Fertility and Sterility

Transcription

1 Fertility and Sterility Volume 88, Issue 1, Pages (July 2007) Modern trends 1. Safety of testosterone treatment in postmenopausal women Pages 1-17 Glenn D. Braunstein Editor's corner 2. Gay male couples and assisted reproduction: should we assist? Pages Dorothy A. Greenfeld Practice committee report 3. Pathogenesis, consequences, and control of peritoneal adhesions in gynecologic surgery Pages Special contribution 4. Workshop report: evaluation of genetic and epigenetic risks associated with assisted reproductive technologies and infertility Pages Rosanna Weksberg, Cheryl Shuman, Louise Wilkins-Haug, Mellissa Mann, Mary Croughan, Donna Stewart, Catherine Rakowsky, Arthur Leader, Judith Hall, J.M. Friedman, et al. Endometriosis 5. Aromatase expression in endometriotic tissues and its relationship to clinical and analytical findings Pages Pedro Acién, Irene Velasco, Mercedes Gutiérrez and Monserrat Martínez-Beltrán

2 Genetics 6. Human myometrium and leiomyomas express gonadotropin-releasing hormone 2 and gonadotropin-releasing hormone 2 receptor Pages Jason D. Parker, Minnie Malik and William H. Catherino In vitro fertilization 7. A comparison of the outcomes between twin and reduced twin pregnancies produced through assisted reproduction Pages Chong-U. Cheang, Lii-Shung Huang, Tsung-Hsien Lee, Chung-Hsien Liu, Yang- Tse Shih and Maw-Sheng Lee 8. Increased efficiency of preimplantation genetic diagnosis for infertility using no result rescue Pages Pere Colls, Tomas Escudero, Natalie Cekleniak, Sasha Sadowy, Jacques Cohen and Santiago Munné 9. In vitro maturation of oocytes collected from unstimulated ovaries for oocyte donation Pages Hananel Holzer, Eleanor Scharf, Ri-Cheng Chian, Ezgi Demirtas, William Buckett and Seang Lin Tan 10. The position of transferred air bubbles after embryo transfer is related to pregnancy rate Pages Marieke J. Lambers, Erbil Dogan, Jan Willem Lens, Roel Schats and Peter G.A. Hompes 11. Changes in measured endometrial thickness predict in vitro fertilization success Pages Grant D.E. McWilliams and John L. Frattarelli 12. Early serum β-human chorionic gonadotropin in pregnancies after in vitro fertilization: contribution of treatment variables and prediction of long-term pregnancy outcome Pages Shay Porat, Stephan Savchev, Yuval Bdolah, Arye Hurwitz and Ronit Haimov- Kochman

3 13. Aneuploidy rates in embryos from women with prematurely declining ovarian function: a pilot study Pages Andrea Weghofer, David Barad, Jianming Li and Norbert Gleicher Menopause 14. Postmenopausal hypoestrogenism increases vasoconstrictor neuropeptides and decreases vasodilator neuropeptides content in arterial-wall autonomic terminations Pages Costantino Di Carlo, Attilio Di Spiezio Sardo, Giuseppe Bifulco, Giovanni A. Tommaselli, Germano Guerra, Emilia Rippa, Vincenzo D. Mandato and Carmine Nappi 15. Effects of testosterone and estrogen treatment on lipolysis signaling pathways in subcutaneous adipose tissue of postmenopausal women Pages Hong Zang, Mikael Rydén, Kerstin Wåhlen, Karin Dahlman-Wright, Peter Arner and Angelica Lindén Hirschberg Ovulation induction 16. The prevalence and influence of luteinizing hormone surges in stimulated cycles combined with intrauterine insemination during a prospective cohort study Pages Astrid E.P. Cantineau and Bernard J. Cohlen Polycystic ovary syndrome 17. Evaluation of effects of an oral contraceptive containing ethinylestradiol combined with drospirenone on adrenal steroidogenesis in hyperandrogenic women with polycystic ovary syndrome Pages Vincenzo De Leo, Giuseppe Morgante, Paola Piomboni, Maria Concetta Musacchio, Felice Petraglia and Antonio Cianci 18. Lack of effect of short-term diazoxide administration on luteinizing hormone secretion in women with polycystic ovary syndrome Pages William S. Evans, Ann E. Taylor, David G. Boyd, Michael L. Johnson, Dennis W. Matt, Yarisie Jimenez and John E. Nestler

4 19. Administration of exogenous ghrelin in obese patients with polycystic ovary syndrome: effects on plasma levels of growth hormone, glucose, and insulin Pages Maurizio Guido, Daniela Romualdi, Laura De Marinis, Teresa Porcelli, Maddalena Giuliani, Barbara Costantini and Antonio Lanzone 20. Pioglitazone reduces the adrenal androgen response to corticotropin-releasing factor without changes in ACTH release in hyperinsulinemic women with polycystic ovary syndrome Pages Daniela Romualdi, Maddalena Giuliani, Gaetano Draisci, Barbara Costantini, Francesca Cristello, Antonio Lanzone and Maurizio Guido 21. Serum insulin-like growth factor I (IGF-I) and IGF-binding protein 3 (IGFBP-3) in IVF patients with polycystic ovary syndrome: correlations with outcome Pages Katherine D. Schoyer, Hung-Ching Liu, Steven Witkin, Zev Rosenwaks and Steven D. Spandorfer 22. Discovery of distinct protein profiles for polycystic ovary syndrome with and without insulin resistance by surface-enhanced laser adsorption/ionization time of flight mass spectrometry Pages Shuyun Zhao, Jie Qiao, Meizhi Li, Xiaowei Zhang, Jiekai Yu and Rong Li Reproductive endocrinology 23. Serum human chorionic gonadotropin level after ovulation triggering is influenced by the patient s body mass index and the number of larger follicles Pages Laura Detti, Mohamed F.M. Mitwally, Anuradha Rode, Frank D. Yelian, Michael Kruger, Michael P. Diamond and Elizabeth E. Puscheck 24. Influence of hysterectomy on long-term fracture risk Pages L. Joseph Melton III, Sara J. Achenbach, John B. Gebhart, Ebenezer O. Babalola, Elizabeth J. Atkinson and Adil E. Bharucha 25. Do sex hormones influence features of the metabolic syndrome in middle-aged women? A population-based study of Swedish women: The Women s Health in the Lund Area (WHILA) Study Pages Yasameen A. Shakir, Göran Samsioe, Per Nyberg, Jonas Lidfeldt, Christina Nerbrand and Carl-David Agardh

5 26. Clinicopathologic characteristics of uterine adenomyoma in pregnant women Pages Jian-Hua Wang, Xiao-Hong He, Rui-Jin Wu and Xiang-Rong Xu Reproductive biology 27. Different degrees of vascularization and their relationship to the expression of vascular endothelial growth factor, placental growth factor, angiopoietins, and their receptors in first-trimester decidual tissues Pages Margreet Plaisier, Sharon Rodrigues, Florian Willems, Pieter Koolwijk, Victor W.M. van Hinsbergh and Frans M. Helmerhorst 28. Remote organ injury induced by myocardial ischemia and reperfusion on reproductive organs, and protective effect of melatonin in male rats Pages Engin Sahna, Gaffari Türk, Ahmet Atessahin, Seval Yılmaz and Ercument Olmez 29. Effect of leptin on prolactin and insulin-like growth factor-i secretion by cultured rat endometrial stromal cells Pages Kamani H. Tennekoon, Thampoe Eswaramohan and Eric H. Karunanayake 30. Deranged expression of follistatin and follistatin-like protein in women with ovarian endometriosis Pages Paulo B. Torres, Pasquale Florio, Marcia C. Ferreira, Michela Torricelli, Fernando M. Reis and Felice Petraglia Techniques and instrumentation 31. Intelligent, impedance-regulated, pulsed coagulation in a porcine renal artery model Pages Christian Wallwiener, Markus Wallwiener, Eva Neunhoeffer, Michael Menger, Keith Isaacson and Wolfgang Zubke Case report summaries 32. Medical management of early pregnancy failure in a patient with coronary artery disease Pages 212.e1-212.e3 David N. Hackney, Mitchell D. Creinin and Hyagriv Simhan

6 33. Segregation of chromosomes in spermatozoa of four Hungarian translocation carriers Pages 212.e5-212.e11 Anna Kékesi, Edit Erdei, Miklós Török, Sándor Drávucz and András Tóth 34. Retrograde ejaculation: simpler treatment Pages 212.e e14 Rene Leiva 35. Azoospermia as a new feature of Fabry disease Pages 212.e e18 Aline Papaxanthos-Roche, Colette Deminière, Frédéric Bauduer, Claude Hocké, Guy Mayer and Didier Lacombe 36. Oxytocin antagonists may improve infertility treatment Pages 213.e e22 Piotr Pierzynski, Torsten M. Reinheimer and Waldemar Kuczynski Correspondence 37. Positive expression of the immunoglobulin superfamily protein IZUMO on human sperm of severely infertile male patients Pages Shinichi Hayasaka, Yukihiro Terada, Naokazu Inoue, Masaru Okabe, Nobuo Yaegashi and Kunihiro Okamura 38. Repeat vasectomy reversal yields high success rates Pages Margarita R. Hollingsworth, Jay I. Sandlow, Christopher G. Schrepferman, Robert E. Brannigan and Peter N. Kolettis 39. Differential expression of selected gene products in uterine leiomyomata and adenomyosis Pages Mary Levy, Khush Mittal, Luis Chiriboga, Xinmin Zhang, Herman Yee and Jian- Jun Wei 40. The value of Chlamydia trachomatis specific IgG antibody testing and hysterosalpingography for predicting tubal pathology and occurrence of pregnancy Pages Denise A.M. Perquin, Matthias F.C. Beersma, Anton J.M. de Craen and Frans M. Helmerhorst

7 41. Prospective, randomized trial of metformin and vitamins for the reduction of plasma homocysteine in insulin-resistant polycystic ovary syndrome Pages Morey Schachter, Arieh Raziel, Devorah Strassburger, Carmela Rotem, Raphael Ron-El and Shevach Friedler 42. Open-identity donor insemination in the United States: is it on the rise? Pages Joanna E. Scheib and Rachel A. Cushing 43. A Prostaglandin D2 system in the human testis Pages Christoph Schell, Monica B. Frungieri, Martin Albrecht, Silvia I. Gonzalez-Calvar, Frank M. Köhn, Ricardo S. Calandra and Artur Mayerhofer 44. Comparison of human chorionic gonadotropin and gonadotropin-releasing hormone agonist for final oocyte maturation in oocyte donor cycles Pages Bruce S. Shapiro, Said T. Daneshmand, Forest C. Garner, Martha Aguirre and Richard Ross 45. The effect of cinnamon extract on insulin resistance parameters in polycystic ovary syndrome: a pilot study Pages Jeff G. Wang, Richard A. Anderson, George M. Graham III, Micheline C. Chu, Mark V. Sauer, Michael M. Guarnaccia and Rogerio A. Lobo 46. Prospective evaluation of the optimal time for selecting a single embryo for transfer: day 3 versus day 5 Pages Nicolas H. Zech, Bernard Lejeune, Francoise Puissant, Sabine Vanderzwalmen, Herbert Zech and Pierre Vanderzwalmen Letters to the editor 47. Single cell diagnosis using comparative genomic hybridization after preliminary DNA amplification still needs more tweaking: too many miscalls Pages Elpida Fragouli, Joy D.A. Delhanty and Dagan Wells 48. Reply of the Authors Pages Geoffrey Sher and L. Keskintepe

8 49. Is there a special subgroup of males with adult-onset idiopathic hypogonadotrophic hypogonadism who may respond with increases in sperm concentration after clomiphene citrate? Page 249 Fabio Firmbach Pasqualotto and Eleonora Bedin Pasqualotto 50. Reply of the Authors Pages Scott J. Whitten, Ajay K. Nangia and Peter N. Kolettis 51. Roles of leptin and ghrelin in eating disorders? Page 250 Simon Ferrero 52. Reply of the Authors Pages Lisa F. Schneider and Michelle P. Warren 53. Finding the right stuff search strategies can and do make a difference! Page 251 Mark A. Damario 54. Reply of the Authors Pages Arieh Raziel, Zvi Vaknin, Morey Schachter, Dvora Strassburger, Arie Herman, Raphael Ron-El and Shevach Friedler Book review 55. Margaret Rees, Sally Hope and Veronica Ravnikar, Editors, The Abnormal Menstrual Cycle, Taylor and Francis, Atlanta, GA (2005), pp Price: $ Pages Frank Stanczyk Erratum 56. Erratum Page 254

9 MODERN TRENDS Edward E. Wallach, M.D. Associate Editor Safety of testosterone treatment in postmenopausal women Glenn D. Braunstein, M.D. Department of Medicine, Cedars-Sinai Medical Center, David Geffen School of Medicine at UCLA, Los Angeles, California Objective: To critically examine the safety of T therapy given to postmenopausal women. Design: MEDLINE literature review, cross-reference of published data, and review of Food and Drug Administration transcripts. Result(s): Although some retrospective and observational studies provide some long-term safety data, most prospective studies have had a duration of 2 years or less. In addition, with the exception of the female-to-male transsexuals, T was administered in conjunction with estrogens or estrogens and progestins, which confound the interpretation of some of the studies. The major adverse reactions are the androgenic side effects of hirsutism and acne. There does not appear to be an increase in cardiovascular risk factors, with the exception of a lowering of high-density lipoprotein with oral T. There are little data on endometrial safety, and most of the experimental data support a neutral or beneficial effect in regards to breast cancer. There does not appear to be an increased risk of hepatotoxicity, neurobehavorial abnormalities, sleep apnea, or fetal virilization (in premenopausal women) with the physiologic treatment doses of T. Conclusion(s): Except for hirsutism and acne, the therapeutic administration of T in physiologic doses is safe for up to several years. However, prospectively collected long-term safety studies are needed to provide a greater degree of assurance. (Fertil Steril Ò 2007;88:1 17. Ó2007 by American Society for Reproductive Medicine.) Key Words: Testosterone, androgens, hirsutism, virilization, breast carcinoma, endometrial carcinoma, lipids For over 60 years, women have been treated with T to improve libido (1 4). Results of the first randomized, doubleblind placebo-controlled trial of T therapy for menopausal women, published in 1950 by Greenblatt and coworkers, demonstrated an improvement in libido (5). Subsequently, numerous trials of T treatment for women with low libido have generally demonstrated efficacy for sexual desire, arousal, pleasure, responsiveness, and satisfaction (6 8). These trials also examined the safety of T administration to women. There is a low incidence of mild androgenic effects (hirsutism and acne) and lowering of HDLs with methyltestosterone (MT) given orally. There have been no reports of serious adverse effects due to T, even with doses that cause moderately supraphysiologic blood T concentrations. However, the duration of most trials is 6 months or less, and concerns about the long-term safety of T treatment in women have been raised by a Food and Drug Administration (FDA) advisory panel (9). The purpose of this article is to Received August 15, 2006; revised and accepted January 11, Dr. Braunstein is a consultant and principal investigator on studies using transdermal testosterone patches for the treatment of hypoactive sexual desire disorder sponsored by Procter and Gamble Pharmaceuticals. Reprint requests: Glenn D. Braunstein, M.D., Room 2119 South Tower, Cedars-Sinai Medical Center, 8700 Beverly Blvd., Los Angeles, CA (FAX: ; braunstein@cshs.org). review the safety concerns and examine the existing data that address these issues. SAFETY CONCERNS The primary safety issues are androgenic side effects; adverse effects on the cardiovascular system; stimulation of the endometrium and breast leading to neoplasia; hepatotoxicity; induction or aggravation of sleep apnea; and behavioral effects (8 11). Some of these concerns are based on problems that have been found in males receiving pharmacological doses of T or anabolic steroids, in women with hyperandrogenic polycystic ovaries, and from the Heart and Estrogen/ Progestin Replacement Study (HERS) and Women s Health Initiative (WHI), in which estrogens and progestins were found to have adverse effects (12, 13). Although these models are useful for providing signals as to the type of safety issues that should be examined, each is fraught with difficulties in trying to extrapolate the findings to women receiving physiologic to moderately supraphysiologic doses of T. Under normal circumstances, circulating T levels in men are times higher than those in women. The administration of supraphysiologic doses of T or anabolic steroids to athletes and body builders has been associated with acne, gynecomastia, testicular atrophy, hepatic inflammation, hepatocellular adenomas and carcinomas, sleep apnea, aggressive /07/$32.00 Fertility and Sterility â Vol. 88, No. 1, July doi: /j.fertnstert Copyright ª2007 American Society for Reproductive Medicine, Published by Elsevier Inc.

10 behavior, polycythemia, lipid abnormalities, and accelerated atherosclerosis (14). Some of these effects, such as the liver effects, are related to the type of anabolic steroid used, while others, like polycythemia, are dose related. Women with polycystic ovarian syndrome (PCOS) have endogenous hyperandrogenism and exhibit androgenic effects including hirsutism, acne, and androgenic alopecia, as well as occasional virilization. They also have an increased risk of endometrial carcinoma, metabolic syndrome, diabetes, and cardiovascular disease (15). Although it is tempting to ascribe a cause and effect relationship to the hyperandrogenism and these latter effects, it is important to note that many of these patients are obese and exhibit insulin resistance that may in fact be the proximate pathophysiologic factors for these problems. The hazard ratios of 1.29 for coronary heart disease, 1.41 for stroke, 2.11 for venous thromboembolism, and 1.26 for breast cancer in women receiving estrogen and progestin for an average of 5.2 years in the WHI raised major concerns about sex steroid therapy for postmenopausal women (13).In postmenopausal women with coronary artery disease (CAD) enrolled in HERS, there was an increase in cardiovascular events in the estrogen/progestin group during the first year of treatment and then a reduction in years 3 5 (12). Since most of the studies that evaluated T therapy in postmenopausal women did so in the presence of estrogen (if the patient had undergone a hysterectomy) or estrogen and a progestin (if she had undergone a natural menopause), there has been a concern that adding androgen may compound any adverse cardiovascular effect of the other sex steroid hormones. Additionally, since T is aromatized into E 2 in a variety of peripheral tissues through the action of aromatase, it has been hypothesized that giving T will result in greater tissue exposure to estrogen (10). Thus, it is speculated that estrogen-induced problems may be exacerbated with androgen therapy in which an aromatizable androgen such as T is given. Given this background, it is understandable that an FDA advisory committee might be concerned about potential long-term adverse effects of T therapy for women. However, with the exception of the androgenic side effects, these concerns appear to be unwarranted based on available data, which will be reviewed below. ANDROGENIC EFFECTS Hirsutism Hair can be classified as asexual, which is present in both sexes at birth (e.g., scalp and eyebrow regions), ambisexual, which develops in the axillary and pubic regions in both sexes in response to the rise in adrenal androgens at adrenarche, and sexual, which is on the face and body and responds to the rising androgen concentrations during the pubertal transition in males. The pilosebaceous unit is composed of a hair papilla and associated sebaceous glands. In the presence of androgens, fine vellus hair in androgen-sensitive areas of the body will become dark, thick, terminal hairs, and the sebaceous glands will enhance sebum production (16). Hirsutism, which represents excessive hair growth in the androgen-sensitive areas of women, is an expected consequence of excessive production of endogenous androgens or exposure to supraphysiologic quantities of exogenous androgens (17, 18). Thus, it is not surprising that hirsutism is the major side effect of exogenous androgen administration in women. As reviewed by Gelfand and Wiita, between 1% and 36% of women receiving various doses of MT, with or without estrogen, noted hirsutism (19). However, as summarized in Table 1, there is no clear-cut dose-response effect noted. This may reflect the means by which the hirsutism is reported (selfreport by the patient vs. observation by the investigator) or the duration of androgen administration, as it often takes 4 6 months of exposure to exogenous T before hirsutism becomes apparent (19 30). In a randomized, double-blind study of postmenopausal women receiving conjugated equine estrogens (CEEs; or 1.25 mg/day) or esterified estrogens (EEs) þ MT (low dose, mg EE þ 1.25 mg MT; high dose, 1.25 mg EE þ 2.5 mg MT), facial hair was reported as an adverse event in 3% of women on CEE and in 6% receiving EE þ MT. In a subgroup of 100 women in whom facial hair was absent at the start of the study, 14% TABLE 1 Frequency of hirsutism and acne noted as adverse effects in women receiving oral methyltestosterone with and without EEs. Dose of MT/day, mg Hirsutism N (%) Acne N (%) References 10 mg a 266 (7.5) 266 (11.3) (20 22) 2.5 mg b 196 (11.7) 97 (15.46) (23 28) 1.25 mg b 196 (0.8) 120 (9.2) (25, 26, 29, 30) Note: Percents represent the mean of all data combined; N ¼ number of subjects. a MT administered without estrogens. b MT administered with EEs. Braunstein. Testosterone safety in women. Fertil Steril Braunstein Testosterone safety in women Vol. 88, No. 1, July 2007

11 of the women receiving the low dose of EE þ MT developed facial hirsutism, as did 22% of those receiving the higher dose of EE þ MT at 12 months. (25). However, 20% of the women in both of the estrogen-only control groups also developed facial hair. Similarly, Lobo et al. found no change in the hirsutism score in 107 women receiving mg of EE þ 1.25 mg MT for 4 months versus 109 women receiving mg EE alone in a randomized, double-blind trial (29). Table 2 provides the levels of serum or plasma testosterone, free testosterone, and/or bioavailable testosterone achieved with the various doses of MT or the other androgens used to treat women with low libido (23, 27 53). Intramuscular injections of 150 mg of T with estrogen, which lead to supraphysiologic T levels, have been associated with a 15% 20% incidence of hirsutism (54). In contrast, with a dose of 75 mg of T, less than 5% of women develop hirsutism (55). Subcutaneous implants of E 2 and T also result in high serum T levels and may be associated with hirsutism. Burger noted hirsutism in 6% of women receiving implants of 40 mg E 2 and 100 mg of T over 6 months (52), while Cardozo et al. indicated that 21% of their patients developed hirsutism using implants containing 50 mg of E 2 and 100 mg of T (53). In contrast, Davis et al. treated women with pellets containing 50 mg E 2 and 50 mg T and did not note any hirsutism over 2 years (48). There have been several double-blind, placebo-controlled trials of transdermal T in women who have undergone surgical menopause and who were receiving concomitant estrogen treatment. They have shown no difference in objective changes in facial hair growth in women receiving 300 mg/ day of T via a patch that was changed twice weekly versus those receiving only placebo (35, 36, 38, 39). This dose of T results in median serum free T levels within the range found in reproductive-age normal women (35; Table 2). Combining the data from one phase II and two phase III studies with the T patch, 5.12% (34/664) of women receiving placebo patches and 6.98% (46/659) of women receiving 300 mg/day of T reported hirsutism as an adverse event. However, in one study, the facial depilation rate was significantly higher in women who received the 300-mg/day dose of T for 24 weeks than in the women receiving placebo (35). In a placebo-controlled, crossover study of 12 weeks of treatment of premenopasual women with low libido who received either T cream (10 mg/day) or placebo, there was no significant change in the hirsutism score with either treatment (43). These results indicate that there is little or no increase in objective hair growth in women receiving physiologic to slightly supraphysiologic doses of T compared with placebo. However, as the levels of serum T increase, the frequency of reported hirsutism increases. Acne Acne vulgaris results from androgen-stimulated sebum production, keratinization of the sebaceous duct, and colonization of the duct with the anaerobic diphtheroid Propionibacterium acnes (16). T stimulates sebum production in a dose-response manner (17). Acne has been noted in 1% 45% of women receiving 10 mg of MT orally per day, 8% 30% ingesting 2.5 mg a day, and 5.6% 38.5% taking 1.25 mg daily (Table 1). In the same studies, 0 7% of the women on estrogen alone noted acne (23, 25, 26, 29, 56). Approximately 3% of women receiving a combination of estrogen þ 100 mg of T implants were noted to develop acne (52, 53), while none of 16 patients treated with SC pellets of estrogen and 50 mg of T developed acne (48). In the transdermal T trials, 8.65% (57/659) of the women receiving 300 mg/day noted acne, while 6.66% (44/664) of the women on placebo patches developed acne (36, 38, 39). None of the 31 premenopausal women with low libido treated with 10 mg/day of T cream for 12 weeks developed acne (43). In a study of 53 postmenopausal women who received combined estrogen/progestin hormone therapy þ placebo or 10 mg of a T gel, Nathorst-Boos and coworkers noted no significant difference (17% vs. 20.7%) in acne, facial hair, or hair on the legs after 3 months of treatment in a randomized, double-blind crossover trial (44). Virilization Signs of virilization include deepening of the voice, increase in muscle mass, temporal hair recession, and clitoromegaly. All of these changes occur in women with androgen-producing tumors as well as in women receiving large doses of T as part of the female-to-male transsexual conversion (57 59).In two phase III trials of 300 mg/day of transdermal T or placebo given to surgically menopausal women receiving concomitant estrogen treatment, 4.2% (23/549) of women reported alopecia as an adverse reaction, while 2.9% (16/545) of the women receiving placebo had similar complaints (38, 39). Excessive use of an injectable androgen-estrogen combination that resulted in serum T concentrations that were times the upper limit of normal for premenopausal women and times the upper limit of normal for postmenopausal women were noted to result in hirsutism in eight of nine women, clitoral enlargement in seven of the nine, mood changes in three, and temporal hair balding in one (60, 61). Of interest, up to 2 years were required for the T levels to fall to within the normal range in some of these women (60). Clitoromegaly has also been occasionally noted in women receiving T implants (10). In female-to-male transsexuals who received mg of intramuscular testosterone cypionate every month, the stretched clitoral length increased from an average of about 1.25 cm to approximately 5 cm over time, with a plateau occurring at about one year (58). Table 3 provides the mean serum testosterone levels reached with various doses of intramuscular testosterone injections in female-to-male transsexuals (58, 59). As androgen receptors are present in laryngeal tissue, deepening of the voice would be anticipated with T use; it is certainly seen in androgen-treated female-to-male transsexuals (57). It has also been noted in women treated with Fertility and Sterility â 3

12 4 Braunstein Testosterone safety in women Vol. 88, No. 1, July 2007 TABLE 2 Serum or plasma testosterone, free testosterone, and/or bioavailable testosterone levels in women receiving testosterone preparations for low libido expressed as a percentage of the upper limit of the reference range for the method used. Study Drug Route Dose With estrogen Percent of Upper Limit of Reference Range Total testosterone Free T Bio T Lobo et al. (29) MT PO 1.25 mg/d yes 38% ND 109% 4 mo Dobs et al. (27) MT PO 2.5 mg/d yes ND 96% ND 4 mo Raisz et al. (23) MT PO 2.5 mg/d yes 47% ND ND 9 wks Warnock et al. (28) MT PO 2.5 mg/d yes 37% 63% 112% 2 mo Flöter et al. (31) TU PO 40 mg/d no 107% ND ND 1-4 d Flöter et al. (32) TU PO 40 mg/d yes 163% 231% ND 6 mo Penotti et al. (33) TU PO 40 mg/d yes 96% ND ND 8 mo Miller et al. (34)* T TD-patch 150 mg/d no 171% 87% ND 3 mo Shifren et al. (35) T TD-patch 150 mg/d yes 118% 57% 56% 3 mo Braunstein et al. (36) T TD-patch 150 mg/d yes 89%** 29%** 24%** 6mo Choi et al. (37)*,# T TD-patch 300 mg/d no 76% 115% ND 6 mo Miller et al. (34)* T TD-patch 300 mg/d no 307% 182% ND 3 mo Shifren et al. (35) T TD-patch 300 mg/d yes 189% 87% 90% 3 mo Buster et al. (38) T TD-patch 300 mg/d yes 131%** 42%** 56%** 6mo Simon et al. (39) T TD-patch 300 mg/d yes 140%** 55%** ND 6 mo Braunstein et al. (36) T TD-patch 300 mg/d yes 182%** 51%** 50%** 6mo Davis et al. (40) T TD-patch 300 mg/d yes 126%** 66%** 56%** 6mo Shifren et al. (41) T TD-patch 300 mg/d yes 108%** 38%** 38%** 6mo Braunstein et al. (36) T TD-patch 450 mg/d yes 245%** 81%** 62%** 6mo Davis et al. (42) T TD-gel 2mg yes 83% 73% ND 4 mo Goldstat et al. (43)*** T TD-cream 10 mg no 96% 122% $ ND 3 mo Nathorst-Boos et al. (44) T TD-gel 10 mg yes 233% ND ND 3 mo Braunstein. Testosterone safety in women. Fertil Steril When tested

13 Fertility and Sterility â 5 TABLE 2 Continued. Study Drug Route Dose With estrogen Percent of Upper Limit of Reference Range Total testosterone Free T Bio T When tested Sherwin, Geldfand (45) TE-bah IM 150 mg/3 mo yes 133% ND ND 3 mo Sherwin, Geldfand (45) TE-bah IM 150 mg yes 285% ND ND 8 days Sherwin, Geldfand (45) TE IM 96 mg no 111% ND ND 3 mo Burger et al. (47) T Implant 50 mg yes 117% ND ND 6 wks Davis et al. (48) T Implant 50 mg yes 96% (79%) ND ND 6 mo (2 yrs) Worboys et al. (49) T Implant 50 mg yes 180% 139% $ ND 6 wks Kapetanakis et al. (50) T Implant 75 mg yes 357% ND ND 1 mo Buckler et al. (51)*** T Implant 100 mg/6 mo no 204% ND ND 3.3 years Burger et al. (52) T Implant 100 mg yes 223% 244% ND 1 mo Cardozo et al. (53)*** T Implant 100 mg/4-12 mo yes 167% ND ND 6 mo Cardozo et al. (53) T Implant 100 mg/4-12 mo yes 92 ND ND 6 mo Note: Total testosterone levels in women receiving estrogens tend to be higher than in women not receiving estrogens because of higher levels of sex hormone-binding globulin. Therefore, the free or bioavailable testosterone levels more accurately reflect the testosterone available to the tissues. PO, taken orally; ND, not determined; d, days; mo, months; wks, weeks; Free T, free testosterone level; Bio T, bioavailable testosterone level; T, testosterone; MT, methyltestosterone; TU, testosterone undeconate; TD, transdermal; IM, intramuscularly; TE-bah, testosterone enanthate benzilic acid hydrazone; TE, testosterone enanthate. * HIV infected women. Not all postmenopausal. ** Median and not mean reported. *** Premenopausal women. # Peak total testosterone 134% at 24 hours and peak free testosterone 140% at 24 hours. $ Free androgen index used in place of free testosterone. Braunstein. Testosterone safety in women. Fertil Steril 2007.

14 TABLE 3 Mean serum testosterone levels before and after intramuscular testosterone therapy in female-to-male transsexuals following one year of therapy. Author Drug Dose Mean Serum testostone (ng/dl) Meyer et al. (58) None 93 ng/ml T cypionate mg/2 weeks 817 T cypionate 200 mg/2 weeks 922 T cypionate 400 mg/2 weeks 1765 Elbers et al. (59) None 46 T esters 250 mg/2 weeks 896 Note: To convert ng/dl to pmol/l divide by T ¼ Testosterone. Braunstein. Testosterone safety in women. Fertil Steril nandrolone decanoate added to menopausal hormonal therapy (62). Voice changes have been reported in 10% 20% of women using 10 mg of MT orally a day for 6 weeks to 3 years (20, 22, 63). In the transdermal T studies, 2.2% (12/ 545) of participants receiving placebo noted voice change, while 2.7% (15/549) of the women receiving T had similar complaints (38, 39). CARDIOVASCULAR EFFECTS Epidemiological Studies Several studies have examined the relationship between endogenous serum T levels and CAD in women (64). Slowinska-Srzednicka and colleagues studied 21 women who had sustained a myocardial infarction and had coronary artery stenosis on angiography and compared them with 14 women with an abnormal exercise stress test but normal coronary arteries and nine healthy women (65). All women were premenopausal. The women with CAD had lower levels of DHEAS and higher fasting insulin levels and insulin response to an oral glucose tolerance test, but there were no significant differences between the groups in regards to the concentration of E 2, androstenedione, or T. Another study of 60 postmenopausal women undergoing angiography used multiple regression analysis to evaluate the relationship between the degree of CAD and several variables including lipids, E 2, total T, free T, DHEAS, sex hormone binding globulin (SHBG), and insulin. Only free T and total cholesterol showed a significant relationship to the degree of CAD (66). Another cross-sectional study examined the relationship between carotid artery intimal-medial thickness and DHEAS, androstenedione, total and free T, and insulin in 101 pre- and postmenopausal women. Of interest, DHEAS, androstenedione, and free T were inversely related to carotid artery thickness, suggesting that within the physiological range, DHEAS and androgens in women are correlated with a lower risk of carotid artery atherosclerosis (67). Low serum levels of SHBG have been associated with the metabolic syndrome and cardiovascular risk factors in women with PCOS. However, this syndrome is also associated with hyperinsulinism, and the insulin excess may inhibit hepatic SHBG production. In the Study of Women Across the Nation (SWAN), low SHBG and/or high free androgen index were related to a variety of cardiovascular risk factors including higher insulin and glucose, higher plasminogen activator inhibitor type 1, tissue plasminogen activator, highly sensitive C-reactive protein, and activated factor VII-c (68, 69). In the Gothenburg, Sweden, longitudinal study of randomly selected women, Lapidus and coworkers evaluated the SHBG levels in a cohort of postmenopausal women not receiving hormone therapy and noted no relationship between the 12- year incidence of myocardial infarction, angina pectoris, or stroke but did find a significant correlation between low SHBG levels and overall mortality (70). A more direct examination of the relationship among SHBG, androgens, and cardiovascular disease was carried out by Hauner et al. They found no differences in the serum concentrations of T and SHBG in 30 women with CAD on coronary angiograms, 21 women undergoing angiography but found to be free of major stenosis, and 25 healthy women without signs of CAD (71).In a similar study, Reinecke and colleagues evaluated 87 consecutive postmenopausal women undergoing coronary angiograms and found that in comparison with the 32 women without CAD, the 55 women with CAD had significantly higher basal insulin levels, higher insulin/glucose ratio, lower insulin sensitivity, and lower SHBG levels but no difference in T or DHEAS concentrations (72). A multivariate analysis by logistic regression indicated that low levels of SHBG were associated with CAD independently of insulin, obesity markers, and dyslipidemia. A relationship between low SHBG concentrations and atherosclerosis was also demonstrated in a casecontrol study carried out in a group of 182 participants in the Atherosclerosis Risk in Communities cohort of postmenopausal women who were at or above the 95th percentile for carotid intimal-medial thickness and who were compared with 182 controls with carotid thickness less than the 75th percentile. Cases had significantly higher concentrations of estrone and androstenedione and lower SHBG levels than controls, but no differences were noted with DHEAS, total 6 Braunstein Testosterone safety in women Vol. 88, No. 1, July 2007

15 T, or total T/SHBG ratio. Compared with participants in the lowest quartile of total T, those in the highest quartile had lower odds of atherosclerosis, as did women in the highest quartile for SHBG. Thus, total T levels in the high normal range were associated with less atherosclerosis than those with lower T levels (73). In a nested case-control study of 200 postmenopausal women who developed cardiovascular disease and who were participating in the Women s Health Study, low SHBG and elevated free androgen index were noted in women who were not using hormone therapy. However, after adjustment for known cardiovascular risk factors, an independent association was no longer present (74). A 19-year prospective study carried out in the Rancho Bernardo, California, community examined the relationship between androstenedione, total and bioavailable T, estrone, and total and bioavailable E 2 concentrations and the risk of death from cardiovascular and ischemic heart disease. None of the age-adjusted hormone concentrations differed significantly in women with or without a history of heart disease at baseline, and none predicted cardiovascular death (75). There are very little data available concerning the longterm cardiovascular safety of androgen administration to women. Postmarketing data on a combination product containing EEs and MT (1.25 or 2.5 mg) did not identify an increased risk of cardiovascular disease in women (19, 56). Van Kestern et al. performed a retrospective analysis of 293 female-to-male transsexuals with a mean age of 34 years (range, years) who were treated with large doses of T for a total of 2,418 patient-years (range, 2 months to 41 years). They did not find any cardiovascular mortality or an increase in myocardial infarction or hypertension over that expected in the population at large (76). Blood Pressure The majority of epidemiological studies have not found a relationship between endogenous serum androgen or SHBG concentrations and systolic or diastolic blood pressure (67, 70, 75, 77). In the SWAN cohort, there was a correlation between total T and free androgen index and diastolic but not systolic blood pressure (68). None of the treatment trials with a combination of oral estrogens and MT or T undeconate, SC T pellets, or T patches have shown an increase in blood pressure after androgen administration, and one noted a decrease with EEs and MT given for 2 months (24, 25, 35, 36, 38, 39, 49, 78). In a 3-month trial of oral T undecanoate given to postmenopausal women in doses to raise the serum T into the premenopausal female range, there was a significant decrease in diastolic blood pressure (79). In addition, the studies carried out on female-to-male transsexuals who received doses of exogenous T to raise the serum T level into the mid-to-high male range have not shown an increase in blood pressure (58, 59, 76). Lipids The effect of exogenous T on lipids in women depends on the dose, whether estrogens or estrogen þ a progestin are concurrently given, and the route of administration. Female-to-male transsexuals using pharmacologic doses of T, which increases the serum T into the mid-to-high normal range for males, experience increased total cholesterol, low-density lipoprotein (LDL) cholesterol, apolipoprotein- B, and triglycerides and decreased high-density lipoprotein (HDL) cholesterol with pharmacological quantities of IM T, which increase the serum T into the high normal range for males (58, 80). In the trials of postmenopausal women receiving estrogen and oral MT, the total cholesterol decreased by 6% 17%; HDL was reduced as much as 26%; and the changes in LDL were variable, going from a 7% increase to a 19.3% decrease. In most studies, there was a reduction in triglycerides (Table 4; 23, 24, 26 30, 33, 35, 44, 47, 48, 52, 79, 81, 82). Thus, the major negative effect on cardiovascular risk factors with oral T therapy is the reduction in HDL cholesterol, which is due to the first-pass effect on the liver. Whether this is offset by the reduction in LDL cholesterol and triglycerides is unknown. Parental T, given by SC implants, or by IM injection in conjunction with estrogen, results in a lowering of total cholesterol, LDL cholesterol, and triglycerides, with a slight increase in HDL cholesterol, which results in a mildly beneficial, antiatherogenic lipid profile (Table 4; 82). Buckler et al. treated 22 patients with severe premenstrual syndrome with 100 mg SC T implants every 6 months for a mean duration of 3.3 years and compared them with 22 age-matched control patients with severe premenstrual syndrome who had not received T therapy (51). Of interest, all patients continued to have regular menses. The T-treated group had a reduction in apolipoprotein A1 and HDL cholesterol, an elevation in very low density lipoprotein cholesterol, and no difference in total serum cholesterol and triglycerides or LDL cholesterol, apolipoprotein B, lipoprotein(a), lecithin:cholesterol acyltransferase, and cholesteryl ester transfer protein activity compared with the control women (51). The effects of transdermal T on lipid values appear to be neutral compared with estrogen therapy alone or with placebo (Table 4; 35, 36, 38 40). Vascular Reactivity Studies in animals have shown that T may induce acute vasodilatation by a mechanism that is too rapid to be mediated through the nuclear androgen receptor and that, hence, has been thought to work through a nongenomic pathway (83). That a similar mechanism is present in humans is supported by the demonstration of an acute anti-ischemic effect of a 5-minute IV infusion of T and increased coronary artery diameter and blood flow after an infusion of T into the right coronary artery (84, 85). Sarrel and Wiita compared the effects of 1.25 mg EEs alone or 1.25 mg EE þ 2.5 mg MT given daily for 8 weeks on postocclusion fingertip blood flow and vaginal blood flow. They found a slight but nonsignificant increase in blood Fertility and Sterility â 7

16 TABLE 4 Effects of various androgen preparations on total cholesterol (TC), high-density lipoprotein cholesterol (HDL), low-density lipoprotein cholesterol (LDL), and triglycerides (TG) in women. Therapy (dose) (reference) Route n TC HDL LDL TG MT (1.25 mg) þ EE (0.625 mg) Oral (14, 26, 29, 30) MT (2.5 mg) þ EE (1.25 mg) Oral (23, 26 28, 30) TU (40 mg/day) (79) a Oral 21 NC 9 NC þ18 TU (40 mg/day) þ E 2 (2 mg/day) Oral NC (79) a TU (40 mg/day) þ TDE 2 Oral (50 mg/day) þ MPA (33) b T (300 mg/day) þ CEE (9, 35) c TD patch T (10 mg) þ E þ P (44) d TD-gel 53 þ þ3.5 þ4.2 T (50 mg/3 months) þ E 2 SC NC (50 mg) (48) T (100 mg) þ E 2 (50 mg) (81) e SC þ T (150 mg) þ E 2 (82) f IM þ NC Note: Numbers represent the mean percent change from baseline from studies in which the androgen was administered for a minimum of 1 month. a Extrapolated from Figure 2 in reference 79. b Patients received TD E 2 plus medroxyprogesterone acetate (10 mg/day) orally for 12 days every 2 months. c All patients on daily oral CEEs. Not all patients had each lipid subtype measured. d Patients were receiving combined estrogen/progestogen hormone therapy, cyclic or continuous, for at least 2 months. e Values based on lipid results at 2 months after injection, which represents the time of peak serum T. f Injections contained 150 mg T enanthate, 7.5 mg E 2 dienanthate, and 1 mg E 2 benzoate. Data are extrapolated from Figures 1 3 in reference 82. Braunstein. Testosterone safety in women. Fertil Steril flow with the estrogen-t preparation in comparison with the estrogen-only group, which indicates that the androgen treatment did not diminish the vasodilator effects of estrogen treatment in postmenopausal women (86). Another study by Penotti et al. examined the pulsatility index of the internal carotid artery and the middle cerebral artery in 40 postmenopausal women who were receiving 50 mg/day of transdermal E 2 þ medroxyprogesterone acetate 10 mg/day every other month. Half of the women received 40 mg/day of oral T undecanoate, while the other 20 served as controls. After 8 months, there was no significant difference between the groups in the pulsatility index of the internal carotid artery, while there was a significant increase in the index of the middle cerebral artery, which suggests that androgens may have reduced some of the positive effects of estrogen (33). The discrepancies between these two studies may relate to the vessels being studied, the duration of androgen administration, the level of androgen that the vessels were exposed to, and the use of estrogen þ P þ T in the Penotti et al. study as opposed to estrogen þ T in the Sarrel and Wiita study. The ability of the blood vessels to dilate in response to the reactive hyperemia after release of occlusion of the brachial artery is referred to as flow-mediated vasodilatation (FMD) and reflects shear stress-induced endogenous release of nitric oxide from the endothelium (endothelium-dependent vasodilatation). A reduction in FMD is associated with atherosclerosis (87). Female-to-male transsexuals receiving large doses of T did not exhibit a significant difference in FMD compared with age-matched normal females (59). However, endothelium-independent vasodilatation, as assessed by the change in brachial artery diameters after the administration of nitroglycerine, was significantly lower in the transsexuals than in normal women, which suggests some impairment in vascular reactivity (59). Of interest, the female-to-male transsexual patients had significantly larger baseline vascular diameter than did the female controls, which may offset any of the negative effects of the impaired endothelium-independent vasodilatation (59). In 33 postmenopausal women on estrogen therapy for more than 6 months, Worboys et al. found that 6 weeks after the SC implantation of 50 mg of T, there was a significant mean increase (42%) in brachial artery FMD in comparison with the pre-t baseline and in comparison with the response of the controls (postmenopausal women not using estrogen, 8 Braunstein Testosterone safety in women Vol. 88, No. 1, July 2007

17 progestin, or androgen therapy) (49). There was also a significant increase in nitroglycerine-induced vasodilatation after T administration, while no change was noted in the brachial artery diameter in the T-treated group (49). It is unknown whether these positive effects of T are due to a direct androgen effect on the vasculature or are mediated by conversion of T to estrogen by the aromatase present in vascular smooth muscle cells (88). Viscosity, Coagulation Factors, and Hemoglobin Increased plasma viscosity is a risk factor for cardiovascular disease and is primarily determined by levels of triglyceride and fibrinogen (89 92). Basaria and colleagues found that in 20 women receiving 1.25 mg of EEs þ 2.5 mg daily oral MT, there was an increase in serum fibrinogen, a decrease in triglycerides, and a significant decrease in plasma viscosity (93). Obviously, more studies are necessary to examine the effect of T on the factors that affect viscosity, but at present, there are no data to suggest an adverse effect of T on this risk factor. An increase in coagulation factors or a decrease in fibrinolysis are associated with cardiovascular disease (51). In the Buckler et al. study, 22 women with severe premenstrual syndrome who were treated every 6 months with a 100-mg SC T implant for over 2 years. They were compared with 22 women matched for age, and there was no difference in prothrombin time or levels of fibrinogen, antithrombin-iii, protein C, total protein S, free protein S, tissue plasminogen activator, plasminogen activator inhibitor, beta thromboglobulin, or prothrombin fragments 1 and 2, and all levels remained within the normal range. The mean serum T level in the T-treated group was ng/dl (4.5 nmol/l), while that in the control group was 54.8 ng/dl (1.9 nmol/l) (51). Four months of high-dose T treatment of 17 female-to-male transsexuals resulted in a reduction in normalized activated protein C sensitivity ratios, increases in protein S total and free antigen, and no change in protein C antigen or prothrombin levels (94). Overall, this treatment, which increased the serum T from 60.1 ng/dl (2.1 nmol/l) to 952 ng/dl (33 nmol/l), resulted in a mild antithrombotic effect. An elevated hemoglobin concentration also is a risk factor for cardiovascular disease. Since androgen therapy stimulates erythropoiesis and has been used therapeutically to treat the anemia of chronic diseases, it is reasonable to anticipate the possibility that some women might develop polycythemia with androgen treatment (95). Although slight increases in hemoglobin have been found in some patients (34), neither polycythemia nor clinically significant increases in hemoglobin have been found in the majority of studies that have examined the effect of physiological to slightly superphysiological doses of androgen given to women (24 26, 35, 36, 38 42, 78). Even with the large pharmacological doses of T used to treat female-to-male transsexuals, the hemoglobin levels only rise to the levels seen in biological males (96). Together, these results indicate that T treatment does not lead to adverse cardiovascular consequences through adverse changes in serum viscosity, coagulation or fibrinolytic factors, or the induction of polycythemia. Insulin Resistance Insulin resistance is a major etiologic component of the metabolic syndrome, which is associated with cardiovascular disease. In a case-control study of carotid atherosclerosis carried out in a subset of women participating in the Atherosclerosis Risk in Communities Study, Golden and coworkers found that the free androgen index, but not total T, was positively associated with the metabolic syndrome, particularly the hyperinsulinemia and hyperglycemia components of the syndrome (97). Several studies have examined the effects of androgen administration on metabolic factors in women. In otherwise normal surgically menopausal women, fasting glucose and insulin levels demonstrated no significant changes for up to 6 months in the phase II and phase III trials on transdermal T (35, 36, 38 40). In a placebo-controlled randomized trial of HIV-infected women with recent weight loss, 300 mg/day of transdermal T did not affect insulin sensitivity as assessed by glucose and insulin levels during a 3-hour IV glucose tolerance test (98). The administration of 30 mg of nandrolone decanoate every 2 weeks for 9 months in 10 healthy obese women on a low-fat diet led to an increase in lean body mass, a decrease in fat mass, and increased visceral fat but no change in fasting blood sugar or insulin sensitivity assessed by the Minmod method (99). Zang and colleagues performed an open-label study on 63 naturally postmenopausal women, who were randomized to receive T undecanoate (40 mg orally every second day), E 2 valerate (2 mg orally/day), or the combination for 3 months. There were no significant changes in fasting glucose or insulin in any of the groups. Basal insulin sensitivity was increased in the estrogen-only group and unchanged in the others. During the hyperinsulinemic euglycemic clamp study, glucose uptake was reduced by about 15% 20% in the T-treated groups but not in the estrogen-only group. There were no differences in the treatment effect among the three groups, which indicates that any decrease in insulin sensitivity was mild (79). Diamond et al. studied normal, regularly menstruating, nonobese women before and after days of treatment with 5 mg 3 times a day of MT. They assessed insulin sensitivity with the hyperinsulinemic hyperglycemic and euglycemic clamp techniques and found no change in fasting glucose, insulin, c-peptide, glucagons, or glucose turnover. During the high-dose insulin infusion, but not the low-dose insulin infusion, whole-body glucose uptake was significantly decreased, and the rate of glucose uptake per unit of insulin also decreased, which indicates that there was a reduction of insulin sensitivity at supraphysiologic insulin levels (100). Similar results were noted in 13 female-to-male transsexuals who were studied before and after 4 months of IM injections every 2 weeks of 250 mg of Testers (101). Endogenous glucose production was not altered, but there was a significant reduction Fertility and Sterility â 9

