Screening for microdeletions in human Y chromosome - AZF candidate genes and male infertility
|
|
- Raymond Hudson
- 5 years ago
- Views:
Transcription
1 J.Cell.Mol.Med. Vol 7, No 1, 2003 pp Screening for microdeletions in human Y chromosome - AZF candidate genes and male infertility Florina Raicu a, L. Popa a, Pompilia Apostol a, D. Cimponeriu a, Letitia Dan a, Elena Ilinca b, Laura Luana Dracea b, B. Marinescu b, L. Gavrila a * a Institute of Genetics, University of Bucharest, Romania b Panait Sarbu Clinical Hospital of Obstetrics and Gynecology - Human Assisted Reproduction Department, Bucharest, Romania Received: September 24, 2002; Accepted: January 14, 2003 Abstract About 30% of couple infertilities are of male origin, some of them caused by genetic abnormalities of the Y chromosome. Deletions in AZF region can cause severe spermatogenic defects ranging from non-obstructive azoospermia to oligospermia. The intracytoplasmatic sperm injection technique (ICSI) is rapidly becoming a versatile procedure for human assisted reproduction in case of male infertility. The use of ICSI allows Y chromosome defects to be passed from father. The goal of our study is to evaluate the frequency of microdeletions in the long arm of Y chromosome, within the AZF regions, in these cases of infertilities, using molecular genetics techniques. Thirty infertile men with azoospermia or oligozoospermia, determined by spermogram, were studied after exclusion of patients with endocrine or obstructive causes of infertility. Peripheral blood DNA was extracted from each patient, then amplified by multiplex PCR with STS genomic markers from the Y chromosome AZF zones. Each case was checked by multiplex PCR through coamplification with the SRY marker. Three men with microdeletions of the long arm of the Y chromosome were diagnosed among the 30 patients, corresponding to a proportion of 10%. The relatively high proportion of microdeletions found in our population suggest the need for strict patient selection to avoid unnecessary screening for long arm Y chromosome microdeletions. The molecular diagnostics was performed according to the current European Academy of Andrology laboratory guidelines for molecular diagnosis of Y chromosomal microdeletions. Keywords: infertility SRY azoospermia microdeletions AZF region Y chromosome Introduction The long arm of the human Y chromosome is required for male fertility [1 6]. Despite the fact that deletions of long arm of the Y chromosome that are associated with spermatogenic failure have been signaled long time ago [7] only in the last few years * Correspondence to: Prof. Dr Lucian GAVRILA Department of Human Genetics, Institute of Genetics, University of Bucharest, 1-3 Portocalelor Street, 76258, sect.6, Bucharest. Tel./Fax: , gavrila@botanic.unibuc.ro these regions have been described at the molecular level [8 13]. Deletion mapping directed the discovery of genes related to spermatogenesis, and defined three regions as the azoospermia factors (AZFa, AZFb and AZFc) mapped to Yq11. These gene families are involved in pathogenic male infertility associated with azoospermia or severe oligozoospermia. AZFa contains two main candidate genes: DFFRY (Drosophila Fat Facets Related Y) and DBY (DEAD
2 box polypeptide Y). The main candidate in AZFb is the RBMY (RNA-binding motif) gene family [14 16] whose expression is restricted to the testis. RBMY consists of approximately 30 copies of genes and pseudogenes found on both arms of the Y chromosome, but it is suggested that functional genes are clustered at the Yq in the AZFb region. The main candidate gene in AZFc is the DAZ (Deleted in AZoospermia) cluster [17 21], a set of genes transcribed in the adult testis and expressed exclusively in germ cells. RBM and DAZ genes families encode RNA binding proteins with similar structures related to hnrnpg family of proteins (heterogenous nuclear ribonucleoproteins) involved in RNA metabolism, including packaging of RNA, transporting to cytoplasm and splicing. The physical size of these regions has been estimated to be 1-3 Mb for AZFa and AZFb and 3 Mb for AZFc. Due the prognostic value of this type of deletions, screening for microdeletions in Y chromosome before assisted reproduction treatment is recommended [22 24]. Infertile men with proximal deletions (AZFa and AZFb regions) show severe defects in spermatogenesis, with high prevalence of Sertoli cell-only syndrome, whereas deletions of distal AZFb and AZFc regions can be compatible with residual spermatogenesis. Approximately % of infertile men have structural changes in the Y chromosome. The sexdetermining region (SRY) of the Y chromosome that controls testis differentiation is intact, but deletions may exist on the long arm of the chromosome (Yq) that result in azoospermia or severe oligozoospermia [25]. Deletions of AZFc regions are the most defined causative factor of spermatogenic failure, with de novo deletions arising in roughly 1 in males. Wide variations in deletion frequency reported in the previous published works could be caused by ethnic differences, different patient selection criteria and, partly, by methodological aspects. The relatively high frequency of de novo Y deletions indicates that the Y chromosome is susceptible to spontaneous loss of genetic material. The instability of the Y chromosome may be related to the high frequency of repetitive elements clustered along the length of the chromosome, and deletions may occur through aberrant recombination events (between areas of homologous or similar sequence repeats between the X and Y chromosomes, or by chromosome unbalanced sister chromatid exchange) or by slippage during DNA replication [26, 27]. It may exist a particular Y chromosome haplotype that promote deletions of the AZF regions [28 30]. Thus, some individuals may be more susceptible to de novo deletions than are others. Advanced paternal age also might promote the loss of Y sequences. The ICSI technique is rapidly becoming an accepted procedure to human assisted reproduction in case of male infertility. ICSI has revolutionized the treatments of males with spermatogenic defects, allowing men who previously would have been unable to have children to achieve biological paternity. When