cord [292], in laminae I and II. They demonstrated that intrathecal administration of PNX-14 suppressed visceral pain and that this effect was blocked with PNX antiserum. Their observations matched two studies that showed partial deletion of SMIM20 gene in patients who had partial epilepsy with pericentral spikes, characterized by various seizure 23

37 types and epigastric pain [293,294]. However, nociception may not be the only sensory modality PNX modulates in the spinal cord, and future studies need to explore these further [292]. 1.6 Hypothalamic Cell Models for the Study of Neuroendocrine Function The hypothalamus is involved in the integration of peripheral signals to coordinate multiple biological processes, including energy homeostasis, sleep, growth, thermoregulation and reproduction. To execute these processes, the hypothalamus is organized into various nuclei, each containing populations of highly specialized neuronal cell types with distinct neuropeptide, neurotransmitter and receptor profiles [7,295]. The heterogeneity of the hypothalamus makes it complicated to dissect the specific molecular mechanisms involved in neuromodulation and neuropeptide synthesis in these nuclei [295]. Although in vivo methods offer valuable insights into the overall physiological system, they are not practical for exploring these cellular events. Using primary cell cultures and immortalized cell lines can circumvent these issues. In the past, hypothalamic cell models were difficult to generate due to the lack of CNS tumors and difficulty of immortalizing highly differentiated primary cells [295,296]. However, in 1990, Mellon et al. successfully established one of the first hypothalamic cell models, the GT1 cell line [297]. The GT1 cell model is a clonal, mature, GnRH neurosecretory cell line generated by targetted tumorigenesis with the simian virus 40 (SV40) T antigen (T-Ag) to the GnRH gene. GnRH-expressing hypothalamic tumors grew and these were isolated and subcloned to generate three separate clonal cell lines, GT1-1, GT1-3 and GT1-7 [297]. These cell lines, especially the GT1-7 model, have been indispensible in developing our understanding of the molecular mechanisms of GnRH synthesis and secretion [295]. Since the generation of the GT1 model, the SV40 T-Ag immortalization technique has been used in other embryonic or fetal dividing hypothalamic cell types, such as in suprachiasmatic nucleus and CRH-expressing cells [295,298,299,300,301,302] and in adult primary cells treated with ciliary neurotrophic factor (CNTF) [303]. The Belsham laboratory has generated over 200 hypothalamic cell lines, including embryonic and adult cell lines through the retroviral transfer of SV-40 T- 24

38 Ag into primary dividing cells. Adult cell proliferation was possible from the observation that CNTF could induce neurogenesis in adult mature neurons [303](Further discussed in Section 1.6.3). These cell lines each have distinct phenotypes and endogenously express neuropeptides, hormone receptors, neurosecretory machinery. These cell lines have become indispensible tools for the investigation of molecular and biochemical processes involved in hypothalamic regulation of neuropeptides [304] Immortalized Adult, Non-Clonal GnRH Cell Model (mhypoa- GnRH/GFP) The GnRH clonal models have been critical in developing our understanding of the cellular and molecular events involved in the synthesis and secretion of GnRH [16]. These models, however, do not account for the full array of GnRH neurons found in the hypothalamus, but rather represent one single GnRH cell type [305]. Recent in vivo work has shown that GnRH neurons exhibit differing morphologies, dendritic organization and membrane properties [36,306,307], leading to the hypothesis that there may be subpopulations of GnRH neurons within the hypothalamus [305]. To bridge this gap in GnRH cell lines and generate a model of multiple GnRH neurons, the Belsham lab generated the mhypoa-gnrh/gfp cell line [305]. A cell line representative of the NPY population [308] was previously generated, and, following a similar protocol, this was achieved with the GnRH population to produce the mhypoa-gnrh/gfp cell model. To summarize, the hypothalami from two-month-old female transgenic GnRH/GFP mice [generated by Dr. Suzanne Moenter (University of Michigan, Ann Arbor, ME, USA)] [309] were isolated for primary culture. Subsequently, the primary culture was treated with CNTF to induce cellular proliferation, and the SV-40 T-Ag and neomycin resistance gene were introduced to cause immortalization [305]. To isolate a population of only GnRH-expressing neurons, GFP-expressing cells were separated using fluorescence- activated cell sorting (FACS) (Figure 1.2). The mhypoa-gnrh/gfp cell model represents a heterogeneous GnRH neurosecretory line and expresses neuron-specific markers along with relevant reproductive neuropeptides and receptors [305] (Table 1A). The development of this unique cell model will allow for exploration of a heterogeneous complement of GnRH neurons. 25

39 Figure 1.2 Schematic representation of the immortalization of cell lines from GnRH/GFP and Kiss/GFP mice. In brief, the hypothalami of adult GnRH/GFP and Kiss/GFP mice were isolated and treated with CNTF to induce neuronal proliferation. Cells were then transfected with SV-40 T-Antigen to cause immortalization. The cells were subsequently FAC sorted to produce the mhypoa-gnrh/gfp, mhypoa- Kiss/GFP-3 and mhypoa-kiss/gfp-4 cell models. mhypoa-kiss/gfp-3 cells were isolated from the Arc and mhypoa-kiss/gfp-4 cells from the AVPV. 26

40 A Gene mhypoa-gnrh/gfp GnRH + Kiss-R (GPR54) + ERα + ERβ + GPR30 + IR + GR + Kiss-1 - SMIM20 + B Gene mhypoa-kiss/gfp-3 (ARC) mhypoa-kiss/gfp-4 (AVPV) ERα + + ERβ + + GPR GPR KiSS1 + + NKB + - Dynorphin A?? Substance P + - SMIM C Gene mhypoa-50 (AVPV) mhypoa-55 (Arc) Kiss ER-α + + ER-β + + GPR NKB - + Dynorphin A - + Substance P - + TH + - SMIM Table 1.1 Characterization of gene expression profiles for the (A) mhypoa- GnRH/GFP cell line (B) mhypoa-kiss/gfp-3 and -4 cell lines and (C) mhypoa-50 and -55 cell lines. RT-PCR results of relevant reproductive neuropeptides and receptors in the cell lines indicated. (+) indicates the presence of the gene and (-) indicates the absence or weak expression of a gene. Screening courtesy of Jennifer Chalmers. 27

41 1.6.2 Immortalized Adult, Non-Clonal Kisspeptin Cell Models (mhypoa-kiss/gfp-3 and mhypoa-kiss/gfp-4) As the generation of both the mhypoa-npy/gfp [308] and mhypoa- GnRH/GFP [305] neuronal models was successful using the protocol described above, our laboratory generated similar models of kisspeptin neurons to further our understanding of kisspeptin populations. Using both female and male Kiss- GFP mice [225,310], the Arc and AVPV were micro-dissected from isolated hypothalamii, and cells were treated separately to generate two separate kisspeptin cell lines. The mhypoa- Kiss/GFP-1 (male) and mhypoa-kiss/gfp-3 (female) represent the Arc neuronal populations, while the mhypoa-kiss/gfp-2 (male) and mhypoa-kiss/gfp-4 (female) represent AVPV neuronal populations. All four cell lines endogenously express neuronspecific markers and the appropriate reproductive neuropeptides and receptors. This thesis focuses on the female models, and Table 1B outlines their specific characterization Immortalized Adult Clonal Kisspeptin Cell Models (mhypoa-xx) Although several hypothalamically-derived cell lines had been generated and became essential tools in neuroendocrine research, only a paucity of cell lines were available, representing only an infinitesimal proportion of cells in the hypothalamus [295]. There was also clear lack of adult-derived cell models as many hypothalamic models are of embryonic origin. This is because mature, differentiated cells do not proliferate and thus cannot be immortalized [303]. However, the demonstration that the hypothalamus is capable of exhibiting low levels of neurogenesis with CNTF allowed for the immortalization of mature hypothalamic neurons [311,312]. Using CNTF to induce proliferation, Belsham et al. developed over 50 immortalized, clonal, adult murine cell lines to offer a broader repertoire of cell lines available for the study of hypothalamic gene regulation [303]. Because these cell models were derived from adult mice, they are named mhypoa-<clone number>. In brief, hypothalami of two-month-old mice were isolated and primary cultures were then treated with CNTF to induce proliferation. Cells were subsequently retrovirally transfected with SV40 T-Ag for immortalization and then 28

42 serially diluted until clonal cell populations were obtained [303]. These cell lines were found to express characteristic neuronal markers of mature neurons and were characterized based on their specific neuropeptide and receptor profiles. They offer new models by which to study the molecular mechanisms that govern neural activity, gene regulation and secretory events. In the presented thesis, two of these cell models have been used to explore the regulation of kisspeptin: the mhypoa-50 and mhypoa-55 cell lines. Both express Kiss-1 mrna; however, only the mhypoa-55 line expresses NKB, Dyn and substance P, which are three neuropeptides co-expressed in Arc kisspeptin neurons [214]. Tyrosine hydroxylase (TH), a marker of the AVPV [228], was only expressed in the mhypoa-50 line, indicating that the mhypoa-50 model may originate from the AVPV (Table 1C). 1.7 Study Hypotheses and Aims To date, it has been established that PNX is a reproductive peptide that upregulates GnRH-R mrna expression and GnRH-stimulated LH release in primary pituitary cultures [3]. Only the role of PNX at the level of the pituitary has been elucidated, although the expression in multiple regions of the hypothalamus suggests that it may also regulate reproductive hypothalamic neurons, such as those expressing kisspeptin or GnRH. The hypothalamus is an interconnected network of neurons that communicate among each other to regulate the activity in the pituitary [313]. PNX neurons may therefore connect with other reproductive neurons for the regulation of the HPG axis. Moreover, the knockdown of hypothalamic PNX delayed the onset of the next estrous cycle [3]. The estrous cycle is centrally regulated by kisspeptin and GnRH neurons [314], therefore, we hypothesize that PNX may directly regulate these two populations of neurons. Using adult mouse immortalized hypothalamic neurons representative of GnRH, AVPV kisspeptin and Arc kisspeptin neurons, I was able to test the general hypothesis that PNX-20 regulates the HPG axis at the level of GnRH and kisspeptin neurons (Figure 1.3). In order to test my general hypothesis, this thesis has been divided into three aims. 29

