Screening for microdeletions in human Y chromosome - AZF candidate genes and male infertility

Transcription

1 J.Cell.Mol.Med. Vol 7, No 1, 2003 pp Screening for microdeletions in human Y chromosome - AZF candidate genes and male infertility Florina Raicu a, L. Popa a, Pompilia Apostol a, D. Cimponeriu a, Letitia Dan a, Elena Ilinca b, Laura Luana Dracea b, B. Marinescu b, L. Gavrila a * a Institute of Genetics, University of Bucharest, Romania b Panait Sarbu Clinical Hospital of Obstetrics and Gynecology - Human Assisted Reproduction Department, Bucharest, Romania Received: September 24, 2002; Accepted: January 14, 2003 Abstract About 30% of couple infertilities are of male origin, some of them caused by genetic abnormalities of the Y chromosome. Deletions in AZF region can cause severe spermatogenic defects ranging from non-obstructive azoospermia to oligospermia. The intracytoplasmatic sperm injection technique (ICSI) is rapidly becoming a versatile procedure for human assisted reproduction in case of male infertility. The use of ICSI allows Y chromosome defects to be passed from father. The goal of our study is to evaluate the frequency of microdeletions in the long arm of Y chromosome, within the AZF regions, in these cases of infertilities, using molecular genetics techniques. Thirty infertile men with azoospermia or oligozoospermia, determined by spermogram, were studied after exclusion of patients with endocrine or obstructive causes of infertility. Peripheral blood DNA was extracted from each patient, then amplified by multiplex PCR with STS genomic markers from the Y chromosome AZF zones. Each case was checked by multiplex PCR through coamplification with the SRY marker. Three men with microdeletions of the long arm of the Y chromosome were diagnosed among the 30 patients, corresponding to a proportion of 10%. The relatively high proportion of microdeletions found in our population suggest the need for strict patient selection to avoid unnecessary screening for long arm Y chromosome microdeletions. The molecular diagnostics was performed according to the current European Academy of Andrology laboratory guidelines for molecular diagnosis of Y chromosomal microdeletions. Keywords: infertility SRY azoospermia microdeletions AZF region Y chromosome Introduction The long arm of the human Y chromosome is required for male fertility [1 6]. Despite the fact that deletions of long arm of the Y chromosome that are associated with spermatogenic failure have been signaled long time ago [7] only in the last few years * Correspondence to: Prof. Dr Lucian GAVRILA Department of Human Genetics, Institute of Genetics, University of Bucharest, 1-3 Portocalelor Street, 76258, sect.6, Bucharest. Tel./Fax: , gavrila@botanic.unibuc.ro these regions have been described at the molecular level [8 13]. Deletion mapping directed the discovery of genes related to spermatogenesis, and defined three regions as the azoospermia factors (AZFa, AZFb and AZFc) mapped to Yq11. These gene families are involved in pathogenic male infertility associated with azoospermia or severe oligozoospermia. AZFa contains two main candidate genes: DFFRY (Drosophila Fat Facets Related Y) and DBY (DEAD

2 box polypeptide Y). The main candidate in AZFb is the RBMY (RNA-binding motif) gene family [14 16] whose expression is restricted to the testis. RBMY consists of approximately 30 copies of genes and pseudogenes found on both arms of the Y chromosome, but it is suggested that functional genes are clustered at the Yq in the AZFb region. The main candidate gene in AZFc is the DAZ (Deleted in AZoospermia) cluster [17 21], a set of genes transcribed in the adult testis and expressed exclusively in germ cells. RBM and DAZ genes families encode RNA binding proteins with similar structures related to hnrnpg family of proteins (heterogenous nuclear ribonucleoproteins) involved in RNA metabolism, including packaging of RNA, transporting to cytoplasm and splicing. The physical size of these regions has been estimated to be 1-3 Mb for AZFa and AZFb and 3 Mb for AZFc. Due the prognostic value of this type of deletions, screening for microdeletions in Y chromosome before assisted reproduction treatment is recommended [22 24]. Infertile men with proximal deletions (AZFa and AZFb regions) show severe defects in spermatogenesis, with high prevalence of Sertoli cell-only syndrome, whereas deletions of distal AZFb and AZFc regions can be