this technique is applied, AZF deleted spermatozoa are capable of fertilizing oocytes and eliciting full developmental potential of new embryo [31]. Vertical transmission of AZF subregion defect to male offspring by ICSI has been reported as Y status, because the infertility problem is transmitted to sons and leads to familiar infertility [32]. Materials and methods Patients Our study was carried out on 30 patients referred to the Human Assisted Reproduction Department - Panait Sarbu Hospital. These 30 infertile men (29-44 yrs., x =31.93yrs.) were azoospermic or oligozoospermic according to semen analyses and following a 2-5 day period of sexual abstinence, according to the World Health Organization (WHO, 1993) guidelines for semen analysis. Light microscopic evaluation of sperm concentration, motility, viability and morphology was performed. Specimens originally considered as azoospermic, were centrifuged (1000 g for 20 min) and the pellet examined for spermatozoa, before confirming azoospermia. Oligozoospermia was defined by a sperm concentration (<20 x 10 6 /ml), asthenozoospermia (by motility, grades A + B, <40%), and teratozoospemia (by normal forms <40%). All cases of azoospemia / oligozoospemia resulting from endocrine or obstructive causes or with a constitutional cytogenetic abnormality were excluded from our study. The semen analyses showed azoospemia (n = 3) or oligozoospermia (n = 27) in 30 men. Among these, 28 had idiopathic infertility (3 azoospermic men and 25 oligozoospermic men), and 2 case of varicocele were also studied, because in these situations, the cause of infertility is 44
3 J.Cell.Mol.Med. Vol 7, No 1, 2003 largely unknown and an associated Y chromosome microdeletion cannot be ruled out. DNA extraction Human genomic DNA was prepared from peripheral blood leukocytes using conventional method as follow: briefly, 2 ml of peripheral blood was collected in EDTA bottles. BLB lysis buffer (3.1 M NH 4 Cl, 0.2 KHCO 3, 20mM EDTA, ph 7.4) was added to whole blood. Following this, 20% sodium dodecyl sulfate and proteinase K were added and then incubated over night, at 37 o C. The resulted proteins were precipitated with 6M NaCl. To precipitate DNA, 2 volumes of 99.5% ethanol was added and then the mixture was washed in 70% ethanol, and dissolved in TE. DNA extracted from each patient was prepared at a concentration of 100 ng/ml DNA. Polymerase chain reaction (PCR) amplifications - sequence tagged sites (STS) The screening method for microdeletions was based on multiplex PCR technology using Y-chromosome specific STSs, published by Vollrath et al. (1992), Foote et al. (1992), Reijo et al. (1995), and Vogt et al. (1996, 2001), which corresponded to the AZFa, b and c regions, respectively. Six previously published Yq STS were used: AZFa prox-2 and AZFa dist-1 (AZFa), sy127, sy134 (AZFb), sy254, sy255 (AZFc) (Fig. 1). In addition, the Yp sy1532 STS within the SRY gene was tested. Specific primers used for each multiplex mix and the expected PCR product lengths are listed in Table 1. The analysis of two STS loci in each region increases diagnostic accuracy, because deletions usually involve more than one STS loci. Genomic DNA (2µl) was added to a mixture of 100 mm Tris-CI (ph 8.3), 500 mm KCI, 15 mm MgCI 2, 200 mm of dntp mix, 0.5 mm of each primer pair, 0.2 µl (2 IU) AmphTaq DNA polymerase (Hoffman La Roche) and adjusted to a final volume of 12.5 µl. The PCRs were performed in a Techne Progene Thermocycler according to the following programs for all the STS markers (except syprox-2 and sydist 1): 35 cycles at 94 o C for 30 sec, 58 o C for 30 sec, and 72 o C for 30 sec. The programs were preceded by a 15-min denaturing step at 94 o C and followed by a final extension step at 72 o C for 7 min. Multiplex PCRs of both syprox 2 and sydist 1 consisted of 35 cycles at 94 o C for1 min., annealing for 1 min. 63 o C (AZFa prox - 2 ) and for 1 min at 57 o C (AZFa dist1), with subsequent polymerization for 1 min. at 65 o C for both mixes and a final autoextension step for 2 min at 65 o C. PCR controls Negative controls were used for every PCR: one sample without DNA and one sample of female genomic DNA. The STS sy1532 was used to prove the presence of Y specific DNA in order to exclude failure of amplification by PCR (to avoid false negative results). Analysis The PCR products (10.5µl) were subjected to electrophoresis on 3 % agarose, stained with ethidium bromide Fig. 1 Schematic representation of Y chromosome deletion found in this study compared to a normal male control (N). The positions of the STS used to screen AZF a, b and c are shown. Solid bars indicate presence of a STS and hatched bars indicate absence of a STS. 45
4 and visualized by exposure to ultraviolet light. As a length marker were used Sigma 100 pb DNA ladder. A patient sample was considered positive for the STS marker tested when the PCR product of the expected size was present, and was considered negative if a product of the expected size was not obtained after 3 PCR attempts. Each failure of multiplex amplification was checked by subsequent PCR analyses using single primer pairs and repeated 3 times with appropriate positive and negative controls to confirm the absence of each STS. When confirmed, coamplification of the missing STS and sy1532 was performed. Results and discussion PCR is a very sensitive technique to detect constitutional Yq microdeletions. The primer set was fruitfully used by different laboratories in detection of over 90% deletions in three major AZF regions. Guidelines for diagnostic testing region, according to European Academy of Andrology [33] and most recent works [34], include these STS primers as the first choice. A total of 30 men were screened for submicroscopic Y-chromosome deletions (see Table 2 for the Table 2. Sperm counts for patients (n=30). Sperm counts Subjects without deletions Subjects with deletions azoospermy 2 1 (INF 1) < 1 x 10 6 / ml 6 2 (INF 19, 24) 1-10 x 10 6 / ml 19 sperm count). Deletions in the Y chromosome were detected and confirmed with PCR-based analysis for 3 out of the 30 infertile patients, corresponding to a proportion of 10%. The relatively high proportion of microdeletions found in our population of 30 infertile men suggest the