43 Figure 1.3 Schematic representation of the HPG axis and thesis general hypothesis. At the peak of the HPG axis, the hypothalamus contains kisspeptin and GnRH neurons, both of which are critical for reproductive function. Kisspeptin neurons regulate GnRH biosynthesis and secretion in GnRH neurons. GnRH neurons secrete GnRH in pulses down to the anterior pituitary to stimulate the production and secretion of LH and FSH. LH and FSH are released into the circulation and regulate steroidogenesis and gametogenesis in the gonads. The novel reproductive peptide PNX increases GnRH-R in the anterior pituitary. The goal of this thesis was to establish a role for PNX in GnRH and kisspeptin neurons. 30

44 Since PNX appears to positively regulate the HPG axis by increasing GnRH-R mrna in the pituitary, I hypothesized PNX would also stimulate the HPG axis at the level of the hypothalamus. Aim 1 of this thesis was focused on testing the hypothesis that PNX-20 directly upregulates the expression of GnRH and PNX along with the secretion of GnRH in GnRH neurons. I also tested whether PNX upregulates Kiss-1 mrna in kisspeptin neurons. Following PNX-20 treatment, GnRH and SMIM20 gene expression, GnRH protein expression and GnRH secretion were measured in the mhypoa- GnRH/GFP cell line. Kiss-1 gene expression was also measured following PNX treatment in the mhypoa-kiss/gfp-3 and mhypoa-55 Arc kisspeptin cell models along with the mhypoa-kiss/gfp-4 and mhypoa-50 AVPV kisspeptin cell models. Currently, the signalling mechanisms and receptor type involved in PNX signal transduction are unknown. As PNX is a probable ligand for an orphan GPCR [292] and previous data demonstrates PNX increases camp, I hypothesize that PNX-20 will activate one or both of the two primary GPCR signal transduction cascades: the camp/ac and PLC/MAPK pathways in the hypothalamus. Aim 2 of the thesis tests whether these pathways are activated by PNX in GnRH and kisspeptin neuronal models. Specifically, the phosphorylation of CREB (camp pathway) and ERK1/2 (PLC/MAPK pathways) were measured in the mhypoa-gnrh/gfp, mhypoa-kiss/gfp-3, and mhypoa-kiss/gfp-4 cell models, representative of GnRH, Arc kisspeptin and AVPV kisspeptin neurons respectively. Steroid hormones and other peripheral factors play a critical role in the regulation of the reproductive axis, in particular kisspeptin, insulin, glucocorticoids and E 2 Because PNX is a novel stimulator of the HPG axis, I hypothesize that the PNX gene, SMIM20, will be upregulated by the stimulatory peptides kisspeptin and insulin, and downregulated by glucorcorticoids in GnRH neurons. I also hypothesize that E 2 will increase SMIM20 mrna in AVPV kisspeptin neurons, similarly to E 2 regulation of Kiss-1 mrna in the AVPV. Aim 3 first determined whether dexamethasone, insulin and kisspeptin regulate SMIM20 gene expression in the mhypoa-gnrh/gfp cell model. Next I explored whether E 2 regulates SMIM20 gene expression in the mhypoa-kiss/gfp-4 and mhypoa-50 AVPV kisspeptin cell models. 31

45 Chapter 2 Materials and Methods 32

46 2.1 Cell Culture and Reagents Five adult-derived hypothalamic cell lines were used to represent GnRH, Arc kisspeptin and AVPV kisspeptin neurons. The mhypoa-gnrh/gfp cell line originated from FAC-sorted immortalized hypothalamic neurons from a GnRH-GFP mouse [309](The Jackson Laboratory, Bar Harbor ME, U.S.A), while the mhypoa-kiss/gfp-3 and mhypoa-kiss/gfp-4 cell lines originated from Kiss-GFP mice [225,310](The Jackson Laboratory, Bar Harbor ME, U.S.A) by the same process. The mhypoa-50 and mhypoa-55 cell lines were generated by SV-40 T-Ag immortalization of primary hypothalamic culture from C57Bl/6 female adult mice. The mhypoa- Kiss/GFP-3 and mhypoa-55 cell lines were isolated from the Arc, while the mhypoa- Kiss/GFP-4 and mhypoa-50 cell lines were isolated from the AVPV. The immortalized cell lines were grown in a monolayer in Dulbecco s Modified Eagle Medium (DMEM) (Sigma) 1 mg/ml glucose, supplemented with 5% fetal bovine serum (FBS) (Sigma-Aldrich, Oakville, Ontario, Canada) and 1% penicillin /streptomycin (Gibco, Burlington, Ontario, Canada). Cells were maintained at 37 C and 5% CO 2 as previously described [295,303]. Phoenixin-20 amide, Kisspeptin-10 and Lutenizing hormone-releasing Hormone (LH-RH) EIA kit were purchased from Phoenix Pharmaceuticals (Burlingame, California, USA). Phoenixin-20 amide and Kisspeptin-10 were dissolved in Hypure water (Hyclone, Fisher Scientific, Whitby, ON, Canada) to 100 μm and 1000 μm (Phoenixin-20 amide only) stock concentrations and stored at 80 C prior to use. Dexamethasone was purchased from Sigma-Aldrich, (Oakville, ON, Canada) and 17βestradiol from Tocris Bioscience (R&D Systems Inc., Minneapolis, MN, U.S.A.). Both were dissolved in 100% ethanol to stock concentrations and stored at 20 C prior to mrna studies. Biosynthetic human insulin was a gift from Novo-Nordisk Canada Inc. (Mississauga, Ontario, Canada) and diluted in phosphate buffered saline (PBS). G-protein β antibody was purchased from Santa Cruz Biotechnology (Dallas, TX, U.S.A). Phospho-CREB (#9191), phospho-p44/42 MAPK (ERK1/2) (#9101), CREB, and p44/42 MAPK (ERK1/2)(#4695) antibodies were purchased from Cell Signaling Technology (via New England Biolabs (Whitby, ON, Canada)). Phospho- CREB and CREB were diluted 1:750 and 1:1000 respectively in 5% bovine albumin 33

47 serum in Tris-buffered saline with 0.1% Tween-20 (1x TBST) (Sigma-Aldrich, (Oakville, ON, Canada). Phospho-p44/42 MAPK (ERK1/2), p44/42 MAPK (ERK1/2) and Gβ antibodies were diluted 1:1000 in 5% milk in 1x TBST. 2.2 Phoenixin-20, Kisspeptin, Steroid and Insulin Treatments For c-fos mrna studies and western blot experiments, cells were grown to 90 95% confluency in 60 mm plates (Sarstedt, Montreal, QC, Canada), then serum starved in 2.5 ml low glucose media supplemented with 1% penicillin streptomycin (Gibco, Life Technologies, Burlington, ON, Canada) for 4 hours. Next, treatment was added in 0.5 ml serum-free media to give final concentrations of 10 and 100 nm PNX-20. The cells were then harvested at 0, 5, 15, 30 and 60 minutes. For 24-hour PNX-20, insulin and kisspeptin treatments, cells were grown to 75 80% confluency in 1 mg/ml glucose DMEM supplemented with 5% FBS and 1% penicillin streptomycin. Media was replaced to 2.5 ml volume the evening before treatments. Treatments were added to each 60 mm plate in 0.5 ml serum-free DMEM to give final concentrations. For steroid treatments, cells were maintained in 4.5 mg/ml glucose phenol-redfree DMEM (Fisher Scientific, Whitby, ON, Canada) supplemented with 5% charcoalstripped FBS (Gemini Bio-Products, Cedarlane, Burlington, ON, Canada) and 1% penicillin/ streptomycin (Gibco, Burlington, ON, Canada). Treatments were added in 0.5 ml serum-free media to 2.5 ml in the plates to give final concentrations. 2.3 cdna Synthesis and Quantitative RT-PCR (qrt-pcr) Total RNA was isolated using the guanidium thiocyanate phenol chloroform extraction method [315]. RNA concentration and purity were measured using a Nanodrop 2000c spectrophotometer. Contaminating DNA was removed using Turbo DNase (Ambion, Austin, TX, USA) treatment for 30 min at 37 C. 2 mg of RNA was reverse transcribed using a High Capacity cdna reverse transcription Kit (Applied Biosystems, Streetsville, Ontario, Canada) according to the manufacturer s protocol. Next, 50 ng of cdna was amplified by real-time PCR with Platinum SYBR Green qpcr SuperMix- UDG with ROX (Life Technologies, Burlington, ON, Canada) and gene- specific primers 34

