Deletions of the distal euchromatic region of the Y chromosome

Transcription

1 Spermatogenesis in a Man with Complete Deletion of USP9Y lice Luddi, Ph.D., Maria Margollicci, Ph.D., Laura Gambera, Ph.D., Francesca Serafini, Ph.D., Maddalena Cioni, M.D., Vincenzo De Leo, M.D., Paolo Balestri, M.D., and Paola Piomboni, Ph.D. Summary Deletions in the azoospermia factor region ZFa on the human Y chromosome and, more specifically, in the region that encompasses the ubiquitin-specific peptidase 9, Y-linked gene USP9Y have been implicated in infertility associated with oligospermia and azoospermia. We have characterized in detail a deletion in ZFa that results in an absence of USP9Y in a normospermic man and his brother and father. The association of this large deletion with normal fertility shows that USP9Y, hitherto considered a candidate gene for infertility and azoospermia, does not have a key role in male reproduction. These results suggest that it may not be necessary to consider USP9Y when screening the Y chromosome of infertile or subfertile men for microdeletions. Deletions of the distal euchromatic region of the Y chromosome (Yq11) are associated with spermatogenic failure. 1 The locus, named azoospermia factor (ZF), extends from the proximal to the distal end of the q region of the Y chromosome 2 and contains three regions: ZFa, ZFb, and ZFc. The ZFa interval is estimated to span 792 kb and includes two widely expressed functional genes: USP9Y (a Y-linked gene encoding the ubiquitin-specific peptidase 9) and DDX3Y (the DED [sp Glu la sp] box polypeptide 3, Y-linked gene formerly known as DBY). 3,4 The exact role of the candidate genes in the ZFa region are largely unknown, owing to the extreme rarity of naturally occurring, single-gene specific mutations. Complete deletion of the ZFa region is relatively rare (deletions in the q region of the Y chromosome are found in less than 2% of men with spermatogenic defects) but is well documented and always associated with the Sertoli-cell only syndrome. 5 USP9Y spans 170 kb of D, consists of at least 46 exons, and occupies a small part of the ZFa interval. It encodes a protein reported to function as ubiquitin C-terminal hydrolase and is ubiquitously expressed. 6,7 Deletions affecting USP9Y have been associated with azoospermia or severe oligospermia. 6,8 Two partial deletions were recently found in men with a milder phenotype, oligoasthenoteratozoospermia, suggesting a minor role of this gene in spermatogenesis. 5,9 From the Department of Pediatrics, Obstetrics, and Reproductive Medicine (.L., M.M., L.G., F.S., M.C., V.D.L., P.B.) and the Department of Biomedical Sciences, pplied Biology Section (P.P.), University of Siena; and the Center for Diagnosis and Treatment of Couple Sterility, Siena Hospital (L.G., F.S., V.D.L., P.P.) all in Siena, Italy. ddress reprint requests to Dr. Piomboni at the Department of Biomedical Sciences, pplied Biology Section, University of Siena, Center for Diagnosis and Treatment of Couple Sterility Siena Hospital, Policlinico S. Maria alle Scotte, Viale Bracci, 14, Siena, Italy, or at piomboni@unisi.it. Engl J Med 2009;360: Copyright 2009 Massachusetts Medical Society. Methods The Patient The patient, a 42-year-old man, underwent spermatologic and genetic analysis during an infertility evaluation solicited by him and his partner after miscarriage. He n engl j med 360;9 nejm.org february 26,

2 Figure 1. Transmission Electron Micrograph of Ejaculated Spermatozoa from the Proband. Sperm with well-shaped nuclei () and acrosomes () are evident among other sperm that are immature and are embedded in cytoplasmic residues or necrotic with disrupted membranes. and other male members of his family provided written informed consent for participation in this study, as required by the institutional review board of the Siena Hospital. nalysis of Semen Three spermiograms were obtained at 3-month intervals for the patient. Semen samples were collected and volume, ph, and sperm concentration and motility were evaluated according to World Health Organization (WHO) guidelines. 