need for strict patient selection to avoid unnecessary screening for long arm Y chromosome microdeletions. The observed deletions and the markers involved are schematically shown in Fig. 1. All patients (referred to as patients INF 1, INF 19, INF 24) had interstitial deletions that could not be detected with classical cytogenetic analysis: 1 of these men has severe oligozoospermia and 2 were azoospermic. Patients INF1 and INF 19 presented a large deletion of Yq (Fig. 2). According to the literature, the prevalence of Y chromosome microdele- Table 1. Y-DNA markers (sequence - tagged sites, STS) their length and their location. Y DNA marker (STS) Sequence PCR product length (pb) Gene or locus AZFa prox - 2 AZFa dist - 1 SY 127 sy134 sy 254 sy 255 sy1532 F: GGT.TCC.TGA.ACA.GGG.GAC.T R: GGC.AGC.AGA.AGG.GCC.TCT.C F: GGT.TCC.TGA.ACA.GGG.GAC.T R: GGC.AGC.AGA.AGG.GCC.TCT.C F:GGC.TCA.CAA.ACG.AAA.AGA.AA R:CTG.CAG.GCA.GTA.ATA.AGG.GA F:ACC.ACT.GCC.AAA.ACT.TTC.AA R:GTC.TGC.CTC.ACC.ATA.AAA.CG F:GGG.TGT.TAC.CAG.AAG.GCA.AA R:GAA.CCG.TAT.CTA.CCA.AAG.CAG.C F:GTT.ACA.GGA.TTC.GGC.GTG.AT R: CTC.GTC.ATG.TGC.AGC.CAC F: TCCTTAGCAACCATTAATCTGG R:AAATAGCAAAAAATGACACAAGGC 220 pb AZFa 390 pb AZFa 274 pb AZFb 301 pb AZFb 350 pb AZFc (DAZ) 126 pb AZFc (DAZ) 167 pb SRY 46
5 J.Cell.Mol.Med. Vol 7, No 1, 2003 Fig. 2 Example of Multiplex PCR: lane M length marker Sigma 100 pb DNA ladder, lane B sample without DNA, lane 3,6,12 AZFc deleted patients. sy pb, sy pb, sy pb. tions in infertile men ranges from 3% [13], 8% [22], 13% [18] to 55% [39]. This variations is probably mainly due to the selection criteria of the patients. If the whole of 30 patients who were studied is considered, the proportion of men with microdeletions falls to 10%, within the range of the published data between 3 55 %. Acknowledgments This work was supported by Institute of Genetics, University of Bucharest, Romania. The authors like to thank especially to clinical staff of Human Assisted Reproduction Department Panait Sarbu Hospital of Bucharest, for our fertile and harmonious cooperation. Conclusions Infertile men with severe spermatogenic failure are at risk for Y chromosome deletions. It is generally believed that men with severe male infertility should be screened for Yq microdeletions as a part of their pretreatment investigations [35]. If Y chromosome testing is offered to these men and a deletion is observed, the most considerative prediction is that the deletion can be passed from father to son. The most likely outcome is that the son will be infertile since no deletions have been shown to occur in normally fertile men but the degree of severity of the spermatogenic defect the son will display cannot be predicted reliably at this time [36 38 ]. Our knowledge of the molecular genetics of human fertility is expanding rapidly. The study of Yq microdeletions will help in the development of better diagnostic methods and the expansion of the current knowledge of spermatogenesis. Diagnostic and therapeutic approaches in reproductive medicine have to keep pace with rapidly developing molecular knowledge of human reproduction; there is an urgent need to implement the increasing molecular knowledge in clinical practice. References 1. Affara N., The role of the Y chromosome in male infertility, Expert Rev. Mol. Med., Cambridge University Press, Cambridge, 2001, 2. Elliott D.J., Cooke H.J., The molecular genetics of male infertility, Bioassays, 19: , Foote S., The human Y chromosome: overlapping DNA clones spanning the euchromatic region, Science, 258:60-66, Foresta C., Y-chromosome deletions in idiopathic severe testiculopathies, J. Clin. Endocrinol. Metab., 82: , Okabe M., Ikawa M., Ashkenas J., Male infertility and the genetics of spermatogenesis, Am. J. Hum. Genet., 62: , Pryor J.L., Microdeletions in the Y chromosome of infertile men, N. Engl. J. Med., 336: , Tiepolo L., Zuffardi O., Localization of factors controlling spermatogenesis in the nonfluorescent portion of the human Y chromosome long arm, Hum. Genet., 34: , Kostiner D., Male infertility: analysis of the markers and genes on the human Y chromosome, Hum. Reprod., 13: , Lahn B.T., Page D.C., Functional coherence of the human Y chromosome, Science, 278: , Kent-First M., Defining regions of the Y-chromosome responsible for male infertility and identification of a fourth AZF region (AZFd) by Y-chromosome microdeletion detection, Mol. Reprod. Dev., 53:27-41,
6 11. Vergnaud G., Page D.C., Simmler M.C., A deletion map of the human Y chromosome based on DNA hybridization, Am. J. Hum. Genet., 258:52-59, Vogt P.H., Microdeletions in interval 6 of the Y chromosome of males with idiopathic sterility point to disruption of AZF, a human spermatogenesis gene, Hum. Genet., 89: , Vogt P.H., Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11, Hum. Mol. Genet., 5: , Ma K., A Y chromosome gene family with RNA-binding protein homology: candidates for the azoospermia factor AZF controlling human spermatogenesis, Cell, 75: , Elliott D.J, Expression of RBM in the nuclei of human germ cells is dependent on a critical region of the Y chromosome long arm, Proc. Natl. Acad. Sci. USA, 94: , Venables J.P., The roles of RNA-binding proteins in spermatogenesis and infertility, C.O. Genetics & Dev., 9: , Saxena R., The DAZ gene cluster on the human Y chromosome arose from an autosomal gene that was transposed, repeatedly amplified and pruned, Nat. Genet., 14: , Reijo R., Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNAbinding protein gene, Nat. Genet., 10: , Yen P.H., Chai N.N. and Salido E.C., The human DAZ genes, a putative male infertility factor on the Y chromosome, are highly polymorphic in the DAZ repeat regions, Mamm. Genome, 8: , Kawaguchi T.K., H. Skaletsky, L. Brown, P.J. Minx, H.S. Cordum, R.H. Waterston, R.K.Wilson, S. Silber, R.Oates, S. Rozen, D.C. Page, The AZFc region of the y chromosome features massive palindrome s and uniform reccurrent deletions in infertile men, Nat. Genet., 29: , Page D.C., Expression of DAZ, an azoospermia factor candidate, in human spermatogonia, Am. J. Hum. Genet., 60: , Qureshi S.J., Polymerase chain reaction screening for Y chromosome microdeletions: a first step towards the diagnosis of genetically-determined spermatogenic failure in