48 using an Applied Biosystems 7900 HT Real-Time PCR machine. The SYBR primers were designed using PrimerBLAST, an online primer design tool [316]. Primer sequences, annealing temperatures and amplicon sizes are listed in Table Protein Isolation, SDS-PAGE and Western Blotting First, plates were washed with cold 1x PBS then harvested in 1x lysis buffer supplemented with phosphatase inhibitor cocktail, protease inhibitor cocktail and PMSF (Sigma-Aldrich, Oakville, ON, Canada). The soluble fraction of the lysate was isolated after centrifugation (14000 rpm, 10 min, 4 C). Total protein was quantified using the biocinchoninic acid (BCA) Protein Assay Kit according to the manufacturer s protocol (Thermo Scientific, Rockford, IL, USA). Total protein (25 35 µg) was run on a 8% polyacrylamide gel and transferred onto 0.22 μm polyvinylidene difluoride membrane (Bio-Rad Laboratories, Mississauga, ON, Canada). Membranes were blocked with 5% milk in Tris buffered saline with 0.1% Tween-20 (1X TBST) for 1 hour and subsequently incubated in primary antibody overnight at 4 C. Primary antibody was either diluted in 5% milk in 1x TBST or 5% bovine albumin serum (Sigma-Aldrich, Oakville, ON, Canada) in 1x TBST depending on the antibody (see reagents section). After 3 washes in 1x TBST, membranes were complexed with secondary horseradish peroxidase antibody for 1 hour and then washed 6 times in 1x TBST. Secondary antibody was diluted 1:7500 in either 5% milk in 1x TBST or 5% BSA in 1x TBST to match the dilution of the primary antibody. Fluorescence was visualized using the ECL select Western Blotting Detection reagent (GE Healthcare Life Sciences, Pittsburgh, PA, USA) and captured using a KODAK Image Station 2000R. Western blot experiments were normalized using the relative phosphorylated samples divided by total protein or Gβ for the specific protein analyzed. 2.5 GnRH Enzyme-Linked Immunoassay (EIA) mhypoa-gnrh/gfp cells were split into triplicates and grown to 90 95% confluency in 24-well plates (Sarstedt, Montreal, QC, Canada). Cells were maintained in 35

49 Table 2.1 List of primers used for quantitative RT-PCR Gene Name Primer Sequence (5 è 3 ) Amplicon Size (bp) Annealing Temp ( C) Histone 3a F: CGC TTC CAG AGT GCA GCT ATT R: ATC TTC AAA AAG GCC AAC CAG AT c-fos F: CAACGAGCCCTCCTCCGACT R: TGCCTTCTCTGACTGCTCACA Gonadotropinreleasing hormone (GnRH) F: CGT TCA CCC CTC AGG GAT CT R: CTC TTC AAT CAG ACT TTC CAG AGC Small integral membrane protein 20 (SMIM20) Kisspeptin (Kiss-1)- Set 1 (mhypoa- Kiss/GFP-3 &-4) Kisspeptin (Kiss-1)- Set 2 (mhypoa-50 & -55) AgRP F: AGCAGGCTGTAAATCGAGCTGGTA R: ACTGCGGAGTGCACAGGATAAAGA F: AAG GAA TCG CGG TAT GCA GA R: CAG TTG TAG GTG GAC AGG TC F: AGC TGC TTC TCC TCT GT R: GCA TAC CGC GAT TCC TTT T F: CGG AGG TGC TAG ATC CAC AGA R: AGG ACT CGT GCA GCC TTA CAC

50 500 µl of 1 mg/ml glucose, 5% FBS, 1% P/S media. For the initial PNX-20 studies without pre-treatments, media was replaced with 300 µl treatment media (1 mg/ml glucose, 1% P/S) containing either vehicle, 10, 100, 1000 nm PNX-20 or 100 μm sodium nitroprusside (SNP, Sigma-Aldrich, Oakville, ON, Canada). In pre-treatment studies, media was replaced with 300 µl of vehicle or 1000 nm PNX-20 DMEM (1 mg/ml glucose, 5% FBS, 1% P/S) 24 hours before the 1 hour treatments described above. Cell supernatants were collected in triplicates after a 1 hour period and immediately dried and stored at 80 C. GnRH immunoreactivity was measured using a LH-RH EIA Kit (Phoenix Pharmaceuticals, Burlingame, California, U.S.A., assay range = 0 25 ng/ml) following the manufacturer s protocol. Total protein was collected after cell supernatant, isolated and quantified as described in the section above. Secretion values were normalized to the total protein per treatment. 2.6 In Silico Analysis The web tool Alibaba 2.1 was used to predict transcription factor binding sites for 2500 basepairs upstream of the 5 flanking regions of SMIM20 gene. Alibaba 2.1 is a program that predicts transcription factor binding sites using the TRANSFAC 4.0 transcription factor database ( 2.7 Statistical Analysis Data are presented as mean ± standard error of the mean (SEM) and were analyzed using GraphPad Prism Software 6.0 (GraphPad Software Inc., La Jolla, CA, USA). Statistical significance was determined using Student s t test, or one-way or twoaway ANOVAs where appropriate, followed by either a Bonferroni, Dunnett s or Tukey s post hoc test. Statistical significance was assumed when P < All experiments were performed with 3 7 repeats. 37

51 Chapter 3 Results 38

52 3.1 PNX-20 Induces Neuronal Activation in the mhypoa- GnRH/GFP Cell Model Since the receptor for PNX-20 is currently unknown, it is important to determine which neurons are sensitive to this peptide. C-Fos, a widely used marker of neuronal activation, was measured to determine whether PNX-20 could stimulate GnRH hypothalamic neurons [317]. After a 4 hour serum starve, the mhypoa-gnrh/gfp cell line was treated with 1, 10 and 100 nm of PNX-20 or vehicle (water) and samples were isolated after 30 minutes. C-Fos gene expression was assessed using quantitative reverse transcription PCR (qrt-pcr). C-Fos mrna levels increased by 30% after 30 min of 10 nm PNX-20 exposure (n = 4, P < 0.05) (Figure 3.1). This finding indicates that the mhypoa-gnrh/gfp cell line is activated by PNX-20 and confirms it is representative of a PNX-responsive cell model. 3.2 PNX-20 Increases GnRH but not SMIM20 mrna Expression in mhypoa-gnrh/gfp Cell Model As the GnRH cell model was responsive to PNX-20, we investigated PNX-20 mediated changes to GnRH and SMIM20 mrna levels to further characterize the role of PNX-20 in GnRH neurons. SMIM20 gene expression was assessed to determine if PNX- 20 could regulate its mrna in the GnRH neuronal model. The mhypoa-gnrh/gfp cell line was treated for 1, 2, 4, 8 and 24 hours with 10 or 100 nm of PNX-20. Changes in GnRH and SMIM20 gene expression were assessed using qrt-pcr. 10 nm (n = 4 5, P < 0.05) and 100 nm (n = 4 5, P < 0.01) PNX-20 increased GnRH mrna expression 2- fold at 2 hours (Figure 3.2A). There is also an increasing trend at 8 and 24 hours; however, it did not reach significance. In addition, over a 24-hour PNX-20 exposure, SMIM20 mrna expression did not change (Figure 3.2B). These findings indicate that PNX-20 increases GnRH mrna levels but does not affect SMIM20 expression over 24 hours in this GnRH cell model. 39

53 Relative c-fos mrna expression mhypoa-gnrh/gfp (30 min) * Vehicle 1 nm PNX 10 nm PNX 100 nm PNX Figure 3.1. PNX-20 mediated regulation of c-fos mrna expression in the mhypoa- GnRH/GFP neuronal cell line. Cells were serum starved for 4 hours then treated with vehicle (water), 1, 10 or 100 nm PNX-20 amide for 30 minutes. C-Fos mrna expression was determined using qrt-pcr and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 3 4), * P < Statistical significance was determined by one-way ANOVA with Bonferroni s post hoc test. 40

54 A mhypoa-gnrh/gfp Relative GnRH mrna expression ** * Vehicle 10 nm PNX 100 nm PNX Time (Hours) B Relative SMIM20 mrna expression mhypoa-gnrh/gfp Time (Hours) Vehicle 10 nm PNX 100 nm PNX Figure 3.2. PNX-20 mediated regulation of (A) GnRH and (B) SMIM20 mrna expression in the mhypoa-gnrh/gfp neuronal cell line. Cells were treated with vehicle (water), 10 or 100 nm PNX-20 amide over a 24 hour time course. GnRH and SMIM20 mrna expression was determined using qrt-pcr and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 4 5), * P < Statistical significance was determined by two-way ANOVA with Bonferroni s post hoc test. 41

55 3.3 PNX-20 Increases GnRH Secretion and Protein Synthesis in the mhypoa-gnrh/gfp Cell Model Next, since PNX-20 increased GnRH mrna, we explored whether PNX-20 could affect GnRH protein secretion. The mhypoa-gnrh/gfp cell model was treated with vehicle (water), 10 nm, 100 nm or 1000 nm PNX-20 for one hour before the media was collected and GnRH protein quantified using a GnRH-specific EIA kit. 10 and 100 nm PNX-20 did not increase GnRH secretion; however, 1000 nm PNX-20 increased GnRH secretion by 30% (Figure 3.3A). As PNX-20 increased both GnRH mrna levels and secretion, we investigated whether it could also elevate intracellular GnRH protein levels. To induce protein synthesis, the mhypoa-gnrh/gfp cells were first pre-treated for 24 hours with 1000 nm PNX or vehicle (water). Subsequently, the cells were incubated for an hour in media containing 100 μm sodium nitroprusside (SNP) to induce the secretion of GnRH. SNP is a nitric oxide donor that potently induces GnRH secretion, effectively unloading GnRH from the cells. This has been previously demonstrated in both the mhypoa-gnrh/gfp [305] and the GT1-7 cell lines [318]. The neurons pre-treated with PNX-20 released a significantly greater amount of GnRH compared to those pre-treated with control media (n = 3, P < 0.05) (Figure 3.3B). This suggests that the pre-treated cells contained a higher content of GnRH protein then those without PNX-20 pre-treatment, indicating PNX-20 induces GnRH protein synthesis. Finally, we sought to determine whether a 24 hour PNX pre-treatment could further increase the amount of GnRH released when the cells are stimulated with 1000 nm PNX-20. mhypoa-gnrh/gfp neurons were pre-treated for 24 hours with 1000 nm PNX-20 or vehicle (water) and then GnRH secretion was measured following 1 hour of 1000 nm PNX-20 treatment. Interestingly, neurons pre-treated with PNX-20 did not change the amount of GnRH released with PNX-20 stimulation compared to controls (Figure 3.3C). This suggests that the 24 hour PNX-20 pre-exposure desensitized the cells to PNX-20. Therefore, re-exposure to 1000 nm PNX-20 for 1 hour did not increase GnRH secretion. 42