10 The brother and father did not provide semen samples. Ultrastructural examination of ejaculated sperm was carried out by means of transmission electron microscopy. Semen specimens were fixed in cold Karnovsky s fixative and maintained at 4 C for 2 hours. Fixed semen samples were washed in 100 mm cacodylate buffer (ph 7.2) for 12 hours, postfixed in 1% buffered osmium tetroxide for 1 hour at 4 C, and dehydrated and embedded in Epon raldite. Ultrathin sections were cut with an ultramicrotome (Supernova, Reickert Jung), mounted on copper grids, stained with uranyl acetate and lead citrate, and observed and photographed with a transmission electron microscope (CM10, Philips). We analyzed ultrathin sections of 300 sperm specimens. To evaluate the frequency of aneuploidy, fluorescence in situ hybridization (FISH) was carried out on sperm nuclei, according to Baccetti et al. 11 total of 2880 sperm were analyzed using a mix of satellite D probes (CEP, Vysis) for chromosomes 18, X, and Y, which were each directly labeled with different fluorochromes. Molecular nalyses Genomic D was isolated from peripheral-blood lymphocytes or spermatozoa with the use of a commercial extraction kit, according to the manufacturer s protocol. Screening for deletions was initially performed for ZFa, ZFb, and ZFc, according to the European cademy of ndrology European Molecular Genetics Quality etwork (E- EMQ) guidelines. 12 In order to define the extent of deletion, we used several sequence-tagged sites (sy82, sy88, sy83, G64723, ZFa-prox2, G66179, G66183, SHGC-3904, G65852, G49201, G65840, G66201, G49206, G66189, sy87, GY6, and G38346) and gene-specific primers to localize the breakpoints to an interval spanning less than 1 kb (see the Supplementary ppendix, available with the full text of this article at EJM.org). Polymerase-chain-reaction (PCR) assays were performed using 1 U of Taq polymerase with the supplier s buffer, 200 μm of each deoxyribonucleotide triphosphate and 0.3 mm of each primer, in a final volume of 20 μl. Thermocycling conditions were as follows: 30 seconds at 95 C, 30 seconds at 57 to 59 C, and 45 seconds at 72 C, for a total of 35 cycles. ll PCR assays were performed on D derived from a woman as a negative control and D from a fertile male as a positive control. The results were considered negative only after three consecutive failures of amplification; occasionally the experiments were repeated on D extracted from the second blood samples obtained from the patient and his brother and father. Specific primers were also used to amplify USP9Y, exon 1 (GenBank accession number, G64987) and exon 46 (GenBank accession number, G34983), and DDX3Y, exon 1 (GenBank accession number, G38346) and exon 17 (GenBank accession number, G65240). For Y-haplotype analysis of the proband, the deep-rooting markers SRY-1532, M9, YP, 12f2, M231, and 92R7 were typed by means of PCR amplification and D sequence analysis. 13,14 DDx3Y Gene-Expression nalysis We assayed the expression of DDX3Y in the patient s lymphocytes using a commercially available kit, according to the manufacturer s protocol. blood specimen from a man with normal spermatogen- 882 n engl j med 360;9 nejm.org february 26, 2009

3 Yp PR PR Yq ZFa ZFb ZFc sy83 G66183 sy86 sy84 USP9Y sy87 G38346 DDX3Y Patient s sequence 100 kb B Proximal sequence Patient s sequence Distal sequence TTTTCGGGCTCGTGCCTGTGGCTTTTCGTTTTGCTTTTGTCGTGCTTTCTGCCGTGGCC TTTTCGGGCTCGTGCCTGTGGCTTTTCGTTTTGCCTGGGCCTGGCCCCGCCTTT TCCCTTTCTCGCGTTCTCTTCTTTGCCTGGGCCTGGCCCCGCCTTT Figure 2. zoospermia Factor Locus (ZF) of the Human Y Chromosome and the Deleted Region in the Proband. Panel shows ZF, including its three regions. For ZFa in particular, shown to scale are the ubiquitin-specific peptidase 9, Y-linked gene USP9Y, the DED (sp Glu la sp) box polypeptide 3, Y-linked gene DDX3Y, and sequence-tagged sites. PR denotes protease-activated receptor, Yp the p region of the Y chromosome, and Yq the q region. The hatch marks indicate a break in the schematic. The patient s sequence is shown immediately below, indicating the presence of sequence-tagged sites (black bars) and their absence (black line); the deletion breakpoints occur where the black bars end. The molecular analysis of the deleted region was performed with the use of standard sequence-tagged sites and specific primers (as indicated in the Supplementary ppendix). Panel B shows the chromatogram and alignment of the sequences proximal and distal to the breakpoints. The exact location of the breakpoints could lie anywhere in a run of three thymidine residues (underlined). esis was used as a positive control, and one from a woman was used as a negative control. For each sample, first-strand complementary D was synthesized from total R (previously treated with RQ1 Rase-Free Dase [Promega] to remove contaminant D), with the use of the reverse primer 5 -CTCGCTGTCTTGCTCCTCC-3 (targeting exon 2). DDX3Y transcripts were PCR-amplified with the same reverse primer and the 5 -GTTCCGCTT- TCGGTCTC-3 primer (targeting exon 1). Thermocycling conditions were as follows: 40 cycles of 30 seconds at 94 C, 30 seconds at 60 C, and 45 seconds at 72 C. Results The analysis of a number of sperm specimens from the patient showed a normal sperm count, 54 to 66 million sperm per milliliter, with a mean of 330 million spermatozoa per ejaculate. The total progressive motility (the sum of rapid and slow) was slightly reduced, ranging from 28 to 34% of sperm, and the percentage of morphologically normal forms was approximately 30%. part from the reduction in sperm motility (mild asthenozoospermia), all other sperm characteristics were within the normal range, according to WHO guide- n engl j med 360;9 nejm.org february 26,