men. Mol. Hum. Reprod, 2: , Seifer J., Screening for microdeletions on the long arm of chromosome Y in 53 infertile man, Intl J. Androl., 22: , Simoni M., Screening for deletions of the Y chromosome involving the DAZ (Deleted in AZoospermia) gene in azoospermia and severe oligozoospermia, Fertil. Steril., 67: , Brenner S., Miller J.H., Encyclopedia of Genetics, Academic Press, San Diego, 2002, vol. 2, pp McElreavey K., Kraus C., Male infertility and the Y chromosome, Am.J. Hum. Genet., 64: , Vogt P.H., Human chromosome deletions in Yq11, AZF candidate genes and male infertility: history and update, Mol. Hum. Reprod., 4: , Paracchini S., Stupia L., Gotta V., Palka G., Moro E., Foresta C., Mengua L., Oliva R., Ballesca J. L., Kremer J.A.M., van Golde R.J.T., Tuerlings J.H.A.M., Hargreave T., Ross A., Cooke H., Huellen K., Vogt P.H., and C. Tyler- Smith, Y-chromosomal DNA haplotypes in infertile european males caring y microdeletions, J. Endocrinol. Invest., 23: , Kraus C., L. Quintana-Murci, E. Rajpert-De Meyts, Jorgensen N., Jobling M.A., Rosser Z.H., Skakkeboek N.E. and McElreavey K., Identification of a Y chromosome haplogroup associated with reduced sperm counts, Hum. Mol. Genet., 10: , Shen P., Wang F., Underhill P.A., Franco C., Yang W., Roxas A., Sung R., Lin A., Hyman R.W., Vollrath D., Davis R.W., Luca-Cavalli-Sforza L., Population genetic implications from sequence variation in four Y chromosome genes, Proc. Natl. Acad. Sci. USA, 97: , Mulhall J.P., Reijo R., Alagappan R., Brown L., Page D.C., Carson R. and Oates R.D., Azoospermic men with deletion of the DAZ gene cluster are capable of completing spermatogenesis: fertilization, normal embryonic development and pregnancy occur when retrieved testicular spermatozoa are used for intracytoplasmic sperm injection, Hum. Reprod., 12: , Page D.C., Sherman S. and Brown L., Men with infertility caused by AZFc deletion can produce sons by intracytoplasmic sperm injection, but are likely to transmit the deletion and infertility, Hum. Reprod., 14: , Simoni M., Bakker E., Eurlings M.C.M., Matthiijs G., Moro E., Muller C.R., Vogt P.H., Laboratory guidelines for molecular diagnosis of Y-chromosomal microdeletions, European Molecular Genetics Quality Network (EMQN), 2000, Kamp C., Huellen K., Fernandes S., Sousa M., Schlegel P.N., Mielnik A., Kleiman S., Yavetz H., Krause W., Kuprek W., Johannisson R., SchulzeW., Weidner W., Barros A., Vogt P.H., High deletion frequency of the complete AZFa sequence in men with Sertoli-cell-only syndrome, Mol. Hum. Reprod., 7: , Simoni M., Kamischke A., Nieschlag E., Current status of the molecular diagnosis of Y-chromosomal microdeletions in the work-up of male infertility, Hum. Reprod., 13: , Ken-First M., Kols S., Muallen A., The incidence and possible relevance of Y-linked microdeletions in babies born after intracytoplasmic sperm injection and their fathers, Mol. Hum. Reprod., 2: , Kamischke, Gromoll J., Simoni M., Behre H.M., Nieschelag E., Transmission of a y chromosomal deletion involving the deleted in azoospermia (DAZ) and chromatin (CDY 1) genes from father to son through intracytoplasmic sperm injection, Hum. Reprod., 14: , Edwards R.G., Bishop C.E., On the origin and frequency of Y chromosome deletions responsible for severe male infertility, Molec. Hum. Reprod., 3: , Foresta C., Ferlin A., Garolla A., Moro A., Pistorello M., Barbaux S., Rossato M., High frequency of well-defined Y- chromosome deletions in idiopathic Sertoli-cell only syndrome, Hum. Reprod., 13: ,
Molecular screening for Yq microdeletion in men with idiopathic oligozoospermia and azoospermia
Molecular screening for Yq microdeletion in men with idiopathic oligozoospermia and azoospermia RIMA DADA, N P GUPTA* and K KUCHERIA Department of Anatomy and *Department of Urology, All India Institute
More informationThe frequency of Yq microdeletion in azoospermic and oligospermic Iranian infertile men
Iran J Reprod Med Vol. 11. No. 6. pp: 453-458, June 2013 Original article The frequency of Yq microdeletion in azoospermic and oligospermic Iranian infertile men Mohammad Ali Zaimy 1, 2 M.Sc., Seyyed Mehdi
More informationY Chromosome Microdeletions and Alterations of Spermatogenesis*
0163-769X/01/$03.00/0 Endocrine Reviews 22(2): 226 239 Copyright 2001 by The Endocrine Society Printed in U.S.A. Y Chromosome Microdeletions and Alterations of Spermatogenesis* CARLO FORESTA, ENRICO MORO,
More informationAZOOSPERMIA Chromosome Y
AZOOSPERMIA Chromosome Y M i c r o d e l e t i o n Ref.: PI EDP003024-40 testspi EDP002024 1. INTRODUCTION In 1976, Tiepolo and Zuffardi reported de novo, microscopically detectable deletions of the distal
More informationAnalysis of Yq microdeletions in infertile males by PCR and DNA hybridization techniques
Molecular Human Reproduction vol.4 no.12 pp. 1116 1121, 1998 Analysis of Yq microdeletions in infertile males by PCR and DNA hybridization techniques Paola Grimaldi 1, Claudia Scarponi 1, Pellegrino Rossi
More informationAZF, SRY Microdeletions and Hormonal Disturbances among Azoospermic Iraqi men
92 Moyet Al-Faisal et al. IJPS Vol. 6, No.2, May-Aug 2010 Original Article AZF, SRY Microdeletions and Hormonal Disturbances among Azoospermic Iraqi men Abdul Hussein Moyet Al-Faisal 1*, Ali Fadel Alnajar
More informationHuman chromosome deletions in Yq11, AZF candidate genes and male infertility: history and update
Molecular Human Reproduction vol.4 no.8 pp. 739 744, 1998 Human chromosome deletions in Yq11, AZF candidate genes and male infertility: history and update Peter H.Vogt Reproduction Genetics in Institute
More informationTHE Y-CHROMOSOME : Genetics of Male Infertility
THE Y-CHROMOSOME : Genetics of Male Infertility Greeshma Gopalan***, Sadia Tabassum Khan**, Ketki Sharma** & Aparna Sarkar * *** Tutor at Physiology Department, Rama Medical College, Hapur, Ghaziabad.;**M.Sc
More informationREVIEW The Y chromosome and male fertility and infertility 1
international journal of andrology, 26:70 75 (2003) REVIEW The Y chromosome and male fertility and infertility 1 CSILLA KRAUSZ,* G. FORTI* and KEN MCELREAVEY *Andrology Unit, Department of Clinical Physiopathology,
More informationCitation for published version (APA): Lutke Holzik, M. F. (2007). Genetic predisposition to testicular cancer s.n.