compatible with residual spermatogenesis. Approximately % of infertile men have structural changes in the Y chromosome. The sexdetermining region (SRY) of the Y chromosome that controls testis differentiation is intact, but deletions may exist on the long arm of the chromosome (Yq) that result in azoospermia or severe oligozoospermia [25]. Deletions of AZFc regions are the most defined causative factor of spermatogenic failure, with de novo deletions arising in roughly 1 in males. Wide variations in deletion frequency reported in the previous published works could be caused by ethnic differences, different patient selection criteria and, partly, by methodological aspects. The relatively high frequency of de novo Y deletions indicates that the Y chromosome is susceptible to spontaneous loss of genetic material. The instability of the Y chromosome may be related to the high frequency of repetitive elements clustered along the length of the chromosome, and deletions may occur through aberrant recombination events (between areas of homologous or similar sequence repeats between the X and Y chromosomes, or by chromosome unbalanced sister chromatid exchange) or by slippage during DNA replication [26, 27]. It may exist a particular Y chromosome haplotype that promote deletions of the AZF regions [28 30]. Thus, some individuals may be more susceptible to de novo deletions than are others. Advanced paternal age also might promote the loss of Y sequences. The ICSI technique is rapidly becoming an accepted procedure to human assisted reproduction in case of male infertility. ICSI has revolutionized the treatments of males with spermatogenic defects, allowing men who previously would have been unable to have children to achieve biological paternity. When this technique is applied, AZF deleted spermatozoa are capable of fertilizing oocytes and eliciting full developmental potential of new embryo [31]. Vertical transmission of AZF subregion defect to male offspring by ICSI has been reported as Y status, because the infertility problem is transmitted to sons and leads to familiar infertility [32]. Materials and methods Patients Our study was carried out on 30 patients referred to the Human Assisted Reproduction Department - Panait Sarbu Hospital. These 30 infertile men (29-44 yrs., x =31.93yrs.) were azoospermic or oligozoospermic according to semen analyses and following a 2-5 day period of sexual abstinence, according to the World Health Organization (WHO, 1993) guidelines for semen analysis. Light microscopic evaluation of sperm concentration, motility, viability and morphology was performed. Specimens originally considered as azoospermic, were centrifuged (1000 g for 20 min) and the pellet examined for spermatozoa, before confirming azoospermia. Oligozoospermia was defined by a sperm concentration (<20 x 10 6 /ml), asthenozoospermia (by motility, grades A + B, <40%), and teratozoospemia (by normal forms <40%). All cases of azoospemia / oligozoospemia resulting from endocrine or obstructive causes or with a constitutional cytogenetic abnormality were excluded from our study. The semen analyses showed azoospemia (n = 3) or oligozoospermia (n = 27) in 30 men. Among these, 28 had idiopathic infertility (3 azoospermic men and 25 oligozoospermic men), and 2 case of varicocele were also studied, because in these situations, the cause of infertility is 44

3 J.Cell.Mol.Med. Vol 7, No 1, 2003 largely unknown and an associated Y chromosome microdeletion cannot be ruled out. DNA extraction Human genomic DNA was prepared from peripheral blood leukocytes using conventional method as follow: briefly, 2 ml of peripheral blood was collected in EDTA bottles. BLB lysis buffer (3.1 M NH 4 Cl, 0.2 KHCO 3, 20mM EDTA, ph 7.4) was added to whole blood. Following this, 20% sodium dodecyl sulfate and proteinase K were added and then incubated over night, at 37 o C. The resulted proteins were precipitated with 6M NaCl. To precipitate DNA, 2 volumes of 99.5% ethanol was added and then the mixture was washed in 70% ethanol, and dissolved in TE. DNA extracted from each patient was prepared at a concentration of 100 ng/ml DNA. Polymerase chain reaction (PCR) amplifications - sequence tagged sites (STS) The screening method for microdeletions was based on multiplex PCR technology using Y-chromosome specific STSs, published by Vollrath et al. (1992), Foote et al. (1992), Reijo et al. (1995), and Vogt et al. (1996, 