18 in glucose uptake during a hyperinsulinemic euglycemic clamp, which indicates some induction of insulin resistance. However, the interpretation is confounded by weight gain in the patients over the 4 months of treatment (101). Elbers et al. also studied 17 female-to-male transsexuals who were given 250 mg of T esters every 2 weeks for 1 year. Using the hyperinsulinemic euglycemic clamp technique, they found no change in fasting blood sugar or insulin levels and no change in insulin sensitivity in the physiological range. They did note a statistically significant reduction in the whole-body glucose uptake during the infusion of supraphysiological levels of insulin, consistent with the findings of Diamond and coworkers (59). Thus, T administration in otherwise healthy women that results in physiologic to slightly superphysiologic serum free T levels does not result in clinically significant insulin resistance or the metabolic syndrome. EFFECTS ON THE ENDOMETRIUM Estrogen stimulation of the endometrium, unopposed by the protective effect of luteal phase P levels, increases the risk of endometrial cancer (102). Although androgens do not directly stimulate endometrial cells ( ), endometrial cancer cells exhibit aromatase activity (104, 107, 108). Thus, there is a concern that androgens may be converted into estrogens by endometrial cancer cells and thereby stimulate endometrial cancer cellular proliferation (109, 110). In a case-controlled study of women with endometrial cancer, Potischman and colleagues found significantly higher levels of androstenedione and lower levels of SHBG in pre- and postmenopausal women with endometrial carcinoma (109). Similarily, Lukanova et al. carried out a case-control study on 124 postmenopausal women with endometrial carcinoma and found significantly increased odds ratios for endometrial cancer for quartiles with the highest hormone levels relative to the lowest for E 2, estrone, androstenedione, T, and DHEAS and an inverse relationship with SHBG (111). However, adjustment of androstenedione and T for E 2 or estrone levels resulted in a loss of statistically significant relationships. In patients with endometrial carcinoma, there is no relationship between the proliferation activity and the serum levels of androstenedione or T (106). A comparison of endometrial biopsies of 26 women randomly assigned to receive 6 months of EE alone or with 1.25 mg/day of MT, without progestins, showed estrogenstimulated proliferative growth in both groups, with no difference in distribution of biopsy scores (30). In a 4-month randomized, double-blind trial of 150 women with natural menopause, Lobo and colleagues found endometrial hyperplasia in one of 74 women taking EE and 1.25 mg/day of MT, compared with one of 76 women who were given EE alone (29). No change in endometrial thickness was noted at any time period in 53 women receiving combined estrogen/progestin treatment after natural menopause who were enrolled in a double-blind, randomized, crossover study of 10 mg/day of transdermal T or placebo for 3 months each (44). Similarly, 8 months of 40 mg/day of oral T undeconate along with 50 mg of transdermal E 2 and 10 mg/day oral medroxyprogesterone acetate given for 12 days every other month resulted in a nonsignificant 16.5% decrease in endometrial thickness, while the control group had a 2.7% decrease in thickness (33). It is difficult to draw firm conclusions about the endometrial safety of T from these studies as androgens were studied against a background of estrogens or estrogens þ progestin. Futterweit and Deligdisch studied 19 female-to-male transsexuals who received large doses of T enanthate (usually 400 mg IM every 3 4 weeks). They found that 12 of the 19 (63.2%) had a proliferative endometrium, three of which were associated with mild glandular cystic hyperplasia, and seven (36.8%) of which had an inactive endometrium (112). Thus, pharmacological doses of androgens appear to be associated with endometrial stimulation. BREAST CANCER The increased risk of breast cancer found in postmenopausal women using estrogens and progestins as postmenopausal hormone therapy in the WHI and the Million Woman Study (as well as in other trials) (13, ) has raised concerns that androgens may either directly or indirectly stimulate the development or growth of breast cancer, despite the fact that androgens had been used to treat breast cancer in the past. Normal mammary epithelial tissue and breast cancers contain androgen receptors ( ) that are coexpressed with the estrogen and P receptors. The periglandular breast fat contains the aromatase enzyme complex, which theoretically could transform circulating T into E 2, potentially stimulating the breast glandular tissue in a paracrine fashion. However, studies have shown that aromatase activity in breast cancer tissue is inversely related to the estrogen status of the women those with low serum estrogen concentrations have higher aromatase activity, while women receiving estrogens have lower aromatase activity, which suggests that androgen administration given on a background of concomitant estrogen treatment is unlikely to result in much local biotransformation to estrogens ( ). Additionally, in the transdermal T patch and gel studies, the mean serum estradiol level following testosterone administration averaged 104% of the baseline, with a range of 79% 125% in the various studies (34 36, 38 44). Following the intramuscular administration of testosterone esters in female-to-male transsexuals, the average serum estradiol level was 99.2% of the baseline, with a range of 96% 113% (56, 57). Thus, there appears to be little aromatization of testosterone to estradiol, at least as assessed by serum estradiol levels. Also, since T binds to SHBG more avidly than does E 2, it is conceivable that raising the circulating concentrations of androgens would displace E 2 from SHBG. However, as noted above in the transdermal T studies, there was no elevation in either the total or free E 2 levels after T administration compared with the baseline values (36, 38 42). 10 Braunstein Testosterone safety in women Vol. 88, No. 1, July 2007

19 Studies on the effects of androgens on breast cancer cell lines have shown variable responses that are dependent on the cell line used, the type and concentration of androgen tested, and the presence or absence of estrogen in the media (128, 129). As summarized by Somboonporn and Davis, most studies indicate that androgens inhibit estrogen-mediated proliferation and stimulate apoptosis of the breast cancer cells (128). Similarly, in animal models of breast cancer, androgens inhibit breast cancer growth (128, 129). Dimitrakakis and coworkers studied the effects of hormone replacement on breast epithelial proliferation in oophorectomized rhesus monkeys (130). With replacement of E 2 or E 2 þ P in quantities that raised the serum levels to those seen in cycling rhesus monkeys, the breast proliferation index rose about threefold, whereas the addition of physiological concentrations of T to E 2 reduced the stimulation by almost 50%. These investigators also showed that the administration of the pure antiandrogen flutamide to cycling rhesus monkeys for 3 months resulted in a doubling of the mammary epithelium proliferation rate. Testosterone administered to ovariectomized rhesus monkeys decreased estrogen-stimulated estrogen receptoralpha expression (120) Thus, in the primate model, androgens antagonize the effects of estrogen or estrogen þ P on the breast tissue. Multiple prospective case-control studies in women have attempted to examine the relationship between the endogenous levels of T and breast cancer. Interpretation of the results is confounded by several variables, including low numbers of cases in some studies, the use in some studies of T assays that were not optimized for the low levels of T seen in women, especially the older cohort, and, in several of the reports, inadequate adjustment for important variables, especially the independent effect of estrogen. Indeed, many studies have shown that T and E 2 track together when E 2 levels are high, so are T levels, which should not be too surprising since T serves as a prohormone for E 2 ( ). Most of the studies have shown no significant increase in odds ratios or relative risk ratios between quartiles of serum T levels and breast cancer, especially when adjusted for other variables such as age, body mass index, age of menarche, family history of breast cancer, and E 2 levels (131, 132, ), while a few have shown increased risk with increasing T levels (133, ), even when corrected for E 2 levels (133, ). Prospective cohort and case-control studies of women with polycystic ovarian disease and endogenous hyperandrogenism have not shown an increased risk of breast cancer, which provides additional evidence that elevated serum T concentrations are not a risk factor for breast cancer ( ). None of the prospective controlled clinical trials of T treatment in postmenopausal women have been adequately powered to determine whether exogenous T administration alters the risk of breast cancer. A prospective cohort study in the Nurses Health Study noted a 1.77 relative risk for breast cancer in women using estrogen þ T in comparison with never users, which was significantly greater than the risk of estrogen-only therapy (relative risk of 1.15) but not different than estrogen þ progestin users (relative risk of 1.58) (150). However, the increased risk with estrogen þ T was only significant during the first 5 years of therapy and was not significant for those using the therapy for 5 or more years. Only 2.4% of the estrogen þ T users had never used other postmenopausal hormone therapy, and the data were not analyzed to ferret out the effect of the prior hormone use; therefore, the potential for recall bias in this study was substantial. Testosterone users were also noted to be younger, leaner, and more likely to have benign breast disease and consumed more alcohol than never users, additional factors that confound the interpretation (150). Three retrospective series have attempted to evaluate the risk but suffer from low numbers of subjects or lack of appropriate controls ( ). One showed no increased risk with MT þ CEEs (151), while another indicated that there was an increased risk with injectable T and E 2 but not with injections of T, E 2, and progestin (152). The third suggested a decreased risk in women receiving estrogen þ T implants when the cases of breast cancer/100,000 women-years were compared with the reported incidence from the WHI and the Million Women study estrogen þ progestin users or even those women in that study who never used postmenopausal hormone treatment (153). Two additional studies concerning the effects of T on the breast are worth noting. Burgess and Shousha examined mastectomy specimens from 29 female-to-male transsexuals who had received long-term androgen therapy before surgery and compared the histological findings with normal female breast tissue obtained at the time of reduction mammoplasty. There were no differences noted in the prevalence of normal acini and ducts, fibrosis, cysts and apocrine metaplasia, estrogen and P receptors, or components of cyst fluid (154). The only difference was a significant increase in microcalcifications in the breasts of transsexual patients. Hofling and coworkers performed fine-needle aspirations of breast tissue before and after 6 months of continuous combined estrogen-progestin therapy with either 300 mg/day of T delivered transdermally via a patch or a placebo patch. They examined the proliferation index of the epithelial and stromal components and noted that the estrogen þ progestin therapy led to a significant increase in proliferation, which was markedly attenuated in women receiving estrogen þ progestin þ T (155). Although the recent data from the Nurses Health Study raise a concern about T and the risk of breast cancer, most of the available data do not support the concept that T treatment in women will increase the risk of breast cancer; rather, the data suggest that either there is no effect or T may actually reduce the risk of breast cancer by antagonizing the effects of estrogen on the mammary tissue. LIVER TOXICITY Elevations of transaminases, cholestatic jaundice, peliosis hepatis, and liver adenomas have been reported in femaleto-male transsexuals receiving high doses of MT orally (74, Fertility and Sterility â 11

20 156). Supraphysiologic doses of parental T esters or oral T undeconate given to this population have also been associated with elevation of liver enzymes, but the degree of elevation was mild and did not exceed 2.5 times the upper limit of normal (58, 76). In addition, liver abnormalities have been reported anecdotally in women receiving large doses of MT for other reasons, although toxicity is not generally seen in patients receiving both estrogens and androgens (19). Hepatic dysfunction has not been noted in the trials of oral EEs þ 1.25 or 2.5 mg of T to postmenopausal women (24 27, 30, 78). Similarly, there has been no liver toxicity reported in the transdermal T patch or gel studies (35, 36, 38 42, 44). Liver toxicity primarily appears to be related to dose and route of administration, with very high doses and the use of oral 17a-alkylated steroids (which have a firstpass effect on the liver) being major risk factors. Hostility Abuse of anabolic steroids by male athletes has been associated with roid rage extreme hostile and aggressive behavior on and off the playing field. Therefore, it would be anticipated that androgen administration to women could have similar effects. A 1997 safety surveillance report on the use of oral EEs and 1.25 or 2.5 mg of MT given orally daily noted that 1.7% of the 863 adverse event reports reported spontaneously to the Adverse Reaction Information System from 1989 through 1996 were related to hostility. The events noted were aggressive behavior, aggressive feelings, rage/angry outbursts, and physical attacks and regretful feelings. These events responded to or abated with dose reduction (54). An increase in the mean hostility scores also were noted in the prospective, double-blind, randomized trial of supraphysiologic doses of T enanthate given to women who underwent bilateral oophorectomy (45). Aggressive or hostile behavior has not been reported in the various trials that have used T preparations that result in physiologic or slightly supraphysiologic serum concentrations of T (35, 36, 38, 39, 41, 42). SLEEP APNEA Sleep apnea, which has been a concern in males receiving high doses of androgens, has not been reported as a problem in women on low-dose androgen treatment. RISK OF FETAL VIRILIZATION Although not an issue in a postmenopausal woman, the FDA Advisory Committee raised a concern about off-label use of androgens in premenopausal women and potential exposure of a fetus to androgens (9). In the developing fetus, the external genitalia remain undifferentiated until 8 weeks of gestation. In the urogenital tubercle and sinus and the labioscrotal tissue, type 2 5a-reductase converts T to dihydrotestosterone, which stimulates growth of the phallus and the fusion of the labioscrotal folds to form a scrotum and penile urethra between 8 and 12 weeks (157). Thus, exposure of a female fetus during this time to excessive quantities of T or dihydrotestosterone may lead to female pseudohermaphroditism. After the critical period for external genitalia formation, elevated androgen levels stimulate further growth of the phallus, leading to clitoromegaly and labial hypertrophy if labioscrotal fusion has not occurred. Fetal virilization has been noted in infants whose mothers took nonaromatizable androgens and progestins and in a few babies born to mothers with virilizing ovarian or adrenal neoplasms ( ). However, the vast majority of babies born to women with endogenous hyperandrogenism due to polycystic ovaries, congenital adrenal hyperplasia, hyperreactio luteinalis, or virilizing luteomas of pregnancy do not exhibit any evidence of virilization ( ). The major reason is the tremendous capacity of the placenta to aromatize androstenedione to estrone and T to E 2 because of the presence of high concentrations of aromatase cytochrome P-450, which increases throughout pregnancy (168). In fact, in several studies at term, the fetal cord blood T level of normal infants born to women who developed virilization during pregnancy associated with massive elevations of T in the maternal serum (e.g., 15 mg/dl; 166) were 3.1% 4.5% of the maternal levels, while fetal cord blood E 2 levels were higher than normal, reflecting the enhanced aromatization of the T (166, 169). The importance of the placental aromatase system is reflected in the cases of female pseudohermaphrodism that have been noted in infants with placental aromatase deficiency ( ). Other factors that may also protect the fetus from virilization during pregnancy include the elevated SHBG level, which reduces the free T concentration and, possibly, the antiandrogenic effects of the high levels of P (167, ). Thus, if a woman receiving T therapy, either percutaneously or IM, becomes pregnant, the likelihood that the fetus would be adversely affected is very low since the levels of total T reached in the maternal serum with these therapies rarely exceed 100 ng/dl and the free T would be substantially reduced because of the estrogen-stimulated elevation of SHBG concentrations. SUMMARY AND CONCLUSIONS There are very little prospectively collected long-term data concerning the safety of T administration to women. Nevertheless, the information gleaned from controlled studies that were carried out for up to 2 years as well as observational information obtained from women receiving T as part of postmenopausal hormone therapy and from T-treated female-tomale transsexuals have provided a great deal of reassurance. The androgenic side effects of hirsutism and acne are the major adverse reactions; they are dose and time related and generally reversible when the T is discontinued. Virilization is rare and, again, is dose and time related. Oral, but not parental or transdermal, androgens may lower HDL cholesterol 12 Braunstein Testosterone safety in women Vol. 88, No. 1, July 2007

21 through a first-pass effect on the liver, which may result in a more atherogenic lipid profile. Exogenous T given in doses that result in physiologic to slightly superphysiologic serum T concentrations does not increase cardiovascular risk through alterations in blood pressure, vascular reactivity, blood viscosity, hemoglobin concentrations, coagulation factors, or insulin sensitivity. The data are too sparse to draw any conclusions about endometrial safety. In vitro studies on breast cancer cell lines and in vivo experiments on nonhuman primates indicate that androgens may actually decrease the risk of breast cancer through antagonism of estrogen action on the mammary epithelium. The limited studies in humans lend some support to these findings, although the Nurses Health Study drew opposite conclusions. The neurobehavioral effects of androgens have not been fully elucidated, but there is a suggestion that aggressiveness and hostility may develop in some women. The risk of virilization of a female fetus whose mother received T (but not nonaromatizable androgens) in doses designed to provide physiological serum T levels is nil. This is based on examining children born to women with polycystic ovary disease, congenital adrenal hyperplasia, or androgen-secreting tumors and is primarily due to the tremendous ability of the placenta to aromatize maternal T. Many of the studies that have examined the safety of exogenous T have done so against a background of estrogen or estrogen þ progestin. Therefore, it is important that studies be carried out in women who receive T as monotherapy without the other sex steroid hormones. Also, since the above conclusions are extrapolated from relatively short-term studies, it is important that long-term safety data be obtained on women given T therapeutically. A well designed, phase IV study using large health plan databases should yield the needed additional safety information. Acknowledgment: The author thanks T. Keta Hodgson, R.N., for her helpful comments during the preparation of the manuscript. REFERENCES 1. Geist S, Salmon U. Androgen therapy in gynecology. JAMA 1941;117: Kurzrok L, Rothbart H. Treatment of female menopause with methyltestosterone and stilbestrol. Am J Surg 1942;56: Greenblatt R. Androgenic therapy in women. Endocrinology 1942;2: Salmon U, Geist S. Effects of androgens upon libido in women. J Clin Endocrinol Metab 1943;3: Greenblatt RB, Barfield WE, Garner JF, Calk GL, Harrod JP, Jr. Evaluation of an estrogen, androgen, estrogen-androgen combination, and a placebo in the treatment of the menopause. J Clin Endocrinol Metab 1950;10: Braunstein GD. Androgen insufficiency in women. Growth Horm IGF Res 2006;16(Suppl): Alexander J, Dennerstein L, Burger H, Graziottin A. Testosterone and libido in surgically and naturally menopausal women. Women s Health 2006;2: Somboonporn W. Testosterone therapy for postmenopausal women: efficacy and safety. Semin Reprod Med 2006;24: Advisory Committee for Reproductive Health Drugs. gov/ohrms/dockets/ac/04/transcripts/ t1.htm. December 2, Slayden SM. Risks of menopausal androgen supplementation. Semin Reprod Endocrinol 1998;16: Basaria S, Nguyen T, Rosenson RS, Dobs AS. Effect of methyl testosterone administration on plasma viscosity in postmenopausal women. Clin Endocrinol (Oxf) 2002;57: Hulley S, Grady D, Bush T, Fuberg C, Herrington D, Riggs B, et al. Randomized trial of estrogen plus progestin for secondary prevention of coronary heart disease in postmenopausal women. Heart and Estrogen/progestin Replacement Study (HERS) Research Group. JAMA 1998;280: Rossouw JE, Anderson GL, Prentice RL, La Croix AZ, Kooperberg C, Stefanick ML, et al. Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Women s Health Initiative randomized controlled trial. JAMA 2002;288: Wu FC. Endocrine aspects of anabolic steroids. Clin Chem 1997;43: Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome. Fertil Steril 2004;81: Deplewski D, Rosenfield RL. Role of hormones in pilosebaceous unit development. Endocr Rev 2000;21: Rosenfield RL. Pilosebaceous physiology in relation to hirsutism and acne. Clin Endocrinol Metab 1986;15: Kirschner MA. Hirsutism and virilism in women. Spec Top Endocrinol Metab 1984;6: Gelfand MM, Wiita B. Androgen and estrogen-androgen hormone replacement therapy: a review of the safety literature, 1941 to Clin Ther 1997;19: ; discussion Hirst J. Conservative treatment and therapeutic test for endometriosis by androgens. Am J Obstet Gynecol 1947;53: Preston SN, Campbell HB. Pelvic endometriosis; treatment with methyl testosterone. Obstet Gynecol 1953;2: Moehlig RC. Methyl testosterone for migraine of women; report of sixty cases. J Mich State Med Soc 1955;54: Raisz LG, Wiita B, Artis A, Bowen A, Schwartz S, Trahiotis M, et al. Comparison of the effects of estrogen alone and estrogen plus androgen on biochemical markers of bone formation and resorption in postmenopausal women. J Clin Endocrinol Metab 1996;81: Watts NB, Notelovitz M, Timmons MC, Addison WA, Wiita B, Downey LJ. Comparison of oral estrogens and estrogens plus androgen on bone mineral density, menopausal symptoms, and lipidlipoprotein profiles in surgical menopause. Obstet Gynecol 1995;85: Barrett-Connor E, Timmons C, Young R, Wiita B. Interim safety analysis of a two-year study comparing oral estrogen-androgen and conjugated estrogens in surgically menopausal women. J Women s Health 1996;5: Barrett-Connor E, Young R, Notelovitz M, Sullivan J, Wiita B, Yang HM, et al. A two-year, double-blind comparison of estrogenandrogen and conjugated estrogens in surgically menopausal women. Effects on bone mineral density, symptoms and lipid profiles. J Reprod Med 1999;44: Dobs AS, Nguyen T, Pace C, Roberts CP. Differential effects of oral estrogen versus oral estrogen-androgen replacement therapy on body composition in postmenopausal women. J Clin Endocrinol Metab 2002;87: Warnock JK, Swanson SG, Borel RW, Zipfel LM, Brennan JJ. Combined esterified estrogens and methyltestosterone versus esterified estrogens alone in the treatment of loss of sexual interest in surgically menopausal women. Menopause 2005;12: Lobo RA, Rosen RC, Yang HM, Block B, Van der Hoop RG. Comparative effects of oral esterified estrogens with and without methyltestosterone on endocrine profiles and dimensions of sexual function in postmenopausal women with hypoactive sexual desire. Fertil Steril 2003;79: Hickok LR, Toomey C, Speroff L. A comparison of esterified estrogens with and without methyltestosterone: effects on endometrial histology and serum lipoproteins in postmenopausal women. Obstet Gynecol 1993;82: Fertility and Sterility â 13

22 31. Flöter A, Carlström K, von Schoultz B, Nathorst-Böös J. Administration of testosterone undecanoate in postmenopausal women: effects on androgens, estrtadiol, and gonadotrophins. Menopause 2000;7: Flöter A, Nathorst-Böös J, Carlström K, von Schoultz B. Addition of testosterone to estrogen replacement therapy in oophorectomized women: effects on sexuality and well-being. Climacteric 2002;5: Penotti M, Sironi L, Cannata L, Vigano P, Casini A, Gabrielli L, et al. Effects of androgen supplementation of hormone replacement therapy on the vascular reactivity of cerebral arteries. Fertil Steril 2001;76: Miller K, Corcoran C, Armstrong C, Caramelli K, Anderson E, Cotton D, et al. Transdermal testosterone administration in women with acquired immunodeficiency syndrome wasting: a pilot study. J Clin Endocrinol Metab 1998;83: Shifren JL, Braunstein GD, Simon JA, Casson PR, Buster JE, Redmond GP, et al. Transdermal testosterone treatment in women with impaired sexual function after oophorectomy. N Engl J Med 2000;343: Braunstein GD, Sundwall DA, Katz M, Shifren JL, Buster JE, Simon JA, et al. Safety and efficacy of a testosterone patch for the treatment of hypoactive sexual desire disorder in surgically menopausal women: a randomized, placebo-controlled trial. Arch Intern Med 2005;165: Choi HH, Gray PB, Storer TW, Calof OM, Woodhouse L, Singh AB, et al. Effects of testosterone replacement in human immunodeficiency virus-infected women with weight loss. J Clin Endocrinol Metab 2005;90: Buster JE, Kingsberg SA, Aguirre O, Brown C, Breaux JG, Buch A, et al. Testosterone patch for low sexual desire in surgically menopausal women: a randomized trial. Obstet Gynecol 2005;105: Simon J, Braunstein G, Nachtigall L, Utian W, Katz M, Miller S, et al. Testosterone patch increases sexual activity and desire in surgically menopausal women with hypoactive sexual desire disorder. J Clin Endocrinol Metab 2005;90: Davis SR, van der Mooren MJ, van Lunsen RH, Lopes P, Ribot C, Rees M, et al. Efficacy and safety of a testosterone patch for the treatment of hypoactive sexual desire disorder in surgically menopausal women: a randomized, placebo-controlled trial. Menopause 2006;13: Shifren JL, Davis SR, Moreau M, Waldbaum A, Bouchard C, DeRogatis L, et al. Testosterone patch for the treatment of hypoactive sexual desire disorder in naturally menopausal women: results from the INTIMATE NM1 study. Menopause 2006;143: Davis SR, Goldstat R, Papalia MA, Shah S, Kulkarni J, Donath S, et al. Effects of a romatase inhibition on sexual function and well-being in postmenopausal women treated with testosterone: a randomized, placebo-controlled trial. Menopause 2006;13: Goldstat R, Briganti E, Tran J, Wolfe R, Davis SR. Transdermal testosterone therapy improves well-being, mood, and sexual function in premenopausal women. Menopause 2003;10: Nathorst-Boos J, Floter A, Jarkander-Rolff M, Carlstrom K, Schoultz B. Treatment with percutanous testosterone gel in postmenopausal women with decreased libido effects on sexuality and psychological general well-being. Maturitas 2006;53: Sherwin BB, Gelfand MM. Sex steroids and affect in the surgical menopause: a double-blind, cross-over study. Psychoneuroendocrinology 1985;10: Sherwin BB, Gelfand MM. The role of androgen in the maintenance of sexual functioning in oophorectomized women. Psychosom Med 1987;49: Burger H, Hailes J, Nelson J, Menelaus M. Effect of combined implants of oestradiol and testosterone on libido in postmenopausal women. Br Med J (Clin Res Ed) 1987;294: Davis SR, McCloud P, Strauss BJ, Burger H. Testosterone enhances estradiol s effects on postmenopausal bone density and sexuality. Maturitas 1995;21: Worboys S, Kotsopoulos D, Teede H, McGrath B, Davis SR. Evidence that parenteral testosterone therapy may improve endothelium-dependent and -independent vasodilation in postmenopausal women already receiving estrogen. J Clin Endocrinol Metab 2001;86: Kapetanakis E, Dmowski WP, Auletta F, Scommegna A. Endocrine and clinical effects of estradiol and testosterone pellets used in long-term replacement therapy. Int J Gynaecol Obstet 1982;20: Buckler HM, McElhone K, Durrington PN, Mackness MI, Ludlam CA, Wu FC. The effects of low-dose testosterone treatment on lipid metabolism, clotting factors and ultrasonographic ovarian morphology in women. Clin Endocrinol (Oxf) 1998;49: Burger HG, Hailes J, Menelaus M, Nelson J, Hudson B, Balazs N. The management of persistent menopausal symptoms with oestradioltestosterone implants: clinical, lipid and hormonal results. Maturitas 1984;6: Cardozo L, Gibb DM, Tuck SM, Thom MH, Studd JW, Cooper DJ. The effects of subcutaneous hormone implants during climacteric. Maturitas 1984;5: Sherwin BB. Randomized clinical trials of combined estrogen-androgen preparations: effects on sexual functioning. Fertil Steril 2002;77(Suppl 4):S Sherwin BB. Use of combined estrogen-androgen preparations in the postmenopause: evidence from clinical studies. Int J Fertil Women s Med 1998;43: Phillips E, Bauman C. Safety surveillance of esterified estrogens-methyltestosterone (Estratest and Estratest HS) replacement therapy in the United States. Clin Ther 1997;19: Moore E, Wisniewski A, Dobs A. Endocrine treatment of transsexual people: a review of treatment regimens, outcomes, and adverse effects. J Clin Endocrinol Metab 2003;88: Meyer WJ, 3rd, Webb A, Stuart CA, Finkelstein JW, Lawrence B, Walker PA. Physical and hormonal evaluation of transsexual patients: a longitudinal study. Arch Sex Behav 1986;15: Elbers JM, Giltay EJ, Teerlink T, Scheffer PG, Asscheman H, Seidell JC, et al. Effects of sex steroids on components of the insulin resistance syndrome in transsexual subjects. Clin Endocrinol (Oxf) 2003;58: Urman B, Pride SM, Yuen BH. Elevated serum testosterone, hirsutism, and virilism associated with combined androgen-estrogen hormone replacement therapy. Obstet Gynecol 1991;77: Gelfand M. Elevated serum testosterone, hirsuitsm, and virilism associated with combined androgen-estrogen hormone replacement therapy [letter]. Obstet Gynecol 1991;78: Gerritsma EJ, Brocaar MP, Hakkesteegt MM, Birkenhager JC. Virilization of the voice in post-menopausal women due to the anabolic steroid nandrolone decanoate (Decadurabolin). The effects of medication for one year. Clin Otolaryngol Allied Sci 1994;19: Moehlig R, Gerisch R. Methyl testosterone for migraine of women. J Mich Med Soc 1949;48: Wu FC, von Eckardstein A. Androgens and coronary artery disease. Endocr Rev 2003;24: Slowinska-Srzednicka J, Malczewska B, Srzednicki M, Chotkowska B, Brzezinska A, Zgliczynski W, et al. Hyperinsulinaemia and decreased plasma levels of dehydroepiandrosterone sulfate in premenopausal women with coronary heart disease. J Intern Med 1995;237: Phillips GB, Pinkernell BH, Jing TY. Relationship between serum sex hormones and coronary artery disease in postmenopausal women. Arterioscler Thromb Vasc Biol 1997;17: Bernini GP, Sgro M, Moretti A, Argenio GF, Barlascini CO, Cristofani R, et al. Endogenous androgens and carotid intimal-medial thickness in women. J Clin Endocrinol Metab 1999;84: Sutton-Tyrrell K, Wildman RP, Matthews KA, Chae C, Lasley BL, Brockwell S, et al. Sex-hormone-binding globulin and the free androgen index are related to cardiovascular risk factors in multiethnic premenopausal and perimenopausal women enrolled in the Study of Women aacross the Nation (SWAN). Circulation 2005;111: Braunstein Testosterone safety in women Vol. 88, No. 1, July 2007

23 69. Sowers MR, Jannausch M, Randolph JF, McConnell D, Little R, Lasley B, et al. Androgens are associated with hemostatic and inflammatory factors among women at the mid-life. J Clin Endocrinol Metab 2005;90: Lapidus L, Lindstedt G, Lundberg PA, Bengtsson C, Gredmark T. Concentrations of sex-hormone binding globulin and corticosteroid binding globulin in serum in relation to cardiovascular risk factors and to 12-year incidence of cardiovascular disease and overall mortality in postmenopausal women. Clin Chem 1986;32: Hauner H, Bognar E, Blum A. Body fat distribution and its association with metabolic and hormonal risk factors in women with angiographically assessed coronary artery disease. Evidence for the presence of a metabolic syndrome. Atherosclerosis 1994;105: Reinecke H, Bogdanski J, Woltering A, Breithardt G, Assman G, Kerber S, et al. Relation of serum levels of sex hormone binding globulin to coronary heart disease in postmenopausal women. Am J Cardiol 2002;90: Golden SH, Maguire A, Ding J, Crouse JR, Cauley JA, Zacur H, et al. Endogenous postmenopausal hormones and carotid atherosclerosis: a case-control study of the Atherosclerosis Risk in Communities cohort. Am J Epidemiol 2002;155: Rexrode KM, Manson JE, Lee IM, Ridker PM, Sluss PM, Cook NR, et al. Sex hormone levels and risk of cardiovascular events in postmenopausal women. Circulation 2003;108: Barrett-Connor E, Goodman-Gruen D. Prospective study of endogenous sex hormones and fatal cardiovascular disease in postmenopausal women. BMJ 1995;311: van Kesteren PJ, Asscheman H, Megens JA, Gooren LJ. Mortality and morbidity in transsexual subjects treated with cross-sex hormones. Clin Endocrinol (Oxf) 1997;47: Haffner SM, Dunn JF, Katz MS. Relationship of sex hormone-binding globulin to lipid, lipoprotein, glucose, and insulin concentrations in postmenopausal women. Metabolism 1992;41: Sarrel P, Dobay B, Wiita B. Estrogen and estrogen-androgen replacement in postmenopausal women dissatisfied with estrogen-only therapy. Sexual behavior and neuroendocrine responses. J Reprod Med 1998;43: Zang H, Carlstrom K, Arner P, Hirschberg AL. Effects of treatment with testosterone alone or in combination with estrogen on insulin sensitivity in postmenopausal women. Fertil Steril 2006;86: Goh HH, Loke DF, Ratnam SS. The impact of long-term testosterone replacement therapy on lipid and lipoprotein profiles in women. Maturitas 1995;21: Farish E, Fletcher CD, Hart DM, Azzawi FA, Abdalla HI, Gray CE. The effects of hormone implants on serum lipoproteins and steroid hormones in bilaterally oophorectomised women. Acta Endocrinol (Copenh) 1984;106: Sherwin BB, Gelfand MM, Schucher R, Gabor J. Postmenopausal estrogen and androgen replacement and lipoprotein lipid concentrations. Am J Obstet Gynecol 1987;156: Jones RD, Hugh Jones T, Channer KS. The influence of testosterone upon vascular reactivity. Eur J Endocrinol 2004;151: Rosano GM, Leonardo F, Pagnotta P, Pelliccia F, Panina G, Cerquetani E, et al. Acute anti-ischemic effect of testosterone in men with coronary artery disease. Circulation 1999;99: Webb CM, Adamson DL, de Zeigler D, Collins P. Effect of acute testosterone on myocardial ischemia in men with coronary artery disease. Am J Cardiol 1999;83:437 9, A Sarrel PM, Wiita B. Vasodilator effects of estrogen are not diminished by androgen in postmenopausal women. Fertil Steril 1997;68: Liu PY, Death AK, Handelsman DJ. Androgens and cardiovascular disease. Endocr Rev 2003;24: Harada N, Sasano H, Murakami H, Ohkuma T, Nagura H, Takagi Y. Localized expression of aromatase in human vascular tissues. Circ Res 1999;84: Yarnell JW, Baker IA, Sweetnam PM, Bainton D, O Brien JR, Whitehead PJ, et al. Fibrinogen, viscosity, and white blood cell count are major risk factors for ischemic heart disease. The Caerphilly and Speedwell collaborative heart disease studies. Circulation 1991;83: Neumann FJ, Katus HA, Hoberg E, Roebruck P, Brawn M, Haupt HM, et al. Increased plasma viscosity and erythrocyte aggregation: indicators of an unfavourable clinical outcome in patients with unstable angina pectoris. Br Heart J 1991;66: Rosenson R. Viscosity and ischemic heart disease. J Vasc Med Biol 1993;4: Rosenson RS, Shott S, Lu L, Tangney CC. Hypertriglyceridemia and other factors associated with plasma viscosity. Am J Med 2001;110: Basaria S, Dobs AS. Safety and adverse effects of androgens: how to counsel patients. Mayo Clin Proc 2004;79(4 Suppl):S Toorians AW, Thomassen MC, Zweegman S, Magdeleyns EJ, Trans G, Gooren LJ, et al. Venous thrombosis and changes of hemostatic variables during cross-sex hormone treatment in transsexual people. J Clin Endocrinol Metab 2003;88: Shahidi NT. Androgens and erythropoiesis. N Engl J Med 1973;289: Schlatterer K, Yassouridis A, von Werder K, Poland D, Kemper J, Stalla GK. A follow-up study for estimating the effectiveness of a cross-gender hormone substitution therapy on transsexual patients. Arch Sex Behav 1998;27: Golden SH, Ding J, Szklo M, Schmidt MI, Duncan BB, Dobs A. Glucose and insulin components of the metabolic syndrome are associated with hyperandrogenism in postmenopausal women: the atherosclerosis risk in communities study. Am J Epidemiol 2004;160: Herbst KL, Calof OM, Hsia SH, Sinha-Hikim I, Woodhouse LJ, Buchanan TA, et al. Effects of transdermal testosterone administration on insulin sensitivity, fat mass and distribution, and markers of inflammation and thrombolysis in human immunodeficiency virus-infected women with mild to moderate weight loss. Fertil Steril 2006;85: Lovejoy JC, Bray GA, Bourgeois MO, Macchiavelli R, Rood JC, Greeson C, et al. Exogenous androgens influence body composition and regional body fat distribution in obese postmenopausal women a clinical research center study. J Clin Endocrinol Metab 1996;81: Diamond MP, Grainger D, Diamond MC, Sherwin RS, Defronzo RA. Effects of methyltestosterone on insulin secretion and sensitivity in women. J Clin Endocrinol Metab 1998;83: Polderman KH, Gooren LJ, Asscheman H, Bakker A, Heine RJ. Induction of insulin resistance by androgens and estrogens. J Clin Endocrinol Metab 1994;79: Pike MC, Ross RK. Progestins and menopause: epidemiological studies of risks of endometrial and breast cancer. Steroids 2000;65: Tuckerman EM, Okon MA, Li T, Laird SM. Do androgens have a direct effect on endometrial function? An in vitro study. Fertil Steril 2000;74: Legro RS, Kunselman AR, Miller SA, Satyaswaroop PG. Role of androgens in the growth of endometrial carcinoma: an in vivo animal model. Am J Obstet Gynecol 2001;184: Hackenberg R, Schulz KD. Androgen receptor mediated growth control of breast cancer and endometrial cancer modulated by antiandrogenand androgen-like steroids. J Steroid Biochem Mol Biol 1996;56: Boman K, Strang P, Backstrom T, Stendahl U. The influence of progesterone and androgens on the growth of endometrial carcinoma. Cancer 1993;71: Watanabe K, Sasano H, Harada N, Ozaki M, Niikura H, Sato S, et al. Aromatase in human endometrial carcinoma and hyperplasia. Immunohistochemical, in situ hybridization, and biochemical studies. Am J Pathol 1995;146: Yamaki J, Yamamoto T, Okada H. Aromatization of androstenedione by normal and neoplastic endometrium of the uterus. J Steroid Biochem 1985;22:63 6. Fertility and Sterility â 15

24 109. Potischman N, Hoover RN, Brinton LA, Siiteri P, Dorgan JF, Swanson CA, et al. Case-control study of endogenous steroid hormones and endometrial cancer. J Natl Cancer Inst 1996;88: Yamamoto T, Kitawaki J, Urabe M, Honjo H, Tamura T, Noguchi T, et al. Estrogen productivity of endometrium and endometrial cancer tissue; influence of aromatase on proliferation of endometrial cancer cells. J Steroid Biochem Mol Biol 1993;44: Lukanova A, Lundin E, Micheli A, Arslan A, Ferrari P, Rinaldi S, et al. Circulating levels of sex steroid hormones and risk of endometrial cancer in postmenopausal women. Int J Cancer 2004;108: Futterweit W, Deligdisch L. Histopathological effects of exogenously administered testosterone in 19 female to male transsexuals. J Clin Endocrinol Metab 1986;62: Beral V. Breast cancer and hormone-replacement therapy in the Million Women Study. Lancet 2003;362: Persson I. Estrogens in the causation of breast, endometrial and ovarian cancers evidence and hypotheses from epidemiological findings. J Steroid Biochem Mol Biol 2000;74: Ross RK, Paganini-Hill A, Wan PC, Pike MC. Effect of hormone replacement therapy on breast cancer risk: estrogen versus estrogen plus progestin. J Natl Cancer Inst 2000;92: Schairer C, Lubin J, Troisi R, Sturgeon S, Brinton L, Hoover R. Menopausal estrogen and estrogen-progestin replacement therapy and breast cancer risk. JAMA 2000;283: Beral V, Banks E, Reeves G. Evidence from randomised trials on the long-term effects of hormone replacement therapy. Lancet 2002;360: Magnusson C, Baron JA, Correia N, Bergstrom R, Adami HO, Persson I. Breast-cancer risk following long-term oestrogen- and oestrogen-progestin-replacement therapy. Int J Cancer 1999;81: Chlebowski RT, Hendrix SL, Langer RD, Stefanick ML, Gass M, Lane D, et al. Influence of estrogen plus progestin on breast cancer and mammography in healthy postmenopausal women: the Women s Health Initiative Randomized Trial. JAMA 2003;289: Zhou J, Ng S, Adesanya-Famuiya O, Anderson K, Bondy CA. Testosterone inhibits estrogen-induced mammary epithelial proliferation and suppresses estrogen receptor expression. Faseb J 2000;14: Hall RE, Aspinall JO, Horsfall DJ, Birrell SN, Bentel JM, Sutherland RL, et al. Expression of the androgen receptor and an androgen-responsive protein, apolipoprotein D, in human breast cancer. Br J Cancer 1996;74: Isola JJ. Immunohistochemical demonstration of androgen receptor in breast cancer and its relationship to other prognostic factors. J Pathol 1993;170: Birrell SN, Bentel JM, Hickey TE, Ricciardelli C, Weger MA, Horsfall DJ, et al. Androgens induce divergent proliferative responses in human breast cancer cell lines. J Steroid Biochem Mol Biol 1995;52: Yue W, Berstein LM, Wang JP, Clark GM, Hamilton CJ, Demers LM, et al. The potential role of estrogen in aromatase regulation in the breast. J Steroid Biochem Mol Biol 2001;79: Berstein LM, Larionov AA, Kyshtoobaeva A, Pozharisski KM, Semiglazov VF, Ivanova OA. Aromatase in breast cancer tissue localization and relationship with reproductive status of patients. J Cancer Res Clin Oncol 1996;122: Bolufer P, Ricart E, Lluch A, Vazquez C, Rodriguez A, Ruiz A, et al. Aromatase activity and estradiol in human breast cancer: its relationship to estradiol and epidermal growth factor receptors and to tumornode-metastasis staging. J Clin Oncol 1992;10: Pasqualini JR, Chetrite G, Blacker C, Feinstein MC, Delalonde L, Talbi M, et al. Concentrations of estrone, estradiol, and estrone sulfate and evaluation of sulfatase and aromatase activities in pre- and postmenopausal breast cancer patients. J Clin Endocrinol Metab 1996;81: Somboonporn W, Davis SR. Testosterone effects on the breast: implications for testosterone therapy for women. Endocr Rev 2004;25: Dimitrakakis C, Zhou J, Bondy CA. Androgens and mammary growth and neoplasia. Fertil Steril 2002;77(Suppl 4):S Dimitrakakis C, Zhou J, Wang J, Belanger A, Labrie F, Cheng C, et al. A physiologic role for testosterone in limiting estrogenic stimulation of the breast. Menopause 2003;10: Missmer SA, Eliassen AH, Barbieri RL, Hankinson SE. Endogenous estrogen, androgen, and progesterone concentrations and breast cancer risk among postmenopausal women. J Natl Cancer Inst 2004;96: Beattie MS, Costantino JP, Cummings SR, Wickerham DL, Vogel VG, Dowsett M, et al. Endogenous sex hormones, breast cancer risk, and tamoxifen response: an ancillary study in the NSABP Breast Cancer Prevention Trial (P-1). J Natl Cancer Inst 2006;98: Berrino F, Muti P, Micheli A, Bolelli G, Krogh V, Sciajno R, et al. Serum sex hormone levels after menopause and subsequent breast cancer. J Natl Cancer Inst 1996;88: Hankinson SE, Willett WC, Manson JE, Colditz GA, Hunter DJ, Spiegelman D, et al. Plasma sex steroid hormone levels and risk of breast cancer in postmenopausal women. J Natl Cancer Inst 1998;90: Zeleniuch-Jacquotte A, Bruning PF, Bonfrer JM, Koenig KL, Shore RE, Kim MY, et al. Relation of serum levels of testosterone and dehydroepiandrosterone sulfate to risk of breast cancer in postmenopausal women. Am J Epidemiol 1997;145: Wysowski DK, Comstock GW, Helsing KJ, Lau HL. Sex hormone levels in serum in relation to the development of breast cancer. Am J Epidemiol 1987;125: Garland CF, Friedlander NJ, Barrett-Connor E, Khaw KT. Sex hormones and postmenopausal breast cancer: a prospective study in an adult community. Am J Epidemiol 1992;135: Thomas HV, Key TJ, Allen DS, Moore JW, Dowsett M, Fentiman IS, et al. A prospective study of endogenous serum hormone concentrations and breast cancer risk in post-menopausal women on the island of Guernsey. Br J Cancer 1997;76: Zeleniuch-Jacquotte A, Shore RE, Koenig KL, Akhmedkhanov A, Afanasyeva Y, Kato I, et al. Postmenopausal levels of oestrogen, androgen, and SHBG and breast cancer: long-term results of a prospective study. Br J Cancer 2004;90: Cauley JA, Lucas FL, Kuller LH, Stone K, Browner W, Cummings SR. Elevated serum estradiol and testosterone concentrations are associated with a high risk for breast cancer. Study of Osteoporotic Fractures Research Group. Ann Intern Med 1999;130: Sturgeon SR, Potischman N, Malone KE, Dorgan JF, Dahling J, Schairer C, et al. Serum levels of sex hormones and breast cancer risk in premenopausal women: a case-control study (USA). Cancer Causes Control 2004;15: Adly L, Hill D, Sherman ME, Sturgeon SR, Fears T, Mies C, et al. Serum concentrations of estrogens, sex hormone-binding globulin, and androgens and risk of breast cancer in postmenopausal women. Int J Cancer 2006;119: Dorgan JF, Longcope C, Stephenson HE Jr, Falk RT, Miller R, Franz C, et al. Relation of prediagnostic serum estrogen and androgen levels to breast cancer risk. Cancer Epidemiol Biomarkers Prev 1996;5: Manjer J, Johansson R, Berglund G, Janzon L, Kaaks R, Agren A, et al. Postmenopausal breast cancer risk in relation to sex steroid hormones, prolactin and SHBG (Sweden). Cancer Causes Control 2003;14: Yu H, Shu XO, Li BD, Dai Q, Gao YT, Jin F, et al. Joint effect of insulinlike growth factors and sex steroids on breast cancer risk. Cancer Epidemiol Biomarkers Prev 2003;12: Yu H, Shu XO, Shi R, Dai Q, Jin F, Gao YT, et al. Plasma sex steroid hormones and breast cancer risk in Chinese women. Int J Cancer 2003;105: Coulam CB, Annegers JF, Kranz JS. Chronic anovulation syndrome and associated neoplasia. Obstet Gynecol 1983;61: Anderson KE, Sellers TA, Chen PL, Rich SS, Hong CP, Folsom AR. Association of Stein-Leventhal syndrome with the incidence of 16 Braunstein Testosterone safety in women Vol. 88, No. 1, July 2007