56 A B GnRH secretion (ng/ml) / total protein (ug/ml) Vehicle 10 nm PNX * 100 nm PNX 1000 nm PNX GnRH secretion (ng/ml) / total protein (ug/ml) μm SNP * No Pre-Treatment 1000 nm PNX Pre-Treatment C GnRH Secretion / total protein Vehicle * Vehicle + Pre-Treatment 1000nM PNX 1000nM PNX + Pre-Treatment Figure 3.3. PNX-20 mediated regulation of GnRH secretion in the mhypoa- GnRH/GFP neuronal cell model. A) Cells were treated with vehicle (water), 10 nm, 100 nm or 1000 nm PNX-20 for 1 hour. B) Cells were pre-treated with either vehicle (water) or 1000 nm PNX for 24 hours then treated for 1 hour with 100 μm sodium nitroprusside (SNP). C) Cells were pre-treated with vehicle or 1000 nm PNX-20 for 24 hours, and then treated for 1 hour with vehicle or 1000 nm PNX-20. Media and total protein was collected and GnRH levels were measured by a GnRH-specific EIA and normalized to total protein levels. Results are expressed as mean ± SEM (n = 3 5), * P < Statistical significance was determined by one-way ANOVA with Dunnett s post hoc test or Student s t-test. 43

57 In summary, short-term (i.e. 1 hour) PNX-20 exposure increases GnRH secretion in mhypoa-gnrh/gfp neurons. Moreover, long-term exposure increased SNP-induced secretion, but not PNX-induced secretion. This suggests long-term PNX-20 incubation increases GnRH protein synthesis, but also desensitizes the cells to further stimulation. 3.4 PNX-20 Increases Kiss-1 mrna Expression in mhypoa- Kiss/GFP-3 and -4 Cell Models PNX-20 peptide is expressed in the hypothalamic Arc and PeN nuclei, which are regions that contain kisspeptin neurons [3]. Kisspeptin neurons play an essential role in the regulation of the HPG axis and therefore I sought to determine if PNX-20 regulates kisspeptin neurons. Specific kisspeptin cell lines generated in our laboratory were used to assess whether PNX-20 could affect the transcription of the Kiss-1 gene. The mhypoa- Kiss-GFP-3 and mhypoa-kiss/gfp-4 are representative of the Arc and AVPV cells respectively. I also assessed the 24-hour time point in two other Arc and AVPV cell lines, the mhypoa-55 and mhypoa-50 respectively. Cell lines were treated with 100 nm PNX-20 and samples taken at 0, 4, 8 and 24 hours to measure the relative changes in Kiss-1 mrna expression with the exception of the mhypoa-50 and -55 cell lines, which were only isolated at 24 hours. There was a significant 2-fold increase in Kiss-1 mrna expression at 24 hours with 100 nm PNX in both the mhypoa-kiss/gfp-3 (n = 3 8, P < 0.05) (Figure 3.4A) and 4 (n = 4 6, P < 0.05) (Figure 3.4B) cell lines. In the mhypoa- 50 cell line there was a 30% increase in Kiss-1 mrna expression (n = 5, P < 0.01) (Figure 3.5A); however, there were no changes in the mhypoa-55 Arc kisspeptin cells (n = 5, P > 0.05) (Figure 3.5B). These results demonstrate that PNX-20 stimulates kisspeptin neurons in the AVPV and Arc to increase mrna levels of the Kiss-1 gene. This effect may only be in certain neurons of the Arc as no changes in Kiss-1 expression were observed in the mhypoa-55 line. 44

58 A mhypoa-kiss/gfp-3 Relative Kiss-1 mrna Expression * Time (hours) Vehicle 100 nm PNX B mhypoa-kiss/gfp-4 Relative Kiss-1 mrna Expression * Time (hours) Vehicle 100 nm PNX Figure 3.4. PNX-20 mediated regulation of Kiss-1 mrna expression in the (A) mhypoa-kiss/gfp-3 and (B) mhypoa-kiss/gfp-4 neuronal cell lines. Cells were treated with vehicle (water) or 100 nm PNX-20 amide over a 24 hour time course. Kiss-1 mrna expression was determined using qrt-pcr and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 3 7), * P < Statistical significance was determined by two-way ANOVA with Bonferroni s post hoc test. 45

59 A Relative Kiss-1 mrna Expression mhypoa-55 (24 hours) Vehicle 100 nm PNX N = 5 B Relative Kiss-1 mrna Expression mhypoa-50 (24 hours) Vehicle ** 100 nm PNX N = 5 Figure 3.5. PNX-20 mediated regulation of Kiss-1 mrna expression in the (A) mhypoa-55 and (B) mhypoa-50 neuronal cell lines after 24 hours. Cells were treated with vehicle (water) or 100 nm PNX-20 amide for 24 hours. Kiss-1 mrna expression was determined using qrt-pcr and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 5), **P < Statistical significance was determined by Student s t test. 46

60 3.5 PNX-20 Increases Phosphorylation of CREB and ERK 1/2 in mhypoa-gnrh/gfp and of CREB in mhypoa-kiss/gfp-3 and -4 Cell Models To elucidate the signal transduction pathways mediating PNX-induced mrna and secretion changes, I measured the phosphorylation of key signalling molecules using Western blot. In particular, I measured changes to the phosphorylation of CREB and ERK1/2 that are involved in the AC and MAPK pathways respectively, following PNX-20 treatment. Neurons were serum starved for 4 hours and then treated with either 10 or 100 nm of PNX-20 and total protein was isolated after 0, 5, 15, 30 and 60 minutes for western blotting. In the mhypoa-gnrh/gfp cells, following 5 minutes of 10 nm PNX-20 treatment, levels of both pcreb (n=4-5, P <0.05) (Figure 3.6B) and perk1/2 (n=4-5, P < 0.05) (Figure 3.6B) increased. However, 100 nm PNX-20 did not significantly increase either, although there was an increasing trend. In both mhypoa- Kiss/GFP-3 (n=3, P <0.05), and mhypoa-kiss/gfp-4 (n=3, P <0.01) cells, 5 minutes of 100 nm PNX, but not 10 nm PNX, increased CREB phosphorylation (Figure 3.7A and Figure 3.7B). In these cells, PNX had no effect on ERK1/2 phosphorylation (Figure 3.7C and Figure 3.7D). These findings indicate the phosphorylation of CREB is increased in response to PNX-20 in both GnRH and kisspeptin models. However, PNX- 20 only induced the phosphorylation of ERK1/2 in the GnRH cell model, suggesting signaling can be cell type dependent. This result also indicates that there could be a convergence of the AC and MAPK signaling cascades in the GnRH cell line resulting in the phosphorylation of both CREB and ERK1/ In Silico Analysis of the SMIM20 Promoter Using Alibaba 2.1 and PROMO Transcription Factor Binding Analysis Programs The final aim was to determine potential regulators of PNX by assessing mrna changes in the PNX precursor protein SMIM20. To predict prospective regulators of 47

61 A mhypoa-gnrh/gfp (5 min) B mhypoa-gnrh/gfp (5 min) Relative CREB phosphorylation Vehicle * 10 nm PNX 100 nm PNX n = 4 Relative ERK1/2 phosphorylation Vehicle * 10 nm PNX 100 nm PNX n = 4-5 pcreb perk 1/2 Gβ Gβ Figure 3.6. PNX-20 increases phosphorylation of A) CREB and B) ERK1/2 in the mhypoa- GnRH/GFP neuronal cell line at 5 min. Cells were serum starved for 4 hours, then treated with either vehicle (water), 10 or 100 nm PNX-20 for 5 minutes. Protein was isolated and relative pcreb and perk1/2 expression was determined using western blot. All results shown are normalized to Gβ. Results are expressed as mean ± SEM (n=4 5), *P < Statistical significance was determined by one-way ANOVA with Dunnett s post hoc test. 48

62 A Relative CREB phosphorylation mhypoa-kiss/gfp-3 (5 min) * Vehicle 10 nm PNX 100 nm PNX B Relative CREB phosphorylation mhypoa- Kiss/GFP-4 (5 min) ** Vehicle 10 nm PNX 100 nm PNX pcreb Total CREB pcreb Total CREB C D Relative perk1/2 phosphorylation mhypoa-kiss/gfp Vehicle 10 nm PNX 100 nm PNX Relative perk1/2 phosphorylation mhypoa- Kiss/GFP Vehicle 10 nm PNX 100 nm PNX perk1/2 perk1/2 total ERK total ERK Figure 3.7. PNX-20 increases phosphorylation of CREB but not ERK1/2 in the mhypoa- Kiss/GFP-3 and mhypoa-kiss/gfp-4 neuronal cell lines at 5 min. Cells were serum starved for 4 hours, then treated with either vehicle (water), 10 or 100 nm PNX-20 over a 1 hour time course. Protein was isolated and relative pcreb and perk1/2 expression was determined using western blot. All results shown are normalized to total protein. Results are expressed as mean ± SEM (n = 3 4), *P < 0.05, **P< Statistical significance was determined by a one-way ANOVA with Dunnett s post hoc test or two-way ANOVA with Bonferroni s post hoc test. 49