2001), which corresponded to the AZFa, b and c regions, respectively. Six previously published Yq STS were used: AZFa prox-2 and AZFa dist-1 (AZFa), sy127, sy134 (AZFb), sy254, sy255 (AZFc) (Fig. 1). In addition, the Yp sy1532 STS within the SRY gene was tested. Specific primers used for each multiplex mix and the expected PCR product lengths are listed in Table 1. The analysis of two STS loci in each region increases diagnostic accuracy, because deletions usually involve more than one STS loci. Genomic DNA (2µl) was added to a mixture of 100 mm Tris-CI (ph 8.3), 500 mm KCI, 15 mm MgCI 2, 200 mm of dntp mix, 0.5 mm of each primer pair, 0.2 µl (2 IU) AmphTaq DNA polymerase (Hoffman La Roche) and adjusted to a final volume of 12.5 µl. The PCRs were performed in a Techne Progene Thermocycler according to the following programs for all the STS markers (except syprox-2 and sydist 1): 35 cycles at 94 o C for 30 sec, 58 o C for 30 sec, and 72 o C for 30 sec. The programs were preceded by a 15-min denaturing step at 94 o C and followed by a final extension step at 72 o C for 7 min. Multiplex PCRs of both syprox 2 and sydist 1 consisted of 35 cycles at 94 o C for1 min., annealing for 1 min. 63 o C (AZFa prox - 2 ) and for 1 min at 57 o C (AZFa dist1), with subsequent polymerization for 1 min. at 65 o C for both mixes and a final autoextension step for 2 min at 65 o C. PCR controls Negative controls were used for every PCR: one sample without DNA and one sample of female genomic DNA. The STS sy1532 was used to prove the presence of Y specific DNA in order to exclude failure of amplification by PCR (to avoid false negative results). Analysis The PCR products (10.5µl) were subjected to electrophoresis on 3 % agarose, stained with ethidium bromide Fig. 1 Schematic representation of Y chromosome deletion found in this study compared to a normal male control (N). The positions of the STS used to screen AZF a, b and c are shown. Solid bars indicate presence of a STS and hatched bars indicate absence of a STS. 45

4 and visualized by exposure to ultraviolet light. As a length marker were used Sigma 100 pb DNA ladder. A patient sample was considered positive for the STS marker tested when the PCR product of the expected size was present, and was considered negative if a product of the expected size was not obtained after 3 PCR attempts. Each failure of multiplex amplification was checked by subsequent PCR analyses using single primer pairs and repeated 3 times with appropriate positive and negative controls to confirm the absence of each STS. When confirmed, coamplification of the missing STS and sy1532 was performed. Results and discussion PCR is a very sensitive technique to detect constitutional Yq microdeletions. The primer set was fruitfully used by different laboratories in detection of over 90% deletions in three major AZF regions. Guidelines for diagnostic testing region, according to European Academy of Andrology [33] and most recent works [34], include these STS primers as the first choice. A total of 30 men were screened for submicroscopic Y-chromosome deletions (see Table 2 for the Table 2. Sperm counts for patients (n=30). Sperm counts Subjects without deletions Subjects with deletions azoospermy 2 1 (INF 1) < 1 x 10 6 / ml 6 2 (INF 19, 24) 1-10 x 10 6 / ml 19 sperm count). Deletions in the Y chromosome were detected and confirmed with PCR-based analysis for 3 out of the 30 infertile patients, corresponding to a proportion of 10%. The relatively high proportion of microdeletions found in our population of 30 infertile men suggest the need for strict patient selection to avoid unnecessary screening for long arm Y chromosome microdeletions. The observed deletions and the markers involved are schematically shown in Fig. 1. All patients (referred to as patients INF 1, INF 19, INF 24) had interstitial deletions that could not be detected with classical cytogenetic analysis: 1 of these men has severe oligozoospermia and 2 were azoospermic. Patients INF1 and INF 19 presented a large deletion of Yq (Fig. 2). According to the literature, the prevalence of Y chromosome microdele- Table 1. Y-DNA markers (sequence - tagged sites, STS) their length and their location. Y DNA marker (STS) Sequence PCR product length (pb) Gene or locus AZFa prox - 2 AZFa dist - 1 SY 127 sy134 sy 254 sy 255 sy1532 F: GGT.TCC.TGA.ACA.GGG.GAC.T R: GGC.AGC.AGA.AGG.GCC.TCT.C F: GGT.TCC.TGA.ACA.GGG.GAC.T R: GGC.AGC.AGA.AGG.GCC.TCT.C F:GGC.TCA.CAA.ACG.AAA.AGA.AA R:CTG.CAG.GCA.GTA.ATA.AGG.GA F:ACC.ACT.GCC.AAA.ACT.TTC.AA R:GTC.TGC.CTC.ACC.ATA.AAA.CG F:GGG.TGT.TAC.CAG.AAG.GCA.AA R:GAA.CCG.TAT.CTA.CCA.AAG.CAG.C F:GTT.ACA.GGA.TTC.GGC.GTG.AT R: CTC.GTC.ATG.TGC.AGC.CAC F: TCCTTAGCAACCATTAATCTGG R:AAATAGCAAAAAATGACACAAGGC 220 pb AZFa 390 pb AZFa 274 pb AZFb 301 pb AZFb 350 pb AZFc (DAZ) 126 pb AZFc (DAZ) 167 pb SRY 46