4 2642 bp 500 bp 250 bp M B Figure 3. Results of Reverse-Transcriptase Polymerase- Chain-Reaction mplification of DDX3Y R in Lymphocytes from the Proband and Controls. Results of amplification of the 5 of the DED (sp Glu la sp) box polypeptide 3, Y-linked gene DDX3Y (arrow) are shown for the proband (1), an unaffected man (2), a woman (3), and an unaffected man and in the absence of reverse transcription (4); lane B contains water only. molecular-weight standard is shown for comparison (M). lines. 10 ormal sperm phenotype was confirmed by means of electron microscopy (Fig. 1), which revealed well-shaped nuclei, condensed chromatin, tails with normal structure, and regular axonemes. Sperm with abnormal morphologic features showed structural anomalies typical of immaturity: altered acrosomal or nuclear molding, uncondensed chromatin, and cytoplasmic residues. small percentage of sperm had necrotic features such as broken plasma membranes, reacted or missing acrosomes, and disrupted chromatin (Fig. 1). FISH analysis of sperm samples revealed a frequency of chromosome 18 disomy of 0.15% (range, 0.13 to 0.17), which was similar to that among fertile men (mean, 0.12%; range, 0.04 to 0.19). 11 The rate of diploidy in the patient was 0.26% (range, 0.19 to 0.31) and did not differ significantly from that of fertile men (mean, 0.28%; range, 0.17 to 0.36), whereas the prevalence of sex-chromosome disomy was 0.42% (range, 0.32 to 0.49), which was slightly higher than that of fertile men (0.23%; range, 0.14 to 0.38). 11 The patient s karyotype was normal (46,XY). Genetic screening for Y microdeletions was carried out by means of multiplex PCR analysis, according to E-EMQ guidelines. 12 nalysis of D derived from peripheral-blood lymphocytes of the proband, his father, and his brother showed a deletion in the ZFa region (Fig. 2). To determine whether the proband had complete or partial deletion of ZFa, we determined the extent of the deletion using 17 markers (called sequence-tagged sites) that are mapped in this region. The deletion encompassed the region from marker SHGC3904 to marker G We then designed additional markers to identify and sequence the breakpoints. The deletion is 513,594 bp, but the exact locations of the breakpoints are ambiguous because of a run of three consecutive thymidine residues at each breakpoint (Fig. 2). The proximal breakpoint is located 320,521 bp ± three thymidine residues upstream of the first USP9Y exon, and the distal breakpoint is at 33,465 bp ± three thymidine residues downstream of the last USP9Y exon. Examination of the flanking sequences suggests that the deletion was partly caused by nonhomologous end joining. We also established that the deletion did not include any known coding or regulatory regions of DDX3Y, which lies downstream of the USP9Y (data not shown). To determine whether the deletion affects DDX3Y expression, 15 we performed reverse-transcriptase PCR analysis on R isolated from lymphocytes from the patient and found that gene expression was not affected (Fig. 3). The haplogroup on which the deletion lies is P*(xR1a), 13 different from the haplogroups identified in the two previously described patients carrying partial deletions of USP9Y. 9 Therefore, at present, no correlation can be made between haplotype and deletions at this locus. Discussion Since deletions in USP9Y have been reported to cause mild-to-severe oligospermia or azoospermia, 5,8,9 a phenotype not observed in our patient, we considered mosaicism as an explanation for the fertility of this subject. However, our analysis showed that D extracted from all ejaculated spermatozoa carried the same deletion. These re- 884 n engl j med 360;9 nejm.org february 26, 2009