University of Groningen Genetic predisposition to testicular cancer Lutke Holzik, Martijn Frederik IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite
More informationInhibin B plasma concentrations in infertile patients with DAZ gene deletions treated with FSH
European Journal of Endocrinology (2002) 146 801 806 ISSN 0804-4643 CLINICAL STUDY Inhibin B plasma concentrations in infertile patients with DAZ gene deletions treated with FSH Carlo Foresta, Andrea Bettella,
More informationScreening for microdeletions of Y chromosome genes in patients undergoing intracytoplasmic sperm injection
Human Reproduction vol.14 no.7 pp.1717 1721, 1999 Screening for microdeletions of Y chromosome genes in patients undergoing intracytoplasmic sperm injection C.Krausz 1,3,4, C.Bussani-Mastellone 2, S.Granchi
More informationY chromosome microdeletion in a father and his four infertile sons
Human Reproduction vol.14 no.11 pp.2689 2694, 1999 OUTSTANDING CONTRIBUTION Y chromosome microdeletion in a father and his four infertile sons Peter L.Chang, Mark V.Sauer 1 and Stephen Brown of the Y chromosome
More informationMATERIALS AND METHODS
www.kjurology.org http://dx.doi.org/1.4111/kju.213.54.2.111 Male Infertility Detection of Y Chromosome Microdeletion is Valuable in the Treatment of Patients With Nonobstructive Azoospermia and Oligoasthenoteratozoospermia:
More informationDetection of the Microdeletions on Yq Chromosome in Egyptian Population with Idiopathic Male Infertility
Detection of the Microdeletions on Yq Chromosome in Egyptian Population with Idiopathic Male Infertility Hesham Saeed * 1,2 Hesham Neamattallah 1, Taha Zaghloul 1, Khali Elmolla 3 and Amal Moustafa 4 1
More informationArticle Genetic association between AZF region polymorphism and Klinefelter syndrome
RBMOnline - Vol 19. No 4. 2009 547 551 Reproductive BioMedicine Online; www.rbmonline.com/article/3741 on web 21 August 2009 Article Genetic association between AZF region polymorphism and Klinefelter
More informationGenetic evaluation of infertile men
Human Reproduction vol.14 no.1 pp.33 38, 1999 Genetic evaluation of infertile men S.E.Kleiman 1, L.Yogev, R.Gamzu, R.Hauser, A.Botchan, J.B.Lessing, G.Paz and H.Yavetz Institute for the Study of Fertility,
More informationGenetics Aspects of Male infertility
Genetics Aspects of Male infertility A. Ebrahimi, Molecular Genetic SM Kalantar, Prof. Molecular Cytogenetic Research & Clinical Centre for Infertility, Reproductive & Genetic Unit, Yazd Medical Sciences
More informationUniform deletion junctions of complete azoospermia factor region c deletion in infertile men in Taiwan
DOI: 10.1111/j.1745-7262.2006.00109.x. Original Article. Uniform deletion junctions of complete azoospermia factor region c deletion in infertile men in Taiwan Chao-Chin Hsu 1, Pao-Lin Kuo 2, Louise Chuang
More informationS.J.Qureshi 1, A.R.Ross 1, K.Ma 1, H.J.Cooke 1, M.A.M c lntyre 2, A.C.Chandley 1 and T.B.Hargreave Introduction
Molecular Human Reproduction vol. no. pp. 775779, 1996 Polymerase chain reaction screening for Y chromosome microdeletions: a first step towards the diagnosis of geneticallydetermined spermatogenic failure
More informationReduced copy number of DAZ genes in subfertile and infertile men
MALE FACTOR FERTILITY AND STERILITY VOL. 77, NO. 1, JANUARY 2002 Copyright 2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Reduced
More informationMale infertility: analysis of the markers and genes on the human Y chromosome
Human Reproduction vol.13 no.11 pp.3032 3038, 1998 Male infertility: analysis of the markers and genes on the human Y chromosome Dana R.Kostiner 1, Paul J.Turek 2 and Renee A.Reijo 1,2,3,4 1 Department
More informationRoutine screening for classical azoospermia factor deletions of the Y chromosome in azoospermic patients with Klinefelter syndrome
Asian J Androl 2007; 9 (6): 815 820 DOI: 10.1111/j.1745-7262.2007.00315.x www.asiaandro.com. Original Article. Routine screening for classical azoospermia factor deletions of the Y chromosome in azoospermic
More informationY chromosome microdeletions in Brazilian fertility clinic patients
Y chromosome microdeletions in Brazilian fertility clinic patients J.T. Arruda 1, B.M. Bordin 1, P.R. Santos 1, W.E.J.C. Mesquita 1, R.C.P.C. Silva 2, M.C.S. Maia 2, M.S. Approbato 2, R.S. Florêncio 2,
More informationPDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/24403
More informationCytogenetic and Y Chromosome Microdeletions Screening in Tunisian Infertile Men
Donnish Journal of Genetics and Molecular Biology Vol 1(1) pp. 001-005 October, 2015. http:///djgmb Copyright 2015 Donnish Journals Original Research Article Cytogenetic and Y Chromosome Microdeletions
More informationLoss of the AZFc region due to a human Y-chromosome microdeletion in infertile male patients
Loss of the AZFc region due to a human Y-chromosome microdeletion in infertile male patients L.K. Pandey 2, S. Pandey 2, J. Gupta 1 and A.K. Saxena 1 1 Human Cytogenetic and Molecular Genetic Laboratory,
More informationMicrodeletion of Y chromosome and Their High Impact on Male Infertility
Commentary Microdeletion of Y chromosome and Their High Impact on Male Infertility INTRODUCTION Male infertility is a multifactorial genetic disorder. WHO defined infertility as an inability to conceive
More informationRECENTLY, CONSIDERABLE attention has focused on
0021-972X/01/$03.00/0 Vol. 86, No. 6 The Journal of Clinical Endocrinology & Metabolism Printed in U.S.A. Copyright 2001 by The Endocrine Society Double-Blind Y Chromosome Microdeletion Analysis in Men
More informationYq MICRODELETIONS IN IDIOPATHIC MALE INFERTILITY
Original Research Article Yq MICRODELETIONS IN IDIOPATHIC MALE INFERTILITY Dinesh Kumar. V * 1, Swetasmita Mishra 2, Rima Dada 2. ABSTRACT International Journal of Anatomy and Research, Int J Anat Res
More informationcyndazla: a cynomolgus monkey homologue of the human autosomal DAZ gene*
Molecular Human Reproduction vol.3 no.6 pp. 479 483, 1997 cyndazla: a cynomolgus monkey homologue of the human autosomal DAZ gene* Cesare Carani 1,Jörg Gromoll 2, Martin H.Brinkworth 2, Manuela Simoni
More informationCytogenetic and Y chromosome microdeletion screening of a random group of infertile males
FERTILITY AND STERILITY VOL. 79, NO. 2, FEBRUARY 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Cytogenetic and Y
More informationGenetic Factors in Male Infertility and their Implications
Kamla-Raj 2006 Int J Hum Genet, 6(2): 163-169 (2006) Genetic Factors in Male Infertility and their Implications Arvind Rup Singh, Radek Vrtel, Radek Vodicka, Ishraq Dhaifalah, David Konvalinka and Jiri
More informationQuadruplex real-time polymerase chain reaction assay for molecular diagnosis of Y-chromosomal microdeletions