5 J.Cell.Mol.Med. Vol 7, No 1, 2003 Fig. 2 Example of Multiplex PCR: lane M length marker Sigma 100 pb DNA ladder, lane B sample without DNA, lane 3,6,12 AZFc deleted patients. sy pb, sy pb, sy pb. tions in infertile men ranges from 3% [13], 8% [22], 13% [18] to 55% [39]. This variations is probably mainly due to the selection criteria of the patients. If the whole of 30 patients who were studied is considered, the proportion of men with microdeletions falls to 10%, within the range of the published data between 3 55 %. Acknowledgments This work was supported by Institute of Genetics, University of Bucharest, Romania. The authors like to thank especially to clinical staff of Human Assisted Reproduction Department Panait Sarbu Hospital of Bucharest, for our fertile and harmonious cooperation. Conclusions Infertile men with severe spermatogenic failure are at risk for Y chromosome deletions. It is generally believed that men with severe male infertility should be screened for Yq microdeletions as a part of their pretreatment investigations [35]. If Y chromosome testing is offered to these men and a deletion is observed, the most considerative prediction is that the deletion can be passed from father to son. The most likely outcome is that the son will be infertile since no deletions have been shown to occur in normally fertile men but the degree of severity of the spermatogenic defect the son will display cannot be predicted reliably at this time [36 38 ]. Our knowledge of the molecular genetics of human fertility is expanding rapidly. The study of Yq microdeletions will help in the development of better diagnostic methods and the expansion of the current knowledge of spermatogenesis. Diagnostic and therapeutic approaches in reproductive medicine have to keep pace with rapidly developing molecular knowledge of human reproduction; there is an urgent need to implement the increasing molecular knowledge in clinical practice. References 1. Affara N., The role of the Y chromosome in male infertility, Expert Rev. Mol. Med., Cambridge University Press, Cambridge, 2001, 2. Elliott D.J., Cooke H.J., The molecular genetics of male infertility, Bioassays, 19: , Foote S., The human Y chromosome: overlapping DNA clones spanning the euchromatic region, Science, 258:60-66, Foresta C., Y-chromosome deletions in idiopathic severe testiculopathies, J. Clin. Endocrinol. Metab., 82: , Okabe M., Ikawa M., Ashkenas J., Male infertility and the genetics of spermatogenesis, Am. J. Hum. Genet., 62: , Pryor J.L., Microdeletions in the Y chromosome of infertile men, N. Engl. J. Med., 336: , Tiepolo L., Zuffardi O., Localization of factors controlling spermatogenesis in the nonfluorescent portion of the human Y chromosome long arm, Hum. Genet., 34: , Kostiner D., Male infertility: analysis of the markers and genes on the human Y chromosome, Hum. Reprod., 13: , Lahn B.T., Page D.C., Functional coherence of the human Y chromosome, Science, 278: , Kent-First M., Defining regions of the Y-chromosome responsible for male infertility and identification of a fourth AZF region (AZFd) by Y-chromosome microdeletion detection, Mol. Reprod. Dev., 53:27-41,

6 11. Vergnaud G., Page D.C., Simmler M.C., A deletion map of the human Y chromosome based on DNA hybridization, Am. J. Hum. Genet., 258:52-59, Vogt P.H., Microdeletions in interval 6 of the Y chromosome of males with idiopathic sterility point to disruption of AZF, a human spermatogenesis gene, Hum. Genet., 89: , Vogt P.H., Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11, Hum. Mol. Genet., 5: , Ma K., A Y chromosome gene family with RNA-binding protein homology: candidates for the azoospermia factor AZF controlling human spermatogenesis, Cell, 75: , Elliott D.J, Expression of RBM in the nuclei of human germ cells is dependent on a critical region of the Y chromosome long arm, Proc. Natl. Acad. Sci. USA, 94: , Venables J.P., The roles of RNA-binding proteins in spermatogenesis and infertility, C.O. Genetics & Dev., 9: , Saxena R., The DAZ gene cluster on the human Y chromosome