5 sults are in line with the previously postulated marginal role of the USP9Y gene in spermatogenesis 9 and are also consistent with the presence of the same deletion in the father and the brother. The relatively normal spermatogenic phenotype of our patient, and the proven fertility of his father, show that previously described azoospermia and oligoasthenospermia cannot be due to deletion of USP9Y alone: additional genetic or nongenetic factors must influence the phenotype. Local testicular factors or the environmental or genetic background could be responsible for the phenotypic variability highlighted in previously reported cases. In particular, investigations of the Y haplotype in patients carrying a USP9Y deletion would be useful to determine whether there is a correlation between genetic background and phenotypic variation. On the basis of the normal rate of USP9Y transcription in patients with spermatogenic failure and the absence of its correlation with the degree of sperm retrieval, 16 we also infer that USP9Y has a marginal role or no role in spermatogenesis. Consistent with this hypothesis is the inactivation of the orthologous gene in chimpanzees and bonobos. 17 In conclusion, we found that complete deletion of the USP9Y gene does not cause spermatogenic defects, nor does it preclude the natural conception of children. This gene was recently reported to be a fine-tuner of human spermatogenesis, improving its efficiency. 9 Our findings indicate that USP9Y is not essential for normal sperm production and fertility in humans and that a revision of the diagnostic approach of screening for Y-chromosome microdeletions, according to E- EMQ guidelines, 11 may be warranted. This approach does not detect deletions affecting DDX3Y alone. Supported in part by a grant (0405) from Monte dei Paschi di Siena Bank. o potential conflict of interest relevant to this article was reported. We thank Csilla Krausz for helpful discussions, Elvira Costantino-Ceccarini for her extensive assistance in the preparation of a previous draft of the manuscript, and Carlo lessandrini for participation in the ultrastructural studies. References 1. Tiepolo L, Zuffardi O. Localization of factors controlling spermatogenesis in the nonfluorescent portion of the human Y chromosome long arm. Hum Genet 1976; 34: Vogt PH, Edelmann, Kirsch S, et al. Human Y chromosome azoospermia factors (ZF) mapped to different subregions in Yq11. Hum Mol Genet 1996;5: Kamp C, Huellen K, Fernandes S, et al. High deletion frequency of the complete ZFa sequence in men with Sertoli-cellonly syndrome. Mol Hum Reprod 2001;7: Sargent C, Boucher C, Kirsch S, et al. The critical region of overlap defining the ZFa male infertility interval of proximal Yq contains three transcribed sequences. J Med Genet 1999;36: Ferlin, rredi B, Speltra E, et al. Molecular and clinical characterization of Y chromosome microdeletions in infertile men: a 10-year experience in Italy. J Clin Endocrinol Metab 2007;92: Brown GM, Furlong R, Sargent C, et al. Characterisation of the coding sequence and fine mapping of the human DFFRY gene and comparative expression analysis and mapping to the Sxrb interval of the mouse Y chromosome of the Dffry gene. Hum Mol Genet 1998;7: Hall M, Brown GM, Furlong R, et al. Usp9y (ubiquitin-specific protease 9 gene on the Y) is associated with a functional promoter and encodes an intact open reading frame homologous to Usp9x that is under selective constraint. Mamm Genome 2003;14: Sun C, Skaletsky H, Birren B, et al. n azoospermic man with a de novo point mutation in the Y-chromosomal gene USP9Y. at Genet 1999;23: Krausz C, Degl Innocenti S, uti F, et al. atural transmission of USP9Y gene mutations: a new perspective on the role of ZFa genes in male fertility. Hum Mol Genet 2006;15: World Health Organization. Laboratory manual for the examination of human semen and sperm-cervical mucus interaction. 4th ed. Cambridge, England: Cambridge University Press, Baccetti B, Bruni E, Collodel G, et al. 10, 15 Reciprocal translocation in an infertile man: ultrastructural and fluorescence in-situ hybridization sperm study: case report. Hum Reprod 2003;18: Simoni M, Bakker E, Krausz C. E/ EMQ best practice guidelines for molecular diagnosis of Y-chromosomal microdeletions: state of the art Int J ndrol 2004;27: Karafet TM, Mendez FL, Meilerman MB, Underhill P, Zebura SL, Hammer MF. ew binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Genome Res 2008;18: Cinnioğlu C, King R, Kivisild T, et al. Excavating Y-chromosome haplotype strata in natolia. Hum Genet 2004;114: Ditton HJ, Zimmer J, Kamp C, Rajpert- De Meyts E, Vogt PH. The ZFa gene DBY (DDX3Y) is widely transcribed but the protein is limited to the male germ cells by translation control. Hum Mol Genet 2004;13: Kuo PL, Lin YH, Teng Y, Hsu CC, Lin JS, Lin YM. Transcriptional levels of four Y chromosome-linked ZF genes in azoospermic men and their association with successful sperm retrieval. Urology 2004; 63: Tyler-Smith C. n evolutionary perspective on Y-chromosomal variation and male infertility. Int J ndrol 2008;31: Copyright 2009 Massachusetts Medical Society. n engl j med 360;9 nejm.org february 26,