25 postmenopausal breast carcinoma in a large prospective study of women in Iowa. Cancer 1997;79: Gammon MD, Thompson WD. Polycystic ovaries and the risk of breast cancer. Am J Epidemiol 1991;134: Tamimi RM, Hankinson SE, Chen WY, Rosner B, Colditz GA. Combined estrogen and testosterone use and risk of breast cancer in postmenopausal women. Arch Intern Med 2006;166: Brinton LA, Hoover R, Fraumeni JF, Jr. Menopausal oestrogens and breast cancer risk: an expanded case-control study. Br J Cancer 1986;54: Ewertz M. Influence of non-contraceptive exogenous and endogenous sex hormones on breast cancer risk in Denmark. Int J Cancer 1988;42: Dimitrakakis C, Jones RA, Liu A, Bondy CA. Breast cancer incidence in postmenopausal women using testosterone in addition to usual hormone therapy. Menopause 2004;11: Burgess HE, Shousha S. An immunohistochemical study of the longterm effects of androgen administration on female-to-male transsexual breast: a comparison with normal female breast and male breast showing gynaecomastia. J Pathol 1993;170: Hofling M, Hirschberg AL, Skoog L, Tani E, Hagerstrom T, Von Shoultz B. Testosterone inhibits estrogen/progestogen-induced breast cell proliferation in postmenopausal women. Menopause 2007;14: Westaby D, Ogle SJ, Paradinas FJ, Randell JB, Murray-Lyon IM. Liver damage from long-term methyltestosterone. Lancet 1977;2: Lee MM. Molecular genetic control of sex differentiation. In: Pescovitz OH, Eugster EA, eds. Pediatric endocrinology: mechanisms, manifestations, and management. 1st ed. Philadelphia: Lippincott Williams & Wilkins, 2004: Grumbach MM, Ducharme JR. The effects of androgens on fetal sexual development: androgen-induced female pseudohermaphrodism. Fertil Steril 1960;11: Wilkins L. Masculinization of female fetus due to use of orally given progestins. JAMA 1960;172: Grumbach MM, Ducharme JR, Moloshok RE. On the fetal masculinizing action of certain oral progestins. J Clin Endocrinol Metab 1959;19: Mürset G, Zachmann M, Prader A, Fischer J, Labhart A. Male external genitalia of a girl caused by a virilizing adrenal tumour in the mother. Case report and steroid studies. Acta Endocrinol (Copenh) 1970;65: Haymond MW, Weldon VV. Female pseudohermaphroditism secondary to a maternal virilizing tumor. Case report and review of the literature. J Pediatr 1973;82: Kirk JM, Perry LA, Shand WS, Kirby RS, Besser GM, Savage MO. Female pseudohermaphroditism due to a maternal adrenocortical tumor. J Clin Endocrinol Metab 1990;70: Cohen DA, Daughaday WH, Weldon VV. Fetal and maternal virilization associated with pregnancy. A case report and review of the literature. Am J Dis Child 1982;136: Lo JC, Schwitzgebel VM, Tyrrell JB, Fitzgerald PA, Kaplan SL, Conte FA, et al. Normal female infants born of mothers with classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency. J Clin Endocrinol Metab 1999;84: Hensleigh PA, Carter RP, Grotjan HE, Jr. Fetal protection against masculinization with hyperreactio luteinalis and virilization. J Clin Endocrinol Metab 1975;40: McClamrock HD, Adashi EY. Gestational hyperandrogenism. Fertil Steril 1992;57: Kitawaki J, Inoue S, Tamura T, Yamamoto T, Noguchi T, Osawa Y, et al. Increasing aromatase cytochrome P-450 level in human placenta during pregnancy: studied by immunohistochemistry and enzyme-linked immunosorbent assay. Endocrinology 1992;130: Berger NG, Repke JT, Woodruff JD. Markedly elevated serum testosterone in pregnancy without fetal virilization. Obstet Gynecol 1984;63: Shozu M, Akasofu K, Harada T, Kubota Y. A new cause of female pseudohermaphroditism: placental aromatase deficiency. J Clin Endocrinol Metab 1991;72: Conte FA, Grumbach MM, Ito Y, Fisher CR, Simpson ER. A syndrome of female pseudohermaphrodism, hypergonadotropic hypogonadism, and multicystic ovaries associated with missense mutations in the gene encoding aromatase (P450arom). J Clin Endocrinol Metab 1994;78: Morishima A, Grumbach MM, Simpson ER, Fisher C, Qin K. Aromatase deficiency in male and female siblings caused by a novel mutation and the physiological role of estrogens. J Clin Endocrinol Metab 1995;80: Mullis PE, Yoshimura N, Kuhlmann B, Lippuner K, Jaeger P, Harada H. Aromatase deficiency in a female who is compound heterozygote for two new point mutations in the P450arom gene: impact of estrogens on hypergonadotropic hypogonadism, multicystic ovaries, and bone densitometry in childhood. J Clin Endocrinol Metab 1997;82: Kerlan V, Nahoul K, Le Martelot MT, Bercovici JP. Longitudinal study of maternal plasma bioavailable testosterone and androstanediol glucuronide levels during pregnancy. Clin Endocrinol (Oxf) 1994;40: Dorfman RI. The antiestrogenic and antiandrogenic activities of progesterone in the defense of a normal fetus. Anat Rec 1967;157: Mauvais-Jarvis P, Kuttenn F, Baudot N. Inhibition of testosterone conversion to dihydrotestosterone in men treated percutaneously by progesterone. J Clin Endocrinol Metab 1974;38: Fertility and Sterility â 17

26 EDITOR S CORNER Gay male couples and assisted reproduction: should we assist? Dorothy A. Greenfeld, M.S.W. Department of Obstetrics and Gynecology, Yale University School of Medicine, New Haven, Connecticut Gay male couples seeking fatherhood through assisted reproduction deserve the same attention to care that other couples, lesbian and heterosexual, receive at fertility centers throughout the country. (Fertil Steril Ò 2007;88: Ó2007 by American Society for Reproductive Medicine.) Key Words: Gay men, homosexuality, father-child relations, parenting, assisted reproduction In the United States, 1 in 10 gay men identify themselves as fathers (1), and according to the 2000 US Census Report, one in five gay male couples have children under 18 years of age living in their households (2, 3). Although many of these children were conceived when their fathers were in a heterosexual relationship, gay male couples are increasingly expressing interest in becoming parents together and establishing a traditional family structure within their relationship (4). Although many such couples will choose to adopt, others plan to become fathers through assisted reproductive technology (ART) by using an oocyte donor and a gestational surrogate. As a result, programs offering such treatment can expect a growing number of requests for ART from gay men in the future. The growing trend among gay male couples toward planning families together follows in the wake of the so-called lesbian baby boom and comes at a time when all same-sex couples are increasingly struggling for equal rights, including the right to marry and have children. Moreover, gay men are seeking to become fathers at a time of increased interest in fatherhood itself. Consequently, in the 1990s, several organizations were formed to enhance and promote research and policy on fatherhood, including the National Center for Fathers and Families; the Center on Fathers, Families, and Public Policy; the National Center for Fathering; and the National Fatherhood Initiative (5). This research has underscored the importance of fathers in the emotional development of their children and has recognized the variety of roles that fathers play in their children s lives, not merely as providers and disciplinarians but also as companions, models, and teachers (6 8). Why do gay men want to become fathers? They are motivated by the same needs as those of heterosexual men: the Received November 9, 2006; revised and accepted April 4, Reprint requests: Dorothy A. Greenfeld, M.S.W., Yale University School of Medicine, Department of Obstetrics and Gynecology, P.O. Box 20863, 333 Cedar Street, New Haven, Connecticut, (FAX: ; dorothy.greenfeld@yale.edu). desire to nurture and raise children, wanting the constancy of children in their lives, wanting to achieve the sense of family that children provide, and wanting a sense of generativity and immortality through having children (9, 10). Gay men who are planning to become fathers appear to give the idea much more thought than do heterosexual men and are more likely than heterosexual fathers to express the higher status accorded to parents than non-parents as a motivation for having children (11). Yet because of entrenched stereotypes, social acceptance of gay men as fathers is far from universal. Common concerns are that children of gay men will be stigmatized, that children of homosexual fathers are more likely to become homosexual themselves, and that gay males are likely to be sexual predators who may molest their own children (12). Although research has largely discredited those prejudices (1, 13 15), these preconceived notions nevertheless remain and may be one reason that some fertility programs appear reluctant to respond to appeals from gay men to achieve fatherhood through assisted reproduction. It is notable that a recent survey of ART programs in the United States found that fertility centers routinely accept lesbians but are less likely to accept gay males as patients (16), despite the support for nondiscrimination in gay and lesbian parenting by such prominent mainstream organizations as the Child Welfare League of America, the American Academy of Pediatrics, the American Academy of Family Physicians, the American Psychiatric Association, the American Psychological Association, the National Association of Social Workers, and the American Bar Association (17, 18). Indeed, the Ethics Committee of the American Society for Reproductive Medicine recently published a statement in support of fertility treatment for gays, lesbians, and unmarried persons (19). From the current literature, we know a great deal about the psychological well-being of lesbian mothers and their children offspring planned and conceived through assisted reproduction (20 24) but there are as yet no studies of 18 Fertility and Sterility â Vol. 88, No. 1, July /07/$32.00 Copyright ª2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

27 gay fathers utilizing ART to create a family. The existing literature on gay fatherhood is derived from studies of children who were born within a heterosexual marriage and whose fathers later identified themselves as gay. These studies describe the parenting experience of gay fathers and how they compared with the experiences of heterosexual fathers. In one study, the investigators matched 33 gay fathers with 33 heterosexual fathers and looked at the following five factors: involvement with children, limit setting, responsiveness, reasoning guidance, and intimacy (9). Although the investigators found no differences between groups in terms of intimacy and involvement with their children, there were significant differences between gay and nongay fathers in terms of limit setting, responsiveness, and reasoning guidance. Gay fathers were more consistent about setting and enforcing limits on their children s behavior, and gay fathers tended to be more responsive to their children s needs (9, 10, 25). Researchers have looked at whether children had social stigma as a result of having a gay father. Wyers et al. (26) report that although many children in their study had concerns about what to tell others about their fathers sexual orientation, only 20% ever experienced any actual discrimination because of their father s homosexuality. In three other studies, gay fathers reported that their children appeared to have normal social relationships with their peers and found little cause for concern about stigmatization resulting from fathers homosexuality (27 29). Several studies examined the sexual orientation of young adult offspring of gay fathers. In terms of gender identity and sexual preference, children of gay fathers appear to fall within normal limits and are not more likely to be homosexual then children reared by heterosexual fathers (14, 28 30). Results from research also indicate that sons and daughters of gay fathers appear to have normal sex-role identification and display normal sex-type behavior (13, 31). In one study, Bozett (28) considered the sexual identity of 19 children of gay fathers. Seventeen described themselves as heterosexual, and two sons and one daughter described themselves as gay. Miller (14) looked at a group of gay men who altogether had 48 adult offspring. Fathers reported that one son and three daughters were gay (8% of the children), well within the expected percentage of gay individuals in the population at large. Bailey et al. (32) queried 55 gay and bisexual fathers about the sexual orientation of their 43 grown sons, who ranged in age from 17 to 43 years. Fathers were asked whether their sons were heterosexual, bisexual, or gay. Fathers reported that 90% of their sons were heterosexual and that 9% were bisexual or gay, an incidence no different from the sons of heterosexual fathers. Further, studies fail to show any evidence that children of gay men are at risk for sexual abuse by their fathers. In fact, the majority of child sexual abusers are heterosexual men (33 35). Jenny et al. (15) looked at 269 cases of child sexual abuse to determine whether offenders were likely to be gay. They reported that only two of the offenders were gay and concluded that children were far more likely to be abused by the heterosexual partner of a relative than by someone gay. Research on gay fathers has demonstrated that gay men are motivated to become fathers for the same reasons as heterosexual men and that they are generally loving and nurturing parents. Furthermore, there are no data to suggest that children of gay fathers are unduly stigmatized, are more likely to be gay, or are likely to be sexually molested by their fathers. Future research should address the experience of gay male couples, and of their children who are planned and conceived through assisted reproduction. This research should explore which issues may be unique to such families and how they are similar or different from those of lesbian and heterosexual couples and their children who are conceived through ART. For the present, although anecdotal and media reports reveal that some programs have welcomed gay men into their fertility practices (36 38), treatment statistics do not appear to have been compiled by the American Society for Reproductive Medicine, the Society for Assisted Reproductive Technology, or any other reproductive medical organization, nor have guidelines on treating gay men in ART practices been published. Future treatment guidelines should include consideration of medical, legal, and psychological issues that are unique to gay male couples who are seeking parenthood though ART. As with other American Society for Reproductive Medicine practice guidelines for ART, these issues may include an assessment of their relationship and their commitment to becoming fathers together; how they made the decision to seek parenthood through ART as well as their understanding of the medical, legal, financial and emotional demands of the treatment; how they arrived at the decision as to who will be the biological and who will be the nonbiological parent; whether they have a trusting and open relationship with the gestational carrier; how they chose between an anonymous and a nonanonymous egg donor, as well as their relationship with her; and what their plans are for disclosure to their child or children about the nature of their conception. Gay male couples increasingly are coming to the conclusion that their homosexuality need not prevent them from becoming fathers and planning a family together. Many are turning to reproductive medical centers for help in their quest for fatherhood. These gay-father families deserve the same attention (and lack of discrimination) in their care that other couples, lesbian and heterosexual, receive in fertility centers around the country. REFERENCES 1. Tasker F. Lesbian mothers, gay fathers, and their children: a review. J Dev Behav Pediatr 2005;26: Simmons T, O Connell M. Married couple and unmarried-partner households: In: Census 2000 special reports. Washington, DC: US Census Bureau, Gates GJ, Ost J. The gay and lesbian atlas. Washington, DC: The Urban Institute Press, Fertility and Sterility â 19

28 4. Johnson SM, O Connor E. The gay baby boom: the psychology of gay parenthood. New York: New York University Press, Lamb ME, Tamis-Lemonda CS. The role of the father: an introduction. In: Lamb ME, ed. The role of the father in child development, 4th edition. Hoboken, NJ: Wiley and Sons, Marsiglio W, Amato P, Day RD, Lamb ME. Scholarship on fatherhood in the 1990s and beyond. J Marriage Fam 2000;62: Pruett KD. Fatherneed. New York: Free Press, Pleck EH, Pleck JH. Fatherhood ideals in the United States: historical dimensions. In: Lamb ME, ed. The role of the father in child development, 3rd edition. Hoboken, NJ: Wiley and Sons, 1996: Bigner JJ, Jacobsen RB. Parenting behaviors of homosexual and heterosexual fathers. J Homosex 1989;18: Bigner JJ. Raising our sons: gay men as fathers. J Gay Lesb Soc Serv 1999;10: Bigner JJ, Jacobsen RB. Adult responses to child behavior and attitudes toward fathering: gay and non-gay fathers. J Homosex 1992;23: Mallon GP. Gay men choosing parenthood. New York: Columbia University Press, Patterson CJ. Children of lesbian and gay parents. Child Dev 1992;63: Miller B. Gay fathers and their children. Fam Coord 1979;28: Jenny C, Roesler TA, Poyer KL. Are children at risk for sexual abuse by homosexuals? Pediatrics 1994;94: Gumankin AD, Caplan AL, Braverman AM. Screening practices and beliefs of assisted reproductive technology programs. Fertil Steril 2005;83: Amato P, Jacob MC. Providing fertility services to lesbian couples: the lesbian baby boom. Sexuality, Reproduction and Menopause 2004;2: Cooper L, Cates P. Too high a price: the case against restricting gay parenting. New York: American Civil Liberties Union Foundation, Ethics Committee of the American Society for Reproductive Medicine. Access to fertility treatment by gays, lesbians, and unmarried persons. Fertil Steril 2006;86: Baetens P, Brewaeys A. Lesbian couples requesting donor insemination: an update of the knowledge with regard to lesbian mother families. Hum Reprod 2001;7: Flaks D, Ficher L, Masterpasqua F, Joseph G. Lesbians choosing motherhood: a comparative study of lesbian and heterosexual parents and their children. Dev Psychol 1995;31: Braeways A, Ponjaert I, Van Hall E, Golombok S. Donor insemination: child and family development in lesbian-mother families with children 4 to 8 years old. Hum Reprod 1997;12: Chan R, Raboy B, Patterson CJ. Psychosocial adjustment among children conceived via donor insemination by lesbian and heterosexual mothers. Child Dev 1998;69: Golombok S, Tasker F, Murray C. Children raised in fatherless families from infancy: family relationships and the socioemotional development of children of lesbian and single heterosexual mothers. J Child Psychol Psychiatry 1997;38: Bigner JJ, Jacobsen RB. The value of children to gay and heterosexual fathers. J Homosex 1989;18: Wyers NL. Homosexuality in the family: lesbian and gay spouses. Soc Work 1987;32: Harris MB, Turner PH. Gay and lesbian parents. J Homosex 1985;12: Bozett FW. Children of gay fathers. In: Bozett FW, ed. Gay and lesbian parents. New York: Praeger, 1987: Bozett FW. Gay fathers: a review of the literature. In: Bozett FW, ed. Homosexuality and the family. New York: Harrington Park, 1989: Barrett H, Tasker F. Growing up with a gay parent: views of 101 gay fathers on their sons and daughters experiences. Educ Child Psychol 2001;18: Turner PH, Scadden L, Harris MB. Parenting in gay and lesbian families. J Gay Lesbian Psychother 1990;1: Bailey JM, Bobrow D, Wolfe M, Mikach S. Sexual orientation of adult sons of gay fathers. Dev Psychol 1995;31: Jones BM, MacFarlane K, eds. Sexual abuse of children: selected readings. Washington, DC: National Center on Child Abuse and Neglect, Groth AN, Birnbaum HJ. Adult sexual orientation and attraction to underage persons. Arch Sexual Behav 1978;7: Sarafino EP. An estimate of nationwide incidence of sexual offenses against children. Child Welfare 1979;58: Boodman SG. Fatherhood by a new formula: using an egg donor and a gestational surrogate, some gay men are becoming dads and charting new legal and ethical territory. Washington Post 2005;January 18:HE Miller SH. Gay men s baby boom. Weekly News Miami 2000;May Sack K. Fathers in the making: launching a journey they d never imagined. Los Angeles Times 2006;October 31: Greenfeld Gay fathers Vol. 88, No. 1, July 2007

29 PRACTICE COMMITTEE REPORT Pathogenesis, consequences, and control of peritoneal adhesions in gynecologic surgery The Practice Committee of the American Society for Reproductive Medicine in collaboration with the Society of Reproductive Surgeons American Society for Reproductive Medicine, Birmingham, Alabama This document is a revision to, and is meant to replace, the ASRM Practice Committee s document, Control and prevention of peritoneal adhesions in gynecologic surgery (Fertil Steril 2006;86(Suppl 4):S1 S5). Postoperative adhesions are a natural consequence of surgical tissue trauma and healing and may result in infertility, pain, and bowel obstruction. Adherence to microsurgical principles, minimally invasive surgery, and use of some peritoneal instillates may help to decrease postoperative adhesions. Some surgical barriers have been demonstrated effective for reducing postoperative adhesions, but there is no substantial evidence that their use improves fertility, decreases pain, or reduces the incidence of postoperative bowel obstruction. (Fertil Steril Ò 2007;88:21 6. Ó2007 by American Society for Reproductive Medicine.) Postoperative adhesions are a natural consequence of surgical tissue trauma and healing. Peritoneal adhesions may result in infertility, pain, or bowel obstruction and may increase the technical difficulty of subsequent abdominal or pelvic surgery. The purpose of this document is to review the epidemiology, pathogenesis, and clinical consequences of adhesion formation, and to summarize available evidence regarding the effectiveness of various strategies for reducing postoperative adhesion formation. EPIDEMIOLOGY AND IMPACT OF POSTOPERATIVE ADHESIONS Studies conducted by the Surgical and Clinical Adhesions Research (SCAR) Group have analyzed the records of surgical patients in Scottish National Health Service hospitals and helped to define the epidemiology and impact of postoperative adhesions (1, 2). Overall, approximately one-third of patients who underwent open abdominal or pelvic surgery were readmitted an average of two times over the subsequent 10 years for conditions directly or possibly related to adhesions or for further surgery that could be complicated potentially by adhesions; more than 20% of all such readmissions occurred during the first year after the initial surgery and 4.5% of readmissions were for small bowel obstruction (1, 2). Among open gynecologic procedures, ovarian surgery had the highest rate of readmissions directly related to adhesions (7.5/100 initial operations) (2). In the Scottish experience, excepting laparoscopic sterilization procedures, open and laparoscopic gynecologic surgery were associated with comparable risk for adhesion-related hospital readmission (3). Received April 4, 2007; revised and accepted April 9, Reprints will not be available. Other retrospective studies of Canadian women admitted to the hospital with a diagnosis of small bowel obstruction after gynecologic surgery have observed that adhesions were the most common cause and that total abdominal hysterectomy was the most common procedure among those performed for benign conditions (4). In two studies, the incidence of small bowel obstruction after abdominal hysterectomy ranged between 13.6 and 16.3 per 1,000 procedures (4, 5). Postoperative adhesions increase operating times (6, 7) and the risk of bowel injury during subsequent surgery (8). Adhesions also have major financial implications. In the United States, adhesion-related health care costs exceed one billion dollars annually (9). PATHOGENESIS Adhesions are the consequence of tissue trauma that may result from sharp, mechanical or thermal injury, infection, radiation, ischemia, desiccation, abrasion, or foreign-body reaction. Such trauma triggers a cascade of events that begins with the disruption of stromal mast cells, which release vasoactive substances such as histamine and kinins that increase vascular permeability. Fibrin deposits then form, containing exudates of cells, leukocytes, and macrophages (10). Healing occurs by a combination of fibrosis and mesothelial regeneration (11). Unlike skin wounds, which heal from the edges, the repair of peritoneal defects occurs from the underlying mesenchyme. As a result, both large and small peritoneal defects heal relatively quickly. Fibrinous exudates form within 3 hours after injury and result from decreased fibrinolytic activity. If not quickly removed by absorption or fibrinolysis, the invasion of fibroblasts and blood vessels soon follows (10). Most fibrinous exudates are transient and break down within 72 hours, but trauma-induced local suppression of /07/$32.00 Fertility and Sterility â Vol. 88, No. 1, July doi: /j.fertnstert Copyright ª2007 American Society for Reproductive Medicine, Published by Elsevier Inc.

30 peritoneal fibrinolysis predisposes to their organization into adhesions (Fig. 1) (10). CONSEQUENCES OF ADHESION FORMATION The most important potential consequences of adhesion formation are infertility, bowel obstruction, and abdominal/pelvic pain. Infertility Adhesions may affect fertility adversely by distorting adnexal anatomy and interfering with gamete and embryo transport. Among infertile women with adnexal adhesions, pregnancy rates (PR) are 32% at 12 months and 45% at 24 months after adhesiolysis compared with 11% at 12 months and 16% at 24 months in women left untreated (12). In women followed for an average of 49 months after tubal surgery, term PRs were inversely correlated with adhesion scores as assigned using the American Society for Reproductive Medicine classification system for adnexal adhesions (13). Bowel Obstruction Adhesions are the most common cause of postoperative small bowel obstruction (5). In a series of 552 patients with bowel obstruction, intra-abdominal adhesions were judged responsible in 74% of cases (14). Abdominal/Pelvic Pain The relationship between adhesions and pelvic pain is unclear. Although nerve fibers have been identified in pelvic adhesions, their prevalence is no greater in patients with pelvic pain than in those without pelvic pain (15). Moreover, there is no relationship between the extent of adhesions and the severity of pain. It is generally accepted that adhesions may cause visceral pain by impairing organ mobility (16, 17). A study of patients with chronic pelvic pain randomized to laparotomy with adhesiolysis or laparotomy alone found that adhesiolysis was effective only in those having dense adhesions involving the bowel (18). A randomized controlled multicenter trial observed that laparoscopic lysis of mild abdominal adhesions relieved abdominal or pelvic pain, but to no greater extent than sham surgery (19). Clearly, the impact that lysis of bowel or adnexal adhesions may have on abdominal and pelvic pain cannot be predicted confidently. REDUCTION IN ADHESION FORMATION All surgeons must be familiar with the risks and consequences of postoperative adhesions. Theoretically, formation of adhesions might be reduced by minimizing peritoneal injury during surgery, by preventing the introduction of reactive foreign bodies, by reducing the local inflammatory response, by inhibiting the coagulation cascade and promoting fibrinolysis, or by placing barriers between damaged tissues. FIGURE 1 Postoperative adhesions. Disruption of stromal mast cells Histamines Kinins Surgical tissue trauma Increased vascular permeability Fibrin Leucocytes Macrophages Release of vasoactive substances and inflammatory exudate Fibrinolysis and mesothelial regeneration Normal fibrinolytic activity Breakdown of fibrinous exudate within 72 hours Repair of underlying mesenchyme Decreased fibrinolytic activity Fibrin deposition Capillary development Adhesion formation ASRM Practice Committee. Peritoneal adhesions. Fertil Steril Surgical Technique Formation of postoperative adhesions may be reduced by careful surgical technique with adherence to microsurgical principles, which include gentle tissue handling, meticulous hemostasis, excision of necrotic tissue, minimizing ischemia and desiccation, the use of fine, nonreactive suture materials, and prevention of foreign-body reaction and infection (20, 21). Postoperative adhesions have been observed in up to 94% of patients after laparotomy (22, 23). Laparoscopy does not result necessarily in fewer adhesions than laparotomy; the extent of tissue injury, not the surgical approach, is the determining factor (24, 25). Risk for the development of anterior abdominal wall adhesions is likely lower after laparoscopy than after laparotomy, because the risk relates to the length of the abdominal incision(s) (25). Minimally invasive endoscopic surgery also may result in less tissue and organ handling and trauma, avoids contamination with foreign bodies such as surgical glove powder and lint from laparotomy pads, and facilitates more precise tissue manipulation, all of which may help to reduce risk for postoperative adhesion formation. The incidence of postoperative infection, another risk factor for adhesion formation, is lower after laparoscopy than after laparotomy. Pneumoperitoneum has a tamponade effect that may help to facilitate hemostasis during laparoscopy. However, as most commonly performed using standard insufflators, laparoscopy also can desiccate the peritoneum and, thus, may increase the risk for adhesion formation (26). In animals, adhesion risk increases with both time and insufflation pressure (27, 28). Regardless of the surgical approach selected, procedures such as myomectomy often result in adhesions. The 22 ASRM Practice Committee Peritoneal adhesions Vol. 88, No. 1, July 2007

31 prevalence of adhesions after open abdominal myomectomy is greater than 90% but is still at least 70% after laparoscopic myomectomy (29 31). Whether parietal peritoneal closure is necessary or advisable remains controversial (32 35). Evidence suggests that the incidence of adhesions at the site of closure after laparotomy is approximately 22% with peritoneal closure and 16% without peritoneal closure (32, 33). In women with ovarian cancer, closure of pelvic and periaortic peritoneum appears to result in greater adhesion formation than is observed when the dissected areas are left open (34). However, parietal peritoneal closure at primary cesarean delivery has been observed to yield significantly fewer dense and filmy adhesions (35). Adjuncts to Surgical Technique Three types of adjuncts to surgical technique have been used in attempts to reduce postoperative adhesions: anti-inflammatory agents, peritoneal instillates, and surgical adhesion barriers. Anti-inflammatory agents A number of local and systemic anti-inflammatory drugs and adhesion-reducing substances, including dexamethasone and promethazine have been evaluated, but none has been found effective for reducing postoperative adhesions (36 39). Peritoneal instillates Antibiotic solutions for peritoneal lavage and prevention of postoperative infection do not reduce adhesions, and some may promote adhesion formation (40). Thirty-two percent dextran 70 and crystalloid solution instillates, such as normal saline and Ringer s lactate with or without heparin or corticosteroids, have been used to separate adjacent peritoneal surfaces via hydrofloatation (40, 41), but none has been demonstrated effective for reducing adhesion formation (42). Icodextrin 4% solution (Adept â Adhesion Reduction Solution, Baxter Healthcare Corp., Deerfield, IL) is a watersoluble, high molecular weight, alpha (1,4)-linked glucose polymer in an electrolyte solution. When used as a peritoneal instillate (1 1.5 L), 4% icodextrin functions as a colloid osmotic agent to retain fluid within the peritoneal cavity for an interval of 3 4 days. Icodextrin is transferred into the systemic circulation via peritoneal lymphatic drainage and metabolized by a-amylase to lower molecular weight oligosaccharides that are eliminated by renal excretion. Although a preliminary randomized, controlled pilot study observed that icodextrin 4% reduced adhesion formation (43), a systematic review concluded that there is insufficient evidence for its use as an adhesion-preventing agent (42). Icodextrin 4% has been approved by the Food and Drug Administration (FDA) for use in the United States as an adjunct to good surgical technique for the reduction of postoperative adhesions in patients undergoing gynecologic laparoscopic adhesiolysis. Heparin has been suggested as a means to decrease adhesion formation via inhibition of the coagulation cascade and the promotion of fibrinolysis (44, 45). However, peritoneal irrigation with heparin solution does not appear to reduce peritoneal adhesions in women after pelvic surgery (46). Surgical adhesion barriers Surgical barriers may help to decrease postoperative adhesion formation but cannot compensate for poor surgical technique. Sodium hyaluronic acid (HA) and carboxymethylcellulose (CMC) are combined in a bioresorbable membrane (Seprafilm â ; Genzyme, Cambridge, MA) that has been modified to prolong its retention time in the body. CMC is nontoxic and is used commonly as filler in food, cosmetics, and pharmaceuticals. The HA film is a transparent and absorbable membrane that acts to separate opposing tissue surfaces and lasts for 7 days (47, 48). In one study involving 127 patients undergoing open abdominal myomectomy, women randomized to receive HA film were observed to have fewer adhesions than untreated controls (49). Although use of HA film may reduce midline adhesions (18), a systematic review concluded that there is limited evidence for its effectiveness for preventing adhesion formation after myomectomy (50).A large multicenter trial involving 1,701 patients randomized to treatment with HA film or no treatment at time of intestinal resection observed no overall difference in the incidence of postoperative small bowel obstruction between the two groups (51). The HA film is limited largely to use during laparotomy because it fragments easily if not handled gently. The HA film has been approved by the FDA for use in the United States. Oxidized regenerated cellulose (Interceed â ; ETHICON Women s Health and Urology, Somerville, NJ) is an absorbable adhesion barrier that requires no suturing. It is degraded into monosaccharides and absorbed within 2 weeks after application. The product has been shown to reduce adhesion formation in randomized controlled clinical trials (52 56), all of which have demonstrated benefit for reducing the incidence and extent of new and recurrent adhesions by 50% 60% after both laparoscopic and open abdominal surgical procedures (50). However, there is no substantive evidence that the reduction in adhesions resulting from use of oxidized regenerated cellulose improves fertility. In one small retrospective study involving 38 infertile women who required pelvic reconstructive surgery, the postoperative PR was higher among those treated with oxidized regenerated cellulose than among women not treated with the adhesion barrier (57). A study in humans (in contrast to the results from animal studies) found that adding heparin to oxidized regenerated cellulose provided no additional benefit (58). Oxidized regenerated cellulose (in the form of Interceed â ) has been approved by the FDA for use in the United States for reducing adhesions. Expanded polytetrafluoroethylene (eptfe, Gore-Tex Surgical Membrane â ; W.L. Gore Corp., Flagstaff, AZ) is a nonabsorbable adhesion barrier produced in thin sheets (0.1 mm thick) with an average pore size of less than 1 mm. Unlike oxidized regenerated cellulose and HA film, eptfe must be sutured to tissue. The product can help to prevent adhesion formation and reformation regardless of the type of injury Fertility and Sterility â 23

32 or whether complete hemostasis has been achieved (59). In one randomized trial, eptfe was found to decrease postmyomectomy adhesions and pelvic sidewall adhesions (60). EPTFE may be more effective than oxidized regenerated cellulose in preventing adhesion formation, but its use has been limited by the need for suturing and later reoperation for removal (50). EPTFE has been approved by the FDA for use in the United States for peritoneal repair. Hyaluronic acid solution (Sepracoat â ; Genzyme, Cambridge, MA) is a natural bioabsorbable component of the extracellular matrix and is cleared in less than 5 days. Women undergoing open gynecologic procedures treated with HA solution have been observed to have fewer new adhesions, particularly in areas of indirect trauma, and a greater likelihood of having at least one adhesion-free ovary compared with women treated with placebo (61). The HA solution is not approved by the FDA for adhesion reduction in the United States. Polyethylene glycol (PEG) (Spraygel â ; Confluent Surgical, Waltham, MA) is a two-component system consisting of two PEG-based liquids. The delivery system consists of an air pump and spray applicator and dispenses blue-colored PEG to cover the serosal defects. Within seconds after application, PEG becomes a gel that adheres to tissue. PEG has shown efficacy in early clinical trials (62), but larger studies are needed to better evaluate its effectiveness. PEG has not been approved by the FDA for use in the United States. Fibrin sealant (Tisseel VH â ; Baxter Healthcare Corp., Deerfield, IL) also has been used as an adhesion-reducing substance. In animal studies, treatment of peritoneal defects with fibrin sealant has been observed to decrease intraabdominal adhesion formation and reformation (63). Clinical data regarding the use of fibrin sealant in prevention of adhesions are limited. The product has been reported to decrease formation of adhesions after salpingostomy, salpingolysis, and ovariolysis, but not after tubal anastomosis (64, 65), probably because the extent of adhesion formation after anastomosis is typically only minimal or mild. Fibrin sealant is a biological product derived from human blood donors and therefore poses a theoretical risk for transmission of infectious agents. Fibrin sealant has been approved by the FDA for use in the United States as an adjunct to hemostasis in cardiothoracic surgery and the surgical treatment of splenic injuries, and as an adjunct for the closure of colostomies. SUMMARY AND RECOMMENDATIONS Postoperative adhesions are a natural consequence of tissue trauma and healing. Postoperative pelvic adhesions may result in infertility, pain, and bowel obstruction. Adherence to microsurgical principles, minimally invasive surgery, and some peritoneal instillates may help to reduce postoperative adhesions. There is no evidence that anti-inflammatory agents reduce postoperative adhesions. Whereas some surgical barriers have been demonstrated effective for reducing postoperative adhesions, there is no substantial evidence that their use improves fertility, decreases pain, or reduces the incidence of postoperative bowel obstruction. Acknowledgments: This report was developed under the direction of the Practice Committee of the American Society for Reproductive Medicine, in collaboration with the Society of Reproductive Surgeons, as a service to its members and other practicing clinicians. Although this document reflects appropriate management of a problem encountered in the practice of reproductive medicine, it is not intended to be the only approved standard of practice or to dictate an exclusive course of treatment. Other plans of management may be appropriate, taking into account the needs of the individual patient, available resources, and institutional or clinical practice limitations. The Practice Committee of the American Society for Reproductive Medicine and the Board of Directors of the American Society for Reproductive Medicine have approved this report. The members of the ASRM Practice Committee and the SRS Board of Directors have the following to disclose: ASRM Practice Committee Marc Fritz, M.D., has nothing to disclose. G. David Adamson, M.D., received a research grant from IBSA, and is a shareholder and CEO of Advanced Reproductive Care. Kurt Barnhart, M.D., is on the speakers bureau for Organon; is a consultant for Novo Nordisk; and has been an investigator in clinical trials for Organon, Wyeth-Ayerst, Johnson & Johnson, Duramed, Xanodyne, Boehringer Ingelheim, Third Wave, Pfeizer, and MGI Pharma. John Buster, M.D., is a consultant and investigator for Procter and Gamble and Vivus, and is an investigator for Solvay. William Catherino, M.D., Ph.D., has nothing to disclose. Marcelle Cedars, M.D., has nothing to disclose. John Collins, M.D., is a regulatory consultant for Berlex Canada, and is on the data and safety monitoring board for an Organon trial. Mark Licht, M.D., has nothing to disclose. James Liu, M.D., is an investigator for Solvay and Barr Laboratories, and is an advisory committee member for Merck and Barr. Catherine Racowsky, Ph.D., is a speaker for IVF Online, Serono, and Ferring. Glenn Schattman, M.D., is on the medical advisory board for TAP Pharmaceuticals, and is an advisor and shareholder for Femasys and Theralogix. Humberto Scoccia, M.D., has nothing to disclose. Michael Thomas, M.D., is a consultant for GlaxoSmithKline. Elizabeth West, R.N.C., B.S.N., is on the speaker s bureau for Serono, and is a consultant for Organon. Barry Witt, M.D., has nothing to disclose. Robert Rebar, M.D., has nothing to disclose. Nancy Frankel, M.B.A., has nothing to disclose. Andrew La Barbera, Ph.D., has nothing to disclose. Society of Reproductive Surgeons Board of Directors Peter Schlegel, M.D., is on the medical advisory board for Theralogix, Inc. Tommaso Falcone, M.D., is a consultant for Gynesonics. 24 ASRM Practice Committee Peritoneal adhesions Vol. 88, No. 1, July 2007

33 Keith Isaacson, M.D., is on the speaker s bureau for Karl Storz Endoscopy, and is an investigator for AMS. Anthony Luciano, M.D., has nothing to disclose. Ana Murphy, M.D., has nothing to disclose. Togas Tulandi, M.D., is a speaker for Baxter and Johnson & Johnson. Ricardo Azziz, M.D., M.P.H., M.B.A., is a consultant for Procter and Gamble, Merck, and Quest Diagnostics. REFERENCES 1. Ellis H, Moran BJ, Thompson JN, Parker MC, Wilson MS, Menzies D, et al. Adhesion-related hospital readmissions after abdominal and pelvic surgery: a retrospective cohort study. Lancet 1999;353: Lower AM, Hawthorn RJ, Ellis H, O Brien F, Buchan S, Crowe AM. The impact of adhesions on hospital readmissions over ten years after 8849 open gynaecological operations: an assessment from the Surgical and Clinical Adhesions Research Study. BJOG 2000;107: Lower AM, Hawthorn RJ, Clark D, Boyd JH, Finlayson AR, Knight AD, et al. Adhesion-related readmissions following gynaecological laparoscopy or laparotomy in Scotland: an epidemiological study of 24,046 patients. Hum Reprod 2004;19: Al-Sunaidi M, Tulandi T. Adhesion-related bowel obstruction after hysterectomy for benign conditions. Obstet Gynecol 2006;108: Al-Took S, Platt R, Tulandi T. Adhesion-related small bowel obstruction after gynecologic operations. Am J Obstet Gynecol 1999;180: Beck DE, Ferguson MA, Opelka FG, Fleshman JW, Gervaz P, Wexner SD. Effect of previous surgery on abdominal opening time. Dis Colon Rectum 2000;43: Coleman MG, McLain AD, Moran BJ. Impact of previous surgery on time taken for incision and division of adhesions during laparotomy. Dis Colon Rectum 2000;43: Van Der Krabben AA, Dijkstra FR, Nieuwenhuijzen M, Reijnen MM, Schaapveld M, Van Goor H. Morbidity and mortality of inadvertent enterotomy during adhesiotomy. Br J Surg 2000;87: Ray NF, Denton WG, Thamer M, Henderson SC, Perry S. Abdominal adhesiolysis: inpatient care and expenditures in the United States in J Am Coll Surg 1998;186: Diamond MP, El-Mowafi DM. Pelvic adhesions. Surg Technol Int 1998;VII: DiZerega GS. Contemporary adhesion prevention. Fertil Steril 1994;61: Tulandi T, Collins JA, Burrows E, Jarrell JF, McInnes RA, Wrixon W, et al. Treatment-dependent and treatment-independent pregnancy among women with periadnexal adhesions. Am J Obstet Gynecol 1990;162: Marana R, Rizzi M, Muzii L, Catalano GF, Caruana P, Mancuso S. Correlation between the American Fertility Society classification of adnexal adhesions and distal tubal occlusion, salpingoscopy, and reproductive outcome in tubal surgery. Fertil Steril 1995;64: Miller G, Boman J, Shrier I, Gordon PH. Etiology of small bowel obstruction. Am J Surg 2000;180: Kligman I, Drachenberg C, Papadimitriou J, Katz E. Immunohistochemical demonstration of nerve fibers in pelvic adhesions. Obstet Gynecol 1993;82: Kresch AJ, Seifer DB, Sachs LB, Barrese I. Laparoscopy in 100 women with chronic pelvic pain. Obstet Gynecol 1984;64: Duffy DM, dizerega GS. Adhesion controversies: pelvic pain as a cause of adhesions, crystalloids in preventing them. J Reprod Med 1996;41: Peters AA, Trimbos-Kemper GC, Admiraal C, Trimbos JB, Hermans J. A randomized clinical trial on the benefits of adhesiolysis in patients with intraperitoneal adhesions and chronic pelvic pain. Br J Obstet Gynaecol 1992;99: Swank DJ, Swank-Bordewijk SC, Hop WC, van Erp WF, Janssen IM, Bonjer HJ, et al. Laparoscopic adhesiolysis in patients with chronic abdominal pain: a blinded randomised controlled multi-centre trial. Lancet 2003;361: Singhal V, Li T, Cooke I. An analysis of the factors influencing the outcome of 232 consecutive tubal microsurgery cases. Br J Obstet Gynaecol 1991;98: Winston R, Margara R. Microsurgical salpingostomy is not an obsolete procedure. Br J Obstet Gynaecol 1991;8: Becker JM, Dayton MT, Fazio VW, Beck DE, Stryker SJ, Wexner SD, et al. Prevention of postoperative abdominal adhesions by a sodium hyaluronate-based bioresorbable membrane: a prospective, randomized, double-blind multicenter study. J Am Coll Surg 1996;183: Menzies D. Peritoneal adhesions (Incidence, cause, and prevention). Surg Annu 1992;24: Brill AI, Nezhat F, Nezhat CH, Nezhat C. The incidence of adhesions after prior laparotomy: a laparoscopic appraisal. Obstet Gynecol 1995;85: Levrant SG, Bieber EJ, Barnes RB. Anterior abdominal wall adhesions after laparotomy or laparoscopy. J Am Assoc Gynecol Laparosc 1997;4: Ott DE. Laparoscopy and tribology: the effect of laparoscopic gas on peritoneal fluid. J Am Assoc Gynecol Laparosc 2001;8: Yesildaglar N, Koninckx PR. Adhesion formation in incubated rabbits increases with high insufflation pressure during endoscopic surgery. Hum Reprod 2000;15: Molinas CR, Koninckx PR. Hypoxaemia induced by CO 2 or helium pneumoperitoneum is a co-factor in adhesion formation in rabbits. Hum Reprod 2000;15: Buttram VC, Reiter RC. Uterine leiomyomata: etiology, symptomatology, and management. Fertil Steril 1981;36: Berkeley AS, DeCherney AH, Polan ML. Abdominal myomectomy and subsequent fertility. Surg Gynecol Obstet 1983;156: Tulandi T, Murray C, Guralnick M. Adhesion formation and reproductive outcome after myomectomy and second-look laparoscopy. Obstet Gynecol 1993;82: Tulandi T, Hum HS, Gelfand MM. Closure of laparotomy incisions with or without peritoneal suturing and second-look laparoscopy. Am J Obstet Gynecol 1988;158: Roset E, Boulvain M, Irion O. Nonclosure of the peritoneum during caesarean section: long-term follow-up of a randomised controlled trial. Eur J Obstet Gynecol Reprod Biol 2003;108: Cheong YC, Bajekal N, Li TC. Peritoneal closure To close or not to close. Hum Reprod 2001;16: Lyell DJ, Caughey AB, Hu E, Daniels K. Peritoneal closure at primary cesarean delivery and adhesions. Obstet Gynecol 2005;106: Bateman BG, Nunley WC, Kitchin JD. Prevention of postoperative peritoneal adhesions with ibuprofen. Fertil Steril 1982;38: Kapur BM, Talwar JR, Gulati SM. Oxyphenbutazone anti-inflammatory agent in the prevention of peritonealadhesions. ArchSurg 1969;98: O Brien WF, Drake TS, Bibro MC. The use of ibuprofen and dexamethasone in the prevention of postoperative adhesion formation. Obstet Gynecol 1982;60: Puchalski A. The influence of cumulative dexamethasone, promethazine and dextran 70 used as protection against intraperitoneal adhesions on selected parameters of humoral immunity in women operated on for infertility. Ann Acad Med Stetin 1998;44: Rappaport WD, Holcomb M, Valente J, Chvapil M. Antibiotic irrigation and the formation of intraabdominal adhesions. Am J Surg 1989;158: Wiseman DM, Trout JR, Diamond MP. The rates of adhesion development and the effects of crystalloid solutions on the adhesion development in pelvic surgery. Fertil Steril 1998;70: Metwally M, Watson A, Lilford R, Vandekerckhove P. Fluid and pharmacological agents for adhesion prevention after gynaecological surgery. Cochrane Database Syst Rev 2006;(2):CD dizerega GS, Verco SJS, Young P, Kettel M, Kobak W, Martin D, et al. A randomized, controlled pilot study of the safety and efficacy of 4% icodextrin solution in the reduction of adhesions following laparoscopic gynaecological surgery. Hum Reprod 2002;17: Reid RL, Hahn PM, Spence JE, Tulandi T, Yuzpe AA, Wiseman DM. A randomized clinical trial of oxidized regenerated cellulose adhesion barrier (Interceed, TC7) alone or in combination with heparin. Fertil Steril 1997;67:23 9. Fertility and Sterility â 25