Quadruplex real-time polymerase chain reaction assay for molecular diagnosis of Y-chromosomal microdeletions Qiwei Guo, M.S., a Fenghua Lan, M.D., b Liangpu Xu, B.S., c Yu Jiang, M.S., a Li Xiao, M.S.,
More informationPrevalence and patterns of Y chromosome microdeletion in infertile men with azoospermia and oligzoospermia in Northeast China
Iran J Reprod Med Vol. 12. No. 6. pp: 383-388, June 2014 Original article Prevalence and patterns of Y chromosome microdeletion in infertile men with azoospermia and oligzoospermia in Northeast China Fadlalla
More informationLaboratory guidelines for molecular diagnosis of Y-chromosomal microdeletions
international journal of andrology, 22:292±299 (1999) Laboratory guidelines for molecular diagnosis of Y-chromosomal microdeletions M. SIMONI, 1 E. BAKKER, 2 M. C. M. EURLINGS, 2 G. MATTHIJS, 3 E. MORO,
More informationY chromosome microdeletions are not associated with spontaneous recurrent pregnancy loss in a Sinhalese population in Sri Lanka
Human Reproduction, Vol.25, No.12 pp. 3152 3156, 2010 Advanced Access publication on October 13, 2010 doi:10.1093/humrep/deq271 ORIGINAL ARTICLE Reproductive genetics Y chromosome microdeletions are not
More informationAsian J Androl 2006; 8 (1): DOI: /j x
Asian J Androl 2006; 8 (1): 39 44 DOI: 10.1111/j.1745-7262.2006.00100.x. Original Article. Y-chromosomal microdeletions and partial deletions of the Azoospermia Factor c (AZFc) region in normozoospermic,
More informationMale infertility in Northeast China: molecular detection of Y chromosome microdeletions in azoospermic patients with Klinefelter s syndrome
Male infertility in Northeast China: molecular detection of Y chromosome microdeletions in azoospermic patients with Klinefelter s syndrome H.-G. Zhang, Z.-B. Zhang, R.-X. Wang, Y. Yu, X.-W. Yu, E. Fadlalla
More informationAbout 15% of couples are infertile because of several
Journal of Andrology, Vol. 24, No. 4, July/August 2003 Copyright American Society of Andrology Y Chromosome Deletions in Azoospermic Men in India KUMARASAMY THANGARAJ, NALINI J. GUPTA, KADUPU PAVANI, ALLA
More informationY-Chromosome Haplotypes in Azoospermic Israeli Men
Y-Chromosome Haplotypes in Azoospermic Israeli Men C.M.B. CARVALHO,I* J.L. ROCHA,' 3 * ER. SANTOS. 2 S.E. KLEIMAN,4 G. PAZ, 4 H. YAVETZ, 4 AND S.D.J. PENA 1, 3 Abstract Among azoospermic and severely oligozoospermic
More informationSEX CHROMOSOME GENETICS 99 Male Infertility and the Y Chromosome
Am. J. Hum. Genet. 64:928 933, 1999 SEX CHROMOSOME GENETICS 99 Male Infertility and the Y Chromosome Ken McElreavey 1 and Csilla Krausz 1,2 1 Immunogénétique Humaine, Institut Pasteur, Paris; and 2 Andrology
More informationThe New England Journal of Medicine MICRODELETIONS IN THE Y CHROMOSOME OF INFERTILE MEN. Study Subjects
MICRODELETIONS IN THE Y CHROMOSOME OF INFERTILE MEN JON L. PRYOR, M.D., MARIJO KENT-FIRST, PH.D., ARIEGE MUALLEM, B.S., ANDREW H. VAN BERGEN, B.S., WOLFRAM E. NOLTEN, M.D., LORRAINE MEISNER, PH.D., AND
More informationSALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A
SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes
More informationMolecular Biology Research Communications 2016; 5(4):
Molecular Biology Research Communications 2016; 5(4):247-255 Original Article Open Access Partial and complete microdeletions of Y chromosome in infertile males from South of Iran Raheleh Masoudi *, Liusa
More informationSymposium: Genetic aspects of male (in)fertility
RBMOnline - Vol 10. No 1. 2005 81-93 Reproductive BioMedicine Online; www.rbmonline.com/article/1506 on web 23 November 2004 Symposium: Genetic aspects of male (in)fertility Azoospermia factor (AZF) in
More informationDeletion of azoospermia factor a (AZFa) regionof human Y chromosome caused by recombination between HERV15 proviruses
2000 Oxford University Press Human Molecular Genetics, 2000, Vol. 9, No. 15 2291 2296 Deletion of azoospermia factor a (AZFa) regionof human Y chromosome caused by recombination between HERV15 proviruses
More informationA Journey on Y Chromosomal Genes and Male Infertility
Kamla-Raj 0 Int J Hum Genet, (4): 03-5 (0) A Journey on Y Chromosomal Genes and Male Infertility V.S. Vineeth and Suttur S. Malini Human Genetics Laboratory, Department of Studies in Zoology, University
More informationY-chromosome AZFc structural architecture and relationship to male fertility
Y-chromosome AZFc structural architecture and relationship to male fertility Celia Ravel, M.D., Ph.D., a,b,c Sandra Chantot-Bastaraud, M.D., Ph.D., a,b,d Brahim El Houate, Ph.D., e Hassan Rouba, Ph.D.,
More informationY-chromosome microdeletions and recurrent pregnancy loss
RECURRENT PREGNANCY LOSS Y-chromosome microdeletions and recurrent pregnancy loss Sheri Dewan, M.S., a Elizabeth E. Puscheck, M.D., b Carolyn B. Coulam, M.D., c Alexander J. Wilcox, B.S., d and Rajasingam
More informationY Choromosomal Microdeletion Screening in The Workup of Male Infertility and Its Current Status in India
Review Article Y Choromosomal Microdeletion Screening in The Workup of Male Infertility and Its Current Status in India Ramaswamy Suganthi, Ph.D. 1 *, Vijayabhavanath Vijayakumaran Vijesh, M.Sc. 1, Nambiar
More informationAsian J Androl 2006; 8 (2): DOI: /j x
Asian J Androl 2006; 8 (2): 213 218 DOI: 10.1111/j.1745-7262.2006.00107.x. Original Article. Associations of homologous RNA-binding motif gene on the X chromosome (RBMX) and its like sequence on chromosome
More informationA family of human Y chromosomes has dispersed throughout northern Eurasia despite a 1.8-Mb deletion in the azoospermia factor c region
Genomics 83 (2004) 1046 1052 www.elsevier.com/locate/ygeno A family of human Y chromosomes has dispersed throughout northern Eurasia despite a 1.8-Mb deletion in the azoospermia factor c region Sjoerd
More informationCitation for published version (APA): Noordam, M. J. (2012). The human Y chromosome: a sole survivor Oisterwijk: Boxpress
UvA-DARE (Digital Academic Repository) The human Y chromosome: a sole survivor Noordam, M.J. Link to publication Citation for published version (APA): Noordam, M. J. (2012). The human Y chromosome: a sole
More informationRobert D.Oates 1,4, Sherman Silber 2,4, Laura G.Brown 3 and David C.Page 3
Human Reproduction Vol.17, No.11 pp. 2813 2824, 2002 Clinical characterization of 42 oligospermic or azoospermic men with microdeletion of the AZFc region of the Y chromosome, and of 18 children conceived
More informationGENETICS OF MALE INFERTILITY: EVOLUTION OF THE X AND Y CHROMOSOME AND TRANSMISSION OF MALE INFERTILITY TO FUTURE GENERATIONS
GENETICS OF MALE INFERTILITY: EVOLUTION OF THE X AND Y CHROMOSOME AND TRANSMISSION OF MALE INFERTILITY TO FUTURE GENERATIONS Sherman J. Silber, M.D.* Infertility Center of St. Louis St. Luke's Hospital
More information202002, India Author affiliations