arose from an autosomal gene that was transposed, repeatedly amplified and pruned, Nat. Genet., 14: , Reijo R., Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNAbinding protein gene, Nat. Genet., 10: , Yen P.H., Chai N.N. and Salido E.C., The human DAZ genes, a putative male infertility factor on the Y chromosome, are highly polymorphic in the DAZ repeat regions, Mamm. Genome, 8: , Kawaguchi T.K., H. Skaletsky, L. Brown, P.J. Minx, H.S. Cordum, R.H. Waterston, R.K.Wilson, S. Silber, R.Oates, S. Rozen, D.C. Page, The AZFc region of the y chromosome features massive palindrome s and uniform reccurrent deletions in infertile men, Nat. Genet., 29: , Page D.C., Expression of DAZ, an azoospermia factor candidate, in human spermatogonia, Am. J. Hum. Genet., 60: , Qureshi S.J., Polymerase chain reaction screening for Y chromosome microdeletions: a first step towards the diagnosis of genetically-determined spermatogenic failure in men. Mol. Hum. Reprod, 2: , Seifer J., Screening for microdeletions on the long arm of chromosome Y in 53 infertile man, Intl J. Androl., 22: , Simoni M., Screening for deletions of the Y chromosome involving the DAZ (Deleted in AZoospermia) gene in azoospermia and severe oligozoospermia, Fertil. Steril., 67: , Brenner S., Miller J.H., Encyclopedia of Genetics, Academic Press, San Diego, 2002, vol. 2, pp McElreavey K., Kraus C., Male infertility and the Y chromosome, Am.J. Hum. Genet., 64: , Vogt P.H., Human chromosome deletions in Yq11, AZF candidate genes and male infertility: history and update, Mol. Hum. Reprod., 4: , Paracchini S., Stupia L., Gotta V., Palka G., Moro E., Foresta C., Mengua L., Oliva R., Ballesca J. L., Kremer J.A.M., van Golde R.J.T., Tuerlings J.H.A.M., Hargreave T., Ross A., Cooke H., Huellen K., Vogt P.H., and C. Tyler- Smith, Y-chromosomal DNA haplotypes in infertile european males caring y microdeletions, J. Endocrinol. Invest., 23: , Kraus C., L. Quintana-Murci, E. Rajpert-De Meyts, Jorgensen N., Jobling M.A., Rosser Z.H., Skakkeboek N.E. and McElreavey K., Identification of a Y chromosome haplogroup associated with reduced sperm counts, Hum. Mol. Genet., 10: , Shen P., Wang F., Underhill P.A., Franco C., Yang W., Roxas A., Sung R., Lin A., Hyman R.W., Vollrath D., Davis R.W., Luca-Cavalli-Sforza L., Population genetic implications from sequence variation in four Y chromosome genes, Proc. Natl. Acad. Sci. USA, 97: , Mulhall J.P., Reijo R., Alagappan R., Brown L., Page D.C., Carson R. and Oates R.D., Azoospermic men with deletion of the DAZ gene cluster are capable of completing spermatogenesis: fertilization, normal embryonic development and pregnancy occur when retrieved testicular spermatozoa are used for intracytoplasmic sperm injection, Hum. Reprod., 12: , Page D.C., Sherman S. and Brown L., Men with infertility caused by AZFc deletion can produce sons by intracytoplasmic sperm injection, but are likely to transmit the deletion and infertility, Hum. Reprod., 14: , Simoni M., Bakker E., Eurlings M.C.M., Matthiijs G., Moro E., Muller C.R., Vogt P.H., Laboratory guidelines for molecular diagnosis of Y-chromosomal microdeletions, European Molecular Genetics Quality Network (EMQN), 2000, Kamp C., Huellen K., Fernandes S., Sousa M., Schlegel P.N., Mielnik A., Kleiman S., Yavetz H., Krause W., Kuprek W., Johannisson R., SchulzeW., Weidner W., Barros A., Vogt P.H., High deletion frequency of the complete AZFa sequence in men with Sertoli-cell-only syndrome, Mol. Hum. Reprod., 7: , Simoni M., Kamischke A., Nieschlag E., Current status of the molecular diagnosis of Y-chromosomal microdeletions in the work-up of male infertility, Hum. Reprod., 13: , Ken-First M., Kols S., Muallen A., The incidence and possible relevance of Y-linked microdeletions in babies born after intracytoplasmic sperm injection and their fathers, Mol. Hum. Reprod., 2: , Kamischke, Gromoll J., Simoni M., Behre H.M., Nieschelag E., Transmission of a y chromosomal deletion involving the deleted in azoospermia (DAZ) and chromatin (CDY 1) genes from father to son through intracytoplasmic sperm injection, Hum. Reprod., 14: , Edwards R.G., Bishop C.E., On the origin and frequency of Y chromosome deletions responsible for severe male infertility, Molec. Hum. Reprod., 3: , Foresta C., Ferlin A., Garolla A., Moro A., Pistorello M., Barbaux S., Rossato M., High frequency of well-defined Y- chromosome deletions in idiopathic Sertoli-cell only syndrome, Hum. Reprod., 13: ,