34 45. Al-Chalabi HA, Otubo JA. Value of a single intraperitoneal dose of heparin in prevention of adhesion formation: an experimental evaluation in rats. Int J Fertil 1987;32: Jansen RP. Failure of peritoneal irrigation with heparin during pelvic operations upon young women to reduce adhesions. Surg Gynecol Obstet 1988;166: Diamond MP, DeCherney AH, Linsky CB, Cunningham T, Constantine B. Adhesion re-formation in the rabbit uterine horn model: I (reduction with carobxymethylcellulose). Int J Fertil 1988;33: Moreira H, Wexner SD, Yamaguchi T, Pikarsky AJ, Choi JS, Weiss EG, et al. Use of bioresorbable membrane (sodium hyaluronate þ carboxymethylcellulose) after controlled bowel injuries in rabbit model. Dis Colon Rectum 2000;43: Diamond MP. Reduction of adhesions after uterine myomectomy by Seprafilm membrane (HAL-F): a blinded, prospective, randomized, multicenter clinical study. Fertil Steril 1996;66: Farquhar C, Vandekerckhove P, Watson A, Vail A, Wiseman D. Barrier agents for preventing adhesions after surgery for subfertility. Cochrane Database Syst Rev 2000;(2):CD Fazio VW, Cohen Z, Fleshman JW, Van Goor H, Bauer JJ, Wolff BG, et al. Reduction in adhesive small-bowel obstruction by seprafilm adhesion barrier after intestinal resection. Dis Colon Rectum 2006;49: INTERCEED(TC7) Adhesion Barrier Study Group. Prevention of postsurgical adhesions by Interceed(TC7), an absorbable adhesion barrier: a prospective randomized multicenter clinical study. Fertil Steril 1989;51: Sekiba K, The Obstetrics and Gynecology Adhesion Prevention Committee. Use of Interceed(TC7) absorbable adhesion barrier to reduce postoperative adhesion reformation in infertility and endometriosis surgery. Obstet Gynecol 1992;79: Azziz R, The INTERCEED (TC7) Adhesion Barrier Study Group II. Microsurgery alone or with INTERCEED Absorbable Adhesion Barrier for pelvic sidewall adhesion re-formation. Surg Gynecol Obstet 1993;177: Li TC, Cooke ID. The value of an absorbable adhesion barrier, Interceed, in the prevention of adhesion reformation following microsurgical adhesiolysis. Br J Obstet Gynaecol 1994;101: Franklin RR, The Ovarian Adhesion Study Group. Reduction of ovarian adhesions by the use of Interceed. Obstet Gynecol 1995;86: Sawada T, Nishizawa H, Nishio E, Kadowaki M. Postoperative adhesion prevention with an oxidized regenerated cellulose adhesion barrier in infertile women. J Reprod Med 2000;45: Reid RL, Lie K, Spence JE, Tulandi T, Yuzpe A. Clinical evaluation of the efficacy of heparin-saturated Interceed for the prevention of adhesion reformation in the pelvic sidewall of the human. Prog Clin Biol Res 1993;381: Magro B, Mita P, Bracco GL, Coccia E, Scarselli G. Expanded polytetrafluoroethylene surgical membrane in ovarian surgery on the rabbit (biocompatibility, adhesion prevention properties and ability to preserve reproductive capacity). J Reprod Med 1996;41: Haney AF, Hesla J, Hurst BS, Kettel LM, Murphy AA, Rock JA, et al. Expanded polytetrafluoroethylene (eptfe) (Gore-Tex Surgical Membrane) is superior to oxidized regenerated cellulose (Interceed TC7þ) in preventing adhesions. Fertil Steril 1995;63: Diamond MP. The Sepracoat Adhesion Study Group. Reduction of de novo postsurgical adhesions by intraoperative precoating with Sepracoat (HAL-C) solution: a prospective, randomized, blinded, placebocontrolled multicenter study. Fertil Steril 1998;69: Mettler L, Audebert A, Lehmann-Willenbrock E, Schive K, Jacobs VR. Prospective clinical trial of SprayGel as a barrier to adhesion formation: an interim analysis. JAm Assoc Gynecol Laparosc 2003;10: Caballero J, Tulandi T. Effects of Ringer s lactate and fibrin glue on postsurgical adhesions. J Reprod Med 1992;37: de Virgilio C, Dubrow T, Sheppard BB, MacDonald WD, Nelson RJ, Lesavoy MA, et al. Fibrin glue inhibits intra-abdominal adhesion formation. Arch Surg 1990;125: Kjaergard HK. Patient-derived fibrin sealant: clinical, preclinical, and biophysical aspects. Dan Med Bull 2003;50: ASRM Practice Committee Peritoneal adhesions Vol. 88, No. 1, July 2007

35 SPECIAL CONTRIBUTION Workshop report: evaluation of genetic and epigenetic risks associated with assisted reproductive technologies and infertility Rosanna Weksberg, M.D., Ph.D., a,b,c,d Cheryl Shuman, M.S., a,b,c Louise Wilkins-Haug, M.D., Ph.D., e Mellissa Mann, Ph.D., f Mary Croughan, Ph.D., g,h Donna Stewart, M.D., i,j Catherine Rakowsky, Ph.D., e Arthur Leader, M.D., k Judith Hall, M.D., l J. M. Friedman, M.D., Ph.D., m Joe Leigh Simpson, M.D., n Lewis Holmes, M.D., o and Claire Infante-Rivard, M.D., Ph.D. p a Division of Clinical and Metabolic Genetics, Department of Paediatrics, and b Research Institute, Hospital for Sick Children, Toronto, Ontario, Canada; c Department of Molecular and Medical Genetics, and d Institute of Medical Sciences, University of Toronto, Toronto, Ontario, Canada; e Department of Obstetrics and Gynecology, Brigham and Women s Hospital, Boston, Massachusetts; f Department of Obstetrics and Gynecology, and Department of Biochemistry, University of Western Ontario and Children s Health Research Institute, London, Ontario, Canada; g Department of Obstetrics, Gynecology, and Reproductive Sciences, and h Department of Epidemiology and Biostatistics, University of California, San Francisco, California; i Department of Women s Health, University Health Network, Toronto, Ontario, Canada; j Department of Women s Health, University of Toronto, Toronto, Ontario, Canada; k Division of Reproductive Medicine, Department of Obstetrics, Gynaecology and Medicine, University of Ottawa, Ottawa, Ontario, Canada; l Department of Paediatrics, University of British Columbia, Vancouver, British Columbia, Canada; m Department of Medical Genetics, University of British Columbia, Vancouver, British Columbia, Canada; n Department of Obstetrics and Gynecology, and Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas; o Department of Genetics, and Teratology Unit, MassGeneral Hospital for Children, Boston, Massachusetts; and p Department of Epidemiology, and Department of Biostatistics, McGill University, Montreal, Quebec, Canada In January 2005, the Assisted Reproductive Technologies (ART) Workshop: Evaluation of Genetic and Epigenetic Risks Associated with Assisted Reproductive Technologies and Infertility was convened to evaluate current data on genetic and epigenetic risks to offspring conceived after a period of infertility and/or via ARTs. Formal presentations and workshop breakout groups reviewed the information from a broad range of disciplines and discussed issues regarding study design, molecular approaches, animal model systems, clinical outcomes, and ethical, legal, and psychosocial issues. The key recommendations of the workshop are that: [1] ART research and education should flow from clinical and basic science studies of the fundamental biology of early mammalian embryonic development, with a focus on how infertility and/or ART might disrupt such processes; [2] such research should include the emerging area of epigenetics and its potential role in reproductive health outcomes; [3] methods for the standardization of data collection and for handling and analysis should be employed, including precise definitions of obstetric and perinatal terminology; [4] much greater awareness and ongoing evaluation of the psychosocial impact of ART and ART research on women, their partners, and their offspring are required; and [5] effective methods of knowledge transfer need to be developed and delivered to healthcare providers and to the general public regarding reproductive planning, infertility, and ART, including the potential risks associated with each. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Received November 25, 2005; revised November 15, 2006; accepted November 26, Supported by the Canadian Institutes of Health Research, Ottawa, Canada, Institutes of Genetics and Cancer Research, National Cancer Institute of Canada, Toronto, Ontario, Canada, and the Reproductive Sciences Branch, National Institute of Child Health and Human Development, Rockville, MD. Presented at the ART Workshop: Evaluation of Genetic and Epigenetic Risks Associated with Reproductive Technologies and Infertility, January 14 15, 2005, Toronto, Ontario, Canada. Reprint requests: Rosanna Weksberg, Division of Clinical and Metabolic Genetics, Department of Paediatrics, Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada (FAX: ; rosanna.weksberg@sickkids.ca). Over two million babies have been conceived worldwide through assisted reproduction. Recently, the complications and safety of assisted reproductive technologies (ARTs) were questioned. For example, ARTs were linked to an increased risk of intrauterine growth restriction (odds ratio [OR], 1.59; 95% confidence interval [CI], ), pre /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 27

36 mature birth ( 33 weeks of gestation: OR, 2.99; 95% CI, ; 37 weeks of gestation: OR, 1.93; 95% CI, ), low birth weight ( 1,500 g: OR, 3.78; 95% CI, ), and in utero death (OR, 2.40; 95% CI, ) (1 4). Furthermore, an apparent association with ART was recently found in registries of children with Angelman syndrome (AS) (5,6) and Beckwith-Wiedemann syndrome (BWS) (7 10). As well, infertility itself likely contributes to these aforementioned risks (11). In light of these reports, the ART Workshop: Evaluation of Genetic and Epigenetic Risks Associated With Assisted Reproductive Technologies and Infertility was held January 14 15, 2005, at the Hospital for Sick Children, Toronto, Ontario, Canada. Forty-five professionals were convened to review the risks to pregnancies and fetuses conceived after a period of infertility and/or via ART, and to make recommendations regarding future research on adverse clinical outcomes caused by genetic or epigenetic alterations following infertility or ART. METHODS Rosanna Weksberg, M.D., Ph.D., Chair, with Co-Chairs Louise Wilkins-Haug, M.D., Ph.D., and Cheryl Shuman, M.S., assembled an international, multidisciplinary group of investigators and clinicians with acknowledged expertise in clinical epidemiology, obstetrics and gynecology, clinical embryology, developmental and molecular biology, clinical and cancer genetics, genomic imprinting (human and mouse), genetic counseling, bioethics, women s health, and law. The goals of the workshop were to: [1] Review the current knowledge of risks to offspring following infertility and/or ART [2] Increase networking and knowledge transfer among relevant experts [3] Determine whether further study is merited, who might collaborate, and how that research would be funded (the full proceedings of the workshop are available from Dr. Weksberg) [4] Develop recommendations for future research on the adverse clinical outcomes caused by genetic or epigenetic alterations after infertility or ART The workshop consisted of formal presentations that reviewed the current state of information on infertility and ART from a broad range of disciplines, followed by group discussion (summarized in Group Discussions and Recommendations, below). In addition, individuals were allocated to one of four breakout groups according to their area of expertise, each with a group chair. Breakout groups addressed issues regarding study design including recruitment and sampling, genetic and epigenetic outcomes including molecular approaches and animal model systems, clinical outcomes, and ethical, legal, and psychosocial issues. The meeting concluded with presentations from each of the breakout groups, after which key recommendations were formulated by the entire workshop membership. REVIEW: CURRENT STATE OF KNOWLEDGE Summary of Systematic Review of All Published Data on Health of Children Conceived by IVF The opening presentation, by Judith Hall, M.D., addressed the conclusions of a recent panel* which reviewed published data on health outcomes in children conceived after IVF. Evidence now indicates that singletons born after ART are at increased risk of premature birth, very low birth weight, and perinatal mortality, compared with singletons born to fertile women. They are also at increased risk for sex chromosome abnormalities, attributable in part to parental chromosomal abnormalities. Compared to naturally conceived twins, twins born after ART do not appear to be at greater risk for adverse birth outcomes. In addition, the panel concluded that evidence is suggestive but not sufficient to conclude that there is an increased risk for rare genetic syndromes involving loss of imprinting, such as Beckwith-Wiedemann syndrome (BWS) and Angelman syndrome (AS). The data were either inadequate or not suggestive of an association between IVF and other risks, including respiratory infection, hypospadias, developmental and psychosocial maladjustment, major malformations, childhood cancer, and growth abnormalities. However, the panel recommended additional research in this area. Technical and Clinical Heterogeneity in ART: Problems in Assessing Anomalies in Offspring The pitfalls of assessing anomalies in offspring after ART are multifold. Joe Leigh Simpson, M.D., emphasized the following salient points, and recommended care in planning future studies. Current databases inadequately describe heterogeneous ART populations in terms of indications for treatment and ART procedures. Furthermore, couples requiring ART for infertility have an a priori increased risk for birth defects in their offspring. Thus, designating an appropriate control group to study ART couples presents a special challenge, given that they cannot be matched to an infertile control group who achieve conception without treatment, or to a large-enough fertile control group who conceive with the use of ART. In addition, technical variables and confounders were rarely taken into account in previous studies, and are particularly challenging to track accurately. Assisted Human Conception: ART of the Possible Arthur Leader, M.D., provided a historical perspective of assisted human conception, and described medical procedures used for infertility treatment, including superovulation, egg retrieval, and embryo transfer. Despite the many advances made to date, current data indicate that ART cannot * Judith Hall, M.D., was a member of a multidisciplinary panel charged with reviewing the medical literature, organized by the Genetics and Public Policy Center, Johns Hopkins University (Baltimore, MD), the American Society of Reproductive Medicine (Birmingham, AL), the American Association of Pediatrics (E/K Grove Village, IL), and the Pew Charitable Trust (Philadelphia, PA). 28 Weksberg et al. ART Workshop Report Vol. 88, No. 1, July 2007

37 compensate for the decline in fertility associated with aging. The success rates for all forms of ART are lower than anticipated, and there is an increased rate of spontaneous losses as well as an increased risk of problematic prenatal outcomes. Again, these issues complicate group comparisons in studies of ART and infertility. ART and Obstetric Outcomes Louise Wilkins-Haug, M.D., Ph.D., described the obstetric outcomes of multifetal and singleton pregnancies, and outlined confounders of these outcomes. Unexplored in large populations are the confounders of ART, such as etiology of infertility, ART methodological variables, effects of selective reduction, and effects of intracytoplasmic sperm injection (ISCI), and the confounders of obstetric complications, such as preterm delivery including maternal disease and fetal disease, and the contribution of placental pathology to adverse outcomes. Controlling for all such variables would require extremely large and highly coordinated study designs. Genetic and Epigenetic Mechanisms Epigenetics and genomic imprinting were reviewed by Rosanna Weksberg, M.D., Ph.D. The human imprinting disorders (BWS and AS) were described, and the evidence that ART may increase the frequency of these disorders was presented. In addition, Dr. Weksberg reported that an excess of female monozygotic twins are discordant for imprinting errors that result in BWS. Thus, the question was raised as to whether programmed genomic methylation during preimplantation development is disrupted by infertility or ART. The North American Antiepileptic Drug Pregnancy Registry: A Seven-Year Experience Lewis Holmes, M.D., reviewed the multifaceted aspects of conducting a long-term prospective study. The steps needed to undertake and complete a study such as the North American Antiepileptic Pregnancy Registry were described. Specific considerations for such a study were highlighted, and include [1] defining inclusion and exclusion criteria, [2] identifying comparison groups, [3] developing marketing strategies to promote enrollment, [4] defining the clinician s role in reviewing reports and clarifying data, and [5] identifying a scientific advisory committee to establish goals, review findings, and set criteria for information dissemination. Epidemiological Issues in Large-Scale, Multicenter Studies Claire Infante-Rivard, M.D., Ph.D., presented a number of factors that would influence the design of a large-scale, multicenter study. Such factors include specific research questions and the nature of selected outcomes (e.g., public health outcomes). Also, a number of components will require clear definition (e.g., when is time zero in the cohort?), as will the covariates and the time dependency of each variable being measured. The advantages and limitations of several theoretical study designs were presented, and it was acknowledged that from an epidemiological perspective, a comprehensive study assessing outcomes associated with infertility and ART is very complex. Multicenter Studies of Rare Conditions: Joys and Challenges Jan Friedman, M.D., Ph.D., presented several approaches to accessing information, and pointed out that the type of information being sought may determine the mechanism for data extraction. For example, information can be obtained via vital statistics, administrative records, special surveillance systems, genetic service databases, and dedicated study databases. The potential advantages and limitations of each were considered with respect to seeking information on pregnancies and birth outcomes after infertility and ART. Also, he presented his experience regarding multicenter record linkage from the Canadian Molecular Cytogenetics Platform, and stressed that high quality data can be obtained only if there is adequate funding for appropriate database development, maintenance, and management. Mechanisms Regulating Genomic Imprinting in Human and Mouse Development Mellissa Mann, Ph.D., described current knowledge regarding the effects of in vitro embryo culture on mice and domesticated livestock; in vitro culture in animal models leads to reduced viability and growth, developmental abnormalities, and behavioral changes. Furthermore, in vitro culture studies revealed that imprinting can be perturbed during preimplantation development in culture, and in the long term can result in the selective loss of imprinting in the placenta compared to the embryo proper. Given that molecular analyses of patients with AS and BWS conceived by IVF or ICSI revealed imprinting errors, these results in mouse models are highly relevant to our understanding of the effects of ARTs in humans. Public Policy, Assisted Human Reproduction, and Stem Cells Arthur Leader, M.D., presented an overview of current Canadian policies regarding assisted human reproduction, including stem-cell research; Erin Nelson, B.Sc.P.T. (Alberta), L.L.B (Alberta), L.L.M (Columbia), (Health Law Institute, University of Alberta, Edmonton, Alberta, Canada) was to have addressed Legal and Ethical Issues in ART Outcomes Research, but was unable to attend the workshop. Assisted Human Reproduction Bill C6 was passed by the Canadian legislature in This bill oversees reproductive genetic research and practice, including the licensing of ART clinics and research laboratories. Pertinent activities that are regulated include any that are undertaken to create an embryo (e.g., IVF) from human reproductive material. Issues of the storage, handling, and use of such materials and em- Fertility and Sterility 29

38 bryos, and the collection of donor medical information, are included. Childhood Outcomes After Infertility and Infertility Treatment Mary Croughan, Ph.D., presented an overview of the design and preliminary data from her retrospective cohort study on children conceived by women who were evaluated for infertility or who underwent infertility treatment, compared to children conceived by fertile women in the general population. Infertile study subjects were assembled from 11 infertility clinics in northern California. Information obtained from medical records and maternal interviews included [1] fertility status, [2] infertility diagnosis, [3] method of conception, [4] prenatal, delivery, and postnatal complications, and [5] the medical condition of the children from birth to age 6 years. Data from 4,000 women (2,000 each in the infertile and fertile populations) and their babies are being analyzed, and will undoubtedly make significant contributions to our knowledge regarding the risk to children if conception is complicated by infertility and/or infertility treatments. GROUP DISCUSSIONS AND RECOMMENDATIONS ART: Recruitment, Sampling and Infertility This group, led by Arthur Leader, M.D., addressed issues concerning recruitment, sampling, and infertility, including: [1] how to appropriately inform patients who are considering ART in light of the available data, [2] whether clinical trials should be attempted and with what aims, and [3] the design of research in specific topic areas. The group proposed a prospective cohort study on ART that would emphasize pregnancy outcomes, short- and long-term effects on children, and the demonstrable obstetrical effects of ART. This discussion underscored the need for a common template for recording clinical protocols across all centers, as well as the management of data sharing, recruitment, and sampling for ART studies. The group also acknowledged the challenge of identifying an appropriate control group, e.g., infertile couples who become pregnant without the use of ART. Consideration would need to be given to issues of privacy, consent, and acceptable risks for patients undergoing ART, including how to quantify and/or describe these risks. ART: Genetic and Epigenetic Outcomes Chaired by Rosanna Weksberg, M.D., Ph.D., this group discussed genetic and epigenetic outcomes of ART. This group focused on: [1] whether testing for BWS and AS should be offered prenatally to participants, [2] the need for placental testing, [3] whether differences exist between cord blood analysis, fetal tissue examination, and placental sampling, and [4] the question of long-term cancer risk to ART offspring. Discussion centered on identifying the molecular bases, genetic or epigenetic, for clinical findings recently associated with ART, and the group endorsed the use of animal models such as mouse and zebrafish, emphasizing that placental samples should be included in analyses. The group suggested a national, retrospective study for AS and BWS, with recommendations on sampling methods. They also recommended a major study of the epigenetic correlates of birth weight in ART versus non-art pregnancies, since imprinted genes are often involved in growth. ART: Clinical Outcomes This group, led by Louise Wilkins-Haug, M.D., Ph.D., discussed clinical outcomes of ART, and noted the need for further data. Discussion included the factors that need to be considered to undertake research, including: [1] age and other demographic characteristics, [2] infertility diagnoses, [3] type of ART intervention and its variation among different centers, and [4] details of laboratory and clinical techniques. A number of other technical issues were discussed, including the timing of initial and follow-up assessments, and which outcome measures to track. The group concluded that more information is required to assess offspring outcomes, including: [1] developmental and obstetrical factors, [2] parental variables, [3] gender differences, [4] demographic issues, [5] the effects of substances (e.g., tobacco, alcohol, and drugs) on outcomes, and [6] the effects of infertility factors identified from the initial workup. Discussion also centered on sample collection and the information to be disseminated to patients, as this might motivate participation. The group suggested prospective studies to measure longitudinal outcomes, emphasizing the requirements for appropriate comparison data from the general population, and recommended the implementation of a perinatal registry in Canada and the United States to obtain contemporaneous controls. ART: Ethical, Legal, and Psychosocial Considerations Led by Cheryl Shuman, M.S., this group focused on [1] the potential psychological impact of ART studies, [2] the clinical relevance of such studies, [3] the infrastructure required (e.g., personnel, databases), and [4] patient-centered issues such as the timing and process of informed consent, ethics and legal issues, and other potential psychosocial impacts on patients and their families. The group recommended a standard-information pamphlet for all prospective patients to identify relevant known and suspected risks of ART, and maternal physical and psychological health-related issues. They also recommended that the disclosure process for informed consent should include the availability of other healthcare professionals, nurses, genetic counsellors, social workers, and others as needed to address patient concerns. In addition, research consent should be obtained early in the workup for ART, and might require a larger investment in local staffing, and increased communication with potential patients. Maternal consent should cover samples obtained by prenatal diagnosis testing, as well as placental, cord, and cord-blood samples. The group suggested that research be 30 Weksberg et al. ART Workshop Report Vol. 88, No. 1, July 2007

39 conducted [1] on how full-risk disclosure influences the acceptance of ART; [2] on patient or family psychosocial impact; and [3] on the nature of risk perception in patients who had received partial- or full-risk disclosure. Finally, the group considered that a national or international registry for ART might be possible, and would facilitate many aspects of research on outcomes after infertility and ART. CONCLUSIONS The workshop concluded with consensus among the participants regarding the following key recommendations: [1] ART research and education should flow from clinical and basic science studies of the fundamental biology of early mammalian embryonic development, with a focus on how infertility and ART might disrupt such processes. Such research should include the emerging area of epigenetics and its role in maintaining, controlling, and coordinating reproductive health outcomes. [2] Prospective studies of clinical outcomes should be employed, with standardized methods for data collection and analysis, including precise definitions of obstetric and perinatal terminology. [3] Much greater awareness and ongoing evaluation of the psychosocial impact of ART, and ART research on women, their partners, and their offspring, are required. In addition, effective methods of knowledge transfer need to be developed for delivery to healthcare providers and to the general public regarding reproductive planning, infertility, and ART. [4] Finally, the group emphasized the importance of adequate funding for such work, considering the high cost of multidisciplinary prospective studies and the need for investment in this area of research. REFERENCES 1. Gekas J, Thepot F, Turleau C, Siffroi JP, Dadoune JP, Briault S, et al. Chromosomal factors of infertility in candidate couples for ICSI: an equal risk of constitutional aberrations in women and men. Hum Reprod 2001;16(1): Bonduelle M, Van Assche E, Joris H, Keymolen K, Devroey P, Van Steirteghem A, et al. Prenatal testing in ICSI pregnancies: incidence of chromosomal anomalies in 1586 karyotypes and relation to sperm parameters. Hum Reprod 2002;17: Schieve LA, Rasmussen SA, Buck GM, Schendel DE, Reynolds MA, Wright VC. Are children born after assisted reproductive technology at increased risk for adverse health outcomes? Obstet Gynecol 2004;103: Jackson RA, Gibson KA, Wu YW, Croughan MS. Perinatal outcomes in singletons following in vitro fertilization: a meta-analysis. Obstet Gynecol 2004;103: Cox GF, Burger J, Lip V, Mau UA, Sperling K, Wu B-L, et al. Intracytoplasmic sperm injection may increase the risk ofimprinting defects. Am J Hum Genet 2002;71: Orstavik KH, Eiklid K, van der Hagen CB, Spetalen S, Kierulf K, Skjeldal O, et al. Another case of imprinting defect in a girl with Angelman syndrome who was conceived by intracytoplasmic sperm injection. Am J Hum Genet 2003;72: DeBaun MR, Niemitz EL, Feinberg AP. Association of in vitro fertilization with Beckwith-Wiedemann syndrome and epigenetic alterations of LIT1 and H19. Am J Hum Genet 2003;72: Maher ER, Brueton LA, Bowdin SC, Luharia A, Cooper W, Cole TR, et al. Beckwith-Wiedemann syndrome and assisted reproduction technology (ART). J Med Genet 2003;40: Gicquel C, Gaston V, Mandelbaum J, Siffrio J-P, Flahault A, Le Bouc Y. In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCNQ1OT1 gene. Am J Hum Genet 2003;72: Halliday J, Oke K, Breheny S, Algar E, Amor DJ. Beckwith- Wiedemann syndrome and IVF: a case-control study. Am J Hum Genet 2004;75: Ludwig M, Katalinic A, Gross S, Sutcliffe A, Varon R, Horsthemke B. Increased prevalence of imprinting defects in patients with Angelman syndrome born to subfertile couples. J Med Genet 2005;42: Fertility and Sterility 31

40 ENDOMETRIOSIS Aromatase expression in endometriotic tissues and its relationship to clinical and analytical findings Pedro Acién, M.D., a,b Irene Velasco, B.Sc., Ph.D., b Mercedes Gutiérrez, M.D., c and Monserrat Martínez-Beltrán, M.D. a a Service of Obstetrics and Gynecology, San Juan University Hospital; b Department of Gynecology, School of Medicine, Miguel Hernandez University; and c Laboratory of Clinical Analysis, San Juan University Hospital, Alicante, Spain Objective: To study the relationship between aromatase expression in endometriotic tissues and clinical and laboratory findings. Design: Prospective basic and clinical research. Setting: University hospital. Patient(s): Sixty-two women with endometriosis, and 12 without endometriosis. Intervention(s): Conservative surgery, or hysterectomy and adnexectomy, along with an immunohistochemical study of aromatase in endometriotic and nonendometriotic tissues. Main Outcome Measure(s): Symptoms of the disease, ultrasound and surgical findings, values of tumor markers, steroids and immunoglobulins, and recurrences after surgery. Result(s): We observed positive immunohistochemical expression for aromatase in endometriotic tissues from 38 patients (61.3%). Aromatase expression was negative in the rest of the tissues studied and in the 12 cases without endometriosis. Aromatase-positive patients had a higher number of endometriomas, more bilaterality, and more moderate-to-severe chronic pelvic pain. Also, infertility and associated leiomyomas were more frequent in these patients, though without significant differences. There were no differences in recurrence of the disease 1 year later. Estradiol and PRL levels were significantly higher, and IgG values lower, than in aromatase-negative patients. High values of blood sedimentation rate were more frequent in aromatase-negative patients. Conclusion(s): Molecular alterations such as the presence of aromatase in endometriotic tissues could be involved in the development or maintenance of endometriosis. Our findings suggest major severity, activity, and chronic pelvic pain in patients with aromatase in endometriotic tissue. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Aromatase expression, endometriomas, tumor markers, estradiol, prolactin, immunoglobulins, recurrence of endometriosis Endometriosis is a common estrogen (E)-dependent disease characterized by the presence of functional endometrium outside the uterus. Although the etiology of the disease is not well-established, several immunological and biochemical alterations are present in these patients (1,2). Abnormal levels of different cytokines and markers of inflammation were described in the serum and peritoneal fluid of women with endometriosis. These alterations are probably related to the progression of the disease, the embryotoxic activity observed in vitro, and the possible associated infertility (3,4). In addition, molecular anomalies such as the aberrant expression of the cytochrome P450 aromatase were described in the Received April 27, 2006; revised November 2, 2006; accepted November 21, Supported by grant FIS 01/0679 from the Fondo de Investigaciones Sanitarias, Ministry of Health, Madrid, Spain. Reprint requests: Pedro Acién, M.D., Department of Gynecology, School of Medicine, Miguel Hernandez University, Campus of San Juan, Alicante, Spain (FAX: ; acien@umh.es). eutopic (5 7) and ectopic (8) endometrium of some women with endometriosis. In general, however, aromatase expression is absent in the eutopic endometrium, and aromatase is not expressed in the endometrium of disease-free women (9). This enzyme is responsible for the conversion of C19 steroids into Es in certain human tissues, such as the placenta, gonads, adipose tissue, skin, and brain (10). On the other hand, prostaglandin E 2 (PGE 2 ) appears to be the most potent known stimulator of aromatase in endometriosis (11,12). This aromatase activity could give rise to a local biosynthesis of Es, which in turn could stimulate PGE 2 production by up-regulation of cyclooxygenase-2, thus establishing a positive feedback cycle (8,12,13). Prostaglandin and E concentrations are associated with proliferation, migration, angiogenesis, apoptosis resistance, and even invasiveness in several human cell lines. Consequently, aberrant aromatase expression in the stromal cells of endometriosis may promote the growth of 32 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

41 endometriotic implants because of the hormone-dependent character of the disease. Recently, we reported on the expression of aromatase in endometriotic tissues and aromatase activity in cell cultures of endometriotic fibroblasts and adipocytes (14). The addition of peritoneal fluid, tumor necrosis factor (TNF)-, and especially interleukin (IL)-6 stimulated the basal enzymatic activity observed in both types of cells, which suggests that there is local production of E in endometriosis that may be stimulated by some factors, such as cytokines, present in the peritoneal fluid of patients with endometriosis. The aim of this study was to relate the expression of aromatase in endometriotic tissues to [1] symptoms of the disease, [2] ultrasound and surgical findings, [3] analytical data, and [4] the recurrence of endometriosis 1 year after surgery. MATERIALS AND METHODS We recruited 62 women with endometriosis who had regular ovulatory cycles and who were going to have a laparoscopy or laparotomy with conservative surgery, or a hysterectomy and salpingooophorectomy, because of recurrent and severe endometriosis. The nonendometriosis group included 12 women who had shown a clinical or echographic differential diagnosis with endometriomas, but who had undergone surgery for dermoid cysts or other nonfunctioning ovarian tumors. The average age of the 49 women who had a laparoscopy (n 9) or laparotomy (n 40) with conservative surgery for endometriosis was (SD) years; that of the 13 women with endometriosis who had a hysterectomy and bilateral salpingooophorectomy was years; and that of the 12 women operated on with nonendometriotic pathologies was years. Twelve patients from the first group, five from the second group, and none from the third one were infertile, whereas 9, 7, and 5 patients from the respective groups had children. Patients had not received any previous medical or surgical treatment for endometriosis at least 3 months before surgery. During the study, in all outpatients, a repeated transvaginal ultrasound was performed in the first and second halves of the cycle, and evaluation of symptomatology was performed with the application of a visual analogue scale (VAS) for endometriosis that includes the symptoms of dysmenorrhea, dyspareunia, chronic pelvic pain, and others, graded on a 10-point scale (15). Laboratory tests included blood sedimentation rate, tumor markers (CA-125 and CA-19-9), hormones (E 2, P, and PRL), and immunoglobulins (IgG, IgA, and IgM). Blood samples were collected in the second half of the cycle. Those parameters were again evaluated 1 year after surgery. During surgery, endometriosis was evaluated and catalogued according to the revised classification criteria of the American Society for Reproductive Medicine (16,17). A cystectomy and ovarian reconstruction, adhesiolysis, implant coagulation, and other conservative surgical techniques were performed in 49 patients. In addition, six patients underwent myomectomy, and two underwent a benign teratoma cystectomy. As we pointed out, 13 women with endometriosis had a hysterectomy with bilateral salpingooophorectomy. Of the 12 women without endometriosis, 11 had a cystectomy or adnexectomy, and one had a hysterectomy with adnexectomy. An attempt was made to perform surgery in the second half of the cycle for all cases, although this was not always possible because of operating-theater availability. Samples of endometriomas, peritoneal endometriotic implants, and deep-infiltrating lesions (if any) were taken from extracted tissues to study aromatase expression and then sent for pathological analysis. Furthermore, samples of endometrium, myometrium (in cases with a hysterectomy), leiomyomas, and healthy peritoneum from women with endometriosis, as well as peritoneum and nonendometriotic cyst samples from women without endometriosis, were collected to study aromatase expression. Patients were scheduled for follow-up every 6 months. In cases with conservative surgery, recurrences were considered according to the parameters of CA-125 ( 35 U/mL), symptoms (VAS 4), and endometriomas observed in the transvaginal ultrasound scan ( 3 cm). This study was approved by our Institutional Review Board, and all patients gave signed consent. Immunohistochemistry for P450 Aromatase Immunohistochemistry for P450 aromatase was described by Velasco et al. (14). Briefly, tissue samples were fixed with 10% paraformaldehyde solution, paraffin-embedded, and cut into 8- m serial sections. To immunostain P450 aromatase, sections were deparaffinized, hydrated in decreasing concentrations of ethanol, washed briefly in phosphate-buffered saline (PBS, 0.01 M, ph 7.2), and incubated in hydrogen peroxide (3%, v/v) in methanol for 30 minutes to block endogenous peroxidase. After washing in PBS, sections were blocked in normal goat serum (Vector Laboratories, Burlingame, CA) diluted 2% in PBS for 20 minutes at room temperature. Tissues were then incubated with a mouse anti-aromatase monoclonal antibody (DPC Biermann, Bad Nauheim, Germany) diluted 1:50 in PBS overnight at 4 C. A goat anti-mouse biotinylated secondary antibody (Vector Laboratories) was diluted 1:200 in PBS and incubated with the tissue sections for 45 minutes at room temperature. Bound antibodies were visualized by incubating the sections with avidin-biotin-peroxidase-horseradish peroxidase (ABC-HRP) complex (Vector Laboratories) for 45 minutes, followed by incubation with 3,3=-diaminobenzidine tetrahydrochloride (Sigma, St. Louis, MO). Finally, sections were stained with Harris hematoxylin. Human placental sections were used as a positive control for aromatase, whereas Fertility and Sterility 33

42 FIGURE 1 Staining for aromatase in eutopic (A) and ectopic (B) endometrium from women with endometriosis. Aromatase is immunolocalized in endometriotic stromal cells, but not in the rest of the tissues tested from patients with endometriosis, as well as in all samples from disease-free women. Original magnification: A, 100; B, 200. Acién. Endometriosis and aromatase expression. Fertil Steril disease-free myometrium was considered a negative control because this tissue lacks aromatase expression (18,19). Tumor Markers, Hormones, and Ig Assays The serum tumor markers CA-19.9 and CA-125 were quantified by a microparticle enzyme immunoassay (MEIA) with the use of the AXSYM system (Abbott Diagnostics, Abbott Park, IL). The quantitative determination of serum E 2, PRL, and P was performed by a chemiluminescent microparticle immunoassay (CMIA) with the use of the Arquitect i2000sr integrated system (Abbott Diagnostics). Plasma levels of IgA, IgG, and IgM were quantified by Roche Tina-Quant immunoturbidmetric assays and a Roche/Hitachi Modular analyzer (Roche, Indianapolis, IN). Statistical Analysis Statistical calculations were performed with the SPSS Windows Release 12.0 software package (SPSS, Inc., Chicago, IL). The chi-square test and t-test for independent samples were used for between-group comparisons. Data are presented as percentages and as arithmetic mean SD. Differences were considered significant at P.05. RESULTS Tissues showed marked heterogeneity in the level of immunostaining, which was localized in the stroma and not in the epithelium of lesions (14) (Fig. 1). Although only the presence or absence of aromatase was evaluated, we observed positive immunohistochemical expression for aromatase in endometriotic tissues from 38 women (61.3% of patients with histologically confirmed endometriosis). In nine of them, positive expression was only observed in endometrioma from one ovary, despite bilateral ovarian endometriomas. Peritoneal endometriotic implants and deep lesions were collected in 10 cases of endometriosis. They showed positive staining in six patients who expressed aromatase in at least one endometrioma. In the other four patients, peritoneal lesions, as well as ovarian endometriosis, were negative. Aromatase was absent in samples from the endometrium, myometrium, leiomyomas, healthy peritoneum, and all tissues collected from nonendometriosis patients. Table 1 shows the clinical findings and recurrences of endometriosis according to the expression of aromatase, and the clinical data observed in nonendometriosis patients. Infertility was more frequent in patients with positive expression for aromatase, although differences were not significant compared with cases that were negative for aromatase. Nor were there significant differences when expression of aromatase was related to previous treatments, type of surgery performed (conservative or hysterectomy), or pelvic adhesion block and affection of the sigmoid and/or rectumvaginal septum. Although clinical and echographical findings were similar in both groups, the presence of leiomyomas or multiple or bilateral endometriomas was more frequent in the aromatase-positive group (P.05). No differences were observed according to the severity of symptoms, except for moderate-to-severe chronic pelvic pain, which was more frequent in the positive cases (P.05). Nor was there a relationship to disease stage or recurrences, although the positive aromatase cases showed a lower percentage of posterior pregnancies than women with aromatase-negative tissue; however, the differences were not statistically significant. There were no infertile cases in the nonendometriosis group, who showed mild symptoms compared with the endometriosis patients (P.05). Similarly, Table 2 provides data about size and number of endometriomas, analytical findings, and months to recurrence of symptoms, endometriomas, and CA-125. The num- 34 Acién et al. Endometriosis and aromatase expression Vol. 88, No. 1, July 2007

43 TABLE 1 Clinical findings in patients with endometriosis according to immunohistochemical expression for aromatase in endometriotic tissues, and in women with nonendometriotic pathologies. Aromatase expression with endometriosis No endometriosis Positive (N 38), Negative (N 24), (N 12), N (%) N (%) N (%) Infertility 13 (34.2) 4 (16.7) 0 c Patients with previous pregnancies 7 (18.4) 9 (37.5) 5 (41.7) Patients without previous treatments 18 (47.4) 12 (50) 10 (83.3) Clinical examination suggesting 25 (65.8) 17 (70.8) 0 c endometriosis Transvaginal ultrasound suggesting: Endometriomas 31 (81.6) 20 (83.3) 0 Endometriomas Leiomyomas 7 (18.4) 1 (4.2) 0 Other cysts 0 3 (12.5) 12 (100) c More dark, more echonegative 14 (36.8) 5 (20.8) endometriomas, or mainly echonegative Endometriomas: 1 or multiple 23 (60.5) a 7 (29.2) Bilateral endometriomas 19 (50) b 4 (16.7) Symptoms: Severe dysmenorrhea 12 (31.6) 10 (41.7) 0 c Moderate/severe dyspareunia 13/33 (39.4) 10/22 (45.4) 2/10 (20) Moderate/severe chronic pelvic pain 26 (68.4) a 9 (37.5) 0 c Other symptoms 30 (78.9) 22 (91.7) 11 (91.7) VAS 4 24 (63.2) 16 (66.7) 2 (16.7) c Endometriosis severity (ASRM): Moderate 11 (28.9) 9 (37.5) Severe 27 (71.1) 15 (62.5) Hysterectomy and bilateral 7 (18.4) 6 (25) 1 (8.3) c salpingooophorectomy Recurrrence of (on 31 and 18 cases of endometriosis): Symptoms VAS 4 9 (29) 7 (38.9) Endometriomas 3 cm 5 (16.1) 3 (16.7) CA (25.8) 3 (16.7) 2 3 parameters 6 (19.3) 4 (22.2) Posterior pregnancy 3 (9.7) 6 (33.3) 2 (18.2) Note: VAS visual analogical scale. ASRM American Society of Reproductive Medicine. Chi-square test between positive and negative aromatase in endometriosis patients. a P.05 between endometriosis and no endometriosis. b P.01 between endometriosis and no endometriosis. c P.05 between endometriosis and no endometriosis. Acién. Endometriosis and aromatase expression. Fertil Steril ber and size of endometriomas positive for aromatase were greater than those which were negative. No differences were observed in the values of serum tumor markers, although they were higher in aromatase-positive patients. However, high values of the blood sedimentation rate were more frequent in negative cases. As for hormones, the patients positive for aromatase had significantly higher E 2 and PRL levels (P.05) and lower values of Ig, especially IgG (P.01). These levels were also observed 1 year after surgery, although the differences were not statistically significant. The months to recurrence were similar in both groups. As for the nonendometriosis group, no differences were observed in most of the parameters, except for the lower tumor-marker and higher E 2 levels (P.05). Fertility and Sterility 35

44 TABLE 2 Size and number of endometriomas, analytical results, and months to recurrence in patients with endometriosis according to aromatase expression, and values in women with nonendometriotic pathologies. Aromatase expression with endometriosis No endometriosis Positive (N 38), Negative (N 24), (N 12), mean SD mean SD mean SD Age d Years of infertility (12) a (4) a Total number of endometriomas b Size of major endometriomas (in every patient) Blood sedimentation rate Blood sedimentation rate 25 mm/h 7 (18.4) 14 (58.3) c 2 (16.7) d CA-19-9 (U/mL) d CA U/mL 14 (36.8) 5 (20.8) 0 d CA-125 (U/mL) d CA U/mL 30 (78.9) 15 (62.5) 0 d Estradiol (pg/ml) b d Progesterone (ng/ml) Prolactin (ng/ml) b IgG (mg/dl) 1, c 1, , IgA (mg/dl) IgM (mg/dl) Points in ASRM classification Months to recurrence of: Symptoms (9) e (7) e Endometriomas 3 cm (5) e (3) e CA U/mL (8) (3) e 2 3 parameters (6) e (4) e Analysis 1 year after surgery (N 31 and 18): CA-125 (U/mL) Estradiol (pg/ml) IgG (mg/dl) 1, , Note: t-test for independent samples between positive and negative aromatase in endometriosis patients. ASRM American Society of Reproductive Medicine. a Number of cases included with infertility. b P.05 between endometriosis and no endometriosis. Chi-square test for nonparametric values. c P.01 between endometriosis and no endometriosis. Chi-square test for nonparametric values. d P.05 between endometriosis and no endometriosis. Chi-square test for nonparametric values. e Number of cases included with recurrence. Acién. Endometriosis and aromatase expression. Fertil Steril DISCUSSION It was pointed out that aberrant expression of aromatase in the stromal cells of endometriosis gives rise to the conversion of circulating androstenedione into estrone in this tissue, and this local E production may promote the growth of endometriotic implants (13,20,21). However, not all patients show positive aromatase expression in endometriotic tissues. In our material, aromatase was detected in 61.3% of cases, which could present more severe endometriosis, with higher values of tumor marker CA- 125 or a stronger inflammatory reaction. But in this study, we did not observe marked differences between patients with or without aromatase expression in endometriotic tissue, probably because of the low number of cases. Aromatase-positive patients had more endometriomas, frequently bilateral, and more moderate-to-severe chronic 36 Acién et al. Endometriosis and aromatase expression Vol. 88, No. 1, July 2007

45 pelvic pain. These cases seemed to be related to the presence of infertility or associated leiomyomas, but not to recurrence of the disease after surgery. Also, E 2 and PRL levels were significantly higher, and IgG levels were lower, than in aromatase-negative patients. These findings suggest that women with aromatase in the endometriotic tissues could show major severity and agressiveness of the disease. This is probably caused by the local biosynthesis of E and the stimulation of PGE 2, which are associated with proliferation, migration, angiogenesis, apoptosis resistance, and even invasiveness in several human cell lines. We reported (14) that the addition of peritoneal fluid, TNF, and especially IL-6 stimulated the basal enzymatic activity observed in endometriotic stromal cells, which suggests that the local production of E in endometriosis may be stimulated by factors such as cytokines or prostanoids present in the peritoneal fluid of patients with endometriosis. Thus, the presence of aromatase and the consequent synthesis of E may promote the growth of endometriotic implants, and probably favor the formation of leiomyomas, which are more frequent in women with endometriosis (22,23). In our material, cases with positive peritoneal endometriosis and/or deep lesions also presented aromatase in endometriomas. It is well-known that pain in endometriosis is correlated with the extent of the disease and the presence of deep-infiltrating endometriosis. However, in our study, we found a low number of cases to relate the presence of these positive implants to the severity of symptoms. In accordance with Heilier et al. (24), previous treatments did not affect aromatase expressions in these patients. As for tumor markers, the increase of serum CA-125 levels in relation to the severity of endometriosis is also well-known (25), although CA-125 value for diagnosis of the disease is limited (26) because normal values can frequently be observed in patients with severe endometriosis. The diagnostic sensibility is greater if CA-125 is high ( 35 U/mL). In patients of the present study, the average values and percentage of cases with elevated CA-125 were significantly higher in the endometriosis group, and in the positive aromatase cases, although differences were not statistically significant. Other markers, such as CA-19-9, increase slightly in severe cases, but do not show a great diagnostic value for endometriosis. According to Somigliana et al. (27), CA-19-9 and IL-6 do not add significant information with respect to the CA-125 test alone for diagnosis in either early or advanced stages of endometriosis. Elevated values of the blood sedimetation rate ( 25 in 1 hour) are associated with inflammation, chronicity, and disglobulinemia. In our study, this increase was more frequently observed in aromatasenegative endometriosis patients. As for serum hormonal levels, E 2 was significantly lower in patients with endometriosis. In this group, these values were significantly higher in aromatase-positive patients, perhaps because of the incorporation of E 2 synthetized locally to the peripheral circulation. Serum PRL was also increased in these patients. Acién et al. (28) reported an increase in mean basal levels of PRL and in the percentage of cases with moderate hyperprolactinemia in patients with endometriosis. There also was a greater rise in PRL with the LH-releasing hormone/thyrotropin-releasing hormone test in moderate and severe endometriosis. Some reports mentioned the occurrence of galactorrhea in women with endometriosis (29,30), but they did not detect concomitant hyperprolactinemia. Others (31) found baseline PRL concentrations 2-fold higher in the endometriosis group versus normal subjects; this hyperprolactinemia could be responsible for luteal insufficiency. Although the mechanism by which endometriosis could increase basal PRL and the response to thyrotropin-releasing hormone remains speculative, it was suggested that the peripheral stimulation of afferent nerves could cause a release of PRL similar to the PRL response to sucking (31), or else release of PRL could be related to a central modification in the control of pituitary hormones. Oxytocin could stimulate the release from the hypothalamus of one or more hypophysiotropic factors that may modulate the PRL response to TRH (32). However, we do not know whether endometriosis or perhaps PGE 2 increase the level of oxytocin. In accordance with Zhang et al. (33), although the causes of endometriosis remain unclear, a composite theory of retrograde menstruation with implantation of endometrial fragments, in conjunction with peritoneal factors to stimulate cell growth, is widely accepted. Molecular alterations, such as the presence of aromatase in endometriotic tissues, could also be involved in the development or maintenance of the disease, and are possibly related to these immunological disorders. Our findings suggest major severity, activity (progression of disease), and pelvic pain in patients with aromatase in endometriotic tissue. Further studies are necessary to discover the connections among molecular, immunological, and peritoneal factors and establish novel therapeutic modalities for endometriosis. REFERENCES 1. Lebovic DI, Mueller MD, Taylor RN. Immunobiology of endometriosis. Fertil Steril 2001;75: Kitawaki J, Kado N, Ishihara H, Koshiba H, Kitaoka Y, Honjo H. Endometriosis: the pathophysiology as an estrogen-dependent disease. J Steroid Biochem Mol Biol 2002;83: Iwabe T, Harada T, Terakawa N. Role of cytokines in endometriosisassociated infertility. Gynecol Obstet Invest 2002;53: Gómez-Torres MJ, Acién P, Campos A, Velasco I. Embryotoxicity of peritoneal fluid in women with endometriosis. Its relation with cytokines and lymphocyte populations. Hum Reprod 2002;17: Kitawaki J, Kusuki I, Koshiba H, Tsukamoto K, Fushiki S, Honjo H. Detection of aromatase cytochrome P-450 in endometrial biopsy specimens as a diagnostic test for endometriosis. Fertil Steril 1999;72: Dheenadayalu K, Mak I, Gordts S, Campo R, Higham J, Puttemans P, et al. Aromatase P450 messenger RNA expression in eutopic endometrium is not a specific marker for pelvic endometriosis. Fertil Steril 2002;78: Fertility and Sterility 37