Copy number variation and microdeletions of the Y chromosome linked genes and loci across different categories of Indian infertile males Anju Kumari 1, Sandeep Kumar Yadav 1, M.M. Misro 2, Jamal Ahmad
More informationTransmission of male infertility to future generations: lessons from the Y chromosome*
Human Reproduction Update, Vol.8, No.3 pp. 217±229, 2002 Transmission of male infertility to future generations: lessons from the Y chromosome* Sherman J.Silber 1,3 and Sjoerd Repping 2 1 Infertility Center
More informationResults of ICSI in severe oligozoospermic and azoospermic patients with AZF microdeletions
Iranian Journal of Reproductive Medicine Vol.7. No.2. pp: 79-84, Spring 2009 Results of ICSI in severe oligozoospermic and azoospermic patients with AZF microdeletions Sevtap Kilic 1 M.D., Ph.D., Beril
More informationASCERTAINING THE GENETIC STATUS OF THE CHROMIUM EXPOSED HUMAN Y CHROMOSOME
ASCERTAINING THE GENETIC STATUS OF THE CHROMIUM EXPOSED HUMAN Y CHROMOSOME 1 Safdar Ali, 2 Sudhir Kumar, 3 Sher Ali 1,2,3 Molecular Genetics Laboratory National Institute of Immunology, Aruna Asaf Ali
More informationDeletions of the distal euchromatic region of the Y chromosome
Spermatogenesis in a Man with Complete Deletion of USP9Y lice Luddi, Ph.D., Maria Margollicci, Ph.D., Laura Gambera, Ph.D., Francesca Serafini, Ph.D., Maddalena Cioni, M.D., Vincenzo De Leo, M.D., Paolo
More informationSomatic cytogenetic and azoospermia factor gene microdeletion studies in infertile men
Brazilian Journal of Medical and Biological Research (2006) 39: 555-561 Cytogenetic and Y microdeletion studies of infertile men ISSN 0100-879X 555 Somatic cytogenetic and azoospermia factor gene microdeletion
More informationCDY1 and BOULE transcripts assessed in the same biopsy as predictive markers for successful testicular sperm retrieval
CDY1 and BOULE transcripts assessed in the same biopsy as predictive markers for successful testicular sperm retrieval Sandra E. Kleiman, Ph.D., Ofer Lehavi, M.D., Ron Hauser, M.D., Amnon Botchan, M.D.,
More informationY Chromosome Microdeletions in Pakistani Infertile Men
Open Access Fu l l L en gt h A r t i cl e ORIGINAL ART ICLE Y Chromosome Microdeletions in Pakistani Infertile Men Atif Mahmood 1, Syeda Nuzhat Nawab 2, Saima Ejaz 3, Masood Anwar Qureshi 4, Fauzia Imtiaz
More informationMODULE NO.14: Y-Chromosome Testing
SUBJECT Paper No. and Title Module No. and Title Module Tag FORENSIC SIENCE PAPER No.13: DNA Forensics MODULE No.21: Y-Chromosome Testing FSC_P13_M21 TABLE OF CONTENTS 1. Learning Outcome 2. Introduction:
More informationCorrelation between chromosomal polymorphisms and male infertility in a Northeast Chinese population
Correlation between chromosomal polymorphisms and male infertility in a Northeast Chinese population L.L. Li 1, D. Peng 1, R.X. Wang 1, H.B. Zhu 1, W.J. Wang 2 and R.Z. Liu 1 1 Center for Reproductive
More informationHuman Y-chromosome variation and male dysfunction
63 REVIEW Human Y-chromosome variation and male dysfunction Cláudia Márcia Benedetto de Carvalho 1,2 and Fabrício Rodrigues Santos 2* 1 Departamento de Bioquímica e Imunologia, and 2 Departamento de Biologia
More informationY CHROMOSOME MICRODELETION Detection System v.4.0
Y CHROMOSOME MICRODELETION Detection System v.4.0 India Contact: Life Technologies (India) Pvt. Ltd. 306, Aggarwal City Mall, Opposite M2K Pitampura, Delhi 110034 (INDIA). Ph: +91-11-42208000, 42208111,
More informationElucigene Male Factor Infertility Products Guide to Interpretation
Elucigene Male Factor Infertility Products Guide to Interpretation Manufactured by: Elucigene Diagnostics Citylabs Nelson Street Manchester M13 9NQ For Sales, Customer Service and Technical Support:- T:
More informationPeter J Stahl, Anna N Mielnik, Christopher E Barbieri, Peter N Schlegel and Darius A Paduch
(2012) 14, 676 682 ß 2012 AJA, SIMM & SJTU. All rights reserved 1008-682X/12 $32.00 www.nature.com/aja ORIGINAL ARTICLE Deletion or underexpression of the Y-chromosome genes CDY2 and HSFY is associated
More informationJ.P.Mulhall 1, R.Reijo 2, R.Alagappan 2, L.Brown 2, D.Page 2, R.Carson 3 and R.D.Oates 1,4
hrep$$0305 Human Reproduction vol.12 no.3 pp.503 508, 1997 Azoospermic men with deletion of the DAZ gene cluster are capable of completing spermatogenesis: fertilization, normal embryonic development and
More informationY-Chromosomal Microdeletion in Idiopathic Azoospermic and Severe Oligozoospermic Indonesian Men
ORIGINAL ARTICLE Y-Chromosomal Microdeletion in Idiopathic Azoospermic and Severe Oligozoospermic Indonesian Men Ponco Birowo 1, Donny E. Putra 1,2, Mewahyu Dewi 2, Nur Rasyid 1, Akmal Taher 1 1 Department
More informationMODERN TRENDS. Edward E. Wallach, M.D. Associate Editor. Mark D. Johnson, M.D.
FERTILITY AND STERILITY VOL. 70, NO. 3, SEPTEMBER 1998 Copyright 1998 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. MODERN TRENDS Edward
More informationMRC-Holland MLPA. Description version 10; 06 April 2018
Description version ; 6 April 8 mix P36-B Y-Chromosome Microdeletions Lot B-5. As compared to version A (Lot A-), all probes f DPY9L, one probe f RBMYCP and one probe f KDM5D have been removed, and one
More informationY chromosome microdeletions in azoospermic patients with Klinefelter's syndrome
Asian J Androl 2006; 8 (1): 81 88 DOI: 10.1111/j.1745-7262.2006.00083.x. Original Article. Y chromosome microdeletions in azoospermic patients with Klinefelter's syndrome Anurag Mitra 1, Rima Dada 2, Rajeev
More informationThe pituitary testicular axis in Klinefelter s syndrome and. in oligo-azoospermic patients with and without deletions of the Y chromosome long arm
Clinical Endocrinology (2003) 59, 214 222 The pituitary testicular axis in Klinefelter s syndrome and Blackwell Publishing Ltd. in oligo-azoospermic patients with and without deletions of the Y chromosome
More informationAn evolutionary perspective on Y-chromosomal variation and male infertility
international journal of andrology ISSN 0105-6263 REVIEW ARTICLE An evolutionary perspective on Y-chromosomal variation and male infertility Chris Tyler-Smith The Wellcome Trust Sanger Institute, Wellcome
More informationNo association of the A260G and A386G DAZL single nucleotide polymorphisms with male infertility in a Caucasian population
Human Reproduction Page 1 of 6 Hum. Reprod. Advance Access published November 1, 2004 doi:10.1093/humrep/deh522 No association of the A260G and A386G DAZL single nucleotide polymorphisms with male infertility
More informationHomologous recombination between HERVs causes duplications in the AZFa region of men accidentally exposed to cesium-137 in Goiânia
Homologous recombination between HERVs causes duplications in the AZFa region of men accidentally exposed to cesium-137 in Goiânia J.T. Arruda 1, D.M. Silva 1,2, C.C. Silva 1,2, K.K.V.O. Moura 1 and A.D.