63 SMIM20 gene transcription, in silico analysis of the SMIM20 promoter region was performed using two online web tools, Alibaba 2.1 ( and PROMO [319,320]. Alibaba 2.1 was used to identify putative estrogen response elements (ERE) and glucocorticoid response elements (GRE) sites in the 5 flanking region (2000 base pairs upstream) of the Mus musculus SMIM20 gene. PROMO was used to identify other notable transcription factor binding sites. Alibaba 2.1 identified 1 ERE and two ERE half-sites, indicating there could be potential regulation of the SMIM20 gene by ER α or ERβ. Three full GRE sites and 1 half GRE site were identified in the SMIM20 promoter region, suggesting glucocorticoids may also play a role in the transcriptional regulation of the SMIM20 gene (Figure 3.8). Analysis using PROMO revealed multiple AR, PR, camp responsive element modulator (CREM), CCAAT/enhancer binding protein alpha (C/EBPα), specificity protein 1 (SP1) and activator protein 1 (AP-1) sites in the 5 flanking region of the Mus musculus SMIM20 gene. This indicates there may be potential regulation of the SMIM20 gene by androgens, progesterone, CREB, c-fos and c-jun. 3.7 Kisspeptin increases SMIM20 gene expression in the mhypoa- GnRH/GFP cell models Kisspeptin exerts potent effects on GnRH neurons [321] and therefore it prompted investigation into kisspeptin mediated changes to SMIM20 gene expression. mhypoa- GnRH/GFP cells were treated with 10 nm kisspeptin-10 (KiSS-10) and RNA was isolated after 24 hours of treatment. qrt-pcr was used to determine SMIM20 gene expression. KiSS-10 treatment caused a 35% increase in SMIM20 mrna compared to vehicle control after 24 hours (n = 7, P < 0.05) (Figure 3.9). These results suggest that kisspeptin increases SMIM20 gene expression in GnRH neurons. This rise in SMIM20 mrna levels might augment the amount of SMIM20 protein translated and lead to higher levels of PNX in the hypothalamus, specifically in GnRH neurons. This could then feedback to increase the levels of Kiss-1 mrna in kisspeptin neurons, forming a positive feedback loop or be important for action on the gonadotropes. 50

64 Figure 3.8 In silico promoter analysis of the 5 flanking region of the Mus musculus SMIM20 gene. The sequence for the 5 flanking region of the SMIM20 Mus musculus gene was obtained through Ensembl (2000 bp) then subsequently analyzed by the gene regulation program Alibaba 2.1 ( for the presence of estrogen responsive elements (EREs) or glucocorticoid responsive elements (GREs). 51

65 mhypoa-gnrh/gfp (24 hours) Relative SMIM20 mrna expression Vehicle * 10 nm Kisspeptin Figure 3.9. Kiss-10 mediated regulation of SMIM20 mrna expression in the mhypoa-gnrh/gfp neuronal cell line. Cells were treated with vehicle (water) or 10 nm Kiss-10 for 24 hours. SMIM20 mrna expression was determined using qrt-pcr and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 7), * P < Statistical significance was determined by Student s t-test. 52

66 3.8 Neither insulin nor dexamethasone regulate SMIM20 gene expression in the mhypoa-gnrh/gfp cell model Because both insulin and glucocorticoids are central regulators of the reproductive axis [322,323], we tested if either could regulate SMIM20 mrna expression in GnRH neurons. Also the presence of GREs in the SMIM20 promoter indicated glucocorticoids may regulate SMIM20 transcription. The mhypoa-gnrh/gfp cell line was treated with 10 nm insulin or 20 nm dexamethasone, a potent glucocorticoid receptor agonist, over 24 hours and RNA was isolated at 0, 1, 2, 4, 8, and 24 hours. I also treated the mhypoa- NPY/GFP cell line with 10 nm insulin to ensure it suppressed AgRP gene expression, indicating that the insulin was working effectively [324]. There was a 30% reduction at 4 hours in AgRP mrna expression in the mhypoa-npy/gfp cell line treated with 10 nm insulin (n = 5, P < 0.05) (Figure 3.10B) that indicated the insulin was functioning properly. However, there were no significant changes in SMIM20 mrna expression with 10 nm insulin the mhypoa-gnrh/gfp cell line (Figure 3.10A), suggesting that insulin may not regulate SMIM20 in GnRH neurons at this concentration. Glucocorticoids are known to suppress GnRH mrna [157] and therefore GnRH mrna levels were measured alongside SMIM20 mrna levels as a positive control. 20 nm dexamethasone suppressed GnRH mrna expression at 2 hours by 50% (n = 3 4, P < 0.05) in the mhypoa-gnrh/gfp cell line (Figure 3.11B), demonstrating that the dexamethasone was functioning in our cell model. However, there were no significant changes in SMIM20 mrna expression with 20 nm dexamethasone (Figure 3.11A), suggesting dexamethasone may not regulate SMIM20 expression at this concentration in GnRH neurons β-estradiol does not appear to regulate SMIM20 mrna expression in the mhypoa-kiss/gfp-4 or mhypoa-50 cell models at 4 and 24 hours As 17β-estradiol (E 2 ) is a critical regulator of kisspeptin neurons, the effects of E 2 on Kiss-1 and SMIM20 mrna expression were examined in the AVPV mhypoa- Kiss/GFP-4 and mhypoa-50 cell models. E 2 stimulates the synthesis of Kiss-1 mrna in 53

67 A Relative SMIM20 mrna expression mhypoa-gnrh/gfp Vehicle 10 nm insulin Time (Hours) B mhypoa-npy/gfp (4 hours) Relative AgRP mrna expression Vehicle * 10 nm insulin Figure Insulin mediated regulation of SMIM20 mrna expression in the mhypoa-gnrh/gfp neuronal cell line. Cells were treated with vehicle (PBS) or 10 nm insulin for 24 hours. To confirm that insulin was working effectively, the (B) mhypoa-npy/gfp cell line was also treated with insulin alongside the (A) mhypoa- GnRH/GFP. (A) SMIM20 and (B) AgRP mrna expression was determined using qrt- PCR and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM (n = 3 5), * P < Statistical significance was determined by a two-way ANOVA with Bonferroni s post hoc test or a Student s t-test. 54

68 A Relative SMIM20 mrna expression mhypoa-gnrh/gfp Time (Hours) Vehicle 20 nm Dexamethasone B mhypoa-gnrh/gfp (2 hours) Relative GnRH mrna expression Vehicle * 20 nm Dexamethasone Figure Dexamethasone mediated regulation of SMIM20 mrna expression in the mhypoa-gnrh/gfp neuronal cell line. Cells were treated with vehicle (EtOH/ water) or 20 nm dexamethasone for 24 hours. (A) SMIM20 (n = 6-7) and (B) GnRH (n=3-4) mrna expression was determined using qrt-pcr and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM, * P < Statistical significance was determined by a two-way ANOVA with Bonferroni s post hoc test or a Student s t-test. 55

69 the AVPV [208,255] and EREs in the SMIM20 promoter region suggest it may also be regulated by E 2 [3]. The mhypoa-kiss/gfp-4 and mhypoa-50 cells were treated with 10 and 100 nm E 2 and RNA was isolated at 0, 4 and 24 hours after treatment. Kiss-1 and SMIM20 mrna expression were measured using qrt-pcr. In the mhypoa-kiss/gfp-4 cell lines there was a 1.5 fold increase in Kiss-1 mrna expression at 4 hours with 100 nm E 2 (n=5-6, P <0.05) (Figure 3.12C). 10 and 100 nm E 2 increased Kiss-1 mrna expression at 24 hours 1.8 and 2 fold respectively in the mhypoa-50 cell line (Figure 3.12D). However, there were no significant changes in SMIM20 gene expression in either the mhypoa-kiss/gfp-4 (Figure 3.12A) or mhypoa-50 (Figure 3.12B) cell lines. This indicates that SMIM20 gene expression is not regulated at the times and concentrations tested in these AVPV cell models. 56

70 A B Relative SMIM20 mrna expression mhypoa-kiss/gfp Time (Hours) Vehicle 10 nm E nm E 2 Relative SMIM20 mrna expression mhypoa Time (Hours) Vehicle 10 nm E nm E 2 C D Relative Kiss-1 mrna Expression mhypoa-kiss/gfp-4 (4 hours) Vehicle 10 nm E nm E 2 * Relative Kiss-1 mrna Expression mhypoa-50 (24 hours) * * Vehicle 10 nm E nm E 2 Figure β-estradiol mediated regulation of SMIM20 and Kiss-1 mrna expression in the mhypoa-kiss/gfp-4 and mhypoa-50 neuronal cell lines. Cells were treated with vehicle (EtOH/water), 10, or 100 nm 17β-estradiol (E 2 ) for 24 hours. Kiss-1 mrna expression was determined using qrt-pcr and levels were normalized to the housekeeping gene histone 3a. Results are expressed as mean ± SEM, (n = 5 6),* P < Statistical significance was determined by a one-way or a two-way ANOVA with Bonferroni s post hoc test. 57

71 Chapter 4 Discussion 58

72 4.1 General Discussion PNX is a novel reproductive peptide proposed to be involved in the regulation of the HPG axis, where it may sensitize the anterior pituitary to GnRH, particularly before the pre-ovulatory surge in females [3]. However, PNX may have other roles in the regulation of reproductive function that have yet to be defined, specifically in the hypothalamus. sirna knockdown of PNX by ICV injection interrupted estrus cyclicity in female rats [3], a process that is centrally regulated by the hypothalamus. This disruption in the estrous cycle could have been the result of dysregulated PNX signalling to hypothalamic GnRH and kisspeptin populations and the anterior pituitary. PNX may be involved in the regulation of GnRH and kisspeptin populations, which control reproductive function. Therefore, I was interested in determining the role of the SMIM20 cleavage product PNX-20 in GnRH and kisspeptin neuronal populations of the hypothalamus. Due to the heterogeneous nature of the hypothalamus, it is difficult to study the direct effects of PNX-20 on various neural populations in vivo, so I took an in vitro approach using immortalized cell lines developed by our laboratory. To study the role of PNX-20 in reproductive hypothalamic neurons, the mhypoa-gnrh/gfp cell line was used as a model for GnRH neurons, and the mhypoa-kiss/gfp-3, mhypoa-kiss/gfp- 4, mhypoa-50, and mhypoa-55 cell lines were used as models for the two known kisspeptin populations [4]. Through the use of these cell models, it was possible to examine the transcriptional, secretion, and signalling events evoked by PNX-20 in both GnRH and kisspeptin neurons. Previous screening of the cell lines in our laboratory has demonstrated the presence of GnRH, GPR54 and SMIM20 mrna expression in the mhypoa-gnrh/gfp cell lines, making them suitable to study the regulation of GnRH and SMIM20 mrna by PNX-20. The mhypoa-kiss/gfp-3 and -4 cell lines express both Kiss-1 and SMIM20 mrna therefore could be used to study Kiss-1 mrna regulation. The expression of SMIM20 in these cell lines suggests that PNX-20 is synthesized by both kisspeptin and GnRH neurons. In GnRH neurons, GnRH feeds back to auto-regulate both GnRH peptide secretion and mrna synthesis [325,326]. PNX-20 may also auto-regulate the hypothalamic neurons in which it is expressed or feedback to regulate other hypothalamic 59