46 7. Wölfler MM, Nagele F, Kolbus A, Seidl S, Schneider B, Huber JC, et al. A predictive model for endometriosis. Hum Reprod 2005;6: Noble LS, Takayama K, Zeitoun KM, Putman JM, Johns DA, Hinshelwood MM, et al. Prostaglandin E2 stimulates aromatase expression in endometriosis-derived stromal cells. J Clin Endocrinol Metab 1997;82: Bulun SE, Fang Z, Imir G, Gurates B, Tamura M, Yilmaz B, et al. Aromatase and endometriosis. Semin Reprod Med 2004;22: Bulun SE, Noble LS, Takayama K, Michael MD, Agarwal V, Fisher C, et al. Endocrine disorders associated with inappropriately high aromatase expression. J Steroid Biochem Mol Biol 1997;61: Ebert AD, Bartley J, David M. Aromatase inhibitors and cyclooxygenase-2 (COX-2) inhibitors in endometriosis: new questions old answers? Eur J Obstet Gynecol Reprod Biol 2005;122: Attar E, Bulun SE. Aromatase and other steroidogenic genes in endometriosis: translational aspects. Hum Reprod 2006;12: Ebert AD, Bartley J, David M, Schweppe KW. Aromatase inhibitors theoretical concept and present experiences in the treatment of endometriosis. Zentralbl Gynakol 2003;125: Velasco I, Rueda J, Acién P. Aromatase expression in endometriotic tissues and cell cultures of patients with endometriosis. Mol Hum Reprod 2006;12: Acién P, Quereda F, Gómez-Torres MJ, Bermejo R, Gutiérrez M. GnRH analogues, transvaginal ultrasound-guided drainage and intracystic injection of recombinant interleukin-2 in the treatment of endometriosis. Gynecol Obstet Invest 2003;55: The American Fertility Society. Revised American Fertility Society classification of endometriosis: Fertil Steril 1985;43: American Society for Reproductive Medicine. Revised American Society for Reproductive Medicine classification of endometriosis Fertil Steril 1997;67: Bulun SE, Simpson ER, Word RA. Expression of the CYP19 gene and its product aromatase cytochrome P450 in human uterine leiomyoma tissues and cells in culture. J Clin Endocrinol Metab 1994;78: Noble LS, Simpson ER, Johns A, Bulun SE. Aromatase expression in endometriosis. J Clin Endocrinol Metab 1996;81: Bulun SE, Zeitoun K, Takayama K, Noble L, Michael D, Simpson E, et al. Estrogen production in endometriosis and use of aromatase inhibitors to treat endometriosis. Endocr Rel Cancer 1999;6: Bulun SE, Zeitoun KM, Takayama K, Sasano H. Molecular basis for treating endometriosis with aromatase inhibitors. Hum Reprod Update 2000;6: Acién P. Miomas y reproducción. In: Remohí J, Pellicer A, Simón C, Navarro J, eds. Reproducción humana, 2nd ed. Madrid: McGraw-Hill Interamericana, Bulun SE, Imir G, Utsunomiya H, Thung S, Gurates B, Tamura M, et al. Aromatase in endometriosis and uterine leiomyomata. J Steroid Biochem Mol Biol 2005;95: Heilier JF, Donnez O, Van Kerckhove V, Lison D, Donnez J. Expression of aromatase (P450 aromatase/cyp19) in peritoneal and ovarian endometriotic tissues and deep endometriotic (adenomyotic) nodules of the rectovaginal septum. Fertil Steril 2006;85: Acién P, Shaw RW, Irvine L, Burford G, Gardner R. CA-125 levels in endometriosis patients before, during and after treatment with danazol or LHRH agonists. Eur J Obstet Gynecol Roprod Biol 1989;32: Mol BW, Bayram N, Lijmer JG, Wiegerinck MA, Bongers MY, van der Veen F, et al. The performance of CA-125 measurement in the detection of endometriosis: a meta-analysis. Fertil Steril 1998;70: Somigliana E, Vigano P, Tirelli AS, Felicetta I, Torresani E, Vignali M, et al. Use of the concomitant serum dosage of CA 125, CA 19-9 and interleukin-6 to detect the presence of endometriosis. Results from a series of reproductive age women undergoing laparoscopic surgery for benign gynaecological conditions. Hum Reprod 2004;19: Acién P, Lloret M, Graells M. Prolactin and its response to the luteinizing hormone-releasing hormone thyrotropin-releasing hormone test in patients with endometriosis before, during, and after treatment with danazol. Fertil Steril 1989;51: Hirschowitz JS, Soler NG, Wortsman J. The galactorrhea-endometriosis syndrome. Lancet 1978;1: Hargrove JT, Abraham GK. Abnormal luteal function in patients with endometriosis. Fertil Steril 1980;34: Muse K, Wilson EA, Jawad MJ. Prolactin hyperstimulation in response to thyrotropin-releasing hormone in patients with endometriosis. Fertil Steril 1982;38: Yen SSC, Quigley ME, Reid RL, Ropert JF, Cetel NS. Neuroendocrinology of opioid peptides and their role in the control of gonadotropin and prolactin secretion. Am J Obstet Gynecol 1985;152: Zhang X, Lin J, Qian Y, Deng L. Decreased levels of interleukin-18 in peritoneal fluid but not in serum of patients with endometriosis. Fertil Steril 2004;81: Acién et al. Endometriosis and aromatase expression Vol. 88, No. 1, July 2007

47 GENETICS Human myometrium and leiomyomas express gonadotropin-releasing hormone 2 and gonadotropinreleasing hormone 2 receptor Jason D. Parker, D.O., a,b,c Minnie Malik, Ph.D., c and William H. Catherino, M.D., Ph.D. a,b,c a Combined Federal Fellowship in Reproductive Endocrinology and Infertility at National Institutes of Health, Walter Reed Army Medical Center, National Naval Medical Center, and Uniformed Services University of the Health Sciences, b Reproductive Biology and Medicine Branch, National Institute of Child Health and Human Development, National Institutes of Health, and c Department of Obstetrics and Gynecology, Uniformed Services University of the Health Sciences, Bethesda, Maryland Objective: To determine the presence or absence of a second form of GnRH (GnRH2) and corresponding receptor (GnRHR2) in human uterine myometrium and leiomyomata. Design: Evaluation of human leiomyoma and patient-matched myometrium of differential mrna and protein expression of GnRH2 and GnRHR2. Setting: University hospital. Patient(s): Eight women undergoing medically indicated hysterectomy for symptomatic fibroids. Intervention(s): Microarray analysis, reverse-transcriptase polymerase chain reaction (RT-PCR), real-time RT- PCR, and immunohistochemistry. Main Outcome Measure(s): Expression of mrna and protein in leiomyoma and patient-matched myometrium. Result(s): Microarray analysis demonstrated expression, and we confirmed the findings by RT-PCR. Real-time RT-PCR demonstrated equivalent expression of the genes in leiomyoma compared with patient-matched myometrium (0.99-fold for GnRH2 and 1.28-fold for GnRHR2). Immunohistochemistry confirmed the expression of GnRH2 protein in both leiomyoma and myometrium. Conclusion(s): A second form of GnRH and corresponding receptor exists in the fibroid and myometrium. We speculate that an autocrine loop exists. Our findings provide further evidence that GnRH agonists may interact directly with GnRH receptors present in uterine fibroids. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: GnRH2 and GnRHR2, microarray analysis, RT-PCR, real-time RT-PCR, Western blot, immunohistochemistry Uterine leiomyomas (fibroids) are the most common benign tumors in reproductive-aged women (1). Approximately 25% to 50% of women have symptoms from fibroids severe enough to warrant clinical intervention (2). The actual prevalence of fibroids may be significantly higher; the evaluation of pathologic specimens identified fibroids in 77% of the hysterectomy samples (3). Symptoms from fibroids include Received January 20, 2006; revised and accepted November 20, This research was supported in part by the intramural research program of the RBMB, NICHD, and NIH. Disclosure: The opinions or assertions contained herein are the private views of the authors and are not to be construed as official or as reflecting the views of the Department of Health and Human Services, the Department of the Army or the Department of Defense. Reprint requests: William H. Catherino, M.D., Ph.D., Department of Obstetrics and Gynecology, Uniformed Services University of the Health Sciences, Building A, Room 3078, 4301 Jones Bridge Road, Bethesda, Maryland (FAX: ; catheriw@mail. nih.gov; wcatherino@usuhs.mil). infertility, menorrhagia, pelvic pressure, pelvic pain, miscarriage, preterm labor, and stillbirth. Such dramatic and widespread symptoms require effective therapeutic options. Therapeutic interventions for leiomyomas can be surgical or medical. Unfortunately, the recurrence of fibroids following surgical therapies short of a hysterectomy ranges between 25% and 44% (4, 5), with a 2% risk of a planned myomectomy resulting in a hysterectomy (6). Medical treatment for fibroids includes GnRH agonists (GnRHa), which induces a systemic hypoestrogenic state (7, 8) that induces fibroid regression. GnRHa can reduce fibroid size by 30% (9). However, following a course of medical treatment with GnRHa, fibroids return to pretreatment size within 6 months (10). Although the current understanding of GnRHa action suggests that medical management of uterine fibroids by GnRHa relies upon establishing a hypoestrogenic state, alternative explanations have not been fully explored /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 39

48 Ectopic production of GnRH and GnRH receptor, referred to as GnRH1 and GnRHR1, respectively, have been identified in tissues outside the brain. These tissues include immune cell lines (11 13), breast tissue (14, 15), placenta (16), ovary (17), endometrium (18, 19), myometrium, and leiomyoma (20, 21). GnRH1 is also present in breast cancer (14, 15), ovarian cancer (22), and endometrial cancer (23, 24). With a half-life of 2 4 minutes, local expression suggests an autocrine or paracrine function for GnRH. In addition, there is increasing evidence of a second GnRH and GnRHR (25, 26). This second GnRH (GnRH2) has been demonstrated in humans in several tissues (breast, ovary, placenta, and endometrium) (14 17, 22, 27), and is expressed at higher concentrations outside the brain in humans (25). Although GnRH1 and GnRHR1 are also identified outside the brain, the expression of GnRH2 and GnRHR2 is expressed at higher concentrations outside the brain, and may have a distinct function compared with GnRH1 and GnRHR1. In ovarian cancers, it was demonstrated that GnRH1 antagonist exerts an antiproliferative effect through GnRH2 receptors (28). As a result, GnRH could potentially exert a direct antiproliferative action on fibroids via GnRHR2 if these receptors are present on fibroid cells. We hypothesized that GnRH2 and GnRHR2 were present in uterine leiomyomas and adjacent myometrium. Such expression provides an alternative mechanism for GnRHa regulation of uterine fibroids, and could provide novel therapies that avoid the side effects of systemic GnRHa exposure. MATERIALS AND METHODS Tissue Procurement Informed consent was obtained from eight women undergoing a hysterectomy with the diagnosis of a symptomatic fibroid uterus at the National Naval Medical Center in Bethesda, Maryland. Enrollment was open to subjects with all ethnic backgrounds and of reproductive age with different gravidity and parity. Subjects who used various modalities of medical management for fibroids were also included. The investigational review board of the National Naval Medical Center, Uniformed Services University of Health Sciences, and the National Institutes of Health approved this study. At the time of hysterectomy, leiomyoma and myometrial tissue were obtained randomly from the center, middle, and peripheral regions from large leiomyomas, and in the case of small fibroids, the entire fibroid was used. Leiomyoma and myometrial tissue that was intended for RNA isolation was immediately minced and placed in RNAlater (Ambion, Inc., Austin, TX). Tissue samples were processed immediately or were placed at 4 C overnight and then stored at 70 C. Tissue that was intended for immunohistochemistry was cut into cubes and were about 5 mm to a side, that is, 125 mm 3, and stored in phosphate-buffered 10% formalin. RNA Isolation Total RNA from leiomyomas and myometrial samples was isolated following a standard protocol used in our laboratory (29, 30). The total RNA integrity was confirmed and the concentration quantified by agarose gel electrophoresis and spectrophotometry. Microarray Analysis Samples of g of total RNA from leiomyoma and myometrium were provided to Capital Genomix (Rockville, MD) for microarray analysis with Affymetrix technology. Thirty-three thousand genes on the U-133 Affymetrix chip were screened. Total RNA was handled according to Affymetrix guidelines (31). Hybridization of purified, labeled crna was performed as described previously (31). Hybridized chips were scanned with the Hewlett-Packard GeneArray Scanner (Palo Alto, CA). Data analysis was performed with GeneChip software. Reverse-Transcriptase polymerase Chain Reaction Primers were designed using LASERGENE Navigator so as to amplify a 90- to 150-bp section close to the 3= end of the translated region (within 500 bp). The primers were generated on a 392 DNA/RNA Synthesizer (Applied Biosystems, Foster City, CA) and purified by high-performance liquid chromatography. Primers for GAPDH were included as an internal control. Leiomyomas and myometrial samples were then electrophoresed side by side at the same starting concentration on a 2% agarose gel stained with ethidium bromide. Stock concentrations of total RNA from leiomyoma and myometrium treated with DNAse were also used to exclude the possibility of amplifying genomic DNA. Tissue samples used for reverse transcriptase polymerase chain reaction (RT-PCR) experiments were unrelated to the tissue samples used for microarray analysis. Real-Time RT-PCR Total RNA from leiomyoma or myometrium was diluted and primers were designed. The GnRH2 and GnRHR2 probe was designed with Primer Express software, version 1.5, and constructed by Applied Biosystems. An 18S RNA control was used for standardization to use as an internal standard to scale the measurements. All experiments were performed in triplicate, and data analysis was performed with Sequence Detector, version 1.7 (Applied Biosystems). Mid-logarithmic points were compared for statistical analysis. Immunohistochemistry Rabbit anti-gnrh-ii antibody specificity has been defined previously (32, 33). This antibody has been used to identify the second form of GnRH in mouse (34), rats (35), and human neuronal cell lines (36) using immunocytochemistry. To determine the presence of GnRH2 in human leiomyomas 40 Parker et al. Human leiomyoma express GnRH2 and GnRHR2 Vol. 88, No. 1, July 2007

49 TABLE 1 Patient characteristics. Patient Race Age (y) Gravid Para Prior GnRHa use Prior OCP use 1 C N N 2 AA N N 3 AA N N 4 AA N N 5 C N Y 6 AA N N 7 AA N Y 8 AA N N Note: AA African American; C Caucasian; GnRHa gonadotropin-releasing hormone agonist; OCP oral contraceptive pills. Parker. Human leiomyoma express GnRH2 and GnRHR2. Fertil Steril and adjacent myometrium, slides were then deparaffined and hydrated in xylene and graded ethanol solutions followed by deionized water. Following established protocols in our lab, slides were prepped and blocking solution was drained and diluted primary antisera directed at GnRH2 was used at a dilution of 1:2,000. For a negative control, leiomyomas and myometrium samples were incubated with blocking solution with nonimmune serum instead of primary and secondary antibody specific antisera, and cardiac muscle was used as a negative tissue control. For a positive control, hypothalamus was used. Statistical Analyses Microarray analysis was done in a genome-wide fashion as a discovery phase, and therefore statistical analysis was not performed. Real-time RT-PCR was used as a quantitative measure of gene expression. Differential expression was evaluated by paired Student s t tests. Normalization with 18S was used to be able to express levels of gene in fibroids and myometrium Ct values. All experiments were performed in triplicate and confidence intervals were calculated. FIGURE 1 Cluster analysis of microarray studies. Far left, gross analysis demonstrated significant molecular differences between leiomyoma and patient-matched myometrium. Analysis of gene ontology through chromosome analysis demonstrated consistent alterations in GnRH-related gene clusters. GnRH-associated genes identified are listed on the right. Parker. Human leiomyoma express GnRH2 and GnRHR2. Fertil Steril Fertility and Sterility 41

50 TABLE 2 Cluster analysis of gonadotropin releasing hormone-related genes. Name Fold expression (M:F) GnRH GnRH GnRH-RI 0.27 GnRH-RII Undefined hcg 0.22 LH 0.91 FSH 1.08 LH receptor 1.00 FSH receptor 1.01 KISS Calmodulin Calmodulin Calmodulin Gonadotropin-regulated 0.14 testicular RNA helicase Gonadotropin-inducible 3.57 transcription repressor Parker. Human leiomyoma express GnRH2 and GnRHR2. Fertil Steril RESULTS The demographic characteristics of the subjects evaluated in this study are presented in Table 1. There were six African Americans and two Caucasians enrolled in the study, and their ages ranged from 34 to 46 years. Subjects with different gravidity and parity were represented in this study. Patients who used oral contraceptive pills for the relief of symptoms related to fibroids were also included. No subjects had prior GnRHa treatment. Microarray analysis screening was performed to determine if GnRH1 and GnRH2 with their corresponding receptors were identified in the myometrium and fibroid (Fig. 1, Table 2). These results demonstrated an equivalent expression of GnRH2 in fibroid compared with myometrium (0.99- fold). Microarray signal from labeled complementary template of GnRHR2 was too low to be reliably interpretable. This could have been because of specific mrna degradation in those samples, or alternatively, the mrna for GnRH2 was not present. It was of additional interest that GnRH1 and GnRHR1 were overexpressed in the fibroid compared with the myometrium (2.29- and 3.77-fold, respectively). Identification of GnRH1 and GnRHR1 expression in uterine fibroids has been described previously (20, 21). We then performed confirmation studies on the expression of GnRH2 and GnRHR2 mrna in leiomyomas and myometrium using multiplex RT-PCR of tissue samples from patients unrelated to those evaluated in the microarray analysis. Figure 2 demonstrated the expression of GnRH2 and FIGURE 2 Reverse-transcriptase polymerase chain reaction (RT-PCR) for myometrium versus fibroid samples. Representative experiments are shown. Samples of myometrium and fibroid for eight patients were analyzed. Molecular marker (DNA molecular size standard, lane 1) and no template control (lane 2) were included on the left. GAPDH was used as an internal positive control. Parker. Human leiomyoma express GnRH2 and GnRHR2. Fertil Steril GnRHR2 in both fibroid and myometrium from the patients. These results demonstrate the presence of GnRH2 and GnRHR2 mrna in uterine fibroids from all patients tested. The internal control of GAPDH demonstrated that a similar FIGURE 3 Representative real-time RT-PCR experiment. All eight patients were evaluated. The x-axis depicts the thermal cycle number while the y-axis represents luminescence ( Rn). The cycle at which exponential luminescence is achieved is dependent on the starting number of mrnas for the gene in question. For GnRH2 and GnRHR2, the red lines represent fibroid and the blue lines represent myometrium. All experiments were performed in triplicate. Parker. Human leiomyoma express GnRH2 and GnRHR2. Fertil Steril Parker et al. Human leiomyoma express GnRH2 and GnRHR2 Vol. 88, No. 1, July 2007

51 TABLE 3 Comparison of differences between myometrium and fibroid for GnRH2. Patient ID Fold difference (M:F) 95% CI (0.07, 0.33) a (0.03, 1.47) (0.48, 2.98) (0.19, 0.79) a (0.60, 1.12) (0.30, 0.90) a (0.20, 3.64) (0.65, 2.11) Mean 0.99 (0.47, 1.51) Note: CI confidence interval; ID identification; M:F myometrium versus fibroid. a Indicates myometrium:leiomyoma pair that reached statistical significance. FIGURE 4 Light microscopy of myometrium and leiomyoma at low and high magnification. Hematoxylin and eosin staining on the left, and immunohistochemical stain for GnRH2 antibody on the right. The arrow indicates intracytoplasmic granules of concentrated GnRH2. GnRH2 antibody concentration was 1:2,000. Magnification 63 (above) and 100 (below). Parker. Human leiomyoma express GnRH2 and GnRHR2. Fertil Steril amount of material was loaded in each well. Expression was also verified using primers crossing introns and in specimens treated with DNAse (data not shown), which further confirmed the expression of mrna for GnRH2 and GnRHR2 in fibroids and myometrium. Although RT-PCR demonstrated the expression of both GnRH2 and GnRHR2, this method could not quantitate differential expression between fibroid and patient-matched TABLE 4 Comparison of differences between myometrium and fibroid for GnRHR 2. Patient ID Fold difference (M:F) 95% CI (1.64, 2.68) a (0.01, 1.97) (1.05, 1.83) a (1.16, 1.82) a (0.89, 1.83) (0.60, 1.80) (0.02, 2.00) (0.01, 1.10) Mean 1.28 (0.90, 1.66) Note: CI confidence interval; ID identification; M:F myometrium versus fibroid. a Indicates myometrium:leiomyoma pair that reached statistical significance. Parker. Human leiomyoma express GnRH2 and GnRHR2. Fertil Steril Parker. Human leiomyoma express GnRH2 and GnRHR2. Fertil Steril myometrium (29). To quantitate relative mrna expression, we optimized real-time RT PCR so as to evaluate a subtle difference in the degree of expression and provide quantitative information of relative expression. We found that the mean fold difference of GnRH2 in myometrium compared with fibroid was 0.99 (95% confidence interval [CI] [0.47, 1.51]), while the fold difference of GnRHR2 was 1.28 (95% CI [0.90, 1.66]; see Fig. 3, Table 3, and Table 4). These results demonstrate equivalent expression in fibroids and myometrium. Several individual fold differences for GnRH2 and GnRHR2 reached statistical significance, but overall the differences were not significant. All experiments were performed in triplicate. The real-time RT-PCR data demonstrated a comparable mrna expression of GnRH2 and GnRHR2 in leiomyomas compared with myometrium. To confirm that mrna expression translated to protein expression, we determined the protein expression of GnRH2 (no antibody is commercially available for GnRHR2). Western blot analyses were attempted but were not reliably successful in detecting the 10 amino acid protein. Immunohistochemical studies were used to confirm the protein expression of GnRH2 in both leiomyoma and myometrium. Staining for GnRH2 was cytoplasmic in both tissues, appearing in cytoplasmic granules. There Fertility and Sterility 43

52 was no significant staining in the cardiac muscle sample that served as a negative control, or in the leiomyomas and myometrium without primary antibody (Fig. 4). DISCUSSION Our study demonstrated that GnRH2 and GnRHR2 were expressed in the fibroid and myometrium at the mrna level, and GnRH2 at the protein level. In addition, expression of GnRH2 and GnRHR2 were comparable in myometrium and fibroid in all patients evaluated. This observation expands upon the findings of White and colleagues (25), who have previously described the presence of GnRH2 and GnRHR2 in tissues other than the hypothalamus. This may provide an alternative explanation of the effects of GnRHa on regression of fibroids. Our study demonstrated equivalence regardless of the woman s age, times in cycle, and ethnicity. This study demonstrated GnRH2 and GnRHR2 mrna expression in fibroids and myometrium at a single point in time. What remains speculative is whether the expression of these genes is modulated by the activity of endogenous hormones and if this impacts the growth or regression of fibroids and if the expression of GnRH2 and GnRHR2 fluctuate throughout the menstrual cycle or throughout the reproductive years in the same patient. Studies are currently underway to address these questions by assessing a direct effect of GnRHa on GnRHR2 in human myometrium and fibroid cell lines. Although GnRH and GnRHR are produced in the basal forebrain region, they are also located peripherally including reproductive and immune tissues throughout the body (18 20, 37 40). The presence of GnRH1 and GnRHR1 located throughout the reproductive system has led to the speculation of an autocrine and paracrine function (31, 41). Our findings that a second form of GnRH, namely GnRH2, is expressed in myometrium, and fibroid tissue may give some insight to the apparent contradictory effect of GnRHa on certain reproductive tissues. An autocrine and paracrine function may explain the contradiction of why GnRH stimulates proliferation in some tissues and inhibits proliferation in others (11, 39, 38 43). The roles of these hormones may also be different depending on the hormonal milieu. The antiproliferative effects may even work through different GnRH receptors. In the case of some ovarian cancers, it has been demonstrated that GnRH1 antagonists exert an antiproliferative effect through GnRH2 receptors (37), and it is therefore possible that alternative modes of action may exist at the local level of the fibroid. Activation of the GnRH2 receptor pathway may have very distinct functions compared with activation of the GnRH1 receptor. The GnRHa mediated fibroid regression is thought to occur by reducing the circulating levels of estrogen (44). The maximal GnRH-induced fibroid reduction occurs by 12 weeks, with no further decrease in size noted at 24 weeks (45). It is hypothesized that this is because of the decreased levels of circulating levels of estrogen. However, there are other mechanisms not directly related to the hypoestrogenic state. For example, GnRHa can reduce uterine blood flow (46), which may contribute toward the overall reduction in fibroid mass. These new findings suggest the possibility of a direct effect of GnRHa on the fibroid, which results in an antiproliferative effect via GnRH receptors expressed by leiomyocytes. An autocrine or paracrine role for GnRH is supported by various explant and tissue culture experiments. Chegini and colleagues (20) were the first to demonstrate both the expression of GnRH1 and GnRHR1 expression in cultured leiomyoma cells, and have demonstrated that concentrations as low as 10 7 M of GnRH agonist can alter gene expression in tissue culture (47 49). Kobayashi and colleagues (21) confirmed GnRH1 and GnRHR1 expression in a leiomyoma explant culture system, and also identified phenotypic changes in leiomyoma cultures when treated with GnRHa. When primary cultures were treated with GnRHa, followed by microarray evaluation, there were distinct molecular changes that demonstrated a direct influence of GnRH1 on leiomyoma mrna expression patterns (50). Finally, Kwon and colleagues (51) found that GnRH antagonist treatment increased mrna and protein expression of GnRH receptor in cultured leiomyoma cells. Each of these studies demonstrated that local exposure can directly influence the leiomyocyte, and our findings provide support of a second GnRH pathway that could be involved in these changes. Further study is warranted to determine if prior exposure to exogenous steroids (estrogens and progestins) as well as to GnRH agonist or antagonist may cause a shift in the relative expression of these genes in the uterus and fibroids. This understanding may lead to novel approaches of using GnRH agonist and antagonist at the specific peripheral receptor of interest instead of systemically. These results may help to increase our understanding of the possible implications of a local autocrine and paracrine relationship in symptomatic fibroid development. Acknowledgments: The authors acknowledge the expert support of Dr. James Segars, MD, members of the USUHS Department of Obstetrics and Gynecology, and faculty of the RBMB, NICHD, NIH. GnRH2 was a generous gift from Dr. Oksuwa. REFERENCES 1. Cramer DW. Epidemiology of myomas. Semin Reprod Endocrinol 1992;10: Buttram V, Reiter R. Uterine leiomyomata: etiology, symptomatology and management. Fertil Steril 1981;36: Cramer SF, Patel A. The frequency of uterine leiomyomas. Am J Clin Pathol 1990;94: Fedele L, Parazzini F, Luchini L, Mezzopane R, Tozzi L, Villa L. Recurrence of fibroids after myomectomy: a transvaginal ultrasonographic study. Hum Reprod 1995;10: Fauconnier A, Chapron C, Babaki-Fard K, Dubuisson JB. Recurrence of leiomyomata after myomectomy. Hum Reprod Update 2000;6: Parker et al. Human leiomyoma express GnRH2 and GnRHR2 Vol. 88, No. 1, July 2007

53 6. Iverson RE Jr, Chelmow D, Strohbehn K, Waldman L, Evantash EG. Relative morbidity of abdominal hysterectomy and myomectomy for management of uterine leiomyomas. Obstet Gynecol 1996;88: Robboy SJ, Bentley RC, Butnor K, Anderson MC. Pathology and pathophysiology of uterine smooth-muscle tumors. Environ Health Perspect 2000;108: Stewart EA. Uterine fibroids. Lancet 2001;357: Felberbaum RE, Kupker W, Krapp M, Gehl B, Ludwig M, Diedrich K. Preoperative reduction of uterine fibroids in only 16 days by administration of a gonadotrophin-releasing hormone antagonist (Cetrotide). Reprod Biomed Online 2001;3: Vollenhoven BJ, Shekleton P, McDonald J, Healy DL. Clinical predictors for buserelin acetate treatment of uterine fibroids: a prospective study of 40 women. Fertil Steril 1990;54: Azad N, LaPaglia N, Kirsteins L, Uddin S, Steiner J, Williams DW, et al. Jurkat cell proliferative activity is increased by luteinizing hormonereleasing hormone. J Endocrinol 1997;153: Chen HF, Jeung EB, Stephenson M, Leung PC. Human peripheral blood mononuclear cells express gonadotropin-releasing hormone (GnRH), GnRH receptor, and interleukin-2 receptor gamma-chain messenger ribonucleic acids that are regulated by GnRH in vitro. J Clin Endocrinol Metab 1999;84: Chen A, Ganor Y, Rahimipour S, Ben-Aroya N, Koch Y, Levite M. The neuropeptides GnRH-II and GnRH-I are produced by human T cells and trigger laminin receptor gene expression, adhesion, chemotaxis and homing to specific organs. Nat Med 2002;8: Chen A, Kaganovsky E, Rahimipour S, Ben-Aroya N, Okon E, Koch Y. Two forms of gonadotropin-releasing hormone (GnRH) are expressed in human breast tissue and overexpressed in breast cancer: a putative mechanism for the antiproliferative effect of GnRH by down-regulation of acidic ribosomal phosphoproteins P1 and P2. Cancer Res 2002;62: Harris N, Dutlow C, Eidne K, Dong KW, Roberts J, Millar R. Gonadotropin-releasing hormone gene expression in MDA-MB-231 and ZR-75-1 breast carcinoma cell lines. Cancer Res 1991;51: Chou CS, Beristain AG, MacCalman CD, Leung PC. Cellular localization of gonadotropin-releasing hormone (GnRH) I and GnRH II in first-trimester human placenta and decidua. J Clin Endocrinol Metab 2004;89: Kang SK, Choi KC, Cheng KW, Nathwani PS, Auersperg N, Leung PC. Role of gonadotropin-releasing hormone as an autocrine growth factor in human ovarian surface epithelium. Endocrinology 2000;141: Raga F, Casan EM, Kruessel JS, Wen Y, Huang HY, Nezhat C, et al. Quantitative gonadotropin-releasing hormone gene expression and immunohistochemical localization in human endometrium throughout the menstrual cycle. Biol Reprod 1998;59: Dong KW, Marcelin K, Hsu MI, Chiang CM, Hoffman G, Roberts JL. Expression of gonadotropin-releasing hormone (GnRH) gene in human uterine endometrial tissue. Mol Hum Reprod 1998;4: Chegini N, Rong H, Dou Q, Kipersztok S, Williams RS. Gonadotropinreleasing hormone (GnRH) and GnRH receptor gene expression in human myometrium and leiomyomata and the direct action of GnRH analogs on myometrial smooth muscle cells and interaction with ovarian steroids in vitro. J Clin Endocrinol Metab 1996;81: Kobayashi Y, Zhai YL, Iinuma M, Horiuchi A, Nikaido T, Fujii S. Effects of a GnRH analogue on human smooth muscle cells cultured from normal myometrial and from uterine leiomyomal tissues. Mol Hum Reprod 1997;3: Grundker C, Gunthert AR, Millar RP, Emons G. Expression of gonadotropin-releasing hormone II (GnRH-II) receptor in human endometrial and ovarian cancer cells and effects of GnRH-II on tumor cell proliferation. J Clin Endocrinol Metab 2002;87: Irmer G, Burger C, Ortmann O, Schulz KD, Emons G. Expression of luteinizing hormone releasing hormone and its mrna in human endometrial cancer cell lines. J Clin Endocrinol Metab 1994;79: Chatzaki E, Bax CM, Eidne KA, Anderson L, Grudzinskas JG, Gallagher CJ. The expression of gonadotropin-releasing hormone and its receptor in endometrial cancer, and its relevance as an autocrine growth factor. Cancer Res 1996;56: White RB, Eisen JA, Kasten TL, Fernald RD. Second gene for gonadotropin-releasing hormone in humans. Proc Natl Acad Sci USA 1998; 95: Miyamoto K, Hasegawa Y, Nomura M, Igarashi M, Kangawa K, Matsuo H. Identification of the second gonadotropin-releasing hormone in chicken hypothalamus: evidence that gonadotropin secretion is probably controlled by two distinct gonadotropin-releasing hormone in avian species. Proc Natl Acad Sci USA 1984;81: Cheon KW, Lee HS, Parhar IS, Kang IS. Expression of the second isoform of gonadotrophin-releasing hormone (GnRH-II) in human endometrium throughout the menstrual cycle. Mol Hum Reprod 2001;7: Grundker C, Emmons G. Role of gonadotropin-releasing hormone (GnRH) in ovarian cancer. Reprod Biol Endocrinol 2003;1: Catherino WH, Prupas C, Tsibris JC, Leppert PC, Payson M, Nieman LK, et al. Strategy for elucidating differentially expressed genes in leiomyomata identified by microarray technology. Fertil Steril 2003; 80: Catherino WH, Leppert PC, Stenmark MH, Payson M, Potlog-Nahari C, Nieman LK, et al. Reduced dermatopontin expression is a molecular link between uterine leiomyomas and keloids. Genes Chrom Cancer 2004;40: Lipshutz, RJ, Fodor SP, Gingeras TR, Lockhart DJ. High density synthetic oligonucleotide arrays. Nat Genet 1999;21: Chen A, Yahalom D, Ben-Aroya N, Kaganovsky E, Okon E, Koch Y. A second isoform of gonadotropin-releasing hormone is present in the brain of human and rodents. FEBS Lett 1998:435: Okuzawa K, Amano M, Kobayashi M, Aida K, Hanyu I, Hasegawa Y, et al. Differences in salmon GnRH and chicken GnRH-II contents in discrete brain areas of male and female rainbow trout according to age and stage of maturity. Gen Comp Endocrinol 1990:80: Gestrin ED, White RB, Fernald RD. Second form of gonadotropinreleasing hormone in mouse: immunocytochemistry reveals hippocampal and periventricular distribution. FEBS Lett 1999:448: Parhar IS, Soga T, Ogawa S, Ogawa S, Pfaff DW, Sakuma Y. Nonmammalian gonadotropin-releasing hormone molecules in the brain of promoter transgenic rats. Proc Natl Acad Sci 2005:102: Chen A, Yahalom D, Laskar-Levy O, Rahimipour S, Ben-Aroya N, Koch Y. Two isoforms of gonadotropin-releasing hormone are coexpressed in neuronal cell lines. Endocrinology 2001:142: Grundker C, Gunthert AR, Westphalen S, Emons G. Biology of the GnRH system in human gynecological cancers. Eur J Endocrinol 2002; 146: Schally AV. LH-RH analogues: their impact on human reproduction and the control of tumorigenesis. Peptides 1999;20: Emons G, Schally AV. The use of luteinizing hormone releasing hormone agonists and antagonists in gynaecological cancers. Hum Reprod 1994;9: Emons G, Ortmann O, Schulz KD, Schally AV. Growth inhibitory actions of analogues of luteinizing hormone releasing hormone on tumour cells. Trends Endocrinol Metab 1997;8: Miller WR, Scott WN, Morris R, Fraser HM, Sharpe RM. Growth of human breast cancer cells inhibited by a luteinizing hormone-releasing hormone agonist. Nature 1985;313: Batticane N, Morale MC, Gallo F, Farinella Z, Marchetti B. Luteinizing hormone-releasing hormone signaling at the lymphocyte involves stimulation of interleukin-2 receptor expression. Endocrinology 1991;129: Marchetti B, Guarcello V, Morale MC, Bartoloni G, Raiti F, Palumbo G Jr, et al. Luteinizing hormone-releasing hormone (LHRH) agonist restoration of age-associated decline of thymus weight, thymic LHRH receptors, and thymocyte proliferative capacity. Endocrinology 1989; 125: Friedman AJ, Harrison-Atlas D, Barbieri RL, Benacerraf B, Gleason R, Schiff I. A randomized, placebo controlled, double blind study evalu- Fertility and Sterility 45

54 ating the efficacy of leuprolide acetate depot in the treatment of uterine leiomyomata. Fertil Steril 1989;51: Lumsden MA, West CP, Baird DT. Goserelin therapy before surgery for uterine fibroids. Lancet 1987;1: Matta WH, Stabile I, Shaw RW, Campbell S. Doppler assessment of uterine blood flow changes in patients with fibroids receiving the GnRH agonist buserelin. Fertil Steril 1988;49: Chegini N, Verala J, Luo X, Xu J, Williams RS. Gene expression profile of leiomyoma and myometrium and the effect of gonadotropin releasing hormone analogue therapy. J Soc Gynecol Invest 2003;10: Xu J, Luo X, Chegini N. Differential expression, regulation, and induction of Smads, transforming growth factor-beta signal transduction pathway in leiomyoma, and myometrial smooth muscle cells and alteration by gonadotropin-releasing hormone analog. J Clin Endocrinol Metab 2003;88: Ding L, Xu J, Luo X, Chegini N. Gonadotropin releasing hormone and transforming growth factor beta activate mitogen-activated protein kinase/extracellularly regulated kinase and differentially regulate fibronectin, type I collagen, and plasminogen activator inhibitor-1 expression in leiomyoma and myometrial smooth muscle cells. J Clin Endocrinol Metab 2004;89: Luo X, Ding L, Xu J, Williams RS, Chegini N. Leiomyoma and myometrial gene expression profiles and their responses to gonadotropin-releasing hormone analog therapy. Endocrinology 2005;146: Kwon JY, Park KH, Park YN, Cho NH. Effect of cetrorelix acetate on apoptosis and apoptosis regulatory factors in cultured uterine leiomyoma cells. Fertil Steril 2005;84: Parker et al. Human leiomyoma express GnRH2 and GnRHR2 Vol. 88, No. 1, July 2007

55 IN VITRO FERTILIZATION A comparison of the outcomes between twin and reduced twin pregnancies produced through assisted reproduction Chong-U Cheang, M.D., a,b,c Lii-Shung Huang, M.Sc., d,e Tsung-Hsien Lee, M.D., f,g Chung-Hsien Liu, M.D., Ph.D., c Yang-Tse Shih, M.D., c and Maw-Sheng Lee, M.D., Ph.D. b,c,h a Department of Obstetrics and Gynecology, Kiang Wu Hospital, Macau; b Division of Infertility Clinic, Lee Women s Hospital, c Department of Obstetrics and Gynecology and d PhD program, Institute of Medicine of Chung Shan Medicine University, e Department of Nursing, Central Taiwan University of Science and Technology, and h Department of Medicine, China Medical University, Taichung; f Department of Obstetrics and Gynecology, National Taiwan University Hospital, College of Medicine, National Taiwan University, Taipei; and g Department of Obstetrics and Gynecology, Taipei County Hospital, Sanchong, Taiwan, Republic of China Objective: To compare the outcome of twin pregnancies, derived from IVF cycles, with and without fetal reduction. Design: A retrospective cohort study. Setting: The IVF Division of the Lee Women s Hospital, Taiwan. Patient(s): Seven hundred forty-two twin pregnancies, including 389 nonreduced pregnancies, 353 of which resulted from fetal reduction. Intervention(s): Selective fetal reduction for high-order multiple pregnancies. Main Outcome Measure(s): The rates of extreme prematurity and prematurity (i.e., less than 28 and 36 weeks gestational age, respectively), frequency of birth weight discordance, mean birth weight of twins, neonatal mortality, and morbidity. Result(s): The fetal reduction group was associated with a higher incidence of extreme prematurity, prematurity, and lower birth weight than the nonreduced group, although the impact was relatively small. These findings were more pronounced among patients with a higher initial number of fetuses. The rates of discordant birth weights between the two groups were not significantly different. Conclusion(s): High-order multiple pregnancies after fetal reduction is still associated with a mild increased risk of premature delivery and low birth weight when compared to nonreduced twin pregnancies. These results provide an additional reason to limit the number of embryos transferred during IVF. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Fetal reduction, twins, birth weight discordance, low birth weight, prematurity, assisted reproduction More couples are seeking infertility treatment than ever before. As a result, in recent decades there has been an exponential increase in the number of high-order, multiple pregnancies (HOMP; i.e., more than twins) arising from treatment using assisted reproductive techniques (ART) (1), as well as an increase in the risk of maternal and perinatal complications. Specifically, the major risks associated with HOMP include spontaneous abortions, prematurity, discordant birth weight, pre-eclampsia, severe obstetric hemorrhage, and intrauterine growth retardation (2, 3). The HOMP Received May 13, 2006; revised November 1, 2006; accepted November 16, Supported by the Chinese Infertility Foundation. Reprint requests: Maw-Sheng Lee, M.D., Ph.D., The Infertility Clinic Division, Lee Women s Hospital. No. 263, Pei-Tun Road, Taichung 406, Taiwan, Republic of China (FAX: ; msleephd@ giga.net.tw). rates have remained high during ART treatment because of the belief that transferring more embryos will improve pregnancy rates (PR). But Ko et al. (4) have shown that the higher the number of fetuses in a pregnancy, the shorter the pregnancy can be sustained. Because of the increased maternal and perinatal risks that accompany HOMP (3, 5), the option exists to reduce HOMP to twins (6, 7). Fetal reduction has been used to reduce the risk of HOMP during the past 15 years (8). These studies are important as many fetal reduction procedures are thought to serve as a safety net for HOMP resulting from ART treatment (9). Thus far, few studies have focused on the complications of fetal reduction in HOMP. At the same time, it is important to know the differences in outcome, if any, between ART /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 47

56 derived twin pregnancies and ART-derived twin pregnancies after fetal reduction from HOMP. To clarify this issue, we have reviewed the data of all HOMP undergoing fetal reduction and their clinical outcomes from our infertility program. This study therefore describes a large cohort of HOMP arising from ART in a single center. Prematurity, birth weight discordance, and low birth weight were selected as the most important clinical parameters in comparing HOMP reduced to twins and nonreduced twin pregnancies, the results of which are essential for physicians and couples contemplating intervention and management options of HOMP. with 3 NaCl solution) was injected into the fetal heart. If cardiac activity persisted, additional potassium chloride was administered. The fetuses selected for termination were: [1] the smallest fetuses of the cohort, [2] monozygotic twins in HOMP, [3] fetuses with structural defects, or [4] fetuses most easily accessible transabdominally (i.e., located proximal to the uterine fundus). The patients were observed for 1 or more hours after the procedure for uterine contractions, vaginal bleeding, or leakage of amniotic fluid. Each patient had a repeat ultrasound examination performed before being discharged to home. MATERIALS AND METHODS Patients This study included all patients who were shown to have HOMP subsequent to IVF and embryo transfer between January 1998 and December 2004 (n 782) in the ART program at the IVF Division of Lee Women s Hospital in Taiwan. We reviewed the medical records of those with twin pregnancies (n 410) and HOMP who subsequently chose to undergo fetal reduction (n 372) during the study period. The records for 21 (21/ %) and 19 (19/ %) patients with twin and HOMP, respectively, were incomplete regarding birth weight data. For the purpose of the current study, only records containing complete pregnancy and birth data were analyzed. The fetal reduction procedures and their outcomes were recorded in patients with HOMP (viz., 176 triplets, 96 quadruplets, and 81 gestations with more than four fetuses). Each patient was informed about the potential risks of the fetal reduction procedure, and written consent was obtained before the surgical procedure was initiated. Fetal reduction to a twin pregnancy is done because the obstetric risks are considered acceptable and two fetuses preserve the option of selective feticide if discordant fetal abnormalities are subsequently demonstrated during midtrimester anatomic ultrasonography (1). Because the analysis for this study was based on existing medical records and the fetal reduction procedures were performed according to standard ethical regulations of practice, Institutional Review Board (IRB) approval was not required. Fetal Reduction All fetal reduction procedures were performed between 10 and 14 weeks gestation, by using transabdominal ultrasoundguided injection of 10% potassium chloride into the heart of the fetuses. The relationships between different gestational sacs were determined so as to locate the fetuses most easily accessible to the transabdominal needles. After cleaning the patient s abdominal skin with a 10% povidone iodine solution, an 18-gauge needle was introduced into one of the gestational sacs and then into the fetal heart. Potassium chloride solution (4 ml of 10% potassium chloride diluted Data Collection Data were obtained from the hospital records for all HOMP, including the maternal age, gestational age, birth weight at delivery, and the number of fetuses reduced. Overall, 353 cases of fetal reduction with complete records were included. Among these data, 176 triplet pregnancies, 96 quadruplet pregnancies, and 81 HOMP with more than four fetuses were reduced to twins. The other group had 389 patients with twin pregnancies, also defined at weeks of gestational age, in which fetal reduction was not performed. All live births of twin pregnancies were recorded as births in the study. Outcome Measures The period of gestation was established from the patient s records. The gestational ages at delivery were categorized into four groups: [1] 28 completed weeks, [2] between 28 and 32 weeks, [3] between 32 and 36 weeks, and [4] 36 weeks. Birth weight discordance is expressed as the weight determined by A minus B, where A is the birth weight of the heavier twin and B is the birth weight of the lighter twin. Birth weight discordant groups were categorized as: [1] 400 g, [2] g, [3] g, and [4] g. The mean birth weights for the nonreduced and reduced twin pregnancies were also compared. The mean birth weights were analyzed separately based on the classification of different gestational ages at delivery. Statistical Analysis Statistical analysis was performed using Student s t-test to compare mean patients ages, birth weights, and mean gestational ages at delivery for nonreduced and reduced twins. The 2 analysis with Spearman correlation tests was used to compare the frequency of prematurity by gestational age for nonreduced and reduced twin pregnancies. The 2 analysis was also applied to compare the incidence rates of discordant birth weights between nonreduced and reduced twin pregnancies. One-way ANOVA with the Bonferroni post-hoc test and trend testing with a linear model were used for mean birth weights of the reduced and nonreduced groups, which were 48 Cheang et al. Outcomes of twins and reduced twins Vol. 88, No. 1, July 2007