More informationThe likelihood of finding mature sperm cells in men with AZFb or AZFb-c deletions: six new cases and a review of the literature ( )
The likelihood of finding mature sperm cells in men with AZFb or AZFb-c deletions: six new cases and a review of the literature (1994 2010) Sandra E. Kleiman, Ph.D., Leah Yogev, Ph.D., Ofer Lehavi, M.D.,
More informationWhat about gr/gr deletions and male infertility? Systematic review and meta-analysis
Human Reproduction Update, Vol.17, No.2 pp. 197 209, 2011 Advanced Access publication on October 19, 2010 doi:10.1093/humupd/dmq046 What about gr/gr deletions and male infertility? Systematic review and
More informationINFERTILITY GENETIC TESTING. Dr. Ahmad Ebrahimi Molecular Medical Genetics,PhD Yass Medical Genetics Lab. Tehran University of Medical Science
INFERTILITY GENETIC TESTING Dr. Ahmad Ebrahimi Molecular Medical Genetics,PhD Yass Medical Genetics Lab. Tehran University of Medical Science INFERTILITY GENETIC TESTING It is estimated that genetics are
More informationSperm gamete screening
Sperm gamete screening Juan G. Alvarez, M.D, Ph.D Instituto Marquès, Barcelona Harvard Medical School, Boston Sperm screening Standard semen analysis Sperm capacitation Oocyte activating factor (PLC zeta
More informationNovel Technologies for Selecting the Best Sperm for IVF and ICSI
Novel Technologies for Selecting the Best Sperm for IVF and ICSI Denny Sakkas, Ph.D. Scientific Director, Boston IVF Waltham, MA, USA Testing The Sperm Population NOW Sperm DNA testing Although we are
More informationMolecular cytogenetic analysis of a ring-y infertile male patient
Characterization of a ring-y infertile male patient 59 A case report Molecular cytogenetic analysis of a ring-y infertile male patient F.M. Carvalho 1*, E.V. Wolfgramm 1*, I. Degasperi 2, B.M. Verbeno
More informationThe Association between Y Chromosome Microdeletion and Recurrent Pregnancy Loss
Iranian Red Crescent Medical Journal ORIGINAL ARTICLE The Association between Y Chromosome Microdeletion and Recurrent Pregnancy Loss S Ghorbian 1, K Saliminejad 2, MR Sadeghi 3, GhR Javadi 1, K Kamali
More informationGenomic integrity of the Y chromosome sequence-taggedsites in infertile and Down syndrome Jordanian males
ORIGINAL ARTICLE Genomic integrity of the Y chromosome sequence-taggedsites in infertile and Down syndrome Jordanian males S. R. Yasin, L. H. Tahtamouni, N. S. Najeeb, N. M. Issa, Z. A. Al Mazaydeh & A.
More informationMutation frequency of cystic fibrosis transmembrane regulator is not increased in oligozoospermic male candidates for intracytoplasmic sperm injection
FERTILITY AND STERILITY VOL. 69, NO. 5, MAY 1998 Copyright 1998 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Mutation frequency of
More informationThe incidence and possible relevance of Y-linked microdeletions in babies born after intracytoplasmic sperm injection and their infertile fathers
Molecular Human Reproduction vol.2 no.12 pp. 943-950, 1996 The incidence and possible relevance of Y-linked microdeletions in babies born after intracytoplasmic sperm injection and their infertile fathers
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,100 116,000 120M Open access books available International authors and editors Downloads Our
More informationRole of Y Chromosome Microdeletions in the Clinical Evaluation of Infertile Males
MGMJMS REVIEW ARTICLE Role of Y Chromosome Microdeletions in the 10.5005/jp-journals-10036-1145 Clinical Evaluation of Infertile Males Role of Y Chromosome Microdeletions in the Clinical Evaluation of
More informationI n 1976, the cytogenetic analysis of six azoospermic
814 ORIGINAL ARTICLE Sequence family variant loss from the AZFc interval of the human Y chromosome, but not gene copy loss, is strongly associated with male infertility N Machev, N Saut, G Longepied, P
More informationGENETIC TESTING: IN WHOM AND WHEN
GENETIC TESTING: IN WHOM AND WHEN Robert D Oates, M.D. Boston University School of Medicine My background in this field I was the first to link Cystic Fibrosis Mutations with Congenital Absence of the
More informationCorresponding author: T.T. Han / X.P. Ding /
Cytogenetic and molecular analysis of infertile Chinese men: karyotypic abnormalities, Y-chromosome microdeletions, and CAG and GGN repeat polymorphisms in the androgen receptor gene T.T. Han, J. Ran,
More informationCommittee Paper SCAAC(05/09)01. ICSI guidance. Hannah Darby and Rachel Fowler
Committee Paper Committee: Scientific and Clinical Advances Advisory Committee Meeting Date: 12 May 2009 Agenda Item: 4 Paper Number: SCAAC(05/09)01 Paper Title: ICSI guidance Author: Hannah Darby and
More informationDEBATEÐcontinued. Safety issues in assisted reproduction technology
Human Reproduction Vol.19, No.3 pp. 472±476, 2004 Advance Access publication 29 January, 2004 DOI: 10.1093/humrep/deh100 DEBATEÐcontinued Safety issues in assisted reproduction technology Should ICSI patients
More informationSTRUCTURAL ABERRATIONS OF Y CHROMOSOME IN AZOOSPERMIC MALES
Original Research Article STRUCTURAL ABERRATIONS OF Y CHROMOSOME IN AZOOSPERMIC MALES Gajanan Laxmanrao Maske 1, Archana Damdharrao Kannamwar * 2. ABSTRACT Background: Male factor infertility is a distressing
More informationChapter 3 To investigate the Y chromosome AZFc partial deletion types and its association in spermatogenic impairment and male infertility
Chapter 3 To investigate the Y chromosome AZFc partial deletion types and its association in spermatogenic impairment and male infertility 3.1 Introduction Classically, infertility is defined as the inability
More informationCHROMOSOME. Chromosomes are act as factors which distinguished one species from another.
CHROMOSOMES The chromosome comes from Greek Chroma = color CHROMOSOME Soma= body (the colored body) Chromosomes are act as factors which distinguished one species from another. Chromosomes are formed of
More information