73 neuropeptides via autocrine mechanisms. Immunohistochemistry revealed high expression of PNX in the periventricular and arcuate nuclei, both regions important for kisspeptin synthesis [3]. PNX may be involved with the autocrine regulation of kisspeptin neurons or signal through paracrine mechanisms to other neurons in the local region, including GnRH neurons. The current studies establish a role for PNX-20 in the regulation of both GnRH and kisspeptin neurons. In GnRH cell models, PNX-20 regulated GnRH mrna and protein expression and GnRH secretion. While in kisspeptin cell models, PNX-20 increased Kiss-1 mrna expression. PNX is a stimulatory neuropeptide in the anterior pituitary and also appears to be in both GnRH and kisspeptin neurons (Figure 4.1). These neurons are central regulators in the HPG axis and delineating the mechanisms for their regulation is crucial for reproductive physiology. These studies also identify pcreb and perk1/2 as downstream targets for PNX, implicating the AC/cAMP and PLC/MAPK pathways as potential mediators of PNX signalling. Interestingly, kisspeptin was found to be a regulator of GnRH neuronal SMIM20 mrna expression. There may be reciprocal interactions between kisspeptin and PNX neurons so they positively stimulate each other. Together, these studies suggest PNX may be involved in the positive regulation of the HPG axis at the level of both kisspeptin and GnRH hypothalamic neurons. These findings suggest that PNX could potentially play a role in the tonic regulation of GnRH neurons, the generation of the GnRH/LH surge, and the initiation of puberty and therefore have implications for reproductive disorders. 4.2 Regulation of GnRH Neuronal Models by PNX-20 These are the first studies implicating a direct stimulatory role for PNX-20 on GnRH neurons. It is widely recognized that GnRH neurons are the convergence point for a wide array of neuropeptides and hormones [8]. The summation of effects on GnRH neurons ultimately determines the output to the gonadotropes. Alongside kisspeptin, E 2, GCs, nutrients, and neurotransmitters, PNX-20 appears to be an additional player in the 60

74 Figure 4.1 Representative model summarizing the regulation of the HPG axis by PNX. Previous studies have demonstrated that PNX increases GnRH-R mrna at the level of the anterior pituitary. We have established that PNX can also act upstream in GnRH and Kisspeptin neurons. In GnRH neurons PNX increases GnRH mrna and protein levels and GnRH secretion. In kisspeptin neurons, PNX increases Kiss-1 mrna expression. Kisspeptin was also found to increase SMIM20, the PNX precursor, mrna expression in GnRH neurons. 61

75 complex regulation of the GnRH neuron [78]. Immunohistochemistry in the hypothalamus revealed PNX expression in multiple regions, including in the Arc and PeN which are both regions that classically express kisspeptin [4]. It is well established that many kisspeptin immunoreactive fibers form close appositions with GnRH neurons in the preoptic area and ME [193,194,195,236] to regulate both the expression [238] and secretion of GnRH and to increase neuronal firing of GnRH neurons [175,216]. Mounting evidence suggests kisspeptin also signals through intermediary neurons, such as GABAor NPY-expressing cells, to exert effects on GnRH neurons [327,328,329]. PNX could be released from the same synaptic terminals as kisspeptin onto GnRH neurons or interneurons to help stimulate GnRH transcription, translation, and secretion. Further characterization of PNX-20 co-localization with kisspeptin in vivo will need to be carried out to determine how these two peptides may be interacting. 10 nm PNX-20 induced c-fos gene expression in the mhypoa-gnrh/gfp cell line, indicating that PNX-20 activated GnRH cells [317,330] and these neurons are PNX- 20-responsive. Second messenger systems activate c-fos, including Ca 2+ influx after depolarization through voltage-dependent Ca 2+ channels [331]. This suggests PNX may depolarize the cells. Interestingly, although there was an increasing trend, 100 nm PNX- 20 did not significantly increase c-fos mrna expression. PNX-20 may have concentration dependent effects, whereby higher doses of the peptide do not activate the neurons. This type of biphasic dose-dependent effect is observed with other neuropeptidergic systems, for example with the endocannabinoid system and the GPCR cannabinoid 1 receptor CB 1. Low doses of receptor agonists activate a G s mechanism on CB 1 to enhance PKA and neuronal activity, while high doses activate a G i on CB 1 to reduce PKA activity and close voltage-gated channels [332]. The PNX receptor, similarly to CB 1, may have the potential to activate both G s and G i proteins to potentiate dosedependent effects. PNX-20 also increased GnRH mrna expression, which could be a result of transcriptional or mrna stability changes. If this increase is a result of transcriptional changes, GnRH mrna may have been induced by the activation of the c-fos signalling cascade or by one of the many TFs induced by c-fos. The GnRH promoter region contains AP-1 sites for the binding of c-fos and c-jun transcription factors, which could 62

76 activate GnRH mrna transcription [78]. However, since PNX-20 increased GnRH mrna levels with both 10 and 100 nm PNX-20, but c-fos with only 10 nm PNX-20, c- Fos may not be the only mediator of PNX-induced changes to GnRH mrna levels. The GnRH 5 flanking region has been previously characterized and is highly conserved between species [78]. Several transcription factors are critical for the regulation of GnRH transcription and these may be regulated by PNX-20 to increase GnRH mrna transcripts. Octamer binding transcription factor-1 (Oct-1) binding motifs have been identified in the rgnrh-i promoter and enhancer regions and mutations to these motifs caused a 95% reduction in transcriptional activity [333]. Two GATA factorbinding sites were also identified in the GnRH-I enhancer region, mutation experiments demonstrated that both are necessary for full enhancer activity [334,335]. In the proximal promoter region, there is a conserved orthodenticle homeobox (Otx) motif that binds Otx2 transcription factors [336], and overexpression of Otx2 in GT1-7 and GN11 cells induced GnRH-I promoter and transcriptional activity [78]. Otx2 has been co-localized to GnRH neurons in mice [337], and its deletion results in significant reproductive abnormalities [338]. Interestingly, Novaira et al. demonstrated that kisspeptin regulated GnRH mrna by increasing Otx2 binding to the enhancer region of the mgnrh-i gene [339]. These experiments indicate that Otx2 is important for GnRH mrna expression and reproductive competence and, therefore, may mediate the PNX induced effects on GnRH mrna expression along with Oct-1, GATA and other transcription factors. Further characterization of the transcription factors activated by PNX-20 will be required to elucidate these mechanisms. PNX may also have increased GnRH mrna expression by improving mrna stability in the mhypoa-gnrh/gfp neurons. Micro RNAs (mirnas) have recently become recognized as important for the regulation of mrna stability, mrna translation and for protein secretion. mirnas are 21-nucleotide gene products that hybridize with the complementary 3 untranslated region (UTR) of mrna to sequester them into protein complexes that degrade or inhibit the translation of the mrna [340]. Several mirnas that regulate the HPG axis have been characterized, including mir-361-3p, an X-linked mirna that inhibits FSH secretion from gonadotropes [341], and mir-132 and mir-122 that are upregulated by GnRH in the LβT2 gonadotrope cell line [342]. To stimulate 63

77 GnRH expression and secretion, PNX may inhibit the expression of particular mirnas that repress GnRH biosynthesis. To determine if PNX-20 directly increases the transcription of GnRH mrna, or whether it improves the stability of mrna transcripts, transcriptional inhibitor experiments should be performed (See Section 4.7 Future Directions). PNX-20 did not affect SMIM20 mrna expression in the mhypoa-gnrh/gfp cell model. This indicates that it is not involved regulating its own expression in GnRH neurons at the times and concentrations studied. However, PNX-20 may regulate SMIM20 at other time points or through post-transcriptional or post-translational processes. This might include the regulation of the cleavage of PNX-20 from the SMIM20 protein or regulation of SMIM20/PNX vesicular transport. PNX-20 may also regulate SMIM20 in other hypothalamic nuclei. Intriguingly, PNX-20 also induced GnRH secretion and measured GnRH protein levels, along with increasing GnRH mrna levels. Kisspeptin also stimulates all three processes in GnRH cell models [238]. The molecular mechanisms for PNX-induced GnRH secretion have yet to be determined. Drawing from kisspeptin signaling cascades, the PLC/MAPK pathway could be activated. This pathway increases intracellular Ca 2+ and stimulates GnRH neuronal depolarization and action potential firing rate [10]. These events occur through the closure of inwardly rectifying potassium channels (K ir ) and activation of non-selective cation channels [278,327]. As will be discussed in Section 4.4, PNX-20 increased ERK1/2 phosphorylation in the mhypoa-gnrh/gfp cell model, suggesting there may be activation of the PLC/MAPK pathways. This suggests the PLC/MAPK pathways could be involved in the regulation of GnRH biosynthesis and secretion by PNX-20. GnRH secretion can also be induced by camp, through the activation of camp-gated cation channels [343,344], suggesting PNX-20 may have also activated the AC/cAMP pathway (Further discussed in Section 4.4). SNP, a nitric oxide (NO) donor, is a potent stimulant for GnRH secretion as demonstrated in in vitro experiments in the GT1-7 and mhypoa-gnrh/gfp cell models [305,318]. SNP releases NO allowing it to bind to guanylyl cyclase to increase the production of cyclic guanosine monophosphate (cgmp). cgmp activates cgmp-gated ion channels causing depolarization of GnRH neurons and subsequent GnRH protein 64