57 TABLE 1 Comparison of prematurity rates between reduced (initial number 3) and nonreduced twins (initial number 2) as a function of the initial number of fetus (Initial No.). Delivery weeks (WK) Initial No. WK<28 28<WK<32 32<WK<36 All WK<36 Total cases 2 7 (1.8) a 21 (5.4) 99 (25.5) 127 (32.7) b 389 (100) 3 5 (2.8) 7 (4.0) 53 (30.1) 65 (36.9) 176 (100) 4 4 (4.2) 4 (4.2) 33 (34.3) 41 (42.7) 96 (100) 5 7 (8.6) 4 (4.9) 28 (34.6) 39 (48.1) 81 (100) 3 16 (4.5) a 15 (4.3) 114 (32.3) 145 (41.1) b 353 (100) Note: Values in parentheses are percentages. Initial No.: P.035 by 2 test and P.004 by Spearman correlation test. a P.032 and b P.017, 2 test. Cheang. Outcomes of twins and reduced twins. Fertil Steril then stratified by the gestational age at delivery. Multiple linear regression model was used for estimation of the effect of initial number of fetuses on the mean birth weight. All the analyses were performed using the Statistical Package for the Social Sciences (version 9.0; SPSS Inc., Chicago, IL). A confidence level of P.05 was considered to be the limit of statistical significance for comparison purposes. RESULTS The pregnancy outcomes of reduced (n 353) and nonreduced twins (n 389) were compared based on the initial number of fetuses, gestational ages, and birth weights. The average maternal ages were and years (P.001) for the reduced and nonreduced groups, respectively. The mean gestational ages at delivery in the reduced and nonreduced twins were and weeks, respectively (P.003). Rates of Prematurity Premature births occurred more frequently in the reduced than in the nonreduced group. The rate of extreme premature delivery ( 28 weeks) was 4.5% (16/353) in the reduced group and 1.8% (7/389) in the nonreduced group (P.032). The rate of premature delivery ( 36 weeks) was 41.1% (145/353) in the reduced group and 32.7% (127/389) in the nonreduced group (P.017). Moreover, the rates of premature deliveries increased as the initial number of fetuses increased (P.035; Table 1). There was an inverse correlation between the gestational age at delivery and the initial number of fetuses (P.004; Table 1). Birth Weight Discordance The frequencies of birth weight discordances 400 g were 31.2% (110/353) for the reduced group and 33.2% (129/389) for the nonreduced group. The frequencies of birth weight discordances 100 g were 82.0% (319/389) for the reduced group and 78.8% (278/353). No matter which criteria we used, the frequencies of discordant birth weights did not differ significantly between the reduced and nonreduced twin groups. In addition, the rates of birth weight discor- TABLE 2 Comparison of the frequency of birth weight discordance in reduced and nonreduced twin pregnancies stratified by the initial number of fetus (Initial No.). Birth weight discordance Initial No. >400 g g g g Total >100 g 2(n 389) 129 (33.2) 51 (13.1) 72 (18.5) 67 (17.2) 319 (82.0) 3(n 176) 55 (31.3) 16 (9.0) 38 (21.6) 31 (17.7) 140 (79.6) 4(n 96) 30 (31.3) 6 (6.2) 19 (19.8) 24 (25.0) 79 (82.3) 5 (n 81) 25 (30.9) 15 (18.5) 5 (6.2) 14 (17.2) 59 (72.8) Note: Values in parentheses are percentages. Cheang. Outcomes of twins and reduced twins. Fertil Steril Fertility and Sterility 49

58 TABLE 3 The mean birth weight of reduced and nonreduced twins at different gestational ages: <28 weeks, >28 weeks and <32weeks, >32 weeks and <36weeks, and >36 weeks. Delivery weeks (WK) Initial No. WK<28 28<WK<32 32<WK<36* WK>36** Total*** , , a 2, c,d,e 2, g,h , , b 2, c 2, , , , d 2, g , , a,b 2, e 1, h Note: The labeled groups had 2, 3, 4, and 5 correspond to the original sacs of multiple pregnancies. The alphabet indicates that the birth weight in the group compared with the original twin group was statistically significant (P.05) by one-way ANOVA and Bonferroni post-hoc comparison. The data were presented as mean SD. * F test, P.003, a P.003, b P.01 by Bonferroni test. ** F test, P.001, c P.008, d P.011, e P.004 by Bonferroni test. *** F test, P.001, g P.002, h P.001 by Bonferroni test. Cheang. Outcomes of twins and reduced twins. Fertil Steril dance were not related to the initial number of fetuses (P.05; Table 2). Mean Birth Weight The mean birth weight of the reduced twin group was significantly lower than that of the nonreduced group (2, g and 2, g, respectively, P.001). Furthermore, we analyzed the mean birth weights of the four groups classified by the initial number of fetuses, which clearly showed that the higher the initial number of fetuses, the lower the mean birth weight (P.001; Table 3). The mean birth weight may also be affected by the gestational age at delivery. To further elucidate this issue, we compared the mean birth weight for groups divided according to different gestational ages at deliveries and the initial number of fetuses. The results are shown in Table 3. A trend existed in which the higher the initial number of fetuses, the lower the mean birth weight for those delivered at a gestational age between 32 and 36 weeks and those delivered at a gestational age 36 weeks (P.003 and P.001, respectively). The trend was not significant for those delivered before 28 weeks of gestation (P.05) and those delivered at gestational age between 28 and 32 weeks (P.05), but the number of such deliveries was relatively small. Multiple linear regression was used to clarify the effect of gestational age at delivery and the initial number of fetuses on the mean birth weight. The results were as the following formula: Mean birth weight (g) 2, (weeks) ( 153.0)(Initial number 5) ( 83.5)(Initial number 4) ( 62.6)(Initial number 3). The results suggested that the effect of initial number of fetuses might reduce the mean birth weight by 153 g, 83.5 g, and 62.6 g for groups with the initial number 5, 4, and 3, respectively, when they were compared with the nonreduced group (initial number 2). All coefficients within this formula were statistically significant (P.05). Perinatal Outcome The rate of infant mortality was 5/353 (1.4%) for the reduced group and 9/389 (2.3%) for the nonreduced group. We considered bronchopulmomary dysplasia, cardiac disease, gastrointestinal tract anomaly, retinopathy, and intraventricular edema as the major morbidity for the newborn. The major morbidity rate was 13/353 (3.7%) for the reduced group and 17/389 (4.4%) for the nonreduced group. The rate of mortality or morbidity is not different between reduced and nonreduced twin and not related to the initial number of fetuses. DISCUSSION Spontaneous twins occur in 1 in 90 births. The era of ART has increased the number of multiple births, therefore the incidence of twins is now 1 in 45 births (10 12) in the United States. In the United Kingdom, almost one-half (46%) of the babies born after ART now come from a multiple pregnancy (3,873 of 8,337 births) (1). In a short communication, Simmons et al. (2) reported data on fetal reduction in the United Kingdom resulting from ART between 1980 and The proportion of twin pregnancies was 0.964% in 1980 and, by 2001, had increased to 1.441% (i.e., a 49.48% rise). We report herein our series of 742 cases of multiple pregnancies resulting from ART performed at a single institution in which the incidence of multiple pregnancy has increased gradually during the period studied. Fetal reduction can be performed through transabdominal and transvaginal approaches. The transabdominal approach 50 Cheang et al. Outcomes of twins and reduced twins Vol. 88, No. 1, July 2007

59 has almost entirely replaced the transvaginal technique, however, because of the lower spontaneous abortion rate (5.4% vs. 12%) (13). All of the women with HOMP in this analysis underwent fetal reduction through the transabdominal approach and the pregnancy loss rates for reduced and nonreduced group are similar. Our data confirm that the transabdominal approach is a safe procedure. Evans et al. (13) reported that reduction of HOMP to twins carries the lowest pregnancy loss rate. In a corollary study, they also reported that the best clinical outcomes are achieved with reductions to a twin gestation (14). The success rates of fetal reduction have improved with increasing experience, a smaller number of fetuses comprising HOMP, and superior equipment. Although the technique of multifetal pregnancy reduction is a very safe procedure (4, 5, 9), in the current study, the reduced twin group was associated with elevated rates of prematurity. This means that some effects of HOMP exert persistently and are unable to be totally eliminated by selective fetal reduction. Antsaklis et al. (15) compared the gestational ages of 158 pregnancies reduced to twins from three or more fetuses to a group of 135 nonreduced twins after ART between January 1992 and May In their retrospective cohort study, the gestational age at the time of delivery was not significantly different between the nonreduced and reduced twins. Hwang et al. (16) reported at 2002 in a case control study that twin pregnancies after fetal reduction only suffered from lower birth weight than primary twins, but no difference in gestational age at delivery was found. Furthermore, Nevo et al. (17) showed in a retrospective case control study that no adverse effect on the intrauterine course of the remaining fetuses, such as prematurity, or their neonatal outcome, including low birth weight was noted for multiple pregnancy reduction to twins. In another case control study, Ko et al. (4) compared the outcome of 100 reduced twins with 210 nonreduced twins and concluded that fetal reduction carries a low risk of preterm birth. In stark contrast, we report herein that the fetal reduction procedure significantly decreased the gestational age at delivery and increased the rate of preterm birth. The sample size in this data analysis is larger than those previous studies (4, 15 17) and provides more precisely estimation of premature rates. However, overall 4.5% delivery before 28 weeks is relatively acceptable and similar with a previous report (11). In a review report, Evans et al. (18) revealed that increasing rates of poor outcomes, including early premature delivery, correlated with the starting number for multifetal pregnancy reduction. We therefore questioned whether premature delivery was related to the initial number of embryos implanted in the uterus. In a retrospective study, Torok et al. (9) investigated the gestational age distribution of twins at the time of birth as a function of the initial number of fetuses. They found that the prematurity rate associated with two, three, four, and five or more fetuses was 61%, 64.8%, 66.9%, and 67.4%, respectively. Similarly, Evans et al. (13) determined that very premature birth was correlated with the starting number of fetuses; our data support this conclusion. A possible explanation for this conclusion is that prematurity and low birth weight might be an effect of the residual material from fetuses subsequent to reduction procedures or some molecules released early in the first trimester. Elevated serum levels of relaxin or E 2 in early gestational age of pregnancy was reported to be associated with IVF and premature delivery (19, 20). Evans and co-workers (13) found a statistically significant difference in birth weight discordance only when the highorder reductions were compared with the nonreduced twins, and they noted that birth weight discordance increased with higher numbers of fetuses before reduction. Audibert et al. (21) also found high rates of discordant birth weights between reduced twins when compared with nonreduced twins, the risk increasing with greater numbers of fetuses (20.2%, 28.6%, 57.1%, and 100% for a starting number of two [i.e., nonreduced], three, four, and five embryos, respectively). We were unable to confirm a similar significant difference, which may be a methodologic artifact. In the past, weight discordance ranging from 15% 45% was considered to be a cause for concern, with most clinical issues arising when the discordance reached 25%. Birth weight differences can be expected in twins and constitute a high risk factor among twin pregnancies. In most studies, discordant fetal growth has been defined as a birth weight difference of 15%. A standard definition for fetal growth discordance on the basis of fetal weight differences has yet to be accepted (13). We considered that there were no statistically significant differences in the outcomes using percentages and because no previous report has been based on an absolute difference in birth weights, we expressed birth weight discordance as the difference in birth weight. However, our data did not show significant difference regarding birth weight discordance between the two study cohorts. Groutz et al. (22) compared the mean gestational weight of 30 pregnancies reduced to twins with 30 nonreduced twins. They concluded that the mean gestational weight at delivery was lower for the reduced twins. Hwang et al. (16) analyzed the mean birth weight data of 54 pregnancies reduced to twins with 406 primary twins. They also reported that the mean birth weight was lower for the reduced twins. In like manner, we report herein that the mean gestational weight is also associated with different gestational ages. From the multiple linear regression model, we can estimate the effect of initial number of fetuses on the birth weight. For example, the reduced twin from triplet would be 62.6 g lighter than nonreduced twin. These data will be useful in the counseling process with those patients who get HOMP subsequent to IVF treatment. Fertility and Sterility 51

60 The benefits of fetal reduction should not, however, blind us to the fact that the decision to proceed with fetal reduction imposes a significant psychological burden on couples who, usually having undergone ART, must decide whether or not to have a procedure that poses a threat to a highly valued pregnancy in an effort to improve its outcome (8). Although fetal reduction for HOMP is an effective measure for lowering substantial morbidity and mortality, its application in multiple gestations does not eliminate all detrimental effects due to HOMP, such as prematurity and low birth weight. In conclusion, even after selective fetal reduction, the initial number of fetuses remains a threat to the outcome of multiple pregnancies. At the present time, we regard selective fetal reduction as a clinically necessary procedure to prevent the complications of HOMP. However, the best way to prevent the complications associated with multiple pregnancies in ART may be achieved, first and foremost, by limiting the number of embryos transferred. REFERENCES 1. Wimalasundera RC, Trew G, Fisk NM. Reducing the incidence of twins and triplets. Best Pract Res Clin Obstet Gynaecol 2003;17: Simmons R, Doyle P, Maconochie N. Dramatic reduction in triplet and higher order births in England and Wales. Br J Obstet Gynaecol 2004;111: Papageorghiou AT, Liao AW, Skentou C, Sebire NJ, Nicolaides KH. Trichorionic triplet pregnancies at weeks: outcome after embryo reduction compared to expectant management. J Matern Fetal Neonatal Med 2002;11: Ko TM, Chung YP, Hua HL, Lu PJ, Tseng LH. Multifetal pregnancy reduction in 100 pregnancies. Taiwanese J Obstet Gynecol 1999;38: Boulot P, Vignal J, Vergnes C, Dechaud H, Faure JM, Hedon B. Multifetal reduction of triplets to twins: a prospective comparison of pregnancy outcome. Hum Reprod 2000;15: Ombelet W, Sutter PD, Elst JV, Martens G. Multiple gestation and infertility treatment: registration, reflection and reaction the Belgian project. Hum Reprod 2005;11: Stone J, Eddleman K, Lynch L, Berkowitz RL. A single center experience with 1000 consecutive cases of multifetal pregnancy reduction. Am J Obstet Gynecol 2002;187: Antsaklis A, Souka AP, Daskalakis G, Papantoniou N, Koutra P, Kavalakis Y, et al. Embryo reduction versus expectant management in triplet pregnancies. J Maternal Fetal and Neonatal Medicine 2004;16: Torok O, Lapinski R, Salafia CM, Bernasko J, Berkowitz RL. Multifetal pregnancy reduction is not associated with an increased risk of intrauterine growth restriction, except for very-high-order multiples. Am J Obstet Gynecol 1998;179: Hansen W. Twin pregnancy developments [letter]. Kentucky Women s and Children s Health 2004;7: Evans MI, Ciorica D, Britt DW. Do reduced multiples do better? Best Pract Res Clin Obstet Gynaecol 2004;18: Jain T, Missmer SA, Hornstein MD. Trends in embryo-transfer practice and in outcomes of the use of assisted reproductive technology in the United States. N Engl J Med 2004;350: Evans MI, Berkowitz RL, Wapner RJ, Carpenter RJ, Goldberg JD, Ayoub MA, et al. Improvement in outcomes of multifetal pregnancy reduction with increased experience. Am J Obstet Gynecol 2001;184: Evans MI, Ciorica D, Britt DW, Fletcher JC. Update on selective reduction. Prenat Diagn 2005;25: Antsaklis AJ, Drakakis P, Vlazakis GP, Michalas S. Reduction of multifetal pregnancies to twins does not increase obstetric or perinatal risks. Hum Reprod 1998;14: Hwang JL, Pan HS, Huang LW, Lee CY. Comparison of the outcomes of primary twin pregnancies and twin pregnancies following fetal reduction. Arch Gynecol Obstet 2002;267: Nevo O, Avisar E, Tamir A, Coffler MS, Markhoul IR. Neonatal course and outcome of twins from reduced multipfetal pregnancy versus non-reduced twins. Isr Med Assoc J 2003;5: Evans MI, Ciorica D, Britt DW. Do reduced multiples do better? Best Pract Res Clin Obstet Gynaecol 2004;18: Haning RV, Goldsmith LT, Seifer DB, Wheeler C, Frishman G, Sarmento J, et al. Relaxin secretion in in vitro fertilization pregnancies. Am J Obstet Gynecol 1996;174: Weiss G, Goldsmith LT. Mechanism of relaxin-medicated premature birth. Ann NY Acad Sci 2005;1041: Audibert F, Boullier M, Boithias C, Kerbrat V, Violaine K, et al. Embryo reduction and birth weight discordance in dichorionic twins. Hum Reprod 2003;18: Groutz A, Yovel I, Amit A. Pregnancy outcome after multifetal pregnancy reduction to twins compared with spontaneously conceived twins. Hum Reprod 1996;11: Cheang et al. Outcomes of twins and reduced twins Vol. 88, No. 1, July 2007

61 Increased efficiency of preimplantation genetic diagnosis for infertility using no result rescue Pere Colls, Ph.D., a Tomas Escudero, M.Sc., b Natalie Cekleniak, M.D., c Sasha Sadowy, M.Sc., d Jacques Cohen, Ph.D., a,d and Santiago Munné, Ph.D. a a Reprogenetics LLC, Livingston, New Jersey; b Reprogenetics LLC, South San Francisco, California; c Institute for Reproductive Medicine and Science, and d Thyo-Galileo Laboratories, Livingston, New Jersey Objective: To improve preimplantation genetic diagnosis (PGD) accuracy by using no result rescue (NRR) consisting of the reanalysis of dubious results with additional probes binding to a locus different from the one previously analyzed. Design: Prospective study of PGD cycles with and without reanalysis of inconclusive results. Setting: PGD laboratory. Patient(s): Patients undergoing PGD for infertility or Robertsonian translocations. Intervention(s): Nuclei from day 3 biopsied embryos were analyzed with fluorescence in situ hybridization for chromosomes X,Y, 13, 15, 16, 17, 18, 21, and 22. When inconclusive results were obtained, NRR was performed. In addition, 100 PGD cycles using NRR were matched to controls according to maternal age, previous failed cycles, number of zygotes, number of eggs, and date of retrieval. Main Outcome Measure(s): Determination of frequency of inconclusive results and error rate after use of additional probes. Comparison of frequency of inconclusive results with prior PGD results when NRR was not used. Assisted reproductive technology outcome was compared between PGD using NRR and controls not using PGD. Result(s): After analysis of 34,831 blastomeres from 34,225 embryos, 2,609 blastomeres (7.5%) showed inconclusive results. After NRR on those 2,609 blastomeres, the number of cells with inconclusive results was reduced to 3.1% (P.001). After the introduction of NRR, fluorescence in situ hybridization errors, measured as discrepancies between the PGD diagnosis and the analysis of the nonreplaced embryo, decreased from 13.6% to 4.7% (P.001). PGD with NRR significantly improved implantation rates, from 20% to 31%, and reduced spontaneous abortions from 27% to 6%. Conclusion(s): The use of NRR has been proven to be a powerful tool to reduce the error rate and the frequency of inconclusive results in PGD, both parameters of high importance to assess quality of PGD laboratories. Indeed, these parameters are two of the few measurable criteria to measure PGD laboratories. In a parallel controlled study, PGD with NRR significantly improved implantation rates and reduced spontaneous abortions, showing that PGD is more efficient in selecting embryos that will reach term. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Preimplantation genetic diagnosis (PGD), FISH, misdiagnosis, error rate, discrepancy Received May 18, 2006; revised and accepted November 20, Reprint requests: Pere Colls, Ph.D., Reprogenetics LLC, 3 Regent Street, Suite 301, Livingstone, New Jersey (FAX: ; Pere.Colls@Reprogenetics.com). Preimplantation genetic diagnosis (PGD) analysis by fluorescence in situ hybridization (FISH) was first proposed in clinical diagnosis to select embryos with a normal chromosome count (1). Preimplantation genetic diagnosis for infertility (also known as PGD for aneuploidy) has shown in some studies to increase implantation rates in women 35 and older (2 4), and to reduce spontaneous abortions in women with or without a history of recurrent miscarriage (3, 5). Since it was first introduced in clinical diagnosis, different protocols have been established to test the maximum number of chromosomes in a single interphase nucleus, these ranging from testing only chromosome Y (6) to the test of 13 chromosomes (4). In addition, at the same time, different strategies such as the use of scoring criteria (7), improvement of fixation technique (8), or the development of more specific and efficient probes, have been established to diminish the error rate of the technique. These improvements have increased PGD sensitivity, but certain shortcomings remain. It appears problematic for some PGD centers to demonstrate efficacy when defining error rates and figures can be given that are confusing, although error rates including false negatives and false positives of 10% are becoming industry norm (8 10). Overlapping signals, split signals, crosshybridization, or polymorphisms (10) can be found during FISH analysis in good-quality nuclei, and can lead to a misdiagnosis or to lack of diagnosis for one or more chromosomes. Most of these problems are related to distribution of chromatin in the interphase nucleus, to the type of DNA probes used or, in the case of polymorphisms, to genetic variations in human population. In our facility, 30,000 embryos have been analyzed for PGD for infertility or Robertsonian translocations /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 53

62 with a high efficiency rate. However, 7.5% of the cells analyzed from these embryos had a lack of diagnosis for one or more of the nine chromosomes (X,Y, 13, 15, 16, 17, 18, 21, and 22) screened, which may not allow the classification of an embryo as normal. This fact would lead to a no result (NR) diagnosis for the chromosome in question. This could limit the chance of embryo replacement depending on factors such as quality of the embryo and the availability of completely normal embryos or type of chromosome diagnosed as NR. Because of lack of diagnosis, an NR event can be considered as noninformative for the chromosome in question, and therefore, the replacement of such an embryo carries a risk possibly resulting in implantation failure, spontaneous abortion, still birth, or even reaching a birth with severe birth defects. One approach to reduce NR events is the use of reanalysis for a specific chromosome with probes binding to a different locus, hereafter called no result rescue or NRR. This approach was first used by us (11) to analyze chromosome 21 twice to minimize errors related to this chromosome. Here we present our experience with NRR to resolve unclear results in 34,831 blastomeres from 34,225 embryos produced in 4,049 cycles of PGD for infertility or Robertsonian translocations. MATERIALS AND METHODS Embryos to Assess the Error Rate before and after NRR Cycles of PGD for infertility or Robertsonian translocations were included from 1995 to the present. These cycles were performed in 125 US-based IVF centers, where embryos were biopsied on day 3 of development by removing a single blastomere, followed by nuclear fixation using the slightly modified Carnoid method (8). The fixed cells were sent to one of two Reprogenetics (West Orange, NJ, or South San Francisco, CA) laboratories with same- or next-day delivery for FISH analysis, and results were provided on days 3 to 5 of embryo development. Most embryos that were reanalyzed had been obtained from procedures performed at The Institute for Reproductive Medicine and Science (Livingston, NJ). Informed, signed consent was obtained from patients undergoing PGD, and this retrospective study was approved by the institutional review board of Saint Barnabas Medical Center. Fluorescence In Situ Hybridization Procedures PGD analysis was performed by two rounds of FISH, as previously reported (12). The first round contained probes for chromosomes 13, 16, 18, 21, and 22 (MultiVysion PB, Vysis) (LSI [locus specific] 13q14.1 q14.3, RB1; CEP 16q11.2, D16Z3; CEP 18p11.1 q11.1, D18Z1; LSI 21q22.13 q22.2, D21S259, D21S341, D21S342; LSI 22q11.2, BCR), and the second round was performed by using an in-house prepared hybridization mixture with probes for chromosomes X (CEP, DXZ1 within Xp11.1 q11.1), Y (CEP, DYZ1 Yq12), 15 (CEP, Alpha Satellite D15Z4 within 15p11.1 q11.1), and 17 (CEP, D17Z1 within 17p11.1 q11.1). In some cases only one round of FISH was performed (MultiVysion PGT, Vysis), including probes specific for chromosomes X, Y, 13, 18, and 21. Robertsonian translocations were analyzed after application of one or two rounds of FISH depending on the chromosomes involved in the translocation using MultiVysion PB alone or followed by another round of FISH using LSI or telomeric probes specific for chromosomes 14 (Telomere 14q32.3, STS-X58399, SHGC-36156, STS-AA034492, IGHV segments) (LSI 14q32.3, IGH) or 15 (Telomere 15, AFM A224XH1) (LSI 15q22, PML). Because the embryos included in this study were obtained over some years, different protocols have been used in the FISH analysis (7, 12 16). After the regular FISH panels, a third hybridization round was performed in cases where doubtful results for one or more of the analyzed chromosomes were obtained. In such cases, a new probe that binds to a different locus than the previous was used; these being a subtelomeric probe binding to the p or q arm, or an LSI probe that targets a different locus of the chromosome in question. These extra hybridization panels were performed following protocols previously described (12, 17). Thus, for chromosome 13 the probes (Telomere 13q34, VIJyRM2002) or (LSI 13q34, D13S25, D13S319, RB1) were used. For chromosome 15 they were (Telomere 15, AFM A224XH1) or (LSI 15q22, PML), for chromosome 16 (Telomere 16p13.3, 16PTEL05) or (Telomere 16q24.3, 16QTEL013), for chromosome 17 (Telomere 17p13.3, 17PTEL80), (Telomere 17q25.3, AFMZ17yD10) or (LSI 17q12 q21, RARA), for chromosome 18 (Telomere 18p11.3, VIJyRM2102), (Telomere 18q23, VIJyRM2050, 18QTEL11), or (LSI 18q21.1 q21.3, BCL2), for chromosome 21 only (Telomere 21q22.3, VIJyRM2029), for chromosome 22 (Telomere 22q13.3, MS607) or (LSI 22q11.2, TUPLE1, 22q13.3, ARSA), and for chromosomes X and Y (Telomere Xp22.3/Yp11.3, DXYS129) or (Telomere Xq28/ Yq12, EST Cdy 16c07) were used. All individual probes as well as multicolor probe hybridization mixtures were obtained from Abbott (Downers Grove, IL). Scoring Criteria Fluorescence in situ hybridization signals were scored applying criteria previously described (7), which facilitates the differentiation between close signals from two homologue chromosomes from two domains belonging to a split signal of a single chromosome. In some nuclei different factors, such as overlapping or split signals, polymorphisms, or crosshybridization, do not 54 Colls et al. Increased efficiency of preimplantation genetic diagnosis Vol. 88, No. 1, July 2007

63 FIGURE 1 Nucleus showing a single large signal for chromosome 16 (Aqua Vysis) in regular first FISH panel. Colls. Increased efficiency of preimplantation genetic diagnosis. Fertil Steril allow clear results for one or more chromosomes, leading to a diagnosis of NR. In other cases, mostly because of defective fixation, no clear results can be obtained for any of the chromosomes. In those instances the cell is diagnosed as NR. Some of the nuclei analyzed showed no conclusive results for one or more of the chromosomes analyzed. In such cases, NR was scored for the chromosome in question and, depending on several criteria as embryo and nucleus quality, timing for results, probes availability, or chromosome number in question, an additional FISH round with probes that bind in a different location than the one that produced the NR was applied to study the problem. Error Rate For quality control purposes and to assess the error rate, some nontransferred embryos classified by PGD as abnormal and donated for research purposes were reanalyzed with all or most of their cells fixed individually. After reanalysis, embryos were classified into normal, aneuploid, haploid, polyploidy, or mosaic following previous criteria (12). The reanalysis and PGD results were compared. In the past we have used a set of criteria to define errors (7, 13). Here we reevaluated those criteria in two ways: [1] because of complex mosaics and abnormalities, as well as the availability of only one cell, it is difficult to define what type of abnormality an embryo has. Thus, provided that the PGD is abnormal and the reanalysis is also abnormal, the PGD was considered correct. [2] Mosaic embryos with a proportion of normal and abnormal cells are a scoring challenge. In the past we have considered an embryo with 3/8s of the cells abnormal as an abnormal embryo, calling it a detrimental mosaic, while mosaics with 1 2/8s were considered mostly normal. This criteria was based on the observation that embryos that have lost 3/8s of the cells after thawing implant significantly less, and the assumption that abnormal cells would most likely arrest. This criteria is arbitrary, and a more stringent one, using a 50% cutoff, will be also used for comparison. Based on the above two considerations, the criteria that were followed are: (a) if it was determined that the embryo was abnormal (any abnormality) and after reanalysis it was aneuploid, polyploid, haploid, or mosaic, with 100% of cells abnormal (but with different abnormal cell lines; thus, a mosaic) we considered the PGD result correct. If instead it was normal, we considered the result a false positive error. (b) If the embryo was classified by PGD as abnormal and after reanalysis it was found to be mosaic with 3/8s or 37.5% abnormal cells, then the embryo was considered abnormal and the diagnosis correct. If instead it was a mosaic with 3/8s or 37.5% abnormal cells, it was considered a false positive error. The same criterion was applied but using a 50% cutoff. Statistical analysis was performed using the high chisquare test. Matching of PGD cycles with NRR with controls Although the purpose of the study was not to determine the clinical effect of NRR but its efficacy in reducing errors, a small blindly matched retrospective study was also performed to find if it affected clinical outcome. One hundred patients 35 years or older undergoing PGD of infertility with NRR at Saint Barnabas Medical Center, Livingston, New Jersey, were blindly and retrospectively matched one to one to 100 controls (no PGD) according to maternal age, number of previous cycles, number of eggs retrieved, number of zygotes produced, and date of retrieval. Because most patients with recurrent pregnancy loss undergo PGD at that center, these were excluded from the study because they could not be properly matched to controls. An employee of Reprogenetics matches the PGD cycles to controls without previous knowledge of pregnancy outcome. Once matched, a genetic counselor from Saint Barnabas filled in the pregnancy information for comparison purposes. Fertility and Sterility 55

64 FIGURE 2 Nucleus showing a split signal for chromosome 15 (Orange Vysis) in regular second FISH panel. number of normal embryos in the cohort, fixation quality, and probe availability, a total of 2,049 (66.7%) NR events were reanalyzed by using NRR, obtaining informative results in 1,791 (87.4%) of them. Thus, the number of blastomeres with NR events was reduced to 1,088 (3.1%) (P.001) after the use of additional probes. The NR events were mainly originated by possible polymorphism, overlapping signals (Fig. 1), or split signals (Figs. 2 and 3). The use of telomeric (Fig. 4) or LSI (Figs. 5 and 6) probes as a third panel was useful to solve unclear results. Colls. Increased efficiency of preimplantation genetic diagnosis. Fertil Steril Statistical Analysis Simple comparisons of proportions were made using Fisher s Exact Test. For more elaborate structures involving more than one factor, generalized linear models methods were used. This technique is somewhat similar to the more familiar analysis of variance, but with greater flexibility in the choice of a model and the error structure. Although these analyses were carried out on the transformed (logistic) scale, summaries of the results will be presented as proportions. Chromosomes Commonly Affected in NR Chromosome 15 is the most frequently involved in inconclusive results, accounting for a total of 899 (29.3%) NRs, followed by chromosomes 18 (712, 23.2%) and 16 (499, 16.2%). Chromosome 22 accounted for 265 (8.6%) of NRs followed by chromosomes 17 having 256 (8.3%), 21 having 221 (7.2%). and 13 with 180 (5.8%) NRs. On the other hand, chromosomes X and Y are least frequently involved, with a total of 41 NRs (1.3%). The chromosomes with more NR events are those labeled in aqua or blue colors, which tend to be more difficult to score when there is poor fixation. Reduction of Error Rate To assess the error rate for quality control purposes, all cells from some nonreplaced embryos classified by PGD as abnormal were reanalyzed using the same probes that were FIGURE 3 Nucleus showing a split signal for chromosome 13 (Red Vysis) in regular first FISH panel. RESULTS No Result Diagnosis A total of 34,831 blastomeres from 34,225 embryos produced in 4,049 IVF cycles were analyzed with PGD for aneuploidy or Robertsonian translocations from 1995 to the present. Because of defective fixation, DNA stage of compaction, crosshybridization, proximity of signals, split signals or polymorphisms, as well as other factors, 4,387 of the analyzed blastomeres showed one or more NR for the chromosomes analyzed, giving a total of 7,279 NR events. Figures 1 3 show several cells with NR for one of the chromosomes. Of those, 1,778 had abnormal results for other chromosomes, indicating that the embryo was abnormal and these were not reanalyzed. Thus, 2,609 (7.5%) blastomeres had one or more NR events that did not permit to classify the embryo as normal or abnormal, with a total of 3,073 individual NR events. Of those, and based on several criteria, such as embryo quality, Colls. Increased efficiency of preimplantation genetic diagnosis. Fertil Steril Colls et al. Increased efficiency of preimplantation genetic diagnosis Vol. 88, No. 1, July 2007

65 FIGURE 4 Same nucleus as in Figure 1 reanalyzed with Telomeric 16q (Orange Vysis) as third panel showing two signals for chromosome 16. explaining why analyzing just a single cell will diagnose most mosaic embryos (Table 1). Matching of PGD Cycles with NRR with Controls Although the purpose of the study was not to determine the clinical effect of NRR but its efficacy in reducing errors, a small blindly matched retrospective study was also performed to find if it affected clinical outcome. The results of 100 PGD cycles using NRR compared with matched controls are shown in Table 2. There was one cycle per patient. Both controls and PGD cycles had similar maternal ages (38.8 and 39.1, respectively), previous number of attempts (1.1 and 1.0), oocytes retrieved (12.1 and 12.5), and zygotes produced (6.8 and 7.2). Significantly less embryos were replaced in the PGD (152) than in the control group (241) (P.001). Implantation rate was significantly higher (31% vs. 20%, P.011), and spontaneous abortions significantly lower (6% vs. 28%, P.001) in the PGD than in the control group. In total, 1 of 32 PGD pregnancies were lost or terminated because of chromosome abnormalities, compared with 9 of 35 (P.014) in controls. Colls. Increased efficiency of preimplantation genetic diagnosis. Fertil Steril used for the PGD screening. As shown in Table 1, using our standard threshold of considering an embryo with 38% or more abnormal cells as abnormal, the error rate before the introduction of the third panel was 13.6% (192 of 1,416). After adding the use NRR there was a significant reduction (P.001 by the chi-square test) of error rate, to 4.7% (28 of 592). As stated above, previous to the introduction of NRR, procedures performed up to 2000 used less than eight probes and had a 11.6% (88 of 759) error rate, and cases between 2001 and 2002 used nine probes and had a 15.4% (101 of 657) error rate. The more stringent threshold of a minimum of 50% abnormal cells proportionally to classify an embryo as abnormal (and less stringent for normalcy) was also tested. The error rate before and after the introduction of the third panel was 15.6% (221 of 1416) and 6.8% (40 of 592) (P.001). There was no significant difference in error rates between using one or other thresholds when using the third probe panel. Although the frequency of mosaics in the fraction of reanalyzed and abnormal embryos was high (64%), only 60% of all mosaics had only abnormal cells. Eighty-nine percent of these had between 50% and 100% abnormal cells, DISCUSSION Reduction of NR Events There are a number of reasons why there are no clear signals after FISH of PGD for infertility, a phenomenon described as NR. The first cause is the quality of the fixation. Suboptimal fixation (condensed nuclei, cytoplasm covering the nucleus, expanded nuclei) can produce splitting, weakening, or even lack of signals. To overcome this source of NR, we routinely use the air-dry methanol:acetic acid technique. This fixation method, which may require additional expertise, has been proven effective in reducing the rate of inconclusive results when compared with other techniques (8). With this fixation technique we obtain a high rate of optimal diameter size nuclei without cytoplasm background, both factors of great importance to reduce overlapping signals that can lead to inconclusive results. The second cause of signal failure after FISH is dependent on the type of probe used for each of the chromosomes. Overall, centromeric probes tend to be more involved in NR than LSI probes. In our study, 78.3% of NR are observed in centromeric probes, with chromosomes 15, 18, and 16 having the highest frequencies. For chromosome 18, NR are mainly because of some crosshybridization that the CEP 18p11.1 q11.1, D18Z1 probe produces with other paracentromeric sequences, but also in some cases with expanded nuclei, the Blue Vysis dye for this chromosome in MultiVysion PB, is difficult to observe clearly, and chromosomes 18 and 16 are labeled with these dyes. Another source of NR for chromosome 18 is the highly frequent association of centromeric region of this chromosome Fertility and Sterility 57

66 FIGURE 5 Same nucleus as in Figure 2 reanalyzed with LSI 15 (Orange Vysis) as third panel showing two signals for chromosome 15. Colls. Increased efficiency of preimplantation genetic diagnosis. Fertil Steril with centromeric region of chromosome 16, resulting in overlapping. Because the Aqua Vysis dye of centromeric 16 is much brighter than the Blue Vysis dye of chromosome 18, it may become difficult to asses the presence of a chromosome 18. In chromosome 16, NR is usually related to the high polymorphic variability of the paracentromeric region (18), where the CEP 16q11.2, D16Z3 binds. In some cases, the size of this region is so reduced that the signal can be easily confused with background, or sometimes it cannot even be seen at all (polymorphism 16qh-) (10). Because the CEP DYZ1 Yq12 probe binds in the highly polymorphic region of the q arm of chromosome Y, a similar reason accounts for NR in this chromosome. In some instances a large signal splits in more than one fragment separated enough to be misinterpreted as two independent signals. For chromosome 15, the NR is mainly produced by the relatively high split signal that produces the CEP 15p11.1 q11.1 D15Z4 probe because of its Alpha Satellite DNA composition. Because chromosome 15 is labeled in Spectrum Orange dye (Abbott) as well as chromosome Y, another source of NR for chromosome 15 is the proximity, almost overlapping, with chromosome Y in some nuclei. Chromosome X accounts for the lowest frequency of NR (4.7% combined with chromosome Y). These are commonly the result of a typical split pattern of the CEP, DXZ1 probe, which in some cases produces two bright spots separated enough to be scored as two signals. The lowest frequency of NR is observed in LSI probes, which as specific nonrepetitive DNA sequences cannot produce crosshybridization or polymorphic events commonly observed in centromeric probes. Most of the NR originate by proximity or split of the signals in these chromosomes [13, 21, and 22]. Other types of probes not commercialized by Abbot may produce different error rates. An effective way to reduce the frequency of NR in PGD is the use of an additional FISH panel including probes that bind to different locations than the ones used in the regular panels. With this approach, 87.4% of the NR analyzed had been resolved. Two different types of probes, telomeric and LSI, can be used for this purpose depending on which chromosome should be analyzed. Initially, because of lack of commercially available LSI probes for some chromosomes, only probes that bind to subtelomeric regions of p or q arms were used. Because telomeric probes are individually supplied and labeled in different fluorescent colors, they can be mixed when more than one chromosome should be reanalyzed with high hybridization efficiency. More LSI probes were used over time because they have larger signals and shorter hybridization times. In addition, new commercially available LSI probes have been developed. Validated PGD data of cells from day 3 biopsy can be made available within hours despite the additional hybridization and transportation time related to couriering samples to the PGD laboratory. Currently, up to five [13, 15, 17, 18, 22] of the routinely screened chromosomes are reanalyzed with LSI probes in FIGURE 6 Same nucleus as in Figure 3 reanalyzed with LSI 13q34 (Green Vysis) as third panel showing two signals for chromosome 13. Colls. Increased efficiency of preimplantation genetic diagnosis. Fertil Steril Colls et al. Increased efficiency of preimplantation genetic diagnosis Vol. 88, No. 1, July 2007

67 TABLE 1 Error rate with and without analysis using a third probe panel. Without third probe panel With third probe panel Embryos abnormal for PGD reanalyzed 1, Normal Mosaic b 38% abnormal Mosaic b 38 49% abnormal Mosaic b 50 99% abnormal Mosaic b 100% abnormal Homogeneously abnormal a Error using 38% threshold c 13.6% 4.7% P.001 Error using 50% threshold c 15.6% 6.8% P.001 Note: PGD preimplantation genetic diagnosis. a Homogeneously abnormal: aneuploid, polyploid, haploid. b Mosaics with different percent of abnormal cells (below). These embryos include aneuploid embryos that were in addition mosaic with a few normal cells. c Threshold above which error is considered. For example, with a 38% threshold, and embryo with 40% abnormal cells would be considered abnormal, but not with a 50% threshold. Colls. Increased efficiency of preimplantation genetic diagnosis. Fertil Steril case of NR. Telomeric probes are still being used for chromosomes X, Y, 16, and 21 and also for the other five chromosomes when color combination of LSI probes does not allow analysis. An overall 66.7% of the NR events were reanalyzed, with a third panel obtaining informative results in a high percentage of them (87.4%). Therefore, with this approach, specific diagnosis could have been established for 58% of embryos with inconclusive results. This frequency may increase further by more aggressively applying this approach after NR detection. Additional third-panel analyses to solve NR have been used by our team for a number of years. However, because of technical limitations such as improving third-panel pro- TABLE 2 Comparison of PGD cases with NRR to matched controls. Controls PGD with NRR Differences Matching parameters Maternal age NS Previous IVF attempts NS Oocytes retrieved NS Zygotes produced NS Outcome Cycles Av. embryos replaced 2.4 (241/100) 1.5 (152/100) P.001 Pregnancy rate a 35% (35/100) 32% (32/100) NS Implantation rate 20% (47/241) 31% (47/152) P.011 Spontaneous abortion rate 28% (13/47) 6% (3/47) P.014 Pregnancies lost 8 1 Pregnancies terminated 1 0 Ongoing pregnancy rate b 26% (26/100) 31% (31/100) NS Note: NRR no result rescue; PDG preimplantation genetic diagnosis. a Defined as presence of a fetal heart beat, ectopics not counted as pregnancies. b Ongoing pregnancy was in its third trimester or had delivered. Colls. Increased efficiency of preimplantation genetic diagnosis. Fertil Steril Fertility and Sterility 59

68 tocols, probe availability, or lack of data regarding the feasibility of this approach, a small percentage of NR could be analyzed initially. As third-panel protocols were being optimized, and new LSI probes becoming commercially available, the use of third rounds of FISH was increasingly being applied until being fully included in routine PGD screenings. Reduction in Error Rate The progressive introduction of third-panel analysis for dubious results is clearly reflected in the decreasing error rate (false positives false negatives), which was significantly lowered from 13.5% to 4.7% before and after the third panel was routinely introduced in PGD analysis. One source of errors is technical, related to the factor described above. There is probably little margin of improvement once the fixation technique has been optimized (8), and the use of third panel hybridization included. The rest of the errors are mostly because of mosaicism. Mosaics are very common in cleavage-stage embryos, but practitioners must realize that most of the cells in these embryos are chromosomally abnormal, such as shown in Table 1. Thus, irrespective of which cell is biopsied, the diagnosis of a single cell will result in a small error rate. Here we have calculated only the false positive error rate. To calculate the false negative error rate (embryos classified by PGD as normal, that were in fact abnormal) we could have analyzed the few normal embryos that arrested and were not replaced. However, it is well known that arrested embryos are invariably more likely to be chromosomally abnormal than nonarrested embryos (16, 19). Thus, the population of normal embryos reanalyzed would not be representative of those replaced, and false negative error would be overestimated. A better way to calculate false negative errors would be to analyze nonarrested embryos donated to research and first fix a single cell that is analyzed independently. This can then be compared with the reanalysis of the rest of the embryo. This study is underway. Otherwise, there is no evidence that the false positive and negative error rates should differ too much, and therefore, the total error rate must be around 4.7% For example, if 5 of 100 (5%) normal embryos are misclassified as abnormal, and 5 of 100 (5%) abnormal embryos are misclassified as normal, the total error rate is relatively the same at 10 of 200 or 5%. In conclusion, it is clear that the use of different probes as an additional panel to solve NR in a reasonable time frame has been proven to be a powerful tool to reduce the error rate of PGD and the frequency of NR. This information is crucial for evaluating published PGD data. The only randomized studies published to date (20, 21) have failed to address these concerns. It is essential that reviewers of PGD literature provide a conceptual analysis of technology and not just a synopsis of data. While reviewing the efficacy of PGD for infertility, two recent reviews did not assess the efficacy of the published work and the NR and other error rates that may be responsible for disappointing data sets (22, 23). We propose that the NR and error rates become standards for comparing the quality of PGD laboratories so practitioners can compare them based on their published error and NR rates. Matching of PGD Cycles with NRR with Controls The purpose of the present study was not to demonstrate the efficacy of performing PGD compared with non-pgd, but to assess if NRR was a better method to reduce NR and error rate. In this regard, a small study was performed to determine if any of the variables usually measured in assisted reproductive technology outcome was improved. Indeed, an effect was noted with only 100 cases in each group and with less embryos replaced in the PGD group. PGD embryos implanting had a significantly lower spontaneous abortion rate (6% vs. 28%, P.011), and of the initial pregnancies, significantly more were ongoing in the PGD group (31 of 32) than in the control group (26 of 35, P.014). Patients are extremely disappointed when there are no embryos available for replacement. PGD with NRR combines a high embryo selection efficiency with a low false positive error rate. This may improve the efficiency of assisted reproductive technology by significantly reducing the replacement of embryos that will not implant or will spontaneously abort, resulting in more pregnancies reaching term. REFERENCES 1. Munné S, Lee A, Rosenwaks Z, Grifo J, Cohen J. Diagnosis of major chromosome aneuploidies in human preimplantation embryos. Hum Reprod 1993;8: Gianaroli L, Magli C, Ferraretti AP, Munné S. Preimplantation diagnosis for aneuploidies in patients undergoing in vitro fertilization with a poor prognosis: identification of the categories for which it should be proposed. Fertil Steril 1999;72: Munné S, Magli C, Cohen J, Morton P, Sadowy S, Gianaroli L, et al. Positive outcome after preimplantation diagnosis of aneuploidy in human embryos. Hum Reprod 1999;14: Munné S, Sandalinas M, Escudero T, Velilla E, Walmsley R, Sadowy S, et al. Improved implantation after preimplantation genetic diagnosis of aneuploidy. Reprod Biomed Online 2003;7: Munné S, Chen S, Fischer J, Colls P, Zheng X, Stevens J, et al. Preimplantation genetic diagnosis reduces pregnancy loss in women aged 35 years and older with a history of recurrent miscarriages. Fertil Steril 2005;84: West JD, Gosden JR, Angell RR, Hastie ND, Thatcher SS, Glasier AF, et al. Sexing the human pre-embryo by DNA-DNA in-situ hybridization. Lancet 1987;1: Munné S, Marquez C, Magli C, Morton P, Morrison L. Scoring criteria for preimplantation genetic diagnosis of numerical abnormalities for chromosomes X, Y, 13, 16, 18 and 21. Mol Hum Reprod 1998;4: Velilla E, Escudero T, Munné S. Blastomere fixation techniques and risk of misdiagnosis for preimplantation genetic diagnosis of aneuploidy. Reprod Biomed Online 2002;4: Li M, Marin DeUgarte C, Surry M, Danzer H, DeCherney A, Hill DL. Fluorescence in situ hybridization reanalysis of day-6 human blasto- 60 Colls et al. Increased efficiency of preimplantation genetic diagnosis Vol. 88, No. 1, July 2007