78 secretion [318]. SNP was used to stimulate GnRH peptide release from the mhypoa- GnRH/GFP neurons after a PNX 24 hour pre-treatment to determine if intracellular stores of GnRH were increased. Since the 24 hour PNX-20 pre-treatment stimulated GnRH protein production, the intracellular stores of GnRH increased, and higher levels of GnRH were released upon stimulation with SNP. GnRH protein biosynthesis induced by PNX-20 could be a result of increased GnRH mrna levels, which was observed, or from post-transcriptional regulatory mechanisms. Mechanisms regulating protein turnover rates, including regulation by mirnas, could account for the changes in GnRH protein levels. The induction of GnRH secretion by PNX was only observed with 1000 nm PNX, a 10 x higher concentration than was required to increase GnRH mrna. Depending on the concentrations of PNX-20 found in the hypothalamus, GnRH secretion might only be induced when PNX-20 levels are elevated. Kisspeptin expression changes across the estrous cycle and peaks before ovulation [213]. Perhaps PNX-20 levels also fluctuate during the estrous cycle and are highest before the GnRH/LH surge. Increased levels of PNX-20 in proestrous would stimulate GnRH secretion in GnRH neurons to help induce the surge. In the original paper describing PNX, GnRH stimulated LH release was only increased with 1000 nm PNX and not 100 nm PNX [3]. It was hypothesized that if PNX sensitizes the pituitary to GnRH by increasing GnRH-R, higher levels of LH will be released from the pituitary and therefore PNX may be helping produce the LH surge [3]. As both GnRH secretion and GnRH-R mrna levels increased with 1000 nm PNX-20 treatment, this higher concentration of PNX may be critical for inducing the GnRH/LH surge. The dose-dependent effects of PNX-20 might be mediated through a biphasic receptor or by differences in the number of receptors on the cell surface. PNX receptor levels may fluctuate during the estrous cycle to cause changes in the cellular responsiveness to PNX. PNX may also be the ligand for more than one receptor. These receptor subtypes could have different affinities for PNX and mediate the activation of separate downstream signalling cascades, such as seen with NPY [345]. Future studies will need to elaborate on the mechanisms through which PNX regulates GnRH mrna, protein, and secretion; however, elucidating a role for PNX in the GnRH neuron has important implications for reproductive physiology. PNX may be 65

79 involved in the initiation of puberty, generation of GnRH pulsatility and regulation of GnRH throughout the female menstrual cycle. As GnRH is the target for extensive reproductive therapies in hormone-dependent diseases and for in vitro fertilization, it is conceivable that PNX or PNX antagonists could be used as an alternative therapy to stimulate or suppress GnRH signalling. 4.3 Regulation of Kisspeptin Neuronal Models by PNX-20 Interestingly, PNX-20 also has a role in the regulation of kisspeptin neurons. Two cell lines micro-dissected from Kiss-GFP mice, representing the Arc and AVPV kiss cell populations, were used to examine the effects of PNX-20 on Kiss-1 gene expression. The mhypoa-kiss/gfp-3 cell line was isolated from the female Arc nucleus, while the mhypoa-kiss/gfp-4 cell line was isolated from the female AVPV. After 24 hours of PNX-20 treatment, Kiss-1 mrna increased 2-fold in both cell lines, suggesting a nonspecific effect on Kiss-1 mrna, regardless of the hypothalamic kisspeptin population. Two adult clonal kisspeptin cell models, the mhypoa-50 (AVPV) and mhypoa-55 (Arc), were used to confirm the effects on Kiss-1 mrna expression. Surprisingly, only the AVPV clonal cell showed increased Kiss-1 mrna expression after PNX treatment. As the clonal lines are representative of only one neuron from the region, it is plausible that only certain subpopulations in the Arc express the PNX receptor and respond to PNX treatment. The mhypoa-55 cell model may represent a neuron that does not express high levels of the PNX receptor while other Arc neurons may have high expression of the PNX receptor, just as only 11 25% of Arc neurons express ERβ [188]. In the mhypoa- 50 model, there was only a 30% increase in Kiss-1 mrna, compared to the 2-fold increase observed in the GFP cell models. As in the Arc, there is heterogeneity between AVPV neurons, with only 21 31% expressing ERβ and 51 68% expressing TH [188]. This heterogeneity could explain why the mhypoa-kiss/gfp-4 cell line was more responsive to PNX-20 then the mhypoa-50 cell line, even though both lines originate from the AVPV. Utilizing a cell model representative of a heterogeneous cell population, instead of a clonal cell model, gives a more accurate representation of the overall activity in this region. Clearly, Arc kisspeptin neurons have a response to PNX; however, this may not be evident with the use of only the mhypoa-55 cell model. These studies also 66

80 highlight the differences between neurons in each population and indicate that we need to further develop our understanding of these subpopulations. Hormonal regulation of kisspeptin neurons is necessary for the control of GnRH neurons [346], and, therefore, PNX-20 may indirectly regulate GnRH neurons by regulating Kiss-1 mrna. Kisspeptin is involved in generating the pre-ovulatory surge in GnRH neurons and for the tonic regulation of GnRH secretion. PNX-20 may stimulate these processes by increasing Kiss-1 mrna expression and likely a concomitant increase in kisspeptin. Since the hypothalamic knockdown of PNX with sirna prolonged the estrous cycle of female cycling rats [3], it could be hypothesized that Kiss-1 or GnRH mrna levels were disrupted. The upregulation of GnRH-R mrna was also specific to female rats [3] and therefore PNX may be primarily involved in the regulation of the female rather than the male reproductive system. A potential role could be in the initiation of the pre-ovulatory surge in female AVPV neurons, as mentioned previously in Section 4.2. The AVPV relays the positive feedback of E 2 to GnRH neurons to generate the LH/GnRH surge [213,258]. The AVPV is a sexually dimorphic region that is larger among female rodents [193,204,210] and Kiss-1 mrna expression is highest right before the surge [210]. By increasing Kiss-1 mrna in the AVPV, PNX-20 may be involved in generating the rise in kisspeptin that induces the GnRH/LH surge (Figure 4.2, detailed explanation in Section 4.4). We can speculate that PNX-20 could also be involved in the GnRH pulse generator. In the Arc, kisspeptin is important for the pulsatile release of GnRH [10]. Reciprocal connections between Arc KNDy neurons and their output to GnRH neurons stimulate pulsatile GnRH release. NKB stimulates reciprocal KNDy neurons while Dyn inhibits them, ultimately influencing the release of kisspeptin to GnRH neurons [261]. PNX-20 may be part of signalling between KNDy neurons, alongside NKB and Dyn, and influence the system by increasing Kiss-1 mrna in reciprocal neurons. Kisspeptin produced by PNX-20 would then stimulate the release of GnRH in the mpoa (Figure 4.3). Future studies should explore how PNX-20 interacts with other Arc kisspeptin neuropeptides, including NKB and Dyn, both which are necessary for the GnRH pulse generator [10]. 67

81 Figure 4.2 Schematic illustration of the positive feedback loop between kisspeptin and PNX to generate the GnRH/LH surge. In this hypothetical model, increasing levels of E 2 during proestrous (late follicular phase in primates) increases kisspeptin in the AVPV. Kisspeptin then stimulates the production of GnRH synthesis and secretion in GnRH neurons. This generates the GnRH surge which increases LH in the anterior pituitary. PNX also stimulates the production and secretion of GnRH in GnRH neurons and increases kisspeptin in the AVPV. Kisspeptin feeds back to PNX neurons and increases the biosynthesis of PNX. Ultimately, this cycle induces the GnRH surge, which stimulates the LH surge in the anterior pituitary. E 2 may also influence PNX, however this still needs further characterization. 68

82 Figure 4.3. Schematic illustration of the proposed role for PNX in the GnRH pulse generator. In this hypothetical model, PNX is released from Arc KNDy axon terminals to other Arc KNDy neurons alongside NKB (stimulatory peptide) and Dyn (inhibitory peptide). PNX stimulates the biosynthesis of kisspeptin and perhaps secretion of kisspeptin from these neurons. The stimulatory and inhibitory actions of this network cause the pulsatile release of kisspeptin onto GnRH neurons in the POA to stimulate pulsatile GnRH secretion. PNX may also be released onto GnRH neurons to help stimulate GnRH secretion. 69

83 The stimulation of kisspeptin by PNX-20 may also be important for initiation of puberty. Kisspeptin neurons are critical for the onset of puberty, as both humans and rodents with GPR54 mutations fail to reach reproductive maturity [183,184]. PNX-20 could induce the distinctive rise in Kiss1 expression before puberty. Currently, the mechanisms initiating pubertal onset are undefined, but as hypothesized by Terasawa et al., the timing of puberty relies more heavily on upstream afferents rather than kisspeptin neurons themselves [245]. These might include NPY or GABA inputs. PNX afferents, in concert with NPY and GABAergic inputs, may help initiate puberty by increasing Kiss-1 mrna expression and kisspeptin release [246,249]. PNX may also be synthesized in kisspeptin neurons, but, similarly to NKB and Dyn [188], may be secreted onto other kisspeptin neurons to increase Kiss-1 mrna expression. Characterization of PNX inputs to kisspeptin neurons will be required to elaborate on this mechanism. PNX-20 increased Kiss-1 mrna after 24 hours but induced GnRH mrna after only 2 hours, indicating multiple downstream effectors are activated upon the stimulation with PNX-20. It could be that multiple transcription factors are stimulated by PNX-20, causing changes to gene expression at different times. As mentioned in Section 4.2, PNX-20 may activate GnRH mrna transcription directly or by increasing mrna stability. Epigenetic modifications also regulate gene expression. These are modifications to the chromatin structure not attributable to the nucleotide sequence alone [347]. Tomikawa et al. recently characterized histone modifications in the Arc and AVPV in response to E 2. E 2 increased histone acetylation of the Kiss-1 promoter in AVPV/PeN while reducing it in the Arc, identifying a possible mechanism behind the dual response of kisspeptin neurons to E 2 [348]. PNX might induce histone acetylation or reduce histone or DNA methylation in kisspeptin neurons to improve the accessibility of the chromatin to TFs, ultimately for increased transcription of Kiss-1 [347]. Alternatively, PNX-20 might act directly on TFs to promote Kiss-1 promoter activity. To date, the promoter for the Kiss-1 gene is not well characterized [347] and further studies must be conducted to identify the TFs and binding sites necessary for the induction of gene expression. Identifying a role for PNX-20 in kisspeptin neurons has significant implications for reproductive physiology. Kisspeptin neurons are important for the regulation of the 70