69 cysts diagnosed with aneuploidy on day 3. Fertil Steril 2005;84: Colls P, Sandalinas M, Pagidas K, Munné S. PGD analysis for aneuploidy in a patient heterozygous for a polymorphism of chromosome 16 (16qh-). Prenat Diagn 2004;24: Magli MC, Sandalinas M, Escudero T, Morrison L, Ferraretti AP, Gianaroli L, et al. Double locus analysis of chromosome 21 for preimplantation genetic diagnosis of aneuploidy. Prenat Diagn 2001;21: Munné, S, Márquez, C, Reing A, Garrisi J, Alikani M. Chromosome abnormalities in embryos obtained after conventional in vitro fertilization and intracytoplasmic sperm injection. Fertil Steril 1998;69: Munné S, Weier HU. Simultaneous enumeration of chromosomes 13, 18, 21, X and Y in interphase cells for preimplantation genetic diagnosis of aneuploidy. Cytogenet Cell Genet 1996;75: Bahce M, Cohen J, Munné S. Preimplantation genetic diagnosis of aneuploidy: were we looking at the wrong chromosomes? J Assist Reprod Genet 1999;16: Bahce M, Escudero T, Sandalinas M, Morrison L, Legator M, Munné S. Improvements of preimplantation diagnosis of aneuploidy by using microwave hybridization, cell recycling and monocolour labeling of probes. Mol Hum Reprod 2000;6: Marquez C, Sandalinas M, Bahce M, Alikani M, Munné S. Chromosome abnormalities in 1255 cleavage-stage human embryos. Reprod Biomed Online 2000;1: Munné S, Sandalinas M, Escudero T, Fung J, Gianaroli L, Cohen J. Outcome of preimplantation genetic diagnosis of translocations. Fertil Steril 2000;73: Hsu LYF, Benn PA, Tannenbaum L, Perlis TE, Carlson AD. Chromosomal polymorphisms of 1, 9, 16, Y in 4 major ethnic groups: a large prenatal study. Am J Med Genet 1987;26: Munné S, Alikani M, Tomkin G, Grifo J, Cohen J. Embryo morphology, developmental rates and maternal age are correlated with chromosome abnormalities. Fertil.Steril 1995;64: Staessen C, Platteau P, Van Assche E, Michiels A, Tournaye H, Camus M, et al. Comparison of blastocyst transfer with or without preimplantation genetic diagnosis for aneuploidy screening in couples with advanced maternal age: a prospective randomized controlled trial. Hum Reprod 2004;19: Platteau P, Staessen C, Michiels A, Van Steirteghem A, Liebaers I, Devroey P. Preimplantation genetic diagnosis for aneuploidy screening in patients with unexplained recurrent miscarriages. Fertil Steril 2005; 83: Shahine LK, Cedars MI. Preimplantation genetic diagnosis does not increase pregnancy rates in patients at risk of aneuploidy. Fertil Steril 2006;85: Twisk M, Mastenbroek S, Van Welry M, Heineman MJ, Van der Veen F, Repping S. Preimplantation genetic screening for abnormal number of chromosomes (aneuploidies) in in vitro fertilization or intracytoplasmic sperm injection. The Coachram Library. Issue 2006;1:CD Fertility and Sterility 61

70 In vitro maturation of oocytes collected from unstimulated ovaries for oocyte donation Hananel Holzer, M.D., Eleanor Scharf, M.Sc., Ri-Cheng Chian, Ph.D., Ezgi Demirtas, M.D., William Buckett, M.D., and Seang Lin Tan, M.D., M.B.A. McGill Reproductive Center, Department of Obstetrics and Gynecology, McGill University Health Center, McGill University, Montreal, Quebec, Canada Objective: To assess the role of immature oocyte collection from unstimulated ovaries as a potential source of oocyte donation. Design: Prospective cohort study. Setting: A tertiary, university-based, in vitro fertilization center. Patient(s): Twelve oocyte donors with ultrasound-only polycystic ovaries or polycystic ovary syndrome matched with 12 oocyte recipients. Intervention(s): Immature oocyte collection without any ovarian stimulation. In vitro maturation of the oocytes. Embryo transfer of the embryos. Main Outcome Measure(s): Immature oocyte collection, maturation, fertilization, and cleavage rates. Implantation, pregnancy, and live birth rates. Result(s): A mean of Germinal-vesicle oocytes were aspirated per collection. The in vitro maturation rate was 68.3% 18.4% with a mean of mature oocytes per collection. The mean fertilization rate was 73.3% 19.4%. Two to five embryos (median four) were transferred. Six recipients conceived, giving a 50% clinical pregnancy rate per cycle. The mean implantation rate per embryo was 18.2%. The live birth rate per cycle started was 30%. Conclusion(s): Collecting immature oocytes from unstimulated ovaries for the purpose of oocyte donation is a simple procedure that totally avoids ovarian stimulation. With appropriate selection of women with ultrasoundonly polycystic ovaries or women with the polycystic ovary syndrome, the pregnancy rates of the recipients are comparable with those achieved through conventional IVF oocyte donor cycles. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key words: Oocyte donation, in vitro maturation of oocytes (IVM), polycystic ovaries (PCO), polycystic ovary syndrome (PCOS) Oocyte donation as a treatment for infertility was first reported in 1983 (1). Oocyte donation is associated with a high pregnancy rate for patients with an otherwise poor reproductive prognosis. A high cumulative pregnancy rate of up to 94.8% after four embryo transfers has been previously reported (2). In most oocyte donation programs, ovarian stimulation is given to donors in order for them to produce the optimal number of oocytes. This controlled ovarian stimulation carries the risk of side effects from the medications that are administered, including mood changes, fatigue, muscle aches, hot flushes, and headaches. Most importantly, it is associated with a risk of severe ovarian hyperstimulation syndrome (OHSS), which has been reported to be as high as 10% for those in high-risk groups, such as young women with ultrasound-only polycystic ovaries (PCO) or polycystic ovarian syndrome syndrome (PCOS) (3, 4). Although there have been many strategies developed to predict and prevent Received December 15, 2005; revised and accepted November 16, Reprint requests: Hananel Holzer, M.D., Department of Obstetrics and Gynecology, McGill University, Women s Pavilion, 687 Pine Avenue West, Montreal, H3A 1A1, Quebec, Canada (FAX: ; hananel.holzer@muhc.mcgill.ca). this potentially life-threatening complication, none has been universally successful, and the only reliable way to prevent OHSS totally is to avoid stimulation with FSH altogether (5). While the potential for success would frequently outweigh the concern of many infertile patients who undertake IVF treatment, potential oocyte donors may be deterred by the side effects of medications, especially the risk of OHSS, and by the concern about the alleged unproven association between multiple repeated cycles of ovarian stimulation and the suggested increased incidence of malignant disease, even though to date there is lack of strong evidence that fertility medications increase the risk for having a malignant disease (6). The potential donors may also be deterred by the risks inherent in the oocyte collection procedure itself (7). In fact, results of a recent survey indicate that three-quarters of potential donors changed their mind about donating oocytes after receiving information about the procedures involved (8). However, the risks associated with ovarian stimulation could be totally avoided by collecting immature oocytes from unstimulated ovaries. In vitro maturation (IVM) of oocytes collected from unstimulated ovaries has been performed since Indeed, the first IVM pregnancy reported by Cha et al. (9) resulted 62 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

71 from an oocyte donation. IVM has since been established as a successful treatment for women with infertility, and clinical pregnancy rates of between 30% and 35% per cycle with implantation rates per embryo of between 10% and 15% have been reported (10 14). Although IVM was initially offered to women with PCOS, the indications have expanded to include any woman with an indication for IVF treatment who has an Antral Follicle Count (AFC) of more than 20 antral follicles at the baseline ultrasound scan (10). At the time of writing, almost 1,000 babies have been born (14) and no increased rates of congenital malformations associated with IVM have been reported. The primary reports of obstetric outcome are also reassuring (15 17). Therefore, collecting immature oocytes from unstimulated ovaries appears to be a safe, simple, and effective treatment that can be offered as an alternative to IVF in suitable patients. Because altruistic oocyte donors have no benefit in undertaking treatment except to help others, it is even more important to minimize the risk of side effects and complications in these patients than it is in infertile women who are undergoing IVF to have a desired child. Given the costs and risks of ovarian stimulation on the one hand and the simplicity and success rate of IVM on the other, collecting immature oocytes from unstimulated ovaries could be offered as an attractive option to prospective oocyte donors in an oocyte donation program. We report our preliminary experience of collecting immature oocytes from unstimulated donors ovaries, maturing these oocytes in vitro and transferring the resulting embryos to recipients. MATERIAL AND METHODS Between 1999 and 2004, 12 oocyte donors who were noted to have over 20 antral follicles at the baseline ultrasound scan and who had indicated a preference to avoid the use of gonadotropins for ovarian stimulation were matched against 12 recipients who had been accepted into the oocyte donation program of the McGill Reproductive Center. All donors and recipients underwent a comprehensive initial evaluation, including a psychologic assessment. Information about medical and gynecologic history, family medical background, and risks concerning possible genetically inherited disease was obtained from all donors. Blood tests for human immunodeficiency virus types I and II, hepatitis B surface antigen, hepatitis C antibody, Cytomegalovirus, blood group, and Rhesus factor were performed on all donors, recipients, and recipients partners. All recipients underwent a baseline pelvic ultrasound scan to assess the uterine cavity and to diagnose pelvic lesions. Informed consent was obtained from the donors, the recipients, and the recipients partners. Since the initial institutional review board approval for IVM, the treatment has emerged as standard routine treatment at the McGill reproductive center. Therefore, new institutional review board approval was not applied for. However, both the donors and the recipients were informed of the disadvantages of the IVM treatment compared with IVF: lower pregnancy and implantation rates as well of the advantages of not having ovarian stimulation. All recipients and donors chose to have an IVM treatment and not ovarian stimulation. By law, all donors were altruistic donors and were not paid for the oocyte donation. All donors underwent an unstimulated IVM treatment cycle as previously described (18). Briefly, a baseline ultrasound scan of the ovaries was performed between days 2 and 5 of the menstrual cycle to measure the number and sizes of antral follicles, the endometrial thickness, and to exclude the presence of any ovarian cysts. A second ultrasound scan was performed between days 6 and 8 of the cycle to repeat all of the above measurements. An injection of 10,000 IU of hcg (Profasi; Serono, Oakville, ON, Canada) was administered subcutaneously when the endometrial thickness was 6 mm and there was no follicle over 12 mm. Transvaginal oocyte retrieval was then scheduled 36 hours later. Oocyte retrieval was performed under ultrasound guidance with a 19-G, single-lumen aspiration needle with a reduced aspiration pressure of 7.5 kpa. Germinal-vesicle oocytes underwent IVM described before (18) and were checked for maturity 24 and 48 hours after culture. Mature oocytes were denuded of the granulosa cells and fertilized by intracytoplasmic sperm injection (ICSI) using the recipient s partner s sperm. After ICSI, the oocytes were transferred into 1 ml of IVF medium in a tissue culture dish. Fertilization was assessed 18 hours after ICSI by examining the oocytes for the appearance of two distinct pronuclei and two polar bodies. To prepare the endometrial lining for implantation, the oocyte recipients received 6 12 mg per day of 17B-estradiol (Estrace; Shire Canada Oakville, ON, Canada) in three divided doses during the period that the designated donor was followed before oocyte collection. Before the initiation of estrogen treatment, cycling recipients (eight patients) were down-regulated with a GnRH analog, Buserelin (Superfact; Aventis Pharma Inc., Laval, QC, Canada), in a dose of 500 g per day, injected subcutaneously. From the day of oocyte maturation, luteal support was administered to the recipients using either vaginal suppositories containing micronized progesterone in three divided doses of 600 mg daily (Prometrium; Schering Canada Inc., Pointe-Claire, QC, Canada) (three patients) or 50 mg of progesterone, which was administered intramuscularly daily (Progesteron inj; USP Cytex Pharmaceuticals Inc., Halifax, NS, Canada) (nine patients). Both estrogen and progestogen supplementation were continued until the day of the pregnancy test, and for the pregnant recipients, hormonal supplementation was continued until the 12th week of gestation. Embryo transfer was undertaken on the second or third day after ICSI. Because the oocytes matured over a period of 24 to 48 hours and were therefore not inseminated at the same time following maturation in culture, the developmental stage of the embryos was variable at the time of transfer. Fertility and Sterility 63

72 TABLE 1 Oocyte donors who underwent immature oocyte collection. Number of donors 12 Age Antral follicle count Day of retrieval (median) 11 (7 19) Holzer. IVM oocytes donors. Fertil Steril When three or more embryos were transferred, the risks of multiple gestation were discussed before transfer. A pregnancy test was performed 14 days after embryo transfer and, if positive, an ultrasound scan was scheduled 2 weeks later. Clinical pregnancy was defined as an intrauterine gestation with a fetal heartbeat seen by a transvaginal ultrasound scan. The Shapiro-Wilk Test was used to assess normal distribution of results. Normally distributed data are presented as means standard deviations; data not normally distributed are presented as medians and ranges. RESULTS Twelve oocyte donors underwent 12 oocyte collections in an unstimulated menstrual cycle. The donor s mean age, mean antral follicle count, and the median day of oocyte retrieval are presented in Table 1. The number of immature germinalvesicle oocytes, the collection, maturation, fertilization, and cleavage rates are given in Table 2. The mean age of the recipients was (Table 3). Seven women had suffered premature ovarian failure; in one case, the premature ovarian failure was related to chemotherapy for myeloblastic leukemia, while a second had a bilateral oophorectomy for a borderline ovarian tumor. One patient had a history of poor response to ovarian stimulation, TABLE 2 Immature oocytes collected from donors without ovarian stimulation: retrieval, maturation, fertilization, and cleavage rates. Per cycle Total Follicles punctured GV oocyte collected Collection rate 61.3% 23 Oocytes matured in vitro Maturation rate 68.3% 18.4 Oocytes fertilized Fertilization rate 73.3% 19.4 Cleaved embryos Cleavage rate 81.4% 23.2 Holzer. IVM oocytes donors. Fertil Steril TABLE 3 Oocyte recipients, embryos transferred, and treatment outcome. Number of recipients 12 Age (years) Days of estrogen treatment 11 (7 19) (median) Endometrial thickness before mm embryo transfer Embryos transferred 4 (2 5) Clinical pregnancies 6 (50%) Implantation rate 18.2% First trimester miscarriages 2 (33.3%) Multiple pregnancies 2 (33.3%) Live births (rate per cycle) 4 (33%) Healthy babies born 5 Holzer. IVM oocytes donors. Fertil Steril while another had experienced repeated failures in IVF treatments. The final three women required oocyte donation because they were 47 to 48 years of age. The range of duration of estrogen treatment before oocyte collection and maturation, and the mean endometrial thickness before embryo transfer, are given in Table 3. Two to five embryos (median four) were transferred. Six of the 12 recipients conceived, giving a 50% clinical pregnancy rate per cycle. (Table 3). The mean implantation rate was 18.2%. Of the four patients with a single gestational sac, two miscarried and two delivered. The twin pregnancy resulted in a twin delivery. The patient with the triplet pregnancy was advised to have an embryo reduction of one embryo but chose to have an embryo reduction to a singleton pregnancy, which ended in a successful normal delivery. In summary, there were 4 live births out of the 12 recipients treated, giving a live birth rate of 33% per cycle started (Table 3). DISCUSSION Oocyte donation offers the only treatment option for some infertile couples that may lead to a reasonable chance of success. Unfortunately, in most countries in the world, both patients and fertility specialists are frustrated by a tremendous shortage of oocyte donors. One of the problems in recruiting oocyte donors is that they are generally required to undergo multiple hormonal injections over the course of several weeks, which may produce side effects and are associated with a risk of OHSS. Furthermore, there is the added inconvenience of numerous visits to the IVF center for ultrasound scans and blood tests. In terms of OHSS, the usual incidence of severe OHSS is about 1%. In oocyte donors the rate of severe OHSS has been reported as 1.5%, while the rate of moderate OHSS in 64 Holzer et al. IVM oocytes donors Vol. 88, No. 1, July 2007

73 the same study was 33.5% (19). Moreover, the risk of OHSS is substantially greater if the woman is young and has PCOS or even ultrasound-only PCO; as for them, the risk of OHSS following ovarian stimulation may be as high as 10.5% (3, 4). The donors in this series have polycystic ovaries; thus, they would have been at an increased risk for OHSS once given ovarian stimulation. Many strategies have been advocated or used to reduce the risk of OHSS (20 29). However, none of these strategies eliminates the risk of OHSS entirely. The only reliable way to totally prevent OHSS is to avoid ovarian stimulation with FSH completely. In addition, apart from the risk of severe OHSS, there are a number of other disadvantages associated with gonadotropin stimulation including high drug costs, the need for daily injections, frequent monitoring, and potential side effects, such as abdominal bloating, breast tenderness, mood swings, and nausea. Because oocyte donors have no medical benefit from undergoing fertility treatment and may actually be deterred by the risks, side effects, and burdens associated with treatment, it is incumbent on IVF practitioners to minimize the risks and burdens of therapy for them. In this context, IVM could prove beneficial: avoiding ovarian stimulation for oocyte donors would obviously eliminate the associated risks, significantly reduce the cost of treatment because there is no necessity of purchasing expensive gonadotropins, and simplify treatment for the oocyte donor. In our experience, some oocyte donors who would not consider IVF oocyte donation would be prepared to undertake IVM oocyte donation. Our study demonstrates that collection of immature oocytes from the unstimulated ovaries of donors is a simple procedure: donors had only two or three vaginal ultrasound scans, and no serum estrogen level monitoring was necessary. Around the ninth day of the menstrual cycle, a single injection of hcg was administrated 36 hours before oocyte collection and the donors then underwent immature oocyte collection similar to an IVF collection. Hence, for the immature oocyte donor, treatment is simple, of short duration, and avoids ovarian stimulation and the risks associated with it. For oocyte donors, having the option of a simple, short, and safe treatment is obviously important; however, such a treatment should also result in high success rates. In our study, the mean number of oocytes collected per cycle was of which a mean number of matured. That is a reasonable number of mature oocytes per cycle, even in stimulated cycles. The fertilization rate of 73% is similar to the ICSI fertilization rate reported in IVF cycles and comparable to the fertilization rate recently reported in oocyte donation cycles with ovarian stimulation (30). Regarding the number of embryos transferred and the implantation rate, a median of four embryos were available for transfer. In the IVM oocyte donation cycles we have traditionally transferred more embryos than in IVF oocyte donation cycles with ovarian stimulation, because of the relatively lower implantation rate in IVM cycles (13) compared with IVF. The relatively good implantation rate in our current preliminary report may lead to a reduction in the number of embryos transferred in future to avoid the risks associated with multiple pregnancies. The pregnancy rate in our study was 50%. In a recently published prospective study in oocyte donation cycles, the clinical pregnancy rates were about 40% (30). The pregnancy rates should probably be compared with other countries where oocyte donations are altruistic. In the Canadian Assisted Reproductive Technologies Register final report, the pregnancy and live birth rates for donor oocytes were 43.1% and 31.5%, respectively (Canadian Assisted Reproductive Technologies Register 2003 final report). In the results of the assisted reproductive technologies in Europe 2003 published by ESHRE, the pregnancy rate for fresh oocyte donation cycles was 34.9% (range 18.8% 83.3%) (31). In the United States, the Centers for Disease Control reports a 50.8% live birth rate for donor oocytes (Centers for disease control 2003 reproductive technology success rates, national summary, and fertility clinics reports). However, this could reflect a wider choice of donors because payment is possible. In our oocyte donation program with ovarian stimulation, in the same period of time, the clinical pregnancy rate per cycle started was 52% and the live birth rate was 37%. Fifty percent of the recipients who participated in the present study conceived and the live birth rate was 33%. These results are comparable to those cited above for stimulated oocyte donor cycles. In terms of suitable oocyte donors who may undergo IVM oocyte donation, the antral follicle count, ovarian volume, and ovarian stromal maximal blood velocity have all been reported to be predictive of the number of immature oocytes retrievable in an unstimulated cycle and to correlate well with IVM pregnancy rates. However, when all the factors were controlled by multiple regression analysis, the antral follicle count was noted to be the only significant predictor; thus, in IVM cycles, patients with a higher antral follicle count will have more oocytes collected and will ultimately achieve a higher pregnancy rate (10). Consequently, the candidates most suitable to undertake IVM oocyte donation in an unstimulated cycle would be young women with a high AFC; namely, those with PCO or PCOS. In our donor group, the average AFC was 30 follicles. If stimulated with gonadotropins, these women would have had a relatively high risk of up to 10.5% of developing OHSS (3). With ovarian stimulation, the donors may have had more available embryos, and surplus embryos may have been frozen and transferred later by that increasing the pregnancy rate per collection. This could be considered as a drawback for using IVM for oocyte donation, but recently around 15% of our patients undergoing IVM treatment had surplus embryos available for freezing (MRC, unpublished data). Fertility and Sterility 65

74 Although some concerns may be raised about using oocytes from donors with ultrasound-only PCO or PCOS, it has been shown that in women undergoing IVF, those who have ultrasound-only PCO have favorable outcomes and may actually have higher cumulative pregnancy and live birth rates (32) than with women with normal ovaries. Furthermore, the odds of achieving a pregnancy within three cycles of treatment in a woman with ulatrsound-only PCO have been found to be higher than those of a woman with normal ovaries (32). Therefore, women with ultrasound-only PCO who are considering oocyte donation are suitable candidates for IVM. The results presented here may prove to be beneficial beyond facilitating and expanding oocyte donation programs; they may serve us in better understanding and improving the results of IVM treatments. The higher implantation rate in IVM oocyte recipients when compared with nondonor IVM cycles (18.2% vs.14%) may indicate that the lower implantation rate reported for IVM may be at least partially attributed to difficulties in synchronizing the endometrium. In our study, a favorable mean endometrial thickness of mm was recorded before embryo transfer after estrogen treatment. Therefore, estrogen treatment in patients undergoing nondonor IVM cycles could be considered before immature oocyte collection, if necessary, to increase endometrial thickness and improve endometrial receptivity. Based on our preliminary study, it appears that collecting immature oocytes from unstimulated ovaries for the purpose of oocyte donation is a simple procedure that totally avoids ovarian stimulation and the associated risks and costs. With the proper selection of suitable donors, namely those with a high antral follicle count, pregnancy rates of the recipients are comparable with those achieved with conventional IVF oocyte donor cycles. The implementation of immature oocyte collection from unstimulated ovaries into oocyte donation programs would certainly help to attract more prospective oocyte donors and thus decrease, at least partially, the enormous difficulties encountered by patients awaiting oocyte donation. Further larger scale studies are needed to confirm these encouraging preliminary results and may even assist us in better understanding and improving the outcome of IVM treatment cycles. REFERENCES 1. Trounson A, Leeton J, Besanko M, Wood C, Conti A. Pregnancy established in an infertile patient after transfer of a donated embryo fertilised in vitro. Br Med J (Clin Res Ed) 1983;286: Remohi J, Gartner B, Gallardo E, Yalil S, Simon C, Pellicer A. Pregnancy and birth rates after oocyte donation. Fertil Steril 1997;67: MacDougall MJ, Tan SL, Balen A, Jacobs HS. A controlled study comparing patients with and without polycystic ovaries undergoing in-vitro fertilization. Hum Reprod 1993;8: Brinsden PR, Wada I, Tan SL, Balen A, Jacobs HS. Diagnosis, prevention and management of ovarian hyperstimulation syndrome. Br J Obstet Gynaecol 1995;102: Orvieto R. Can we eliminate severe ovarian hyperstimulation syndrome? Hum Reprod 2005;20: Brinton LA, Moghissi KS, Scoccia B, Westhoff CL, Lamb EJ. Ovulation induction and cancer risk. Fertil Steril 2005;83:261 74;. 7. Bennett SJ, Waterstone JJ, Cheng WC, Parsons J. Complications of transvaginal ultrasound-directed follicle aspiration: a review of 2670 consecutive procedures. J Assist Reprod Genet 1993;10: Murray C, Golombok S. Oocyte and semen donation: a survey of UK licensed centres. Hum Reprod 2000;15: Cha KY, Koo JJ, Ko JJ, Choi DH, Han SY, Yoon TK. Pregnancy after in vitro fertilization of human follicular oocytes collected from nonstimulated cycles, their culture in vitro and their transfer in a donor oocyte program. Fertil Steril 1991;55: Tan SL, Child TJ, Gulekli B. In vitro maturation and fertilization of oocytes from unstimulated ovaries: predicting the number of immature oocytes retrieved by early follicular phase ultrasonography. Am J Obstet Gynecol 2002;186: Chian RC, Gulekli B, Buckett WM, Tan SL. Priming with human chorionic gonadotropin before retrieval of immature oocytes in women with infertility due to the polycystic ovary syndrome. N Engl J Med 1999;341: Chian RC, Buckett WM, Tulandi T, Tan SL. Prospective randomized study of human chorionic gonadotrophin priming before immature oocyte retrieval from unstimulated women with polycystic ovarian syndrome. Hum Reprod 2000;15: Chian RC. In-vitro maturation of immature oocytes for infertile women with PCOS. Reprod Biomed Online 2004;8: Chian RC, Lim JH, Tan SL. State of the art in in-vitro oocyte maturation. Curr Opin Obstet Gynecol 2004;16: Cha KY, Han SY, Chung HM, et al. Pregnancies and deliveries after in vitro maturation culture followed by in vitro fertilization and embryo transfer without stimulation in women with polycystic ovary syndrome. Fertil Steril 2000;73: Buckett WM, Chian RC, Holzer H, Usher R, Tan SL. Congenital abnormalities and perinatal outcome in pregnancies following IVM, IVF, and ICSI delivered in a single center. Fertil Steril 2005; 84(Suppl 1):S Cha KY, Chung HM, Lee DR, et al. Obstetric outcome of patients with polycystic ovary syndrome treated by in vitro maturation and in vitro fertilization-embryo transfer. Fertil Steril 2005;83: Rao GD, Tan SL. In vitro maturation of oocytes. Semin Reprod Med 2005;23: Sauer MV, Paulson RJ, Lobo RA. Rare occurrence of ovarian hyperstimulation syndrome in oocyte donors. Int J Gynaecol Obstet 1996; 52: Marci R, Senn A, Dessole A, et al. A low-dose stimulation protocol using highly purified follicle-stimulating hormone can lead to high pregnancy rates in in vitro fertilization patients with polycystic ovaries who are at risk of high ovarian response to gonadotropins. Fertil Steril 2001;75: Sher G, Zouves C, Feinman M, Maassarani G. Prolonged coasting : an effective method for preventing severe ovarian hyperstimulation syndrome in patients undergoing in-vitro fertilization. Hum Reprod 1995; 10: Isik AZ, Vicdan K. Combined approach as an effective method in the prevention of severe ovarian hyperstimulation syndrome. Eur J Obstet Gynecol Reprod Biol 2001;97: Balasch J, Tur R, Creus M, et al. Triggering of ovulation by a gonadotropin releasing hormone agonist in gonadotropin-stimulated cycles for prevention of ovarian hyperstimulation syndrome andmultiple pregnancy. Gynecol Endocrinol 1994;8: Chen CD, Wu MY, Yang JH, Chen SU, Ho HN, Yang YS. Intravenous albumin does not prevent the development of severe ovarian hyperstimulation syndrome. Fertil Steril 1997;68: Endo T, Kitajima Y, Hayashi T, fujii M, Hata H, Azumaguchi A. Low-molecular-weight dextran infusion is more effective for the treatment of hemoconcentration due to severe ovarian hyperstimulation syndrome than human albumin infusion. Fertil Steril 2004;82: Holzer et al. IVM oocytes donors Vol. 88, No. 1, July 2007

75 26. Shaker AG, Zosmer A, Dean N, Bekir JS, Jacobs HS, Tan SL. Comparison of intravenous albumin and transfer of fresh embryos with cryopreservation of all embryos for subsequent transfer in prevention of ovarian hyperstimulation syndrome. Fertil Steril 1996; 65: Tan SL, Balen A, el Hussein E, Campbell S, Jacobs HS. The administration of glucocrticoids for the prevention of ovarian hyperstimulation syndrome in in vitro fertilization: a prospective randomized study. Fertil Steril 1992;58: Awonuga AO, Dean N, Zaidi J, Pittrof RU, Bekir JS, Tan SL. Outcome of frozen embryo replacement cycles following elective cryopreservation of all embryos in women at risk of developing ovarian hyperstimulation syndrome. J Assist Reprod Genet 1996; 13: Onalan G, Pabuccu R, Goktolga U, Ceyhan T, Bagis T, Cincik M. Metformin treatment in patients with polycystic ovary syndrome undergoing in vitro fertilization: a prospective randomized trial. Fertil Steril 2005;84: Prapas N, Prapas Y, Panagiotidis Y, et al. GnRH agonist versus GnRH antagonist in oocyte donation cycles: a prospective randomized study. Hum Reprod 2005;20: Andersen AN, Gianaroli L, Felberbaum R, de Mouzon J, Nygren KG. Assisted reproductive technology in Europe, Results generated from European registers by ESHRE. Hum Reprod 2006;21: Engmann L, Maconochie N, Sladkevicius P, Bekir J, Campbell S, Tan SL. The outcome of in-vitro fertilization treatment in women with sonographic evidence of polycystic ovarian morphology. Hum Reprod 1999;14: Fertility and Sterility 67

76 The position of transferred air bubbles after embryo transfer is related to pregnancy rate Marieke J. Lambers, M.D., a Erbil Dogan, M.D., b Jan Willem Lens, Ph.D., a Roel Schats, M.D., Ph.D., a and Peter G. A. Hompes, M.D., Ph.D. a a Department of Obstetrics, Gynaecology and Reproductive Medicine, VU University Medical Center, Amsterdam, The Netherlands; and b Department of Obstetrics & Gynaecology, Dokuz Eylul University, Izmir, Turkey Objective: The possibility to visualize the transfer air bubbles is one of the main benefits of ultrasonographicguided embryo transfer. The objective of this study was to analyze the relation between the position of the air bubbles and pregnancy rates. Design: Prospective data-analysis. Setting: University fertility clinic. Patient(s): IVF and intracytoplasmic sperm injection patients. Intervention(s): Transabdominal ultrasonographic guidance at embryo transfer. Main Outcome Measure(s): Pregnancy rate, length endometrial plate, distance catheter to fundus, distance air bubbles to fundus. Result(s): Analysis of 367 consecutive ultrasonographic-guided embryo transfers following IVF or intracytoplasmic sperm injection treatment. Both absolute and relative position of the air bubbles were significantly closer to the fundus in patients who became pregnant compared with patients who did not become pregnant. When the relative position of the air bubbles was in the fundal half of the endometrial plate pregnancy rates were significantly higher compared with the lower half of the endometrial plate, 43.0% and 24.4%, respectively, P.002. Multiple regression analysis revealed the relative position as an independently associated determinant for pregnancy. Conclusion(s): The position of the air bubbles after embryo transfer is related to pregnancy rate; the highest pregnancy rates are found when the air bubbles end up closer to the fundus. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Embryo transfer, air bubble position, pregnancy rate, ultrasonographic guidance, IVF Pregnancy rates following embryo transfer in IVF/intracytoplasmic sperm injection (ICSI) treatment are dependent on multiple factors like embryo quality (1, 2), endometrial receptivity (3), and the technique of the transfer itself (4). The embryo transfer is the final moment in IVF/ICSI that can be influenced by physicians. Therefore, there has been much interest in analyzing and optimizing several aspects of the embryo transfer. One of the main topics in recent studies is the use of transabdominal ultrasonographic guidance during the transfer procedure (5, 6). Although there is no consensus on the effect on pregnancy and implantation rates, there are other important advantages of performing the transfer under ultrasonographic guidance (7). This technique offers the opportunity to visualize the transfer catheter, the air bubbles, the endometrial cavity, and the aspect of the endometrium. Under ultrasonographic guidance the catheter can be positioned very accurately. A number of studies analyzed the relation between catheter position and pregnancy rates and found that the catheter position does influence pregnancy rates (8 10). Received May 31, 2006; revised and accepted November 16, Reprint requests: Marieke J. Lambers, Department of Obstetrics, Gynaecology and Reproductive Medicine, VU University Medical Center, P.O. Box 7057, 1007 MB Amsterdam, the Netherlands ( mj.lambers@ vumc.nl). The transfer catheter is usually loaded using a three drop technique, in which the drop of medium containing the embryo(s) is/are separated from a preceding and a following drop of medium by an air bubble (11). When standing up directly after embryo transfer, 94.1% of the air bubbles show no movement (12). Of all embryos that implant successfully, 81% does so in the area where the air bubbles were initially seen at embryo transfer (13). Therefore, the air bubbles can be regarded as an indication of the position of the embryos (14). Surprisingly enough, there are only a few studies analyzing the relation between the air bubble position and pregnancy rates (15 17). The ones that did are contradictive and do not position the catheter at a standardized distance from the fundus. In our clinic we perform embryo transfer at a standardized depth of the transfer catheter according to the findings of Coroleu et al. (8). In this study we analyzed the relation between pregnancy rates and the position of the air bubbles after positioning the tip of the inner catheter 1.5 to 2 cm from the fundus under ultrasonographic guidance. MATERIALS AND METHODS All consecutive patients undergoing a fresh embryo transfer after IVF or ICSI treatment during the period November 2004 until February 2005 were included in this prospective 68 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

77 study. Patients were only included once; if patients had another transfer within this period the first transfer was included. Patients undergoing embryo transfer after cryopreservation were excluded. Oocyte donation cycles were not included in this study. Stimulation Protocol Stimulation protocols and IVF procedures were performed as previously described by Roseboom (1) and Goverde (18). In summary, patients 38 years of age or with previous good response in an IVF or ICSI treatment underwent controlled ovarian hyperstimulation with a long protocol with GnRH agonist (Decapeptyl [Ferring, Copenhagen, Denmark]) and gonadotropins (Gonal F [Serono, Geneva, Switzerland] or Puregon [Organon, Oss, the Netherlands]). In women 38 years or with a previous poor response a short GnRH-agonist protocol was applied. Ovarian response was monitored by vaginal ultrasonographic and serum estradiol determinations. Human chorionic gonadotrophine (Pregnyl [Organon, Oss, the Netherlands]) IU SC was administered, when there was at least one follicle 18 mm and three or more follicles 16 mm. Ultrasonographic-directed oocyte retrieval was performed 36 hours later. Embryo transfer was generally executed on day 3 after oocyte retrieval. If only two or fewer embryos were available the transfer was performed on day 2 after oocyte retrieval. In consultation between physician and the couple a maximum of two embryos were transferred. Embryo Selection and Embryo Transfer Directly before the transfer procedure, the embryo development and morphology score were determined and the best embryo(s) was/were selected. Each embryo was scored 1 to 4 according to its symmetry and the extent of fragmentation of the blastomeres (11, 19). An optimal quality embryo received a score of 1. Embryo transfer was performed by one of six experienced physicians. Although ongoing pregnancy rates do vary among the individual physicians, these differences are not statistically significant (20). All embryo transfers were performed under ultrasonographic guidance. Ultrasonographic guidance was performed by one physician, who also performed all ultrasonographic measurements. Patients were instructed to come with moderate bladder filling (last lavatory visit hours before embryo transfer). The patient was positioned in the lithotomy position and the cervix was exposed using a bivalve speculum. The mucus in the cervical canal was removed with a cotton swab. The outer catheter of the Cook catheter (K-JETS SIVF/Sydney IVF Embryo Transfer Set, Cook Ireland Ltd, Limerick, Ireland) was positioned under the guidance of abdominal ultrasonography. Then the inner catheter was loaded with the embryo(s) by a three-drop technique (11), in which the drop of medium containing the embryo(s) is separated from a preceding and a following drop of medium by a bubble of air, and is inserted through the outer catheter. Both air bubble and droplet volume do not exceed 10 L. The tip of the inner catheter was placed 1.5 to 2 cm from the fundal myometrium endometrial interface as measured by ultrasonography. Then the embryo(s) was/were slowly released into the uterine cavity, and the distance between fundal myometrium endometrial interface and the transfer air bubbles was measured. The catheter was slowly removed and checked under a stereomicroscope to ensure that there were no retained embryos. During the study we noticed that on abdominal ultrasonography in all patients the upper part of the endometrium was clearly thicker. This was also previously described by Prapas et al. (21). We called this the endometrial plate (Fig. 1A). In all patients the following was measured (Fig. 1A and B): length of endometrial plate (distance A), distance between fundal myometrium endometrial interface and the tip of the inner catheter (distance B), and distance between fundal myometrium endometrial interface and air bubbles (distance C). The distance between the tip of the catheter and the transfer air bubbles (distance D) was calculated by subtracting distance C from distance B (Fig. 1B). The relative position of the air bubbles with regard to the length of the endometrial plate was calculated by dividing the distance between the air bubble and the fundal myometrium endometrial interface by the length of the endometrial plate (CA ratio). The relative position of the air bubbles was calculated in relation to the endometrial plate because this feature can be measured in most patients, whereas it is more difficult to measure the whole length of the uterus by abdominal ultrasonography. Data were completed with information obtained from patient records. The intraobserver variation was monitored using Bland- Altman plots (22). Measurements on 12 patients were carried out three times using blinded procedures. All observed differences fell within the acceptability zone. Outcome A serum pregnancy test was performed days after oocyte retrieval. Pregnancies were monitored by transvaginal ultrasonography at 6, 9, and 12 weeks gestational age. An ongoing pregnancy was defined as an intrauterine pregnancy with fetal cardiac activity 70 days after oocyte retrieval. Statistical Analysis Statistical analysis was performed using SPSS 11.5 software for Windows (SPSS Inc. Chicago, IL). Data were analyzed using an unpaired t test or 2 -analysis and binary logistic Fertility and Sterility 69

78 FIGURE 1 View of the transfer catheter and the air bubble at embryo transfer. (A) Transvaginal ultrasonographic view. (B) Schematic diagram. Lambers. Air bubble position is related to pregnancy rate. Fertil Steril regression analysis with a backward likelihood ratio (the dependent variable was pregnancy). The study was approved by the institutional review board of the of the Department of Obstetrics & Gynaecology of the VU University Medical Center. RESULTS A total of 367 embryo transfers in 367 patients was performed under ultrasonographic guidance. There were 207 transfers after IVF treatment and 160 transfers after ICSI treatment. In 95 transfers one embryo was transferred (single embryo transfer), and in 272 transfers two embryos were transferred (double embryo transfer). Of all transfers 129 (35.1%) resulted in a clinical pregnancy; 114 (31.1%) pregnancies were ongoing. There were few differences between the pregnant and nonpregnant patients (Table 1). The most important statistical significant differences were found in the cause of infertility, the possibility of cryopreservation, distance C, and the CA ratio. There was no difference is the number of difficult transfers (Table 1), nor in the number of transfers with more than one problem at transfer (data not shown). All air bubbles were recorded at the interface of the endometrial plate. The mean distance between the transfer bubble and fundal myometrium endometrial interface (distance C) was smaller in the pregnant group (8.7 mm vs mm, P.014). Following this, the relative position of the transfer bubble to the length of the endometrial plate (the CA ratio) was lower in the pregnant group (0.36 vs. 0.45, P.001). Regression analysis for pregnancy also revealed 70 Lambers et al. Air bubble position is related to pregnancy rate Vol. 88, No. 1, July 2007

79 TABLE 1 Baseline characteristics of the patients. Pregnant (N 129) Not pregnant (N 238) P Age (years) Cycle day 3 FSH (U/L) Duration of infertility (years) Primair infertility (%) First attempt (%) IVF/ICSI cycle number ICSI treatment (%) Cause of infertility (%).033 Tubal factor(%) Male factor (%) Idiopathic (%) Other a (%) Long stimulation schedule (%) 72.1% 58.8%.014 Dosage FSH (per day) Days of stimulation Peak estradiol 7,198 6, Number of follicles Number of oocytes Number of embryos Fertilisation rate (%) Number of cryopreserved embryos Cryopreservation possible (%) Transfer on day 3 (%) No of embryos transferred Problem at transfer (%) Difficult transfers (%) Blood stained catheter (%) Mucus on catheter (%) Retained embryos (%) Endometrial thickness (mm) Distance A (mm) Distance B (mm) Distance C (mm) Distance D (mm) CA ratio Note: ICSI intracytoplasmic sperm injection. a Cause of infertility other : endometriosis, hormonal disorder, cervical hostility, immunologic factors. Lambers. Air bubble position is related to pregnancy rate. Fertil Steril the CA ratio as an independently associated determinant (Table 2). Figure 2 displays the cumulative percentages of pregnant and nonpregnant cases related to the CA ratio, indicating that, on average, the air bubbles have a position closer to the fundal myometrium endometrial interface in cases resulting in pregnancy. Pregnancy rates from cases where the position of the air bubbles was in the fundal half (CA ratio 0.5) or in the lower half of the endometrial plate (CA ratio 0.5) were 43.9% and 24.4%, respectively (P.002). There was one case with retained embryos among the cases with a CA ratio 1. DISCUSSION Our data indicate that the position of the transfer air bubbles after embryo transfer performed at a standardized depth is related to pregnancy rates. For treatment cycles resulting in pregnancy the average position of the air bubbles, both absolute and relative, was closer to the fundal myometrium endometrial interface. This was confirmed by multivariate Fertility and Sterility 71

80 TABLE 2 Regression analysis for pregnancy. OR 95% CI Endometrial thickness Treatment Stimulation protocol No. of embryos Problem at ET Distance B Age Infertility primair/ secundair Day of transfer (day 2/ day3) CA ratio Male factor Tubal factor Idiopathic infertility Embryos for cryopreservation Note: CI confidence interval; OR odds ratio. Lambers. Air bubble position is related to pregnancy rate. Fertil Steril regression analysis for pregnancy, in which the CA ratio, the relative position of the air bubbles, was also revealed as an independently associated determinant. Nowadays, many clinics perform embryo transfer under ultrasonographic guidance. One of the main advantages of the ultrasound-guided embryo transfer is the possibility to document the position of the transfer catheter and the air bubbles (7). Several studies analyzed the influence of the position of the catheter on pregnancy rates: Coroleu et al. (8) showed that catheter placement at 1.5 or 2.0 cm from the fundus was superior to catheter placement at 1.0 cm from the fundus. Pope et al. (10) found that pregnancy rates were higher when the catheter was placed 5 mm from the fundus. For every additional millimeter of placement from the fundus, the odds of clinical pregnancy increased by 11%. The transfed air bubbles are often regarded as an indicator for the position of the embryos: in the transfer catheter the embryos are sandwiched between the air bubbles. This is usually referred to as the double bubble sign (14) or transfer flash (16). Because it was shown that 94.1% of the transfered air bubbles show no movement, even after standing up (12), and that 81% of the embryos that implant successfully do so in the area where they were initially transferred (13), it was surprising that only a few studies analyzed the relation between the location of the air bubbles and pregnancy rates (15 17). In a small retrospective study analyzing 23 pairs of pregnant and nonpregnant cycles, Frankfurter et al. (16) found that the relative position of the embryos (distance of air bubble to fundus relative to the length of the endometrial stripe) was further from the fundus in pregnant cycles. This was followed by a prospective nonrandomized study (17) in which the transfers were directed to a certain part of the uterus. The final position of the embryos cannot be predicted because it depends on multiple factors such as the syringe, the resistance of the plunger, the pressure used to press the plunger, and possible intrauterine resistance, partly because of uterine contractions. The investigators did find better pregnancy rates when the transfer was directed to a lower part of the uterus, but unfortunately, in this study they did not analyze pregnancy rates to the relative position of the air bubbles. The lower pregnancy rates found in the group transfers directed towards the uterine fundus may be a result of more traumatic transfers, resulting in more frequent uterine contractions, negatively affecting pregnancy rates. In a study by Krampl et al. (15) the position of the air bubbles themselves was analyzed and the highest pregnancy rates were found when the air bubbles ended up close to the fundus. But, unfortunately, in this study the influence of the air bubble position on pregnancy rates was not a primary outcome, and was therefore not indicated precisely. Our study is the first to analyze the position of the air bubbles in relation to pregnancy rates after embryo transfer with a standardized depth of the transfer catheter. The depth of the transfer catheter was based on a study by Coroleu et FIGURE 2 Cumulative percentages of pregnant and nonpregnant cycles related to the relative position of the air bubbles (CA ratio). Lambers. Air bubble position is related to pregnancy rate. Fertil Steril Lambers et al. Air bubble position is related to pregnancy rate Vol. 88, No. 1, July 2007

81 al. (8), that proved a positioning of the catheter at 1.5 to 2 cm from the fundus to be optimal. We found that both the absolute and the relative position of the air bubbles was closer to the fundus in pregnant cycles. The difference was found in causes of infertility found between pregnant and nonpregnant patients is in accordance with the findings of Roseboom et al. (1), identifying the cause of infertility as a prognostic factor for probability of pregnancy. An explanation for the relation between embryo position and pregnancy rates may be found in the difference in expression of factors involved in implantation. It is believed that the window of implantation is not only a temporal window but also a spatial window (3, 23): the expression of important factors in implantation such as leptin (24) and MUC-1 (25, 26) differs throughout the endometrium. Therefore, it can be hypothesized that the expression of implantation factors in the fundal endometrium is more optimal for implantation. This is supported by the fact that in early pregnancies gestational sacs are mostly detected in the fundal area (13, 27). The position of the air bubble at embryo transfer was found to be relevant for pregnancy rates, but unfortunately, it is at present not possible to predict and/or control the position of the air bubbles; after positioning of the transfer catheter the final position of the air bubbles is dependent on the syringe, the resistance of the plunger, the pressure used to press the plunger, and patient-related determinants as a possible intrauterine resistance. Therefore, we feel there is need for a more standardized method of embryo transfer that allows the surplus value of exact positioning at embryo transfer to be analyzed. REFERENCES 1. Roseboom TJ, Vermeiden JP, Schoute E, Lens JW, Schats R. The probability of pregnancy after embryo transfer is affected by the age of the patient, cause of infertility, number of embryos transferred and the average morphology score, as revealed by multiple logistic regression analysis. Hum Reprod 1995;10: Strandell A, Bergh C, Lundin K. Selection of patients suitable for one-embryo transfer may reduce the rate of multiple births by half without impairment of overall birth rates. Hum Reprod 2000;15: Hoozemans DA, Schats R, Lambalk CB, Homburg R, Hompes PG. Human embryo implantation: current knowledge and clinical implications in assisted reproductive technology. Reprod Biomed Online 2004; 9: Schoolcraft WB, Surrey ES, Gardner DK. Embryo transfer: techniques and variables affecting success. Fertil Steril 2001;76: Coroleu B, Carreras O, Veiga A, Martell A, Martinez F, Belil I, et al. Embryo transfer under ultrasound guidance improves pregnancy rates after in-vitro fertilization. Hum Reprod 2000;15: Matorras R, Urquijo E, Mendoza R, Corcostegui B, Exposito A, Rodriguez-Escudero FJ. Ultrasound-guided embryo transfer improves pregnancy rates and increases the frequency of easy transfers. Hum Reprod 2002;17: Strickler RC, Christianson C, Crane JP, Curato A, Knight AB, Yang V. Ultrasound guidance for human embryo transfer. Fertil Steril 1985;43: Coroleu B, Barri PN, Carreras O, Martinez F, Parriego M, Hereter L, et al. The influence of the depth of embryo replacement into the uterine cavity on implantation rates after IVF: a controlled, ultrasound-guided study. Hum Reprod 2002;17: Franco JG Jr, Martins AM, Baruffi RL, Mauri AL, Petersen CG, Felipe V, et al. Best site for embryo transfer: the upper or lower half of endometrial cavity? Hum Reprod 2004;19: Pope CS, Cook EK, Arny M, Novak A, Grow DR. Influence of embryo transfer depth on in vitro fertilization and embryo transfer outcomes. Fertil Steril 2004;81: van Weering HG, Schats R, McDonnell J, Vink JM, Vermeiden JP, Hompes PG. The impact of the embryo transfer catheter on the pregnancy rate in IVF. Hum Reprod 2002;17: Woolcott R, Stanger J. Ultrasound tracking of the movement of embryo-associated air bubbles on standing after transfer. Hum Reprod 1998;13: Baba K, Ishihara O, Hayashi N, Saitoh M, Taya J, Kinoshita K. Where does the embryo implant after embryo transfer in humans? Fertil Steril 2000;73: Aichberger L, Boldizsar A, Herczeg C, Obermair A, Plockinger B, Strohmer H, et al. [Vaginal ultrasonographic observation of uterine contractions in embryo transfer and its relevance to treatment success]. Geburtshilfe Frauenheilkd 1991;51: Krampl E, Zegermacher G, Eichler C, Obruca A, Strohmer H, Feichtinger W. Air in the uterine cavity after embryo transfer. Fertil Steril 1995;63: Frankfurter D, Silva CP, Mota F, Trimarchi JB, Keefe DL. The transfer point is a novel measure of embryo placement. Fertil Steril 2003;79: Frankfurter D, Trimarchi JB, Silva CP, Keefe DL. Middle to lower uterine segment embryo transfer improves implantation and pregnancy rates compared with fundal embryo transfer. Fertil Steril 2004;81: Goverde AJ, McDonnell J, Vermeiden JP, Schats R, Rutten FF, Schoemaker J. Intrauterine insemination or in-vitro fertilisation in idiopathic subfertility and male subfertility: a randomised trial and cost-effectiveness analysis. Lancet 2000;355: Rijnders PM, Lens JW. The embryo. In: Bras M, Lens JW, Rijnders PM, Verveld M, Zeilmaker GH, IVF laboratory: aspects of in vitro fertilization. Etten Leur: Organon BV Nederland, van Weering HG, Schats R, McDonnell J, Hompes PG. Ongoing pregnancy rates in in vitro fertilization are not dependent on the physician performing the embryo transfer. Fertil Steril 2005;83: Prapas Y, Prapas N, Hatziparasidou A, Vanderzwalmen P, Nijs M, Prapa S, et al. Ultrasound-guided embryo transfer maximizes the IVF results on day 3 and day 4 embryo transfer but has no impact on day 5. Hum Reprod 2001;16: Bland JM, Altman DG. Statistical methods for assessing agreement between two methods of clinical measurement. Lancet 1986;1: Giudice LC. Potential biochemical markers of uterine receptivity. Hum Reprod 1999;14(Suppl 2): Yoon SJ, Cha KY, Lee KA. Leptin receptors are down-regulated in uterine implantation sites compared to interimplantation sites. Mol Cell Endocrinol 2005;232: Meseguer M, Aplin JD, Caballero-Campo P, O Connor JE, Martin JC, Remohi J, et al. Human endometrial mucin MUC1 is up-regulated by progesterone and down-regulated in vitro by the human blastocyst. Biol Reprod 2001;64: DeLoia JA, Krasnow JS, Brekosky J, Babaknia A, Julian J, Carson DD. Regional specialization of the cell membrane-associated, polymorphic mucin (MUC1) in human uterine epithelia. Hum Reprod 1998;13: Minami S, Ishihara K, Araki T. Determination of blastocyst implantation site in spontaneous pregnancies using three-dimensional transvaginal ultrasound. J Nippon Med Sch 2003;70: Fertility and Sterility 73