84 GnRH neuron and necessary for GnRH pulsatility, the GnRH/LH surge and puberty. PNX-20 may be involved in the regulation of these three processes by increasing Kiss-1 mrna. PNX may work in concert or alongside kisspeptin to stimulate GnRH synthesis and secretion. Kisspeptin antagonists are being considered as alternatives to GnRH agonists and antagonists for therapeutics [349]. GnRH agonist and antagonist treatments reduce gonadotropin secretion; however, there is a consequent suppression of gonadal steroids. This reduction in gonadal steroids can have severe side effects including bone loss and hot flushes [349]. Using kisspeptin antagonists, LH pulsatility can be reduced and sex steroids lowered without the complete abrogation of gonadal steroid production [349]. This is beneficial for disorders such as endometriosis and uterine fibroids, where partial reduction of sex steroids can improve the condition of the patient without consequent side effects [349]. As PNX appears to work in concert with kisspeptin, PNX antagonists also hold a similar promise for lowering LH pulsatility, without the negative side-effects. PNX antagonists would also reduce kisspeptin expression ultimately supressing GnRH and LH secretion. Once the role for PNX in GnRH and kisspeptin neurons is more thoroughly characterized, PNX may have potential to improve the outcomes of reproductive disorders. 4.4 Signal Transduction Pathways Activated by PNX-20 Currently the receptor for PNX is unknown; however, because it stimulated an increase in camp in pituitary adenoma cells and many reproductive neuropeptides act through GPCRs, it has been suggested that PNX may also bind to either a G αs, G αi, G α q/11 or G α12/13 coupled receptor [3,292]. Interestingly, pre-treating the mhypoa- GnRH/GFP neurons with PNX-20 for 24 hours abrogated the PNX-20 induced increase in GnRH secretion. Desensitization of GPCRs is an important physiological feedback mechanism that prevents chronic receptor stimulation. It involves the receptor uncoupling from the G protein by phosphorylation, internalization of the receptor, and eventual downregulation of the total cellular concentration of receptors [350]. The PNX-20 pretreatment may have desensitized the neurons to further PNX-20 treatment and caused internalization of the receptors, suggesting the receptor could be a GPCR. Further studies should be performed to elucidate the orphan receptor for PNX. Determining the receptor 71

85 for PNX will help to identify other hypothalamic regions it may stimulate, elucidate further functions for this novel peptide and develop our understanding of its signalling cascades and potential desensitization mechanisms. We measured the phosphorylation of key signalling molecules after PNX-20 treatment to help elucidate the mechanism through which PNX-20 may increase GnRH- R, GnRH, and Kiss-1 mrna expression and GnRH protein secretion. PNX-20 increased the relative levels of pcreb and perk1/2 in the mhypoa-gnrh/gfp cells and pcreb in the mhypoa-kiss/gfp-3 and 4 cell lines after 5 minutes. This suggests there is likely activation of a G αs coupled GPCR leading to the phosphorylation of CREB through the activation of the AC pathway. Cross talk from this pathway may activate the MAPK pathway leading to the phosphorylation of ERK1/2 in GnRH cells. There could also be activation of a G αq/11 in the GnRH cell line leading to the activation of the PLC pathway (Figure 4.4). CREB is a TF, expressed in most hypothalamic neurons and is phosphorylated after PNX-20 treatment. It signals by binding to specific Ca 2+ -camp responsive elements (CRE) in the promoter region of target genes and activates cellular events that alter the intracellular levels of camp or Ca 2+ [351]. The GnRH gene has regions that bind CREB to regulate its transcription [78]. pcreb is elevated by E 2 in GnRH neurons to mediate the negative feedback from the gonads [352]. Interestingly, mice with GnRH neuron specific CREB deletion have disrupted estrous cycles, with particularly long diestrous periods and shortened estrous phases [353]. A similar dysfunction in estrous cyclicity was observed in PNX sirna KO rats, who also had prolonged diestrous periods [3]. If PNX signal transduction relies on the phosphorylation of CREB, CREB KO animals and PNX KO animals may display similar phenotypes. In a theoretical PNX KO model, GnRH gene expression, protein levels and secretion from GnRH neurons would be reduced, which could prevent the GnRH/LH surge and prolong the diestrous phase. Together, these studies suggest PNX-20 may signal through pcreb to increase the activity in GnRH neurons (Figure 4.5). Similarly in kisspeptin cells, CREB may be important for PNX signal transduction. A CREB binding site was located on the Kiss-1 gene for CREB and CREB- 1 regulated transcription co-activator-1 (Crtc1) TFs [354]. Knockdown of Crtc1, a TF 72

86 Figure 4.4. Representative model summarizing the proposed pathways activated by PNX-20. The activation of an orphan GPCR by PNX-20 likely activates a G αs type GPCR leading to the activation of the adenylate cyclase/camp pathway which results in the phosphorylation of CREB. There could also be the activation of a G αq/11 coupled GPCR in the GnRH cell model leading to the activation of the PLC/MAPK pathways and resulting in the phosphorylation of ERK1/2. ERK1/2 may also be phosphorylated by crosstalk from the AC pathway. 73

87 Figure 4.5 Representative model summarizing the proposed mechanisms involved in the regulation of GnRH neuron activity by PNX-20 in mhypoa-gnrh/gfp cell model. The receptor for PNX is hypothesized to be an orphan GPCR. We report that PNX-20 increases the phosphorylation of CREB and ERK1/2, c-fos and GnRH mrna expression, intracellular levels of GnRH, and GnRH secretion.we propose that either the AC or PLC/MAPK pathways are activated by stimulation of the PNX receptor and induce changes in GnRH mrna levels, GnRH protein levels, and GnRH secretion. The orphan GPCR probably activates the AC pathway via a G αs and there is crosstalk to activate the MAPK pathway leading to the phosphorylation of ERK1/2. Dotted line (to be elucidated). 74

88 that binds with CREB to induce or repress gene expression, caused a significant reduction in Kiss-1 mrna expression in mice [354]. In human embryonic kidney HEK cells, expression of a dominant negative CREB inhibitor blocked the forskolin and A23187 induction of a KiSS-1 reporter gene [354]. Chromatin immunoprecipitation assays (ChIPs) confirmed the binding of CREB and Crct1 to the Kiss-1 promoter in GT1-7 cells. The phosphorylation of CREB in both the mhypoa-kiss/gfp-3 and 4 cell models in response to PNX could directly induce the transcription of the Kiss-1 gene through CREB binding elements (Figure 4.6). The increased phosphorylation of CREB in the mhypoa-gnrh/gfp, mhypoa- Kiss/GFP-3 and mhypoa-kiss/gfp-4 cells by PNX-20 suggests that PNX-20 may stimulate a G αs -type GPCR and activate the AC/cAMP pathway. G αs GPCRs activate AC to stimulate the production of camp. camp activates protein kinase A (PKA) and leads to the phosphorylation of CREB. These studies corroborate previous data demonstrating PNX increased camp levels in rat pituitary adenoma cells [288]. Many neuropeptides, including CRH, signal through G αs -type GPCRs to regulate the transcription, translation and secretion of peptides. For example, to induce exocytosis of ACTH, CRH stimulates a G αs GPCR which increases camp, activates PKA and opens L-type Ca 2+ channels to cause an influx of Ca 2+ and the subsequent release of vesicles [355]. A similar mechanism may be responsible for inducing PNX-20 mediated GnRH secretion. Interestingly, a coupling between elevated camp and increased GnRH vesicle release has been established in GT1 neurons [344]. This has been demonstrated with dopamine, noradrenaline and forskalin treatments, all which stimulate the AC pathway [356,357,358]. The rise in intracellular camp opens camp-gated cation channels to stimulate GnRH vesicle release [343,344]. As PNX has previously been shown to increase camp and the current studies suggest the activation of the AC pathway, PNX may also increase GnRH secretion through this same pathway. Interestingly, only 10 nm PNX-20 activated CREB in the GnRH neurons while 100 nm PNX-20 activated CREB in kisspeptin neurons. This suggests GnRH neurons might be more sensitive to PNX; perhaps they have more PNX receptors than kisspeptin neurons, or a second type of receptor with a higher affinity for PNX. However, 100 nm 75

89 Figure 4.6 Representative model summarizing the proposed mechanisms involved in the regulation of kisspeptin neuron activity by PNX-20 in mhypoa-kiss/gfp-3 and -4 cell models. The receptor for PNX is hypothesized to be an orphan GPCR. We report that PNX-20 increases the phosphorylation of CREB and increases Kiss-1 mrna expression. We propose that the AC pathway is activated by stimulation of the PNX receptor. This pathway may induce changes to Kiss-1 mrna expression. Future studies should explore whether PNX-20 increases the secretion of kisspeptin. Dotted line (to be elucidated). 76