82 Changes in measured endometrial thickness predict in vitro fertilization success Grant D. E. McWilliams, D.O., a and John L. Frattarelli, M.D. b a Tripler Army Medical Center, Honolulu, Hawaii; and b Reproductive Medicine Associates of New Jersey, Somerset, New Jersey Objective: To assess the predictive ability of endometrial thickness and changes in endometrial thickness on pregnancy outcomes in patients undergoing IVF. Design: Retrospective cohort analysis. Setting: Academic IVF center. Patient(s): Infertile patients undergoing 132 fresh autologous IVF cycles. Intervention(s): Transvaginal ultrasound to assess endometrial thickness at three defined points during IVF (after pituitary suppression, on the sixth day of gonadotropin stimulation, and on the day of hcg administration). Main Outcome Measure(s): Primary outcome variables included endometrial lining thickness at baseline, on day 6 of gonadotropins, the day of hcg administration, and the change in endometrial thickness during gonadotropin stimulation. Result(s): Patients attaining pregnancy had significantly greater endometrial thickness on day 6 and endometrial thickness on day of hcg administration. Pregnant patients had a greater change in endometrial thickness from the baseline to day 6 when compared to nonpregnant patients. Threshold analysis and receiver operator characteristic curves noted significant endometrial thickness levels for implantation and pregnancy rates. Conclusion(s): Endometrial responsiveness and thickness during the early IVF stimulation seem to be better prognostic predictors of success than endometrial thickness at the start or the end of the IVF cycle. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Infertility, endometrial thickness, endometrial growth, transvaginal ultrasound, pregnancy outcome, IVF, endometrium, implantation Many factors contribute to obtaining a successful pregnancy. Understanding these factors can help in counseling patients regarding their chances of success and in offering interventions for improvement. Factors of both embryologic development and endometrial differentiation have been evaluated (1 15). With respect to endometrial differentiation, the possible predictors of pregnancy that have been evaluated are endometrial blood flow, endometrial pattern, and endometrial thickness (3 15). Endometrial thickness has been evaluated as a possible predictor of pregnancy in multiple studies with conflicting results (6, 11 16). Some studies have shown no differences in pregnancy rates with respect to endometrial thickness (6, 12). Rinaldi et al. (13) noted decreased pregnancy success with thin endometrial linings ( 10 mm) on the day of hcg administration (13). Others have found contrasting data in evaluating thicker endometrial linings on the day of hcg administration (12, 15). Received April 9, 2006; revised and accepted November 17, This study was supported by the Department of Clinical Investigation at Tripler Army Medical Center, Honolulu, HI. The views expressed in this manuscript are those of the investigators, and do not reflect the official policy or position of the Department of the Army, Department of Defense, or the U. S. Government. Reprint requests: John L. Frattarelli, M.D, Reproductive Medicine Associates of New Jersey, 100 Franklin Square Drive, Suite 200, Somerset NJ (FAX: , jfrattarelli@rmanj.com). Few studies have evaluated the change in endometrial thickness occurring during IVF stimulation (8, 11, 16). Based on the lack of available literature, this study was designed to assess the change in endometrial thickness throughout the IVF stimulation in patients undergoing IVF. MATERIALS AND METHODS Population This is a retrospective cohort analysis of 132 couples undergoing 132 fresh autologous IVF cycles at the Tripler Army Medical Center In Vitro Fertilization Institute. Institutional review board approval was obtained from the Tripler Army Medical Center institutional review board, Honolulu, HI. All infertile women undergoing IVF were eligible to participate in the study. Inclusion criteria included: normal basal FSH concentration per our laboratory ( 12 miu/ml), documented measurement of endometrial thickness at cycle baseline, on day 6 of gonadotropin stimulation, and on the day of human menopausal gonadotropin (hcg) administration. Patients were included independent of their diagnoses or reproductive history. Diminished ovarian reserve was defined as women having an FSH 10 miu/ml, basal antral follicle count of 4, or age 40 years. Exclusion criteria included: patients who did not have the transvaginal ultrasound on the specified dates, patients Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

83 years, and patients without documented endometrial lining thickness. All endometrial measurements were performed by the author (JLF) using an ATL Ultramark HDI 3000 (Philips Medical Systems, Bothell, WA) with a 7-MHz vaginal transducer. The full thickness of the endometrial stripe was measured from the outer margin to the outer margin of the stripe. The stripe measurement was obtained approximately 1 cm from the fundus of the uterus. Experimental Design All patients started oral contraceptive pills (OCs) (30 g ethinyl estradiol, 0.15 mg norgestrel) the evening of menstrual day 3. The patients continued the OCs for 21 days before pituitary suppression with GnRH-a (500 g) (Luprolide acetate, Lupron; TAP Pharmaceuticals, North Chicago, IL). There was a 7-day overlap of the GnRH-a with the OCs. After 14 days of GnRH-a, the dose was decreased to 250 g, and stimulation with exogenous gonadotropins was initiated 5 days later. Baseline endometrial stripe measurement was determined on the day the patient decreased the GnRH-a dose to 250 g. When the largest cohort of follicles reached the 16 mm to 18 mm range, a single 10,000 IU intramuscular dose of hcg was administered. Transvaginal follicular aspiration was performed approximately 35 hours after hcg administration. Using a Wallace transfer catheter (Cooper Surgical, Shelton, CT), embryos were transferred under transabdominal ultrasound guidance 72 to 120 hours after follicular aspiration. Outcome Measures Primary outcome measures [1] were endometrial lining thickness on the baseline day after pituitary suppression with GnRH-a and 5 days before gonadotropin initiation (EMT Baseline ), [2] on day 6 of gonadotropin stimulation (EMT Day 6 ), [3] on the day of hcg administration (EMT hcg ), [4] the change in endometrial thickness from the EMT Baseline to EMT Day 6 ( EMT Day 6 Baseline ), [5] the change in endometrial thickness from the EMT Day 6 to EMT hcg ( EMT hcg - Day 6 ), and [6] the change in endometrial thickness from the EMT Baseline to EMT hcg ( EMT hcg - Baseline ). Secondary outcome measures were age, body mass index, IVF stimulation parameters (day 3 FSH, day 3 LH, day 3 estradiol, total ovarian volume, total antral follicle count, baseline estradiol, stimulation day 6 estradiol, day of hcg estradiol, total oocytes retrieved, total embryos obtained, ampules of gonadotropins used, and days of stimulation), and pregnancy outcomes (implantation rate, initial pregnancy rate, spontaneous pregnancy loss rate, and live birth rate). Pregnancies and the accompanying rates were defined as follows. Initial pregnancy was documented by a rising serum hcg concentration on luteal days 14 and 16. Spontaneous pregnancy loss was defined as a pregnancy loss following sonographic visualization of an intrauterine gestational sac at 5 to 6 weeks of gestation. Live birth rate was defined as those pregnancies proceeding to deliver a live infant. Implantation rate was calculated by dividing the number of gestational sacs visualized on transvaginal ultrasound by the number of embryos transferred. Statistical Analysis Statistical analysis was performed using SPSS 12.0 (SPSS Inc., Chicago, IL). For normally distributed data, a t test was used to compare the means between two groups, and a one-way analysis of variance was used to compare the means between multiple groups. For data not normally distributed, a Mann- Whitney rank sum test was used to compare means between two groups and a Kruskal-Wallis one-way analysis of variance on ranks was used to compare the means of multiple groups. A Tukey test was used for pairwise multiple comparisons. Patients were grouped by EMT Baseline, EMT Day 6, and EMT hcg at increments of 1 mm from 2 mmto 10 mm. Patients were then grouped by EMT Day 6 Baseline, EMT hcg - Baseline, and EMT hcg - Day 6 at increments of 1 mm from 4 mmto 10 mm. Implantation rates, pregnancy rates, pregnancy loss rates, and live birth rates were calculated for each increment. The rates above and below each threshold were evaluated to determine if there were any obvious break points at which there was a significant change in these rates. Contingency table analysis and receiver operator characteristic (ROC) curves were then used to evaluate the outcome rates above and below the selected threshold value. Differences in outcome rates were analyzed using a chi-square or two-tailed Fisher exact test where appropriate. Univariate analysis included regression and correlation coefficients examining the association of endometrial lining measurements and changes with parameters of ovarian reserve and response. An alpha error of 0.05 was considered significant for all comparisons. Relative risk and 95% confidence intervals are displayed where appropriate. All data were reported as means with their associated standard deviations. RESULTS A total of 132 IVF cycles were analyzed. The patient demographics, prestimulation, and stimulation parameters are depicted in Table 1. When subdividing the patients into those who conceived (n 70) and those who did not conceive (n 62), there were expected significant differences between these two groups with regard to age, total number of antral follicles, peak estradiol level on day of hcg administration, number of oocytes obtained, and total number of embryos. EMT measurements from the subgroup of pregnant patients were compared to the nonpregnant patients (Table 2). The pregnant patients had significantly thicker endometrial linings on EMT Day 6,onEMT hcg, and a greater change with EMT Day 6 Baseline. The overall change in endometrial Fertility and Sterility 75

84 TABLE 1 Population demographics, prestimulation, and stimulation parameters for the IVF study group, which was further subdivided into patients who conceived and patients who did not conceive. Variables All patients N 132 Pregnant N 70 Not pregnant N 62 a P value Age (years) b BMI (kg/m 2 ) b Day 3 FSH (miu/ml) c Day 3 LH (miu/ml) b Day 3 estradiol (pg/ml) b Total ovarian volume (cm 3 ) c Total antral follicles b Baseline estradiol (pg/ml) b Day 6 estradiol (pg/ml) b Day of hcg estradiol (pg/ml) b Number of oocytes retrieved b Number of embryos b Ampules of gonadotropins used b Days of stimulation b Note: Values represent means and the associated standard deviation. BMI body mass index. a Comparing pregnant patients with those not pregnant, P.05 is considered statistically significant. b Normality test failed. Mann-Whitney Rank Sum Test was used to determine significance. c Normality test passed. t Test was used to determine significance. McWilliams. Endometrial thickness and IVF success. Fertil Steril thickness, EMT hcg Baseline, trended toward significance (P.05). Our patients had the following primary etiologies for their infertility: male factor (28%), anovulation (23%), tubal factor (19%), unknown (14%), diminished ovarian reserve (10%), and endometriosis (6%). Etiologies of infertility were compared to the endometrial stripe measurements in Table 3. Patients with the diagnosis of diminished ovarian reserve had the thinnest endometrium on EMT Day 6 and on EMT hcg, as well as the least amount of overall change from EMT hcg Baseline. Patients with the diagnosis of either endometriosis or male factor had the thickest endometrium on EMT hcg. Patients with the diagnosis of male factor had the greatest change from EMT hcg Baseline. TABLE 2 Pregnant patients compared to nonpregnant patients with respect to their endometrial thickness and the change in the endometrial thickness during the IVF cycle. Measurements Pregnant (n 70) Not Pregnant (n 62) a P value EMT Baseline (mm) b EMT Day 6 (mm) c EMT hcg (mm) b EMT Day 6 Baseline (mm) c EMT hcg Day 6 (mm) c EMT hcg Baseline (mm) c Note: Values represent means and the associated standard deviation. a P.05 is considered statistically significant. The pregnant patients were compared with those who were not pregnant. b Normality test failed. Mann-Whitney rank sum test was used to determine significance. c Normality test passed. t Test was used to determine significance. McWilliams. Endometrial thickness and IVF success. Fertil Steril McWilliams and Frattarelli Endometrial thickness and IVF success Vol. 88, No. 1, July 2007

85 TABLE 3 Etiologies for infertility compared to endometrial thickness (EMT) and change in endometrial thickness ( EMT). Anovulation DOR Endometriosis Male factor Tubal factor Unexplained a P value EMT Baseline (mm) b EMT Day 6 (mm) d e d d d d.05 c EMT hcg (mm) d e f f d d.001 c EMT Day 6 Baseline b (mm) EMT hcg Day c (mm) EMT hcg Baseline (mm) d e d f d d.05 c Note: DOR diminished ovarian reserve. a P.05 is considered statistically significant. b Normality test failed. Kruskal-Wallis one-way analysis of variance on ranks was used to determine significance. c Normality test passed. One-way analysis of variance was used to determine significance. d,e,f Values with different superscripts are statistically different based on pair-wise multiple comparison with a Tukey test. McWilliams. Endometrial thickness and IVF success. Fertil Steril Univariate analyses were completed comparing endometrial thickness to the demographics, prestimulation, and stimulation parameters were performed. As expected, EMT and EMT measurements significantly correlated with each other. The EMT Baseline significantly correlated with the patient s level of estradiol on day 3 (r 0.38, P.001). The EMT Day 6 significantly correlated with most of the parameters including age (r 0.26, P.05), the level of FSH on day3(r 0.22, P.05), the total ovarian volume (r 0.27, P.05), the total number of antrals (r 0.30, P.05), the level of estradiol at baseline (r 0.19, P.05), the level of estradiol on day 6 of gonadotropin stimulation (r 0.45, P.001), the level of estradiol on day of hcg administration (r 0.45, P.001), the number of oocytes (r 0.34, P.001), the number of embryos (r 0.27, P.05), the number of ampules of gonadotropins used (r 0.19, P.05), and the number of days of stimulation (r 0.27, P.01). The EMT hcg significantly correlated with age (r 0.26, P.05), the level of estradiol on day of hcg administration (r 0.28, P.001), and the number of oocytes (r 0.26, P.05). Univariate analyses were completed comparing the change in endometrial thickness to the demographics; prestimulation and stimulation parameters were also performed. The EMT Day 6 Baseline significantly correlated with age (r 0.27, P.05), the total ovarian volume (r.30, P.05), the total number of antral follicles (r.35, P.001), the level of estradiol on day 6 of gonadotropin stimulation (r 0.40, P.001), the level of estradiol on day of hcg administration (r 0.37, P.001), the number of oocytes (r 0.32, P.001), the number of embryos (r 0.23, P.05), the number of ampules of gonadotropins used (r 0.22, P.05), and the number of days of stimulation (r 0.29, P.05). The EMT hcg - Day 6 significantly correlated with the level of FSH on day 3 (r 0.23, P.05), the total ovarian volume (r 0.21, P.05), the total number of antral follicles (r 0.28, P.05), the level of estradiol on day 6 of gonadotropin stimulation (r 0.34, P.001), the level of estradiol on day of hcg administration (r 0.27, P.05), and the number of embryos (r 0.20, P.05). The EMT hcg Baseline significantly correlated with age (r 0.20, P.05), the level of estradiol on day of hcg administration (r 0.19, P.05), and the number of oocytes (r 0.23, P.05). Threshold levels for EMT Baseline, EMT Day 6 and EMT hcg as well as the changes in thickness ( EMT Day 6 Baseline, EMT hcg Baseline, EMT hcg - Day 6 ) during the course of an IVF cycle were evaluated using contingency table analysis and ROC curves (Figs. 1 and 2). Table 4 shows the area under the ROC curves with 95% confidence intervals for implantation and pregnancy rates. An EMT Baseline of 3 mm was found to have a significantly higher implantation rate (35.4%) than an EMT Baseline of 3 mm (23.9%) (P.05, RR 1.48 [1.03, 2.12]). No significant threshold level was found for pregnancy rate or pregnancy loss rate. An EMT Day 6 of 6 mm was found to have a significantly lower implantation rate (17.1% vs. 33.3%) (P.001, RR 0.51 [0.34, 0.77]) and pregnancy rate (38.0% vs. 64.5%) (P.01, RR 0.59 [0.40, 0.87]) compared to an EMT Day 6 of 6 mm. No significant threshold level was found for pregnancy loss rate. An EMT hcg of 7 mm was found to have a significantly lower implantation rate (11.9% vs. 28.6%) (P.01, RR Fertility and Sterility 77

86 FIGURE 1 Receiver operator characteristic curves for implantation rates of patients undergoing IVF based on the endometrial lining thickness (EMT) and the change in EMT ( EMT) during the stimulation cycle. Endometrial measurements were taken at baseline before gonadotropin stimulation (EMT Baseline ), on day 6 of gonadotropin stimulation (EMT Day 6 ), and on the day of hcg administration (EMT hcg ). Calculations were also made based on the change in endometrial thickness from the EMT Baseline to EMT Day 6 ( EMT Day 6 Baseline ), the change in endometrial thickness from the EMT Day 6 to EMT hcg ( EMT hcg Day 6 ), and the change in endometrial thickness from the EMT Baseline to EMT hcg ( EMT hcg Baseline ). The most significant measurements as determined by the area under the curve were the EMT Day 6 and the EMT Day 6 Baseline. McWilliams. Endometrial thickness and IVF success. Fertil Steril [0.20, 0.85]) compared to an EMT hcg of 7 mm. An EMT hcg of 8 mm was found to have a significantly lower pregnancy rate (34.1% vs. 60.7%) (P.01, RR 0.56 [0.36, 0.89]) compared to an EMT hcg of 8 mm. Of note, only 1 of 24 (4.2%) transferred embryos implanted and only 1 of 8 (12.5%) patients got pregnant with an EMT hcg of 6 mm. No significant threshold level was found for pregnancy loss rate. A EMT Day 6 Baseline 3 mm was found to have a significantly lower implantation rate (22.4% vs. 35.7%) (P.01, RR 0.63 [0.44, 0.88]) compared to a EMT Day 6 Baseline of 3 mm. A EMT Day 6 Baseline of 2 mm was found to have a significantly lower pregnancy rate (42.0% vs. 62.7%) (P.05, RR 0.67 [0.46, 0.97]) compared to a EMT Day 6 Baseline of 2 mm. No significant threshold level was found for pregnancy loss rate. A EMT hcg Day 6 of 0 mm was found to have a significantly higher implantation rate (43.2% vs. 24.8%) (P.05, RR 1.75 [1.15, 2.65]) and pregnancy rate (70.4% vs. 48.5%) (P.05, RR 1.45 [1.06, 2.00]) compared to a EMT hcg Day 6 of 0 mm. No significant threshold level was found for pregnancy loss rate. A EMT hcg Baseline of 3 mm was found to have a significantly lower implantation rate (13.3% vs. 29.7%) (P.01, RR 0.45 [0.25, 0.82]) and pregnancy rate (24.0% vs. 59.4%) (P.01, RR 0.40 [0.20, 0.83]) compared to a EMT hcg Baseline of 3 mm. No significant threshold level was found for pregnancy loss rate. DISCUSSION Previous literature has noted conflicting results regarding the prognostic ability of endometrial thickness on the day of hcg administration (6, 11 16). In reviewing our data, correlations were seen from which general principles can be derived. The endometrial thickness on day 6 of stimulation, EMT Day 6, and the change in the initial endometrial thickness from the baseline appointment to day 6 of stimulation, EMT Day 6 Baseline, seemed to have the most significant association with IVF stimulation and pregnancy outcomes. 78 McWilliams and Frattarelli Endometrial thickness and IVF success Vol. 88, No. 1, July 2007

87 FIGURE 2 Receiver operator characteristic curves for pregnancy rates of patients undergoing IVF based on the endometrial lining thickness (EMT) and the change in EMT ( EMT) during the stimulation cycle. Endometrial measurements were taken at baseline before gonadotropin stimulation (EMT Baseline ), on day 6 of gonadotropin stimulation (EMT Day 6 ), and on the day of hcg administration (EMT hcg ). Calculations were also made based on the change in endometrial thickness from the EMT Baseline to EMT Day 6 ( EMT Day 6 Baseline ), the change in endometrial thickness from the EMT Day 6 to EMT hcg ( EMT hcg - Day 6 ), and the change in endometrial thickness from the EMT Baseline to EMT hcg ( EMT hcg - Baseline ). The most significant measurements as determined by the area under the curve were the EMT Day 6 and the EMT Day 6 Baseline. McWilliams. Endometrial thickness and IVF success. Fertil Steril This significance was confirmed using contingency table analysis and ROC curves. Using contingency tables and ROC curves, we have shown that implantation rates were higher if the EMT was 3 mm for EMT Baseline, 6 mm for EMT Day 6, 7 mm for EMT hcg, 3 mmfor EMT Day 6 Baseline, 0 mmfor EMT hcg Day 6, and 3 mm for EMT hcg Baseline. Likewise, pregnancy rates were higher if the following EMT values were noted: 6 mm for EMT Day 6, 8 mmfor EMT hcg, 2 mm for EMT Day 6 Baseline, 0 mm for EMT hcg Day 6, and 3 mmfor EMT hcg Baseline. Based on these data, if the EMT is less than the threshold, or if the endometrial thickness decreases during the stimulation cycle, the implantation and pregnancy rates decrease dramatically. An EMT hcg of 7 mm was found to have a significantly lower implantation rate (11.9% vs. 28.6%) (P.01, RR 0.42 [0.20, 0.85]) compared to an EMT hcg of 7 mm. An EMT hcg of 8 mm was found to have a significantly lower pregnancy rate (34.1% vs. 60.7%) (P.01, RR 0.56 [0.36, 0.89]) compared to an EMT hcg of 8 mm. Of note, only 1 of 24 (4.2%) transferred embryos implanted and only 1 of 8 (12.5%) patients got pregnant with an EMT hcg of 6 mm. The clinical significance concerning endometrial thickness 6 mmon day 6 or 8 mm on day hcg is unknown. The exact pathophysiology for endometrial receptivity is still unknown. In a previous manuscript, we showed that using Fertility and Sterility 79

88 TABLE 4 Area under the curve and 95% confidence intervals for implantation and pregnancy rates. Implantation rate Pregnancy rate EMT Baseline 0.37 (0.20, 0.53) 0.53 (0.43, 0.61) EMT Day (0.47, 0.72) 0.67 (0.58, 0.77) EMT hcg 0.48 (0.31, 0.65) 0.63 (0.54, 0.73) EMT Day 6 Baseline 0.65 (0.51, 0.78) 0.64 (0.54, 0.74) EMT hcg Day (0.40, 0.72) 0.60 (0.50, 0.71) EMT hcg Baseline 0.41 (0.24, 0.57) 0.46 (0.36, 0.56) McWilliams. Endometrial thickness and IVF success. Fertil Steril adjuvant therapy in patients with thin endometrial linings did not improve outcomes (17). The endometrial thickness on the day of hcg administration, EMT hcg, is often used to document adequate endometrial development. The pregnancy rate threshold for EMT hcg calculated in this study was 8 mm; this is consistent with the findings of Basir et al. (4), who developed an ROC curve looking for a threshold on day of hcg. Both Basir et al. (4) and our study agree that IVF patients with a EMT hcg 8 mm have a statistically significant increased pregnancy rate (4). EMT hcg correlated with the estradiol concentration on the day of hcg, the number of oocytes, and was inversely correlated with age. Based on ROC curves, EMT hcg was less predictive than EMT Day 6 and EMT Day 6 Baseline.In contrast to our design, other studies that have evaluated EMT hcg measurements have used arbitrary threshold values (5, 10, 12, 13, 15). Another difference between our study and other studies includes the timing of the EMT evaluation. Studies have evaluated the endometrial lining on the day before hcg administration (6, 8, 11), the day of hcg administration (4 6, 9, 11 13, 15), the day after hcg administration (8, 10), the day of oocyte retrieval (9, 11, 16), and the day of embryo transfer (7, 11, 14). We could find only two studies, which produced conflicting results, that evaluated the change in endometrial thickness occurring at different points in the IVF cycle (8, 11). Bassil et al. (8) prospectively evaluated the change in endometrial growth from day 10 to day after hcg administration and found that a statistically significant increase in endometrial thickness correlated with a patient s ability to conceive. Noyes et al. (11) found no correlation between pregnancy rates and the endometrial thickness at any time during ovarian stimulation; however, their data showed that the largest change occurred in the first seven days of stimulation. In our study, day 6 was used as our first evaluation of EMT after initiation of exogenous gonadotropins. There was no significant difference in baseline endometrial thickness between those who became pregnant and those who did not become pregnant. There was a significant threshold value of 3 mm for implantation rate, but none for pregnancy rate. This finding is important because the initial thickness of the endometrium may not be as important as endometrial responsiveness early in the stimulation process, as evidenced by the significance values for the EMT Day 6 and EMT Day 6 Baseline. Early endometrial evaluation during gonadotropin stimulation seems to be significant in that it shows which patients have responsive endometrium. Data from Basir et al. (4) support the theory that there is a difference in pregnancy rates with respect to how receptive the endometrial lining is towards stimulation. With the statistically significant and clinically significant findings for the EMT Day 6 and EMT Day 6 Baseline values, our data confirm that the early responsiveness of the endometrium is critical for improved pregnancy success. Both EMT Day 6 and EMT Day 6 Baseline were found to correlate with pregnancy outcomes as well as the IVF prestimulation and stimulation parameters of age, ovarian volume, antral follicles, estradiol levels, oocytes, number of embryos, ampules of gonadotropins used, and number of days of stimulation. Etiologies of infertility were not compared against one another with respect to pregnancy outcomes; however, diminished ovarian reserve showed significantly decreased thickness on EMT Day 6, EMT hcg, and with EMT hcg Baseline, as opposed to anovulation, endometriosis, male factor, tubal factor, or unexplained infertility. It is noteworthy that on EMT Day 6, EMT hcg, and EMT hcg Baseline there was also a statistical difference between those patients pregnant and those not pregnant. This difference between diminished ovarian reserve and other infertility etiologies supports previous findings where patients with diminished ovarian reserve have low probability of conception and decreased fecundity (18). Possible weaknesses of this study include its retrospective nature. However, the data were derived from a prospective database. Therefore, there was no chart review and no patients were lost to follow-up. This decreases the possibility of selection and information biases. The use of contingency table analysis and ROC curves to create significant threshold values so as not to use arbitrary cutoff points was a major strength of the study. Likewise, all stimulation cycles, ultrasounds, oocyte retrievals, and embryo transfers were performed by the author (JLF). 80 McWilliams and Frattarelli Endometrial thickness and IVF success Vol. 88, No. 1, July 2007

89 In summary, continued use of transvaginal ultrasound to evaluate endometrial thickness and the change occurring during ovarian stimulation can aid providers in counseling patients and predicting IVF success. Increased endometrial responsiveness seen on day 6 of gonadotropin stimulation compared to the baseline EMT is important to IVF success. An increase in endometrial response seems to prognosticate better IVF success. Endometrial receptivity is still difficult to prognosticate. It is unclear if the improved IVF success is because of a more responsive or sensitive endometrial lining or if the responsiveness of the endometrial lining is only a marker of better gonadotropin stimulation of the ovary with downstream effects on the endometrium. EMT during the early part of the IVF cycle seems to be a more important prognostic variable than does EMT at the start or end of the IVF cycle. Measuring the EMT earlier or looking at the initial change in endometrial thickness may be an important factor in stratifying those patients with an optimal response from those with a suboptimal response. REFERENCES 1. Erenus M, Zouves C, Rajamahendran P, Leung S, Fluker M, Gomel V. The effect of embryo quality on subsequent pregnancy rates after in vitro fertilization. Fertil Steril 1991;56: Wittemer C, Bettahar-Lebugle K, Ohl J, Rongieres C, Nisand I, Gerlinger P. Zygote evaluation: an efficient tool for embryo selection. Hum Reprod 2000;15: Yuval Y, Lipitiz S, Dor J, Achiron R. The relationships between endometrial thickness, and blood flow and pregnancy rates in in-vitro fertilization. Hum Reprod 1999;14: Basir GS, O WS, So WW, Ng EH, Ho PC. Evaluation of cycle-to-cycle variation of endometrial responsiveness using transvaginal sonography in women undergoing assisted reproduction. Ultrasound Obstet Gynecol 2002;19: Dickey RP, Olar TT, Curole DN, Taylor SN, Rye PH. Endometrial pattern and thickness associated with pregnancy outcome after assisted reproduction technologies. Hum Reprod 1992;7: De Geyter C, Schmitter M, De Geyter M, Nieschlag E, Holzgreve W, Schneider HP. Prospective evaluation of the ultrasound appearance of the endometrium in a cohort of 1,186 infertile women. Fertil Steril 2000;73: Puerto B, Creus M, Carmona F, Civico S, Vanrell JA, Balasch J. Ultrasonography as a predictor of embryo implantation after in vitro fertilization: a controlled study. Fertil Steril 2003;79: Gonen Y, Casper RF, Jacobson W, Blankier J. Endometrial thickness and growth during ovarian stimulation: a possible predictor of implantation in in vitro fertilization. Fertil Steril 1989;52: Sharara FI, Lim J, McClamrock HD. Endometrial pattern on the day of oocyte retrieval is more predictive of implantation success than the pattern or thickness on the day of hcg administration. J Assist Reprod Genet 1999;16: Noyes N, Liu HC, Sultan K, Schattman G, Rosenwaks Z. Endometrial thickness appears to be a significant factor in embryo implantation in in-vitro fertilization. Hum Reprod 1995;10: Bassil S. Changes in endometrial thickness, width, length and pattern in predicting pregnancy outcome during ovarian stimulation in in vitro fertilization. Ultrasound Obstet Gynecol 2001;18: Dietterich C, Check JH, Choe JK, Nazari A, Lurie D. Increased endometrial thickness on the day of human chorionic gonadotropin injection does not adversely affect pregnancy or implantation rates following in vitro fertilization-embryo transfer. Fertil Steril 2002;77: Rinaldi L, Lisi F, Floccari A, Lisi R, Pepe G, Fishel S. Endometrial thickness as a predictor of pregnancy after in-vitro fertilization but not after intracytoplasmic sperm injection. Hum Reprod 1996;11: Kovacs P, Matyas S, Boda K, Kaali SG. The effect of endometrial thickness on IVF/ICSI outcome. Hum Reprod 2003;18: Weissman A, Gotlieb L, Casper RF. The detrimental effect of increased endometrial thickness on implantation and pregnancy rates and outcome in an in vitro fertilization program. Fertil Steril 1999;71: Gonen Y, Casper RF. Prediction of implantation by the sonographic appearance of the endometrium during controlled ovarian stimulation for in vitro fertilization (IVF). J In Vitro Fert Embryo Transfer 1990; 7: Frattarelli JL, Miller BT, Scott RT. Adjuvant therapy enhances endometrial receptivity in patients undergoing assisted reproduction. Reprod Biomed Online 2006;12: Levi AJ, Raynault MF, Bergh PA, Drews MR, Miller BT, Scott RT Jr. Reproductive outcome in patients with diminished ovarian reserve. Fertil Steril 2001;76: Fertility and Sterility 81

90 Early serum -human chorionic gonadotropin in pregnancies after in vitro fertilization: contribution of treatment variables and prediction of long-term pregnancy outcome Shay Porat, M.D., Stephan Savchev, M.D., Yuval Bdolah, M.D., Arye Hurwitz, M.D., and Ronit Haimov-Kochman, M.D. IVF Unit, Department of Obstetrics and Gynecology, Hadassah Hebrew University Medical Center, Mt. Scopus, Jerusalem, Israel Objective: Low initial serum hcg is a good predictor of early pregnancy failure. We sought to determine the contribution of treatment variables and the predictive value of early serum hcg after IVF on long-term pregnancy outcome. Design: A retrospective case control study. Setting: An academic IVF unit. Patient(s): Five hundred thirty-three IVF cycles performed between 1999 and 2004, which resulted in a positive serum hcg level ( 10 miu/ml) on day 13 after embryo transfer (ET). Intervention(s): The study group included 281 pregnancies with initial hcg 150 miu/ml on day 13 after ET. Randomly selected 252 IVF cycles with initial hcg 150 miu/ml comprised the control group. Characteristics of the patients and the treatment protocols were analyzed using logistic regression, Pearson s chi-square, and Fisher s exact test. Main Outcome Measure(s): Primary pregnancy outcome was defined as favorable when a fetal pulse was detected, testifying to a viable gestation. Unfavorable outcome referred to chemical or ectopic pregnancies, as well as spontaneous abortions. Additionally, the two groups were followed throughout gestation. Secondary pregnancy outcome was based on the following parameters: gestational age at delivery, method of delivery, and birth weight. Result(s): Poor primary pregnancy outcome was encountered in 64.8% of the study group and in 22.2% of the control group. Predictors of unfavorable primary pregnancy outcome were older age, use of a short protocol, and shorter than anticipated crown rump length. No difference was found in the secondary pregnancy outcome between the groups. Preterm labor was more prevalent in the study group, but the difference did not reach statistical significance. Conclusion(s): Pregnancy viability can be predicted by measuring serum hcg as early as on day 13 after ET. Older age, use of a short protocol, and shorter than anticipated crown rump length are associated with early pregnancy loss. Of those who reach delivery, no significant adverse outcome is anticipated in IVF pregnancies with low initial serum hcg. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: IVF, human chorionic gonadotropin, outcome, pregnancy Received April 13, 2006; revised and accepted November 21, Reprint requests: Ronit Haimov-Kochman, M.D., Department of Obstetrics and Gynecology, Hadassah Medical Center, P.O. Box 24035, Mt. Scopus, Jerusalem, Israel (FAX: ; kochman@hadassah.org.il). Human chorionic gonadotropin (hcg) can be detected in the maternal serum as early as 8 days after conception. Being produced and secreted by syncytial trophoblast, its serum level represents the trophoblastic mass (1). Human chorionic gonadotropin level dynamically increases during early gestatation. Low levels of serum hcg in early pregnancy have been reported as a predictor of poor pregnancy outcome such as chemical and ectopic pregnancies as well as spontaneous miscarriage (2 12). However, the contribution of patients characteristics and IVF treatment variables to low serum hcg level in early pregnancy has not been investigated. Additionally, an association between low serum hcg level and the longterm outcome of a pregnancy has not been reported. We sought to correlate low serum hcg levels with patients characteristics and IVF treatment variables as well as primary pregnancy outcome (i.e., chemical and ectopic pregnancies as well as spontaneous miscarriage) and secondary pregnancy outcome (i.e., preterm labor, low birthweight, Cesarean section delivery) in a population of IVF patients. We hypothesized that low levels of hcg might represent abnormal placentation. Hence, the 82 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

91 occurrence of obstetric complications of placental origin in pregnancies with low initial hcg levels may be higher. MATERIALS AND METHODS Study Group This was a retrospective case-controlled study. The records of all patients who conceived in the IVF unit of Hadassah Mt Scopus during 1999 to 2004 were retrospectively reviewed. Institutional review board approval was not obtained because of the retrospective noninterventional nature of this work. Two hundred eighty-one pregnancies (study group) fulfilled the following inclusion criteria: [1] an initial hcg 150 miu/ml on day 13 after embryo transfer (ET); [2] a singleton pregnancy, [3] the data on pregnancy outcome was available. We used 150 IU as a cutoff of hcg level on day 13 from ET based on previous reports (4, 6, 8, 10, 11). Randomly selected patients with initial hcg 150 miu/ ml, treated at the same time period who fulfilled criteria [2] and [3] comprised the control group (252 pregnancies). The selection of the subjects to the control group was done in the following randomized fashion. After electing a case record to the study group, the consecutive suitable patient record by file number was used as a control. Data regarding patient s age, type of treatment protocol, method of fertilization, ultrasound findings, and pregnancy outcome were collected from the patients files. Treatment Protocol All patients underwent IVF and ET according to conventional protocols. Long protocol denotes pituitary down-regulation using a midluteal administration of a GnRH agonist (Decapeptyl CR 3.75 mg [Ipsen Pharma Biotech, Signes, France]). Short protocol denotes use of either GnRH agonist (Decapeptyl 0.1 mg [Ipsen Pharma Biotech, Signes, France]) from day 1 of the cycle (short flareup protocol) or GnRH antagonist (Cetrotide 0.25 mg [Serono, SA, the Netherlands]) starting when the leading follicle reached 14 mm (short antagonist protocol). Ovarian stimulation was achieved using recombinant FSH (Gonal F [Serono, SA, the Netherlands]) in various flexible protocols. Ovulation was induced when at least three leading follicles reached the size of 18 mm, using hcg ,000 IU (Pregnyl [Organon, Oss]) or recombinant hcg 250 g (Ovitrelle [Serono SA]). Ovum collection was performed hours later. Ova were fertilized by either conventional IVF or intracytoplasmic sperm injection (ICSI). Infrequently (e.g., in patients with unexplained infertility) part of the collected ova was fertilized by IVF and another part by ICSI. Viable embryos were either transferred 2 3 days after ovum collection, or cryopreserved for further use. Cryopreserved embryo transfer was performed following endometrial preparation (13) using oral estrogen 6 mg/day (Estrofem [Novo Nordisk A/S, Bagsverd, Denmark]) for 2 to 3 weeks and then adding vaginal progesterone 800 mg/d (Uterogestan [Besins International, France]) as luteal supplementation until a pregnancy test was performed. Estrogen and progesterone therapy was continued until the 12th week of gestation in all cases. Hormone Assays Samples of venous blood were collected routinely on the 13th day after ET. Serum hcg concentrations were measured by microparticle enzyme immunoassay for the intact hcg molecule (Elecsys HCG STAT Roche Diagnostics GmbH, Mannheim, Germany) at the Central biochemical laboratory of our hospital. The test has been standardized according to the Fourth International Standard for Chorionic Gonadotropin from the National Institute for Biological Standards and Control, code 75/589. The intraassay coefficient of variation was 1.5% for a mean hcg of 42 miu/ml, 618 miu/ml, and 4634 miu/ml. The interassay coefficient of variation was 2.2%, 2.3%, and 2.1%, respectively, and the sensitivity was 0.5 miu/ml. Ultrasonographic Studies Two weeks after confirmation of a viable pregnancy all patients underwent ultrasound examinations. All examinations were performed by the transvaginal route by professional gynecologic ultrasound technicians. The scans were performed on an ATL HDI 3500 system (Phillips Ultrasound, Bothell, WA) using 4 8-MHz transvaginal transducers. Conversion of crown rump length (CRL) from measurement in millieters to the compatible gestational age was done using the Robinson s table (14). In viable pregnancies, the difference between the expected gestational age (in days) by the date of ET and the calculated gestational age by CRL was recorded. This difference was designated by the variable Expected-Measured ( EM). Pregnancy Outcome Data regarding primary pregnancy outcome was collected from the IVF patients files and secondary pregnancy outcome from delivery room records. Primary poor pregnancy outcome was defined in cases of a chemical pregnancy, spontaneous abortion, or extra-uterine pregnancy. Secondary pregnancy outcome was based on gestational age at delivery, birth weight, and mode of delivery (normal vaginal vs. Cesarean delivery). Birthweight equal to or less than fifth percentile was regarded as small for gestational age (15). Gestational age of 37 weeks at delivery was considered preterm labor. Analysis was performed in each gestational age of 37, 35, and 32 weeks. Statistical Analysis Following examination of the skewness and kurtosis of the distributions of the numeric variables, Student s t test was found appropriate for comparisons between the study and control groups. The t tests were preceded by Levene s test for the homogeneity of variance. For categorical variables, Fertility and Sterility 83

92 TABLE 1 Low initial hcg and primary pregnancy outcome in study versus control groups. Study group hcg <150 miu/ml n 281 cycles Control group hcg >150 miu/ml n 252 cycles P Primary pregnancy outcome Note: Data are presented as n (%). Porat. Low initial hcg in IVF cycles. Fertil Steril Chemical pregnancy 115 (40.9) 14 (5.6) First trimester abortion 59 (21) 36 (14.3) Second trimester abortion 2 (0.7) 6 (2.4) Ectopic pregnancy 6 (2.1) 0 (0) Delivery 99 (35.2) 196 (77.8) Pearson s chi-square was used and Fisher s exact test for dichotomies. Associations of initial hcg, endometrial thickness, and age with pregnancy outcome were evaluated with univariate logistic regression models built separately for each group to control for interactions. The P values reported are for Wald s test with 1 degree of freedom. Associations of parameters with pregnancy outcome were evaluated with logistic regression models for numeric variables. Associations of categorical variables with low initial hcg were tested by Pearson s chi-square and Fisher s exact test for dichotomies. RESULTS Validation of the Impact of Low Initial hcg Level on Primary Pregnancy Outcome The groups differed significantly in primary pregnancy outcome; patients with a hcg level 150 miu/ml had 77.8% chance of delivery, whereas if the level was 150 miu/ml, the likelihood of delivery dropped more than twofold to 35.2% (P ) (Table 1). Moreover, when pregnancy success was plotted for the hcg level, a linear positive association existed between the two parameters with a coefficient of the linear model of (P.0001). The odds ratio was for each increase in the hcg quartile (Fig. 1). endometrial thickness appeared to be significant variables for pregnancy outcome, we performed a logistic regression analysis. The odds of poor primary pregnancy outcome increased with age (P.001, odds ratio [OR] 1.052, 95% confidence interval [CI] [ ]) and thinner endometrium (P.024, OR 0.915, 95% CI [ ]). When a logistic regression analysis was taken separately within each group, those variables lost their significance. Initial hcg value was a highly significant, positively correlated variable to pregnancy success on logistic regression analysis of the study group. However, in the control group no significance was found. FIGURE 1 Pregnancy success shows linear correlation with initial hcg level 13 days after ET with a coefficient of the linear model of (P.0001). hcg quartiles: first quartile: 0 62 miu/ml (n 134), second quartile: miu/ ml (n 134), third quartile: miu/ml (n 132), fourth quartile: 298 3,047 miu/ml (n 133). The odds ratio was for each increase in the hcg quartile. Association of Patient s Characteristics with Low Initial hcg Level As derived from the study design, the mean initial hcg level was more than fivefold lower in the study versus the control group. The study group was significantly older (P.0001) and had a significantly thinner mean endometrial stripe measured by sonography on the day of HCG administration (P.01) (Table 2). There was no significant difference of E2 levels (mean SD) on hcg day between of the successful versus unsuccessful outcome groups ( pmole/ml pmole/ml vs pmole/ml pmole/ml, respectively, P.8386). Because age and Porat. Low initial hcg in IVF cycles. Fertil Steril Porat et al. Low initial hcg in IVF cycles Vol. 88, No. 1, July 2007

93 TABLE 2 Patient s characteristics in the study and control groups. Patient variables Study group hcg <150 miu/ml n 281 cycles Control group hcg >150 miu/ml n 252 cycles P Mean initial hcg level on day 13 post-et (miu/ml) Age (years) Endometrial stripe on day of hcg administration (mm) Porat. Low initial hcg in IVF cycles. Fertil Steril Association of IVF Treatment s Parameters with Low Initial hcg Level By looking into the treatment parameters in each group we tried to point out the preferred method for favorable pregnancy outcome. There was no difference in the distribution of specific treatment parameters between the groups in regard to the protocol regimen (long vs. short antagonist and flare up protocols; 70.1%, 21%, 8.9% vs. 77%, 14.7%, 8.3%, respectively, P.15), fertilization method (IVF vs. ICSI; 14.9%, 77.2% vs. 14.3%, 79.4%, respectively, P.77), and type of ET (fresh vs. frozen thawed; 70.5%, 29.5% vs. 62.7%, 37.3%, respectively, P.07). Segregation of pregnancy outcome by ovarian stimulation protocol type demonstrated a slight advantage in favor of the long protocol in the study group (P.03). However, all protocol types yielded similar results in the control group (Table 3). Analysis of pregnancy outcome by fertilization method (ICSI vs. IVF) and by ET (frozen vs. fresh) demonstrated similar success rate within both groups (Table 3). Correlation of Low Initial hcg Level and Early Ultrasonic Parameters In this study the lag between the expected gestational age as calculated by the ET date and the actual embryo age as derived from CRL measurement by ultrasound ( EM) was in close correlation with pregnancy failure. In our study population the delivery rate was very high (above 90%) for both control and study groups when EM was 4 days. This correlation was consistent in both groups testifying that EM was an independent determinant of pregnancy outcome (Fig. 2). Secondary Pregnancy Outcome Preterm deliveries in the study group was relatively but not significantly more prevalent than in the control group (13.4% vs. 7.3%). Delivery at extreme prematurity before 32 weeks of gestation was significantly more prevalent in the study group although the numbers for analysis were small (Fig. 3). The groups did not differ in the prevalence of low birth TABLE 3 Pregnancy outcome by IVF treatment parameters in study versus control groups. Study group Control group Delivery n (%) Failure n (%) P Delivery n (%) Failure n (%) P Protocol type Long 79 (40.1) 118 (59.9) (76.8) 45 (23.2).11 Short flareup 6 (24.0) 19 (76.0) 14 (66.7) 7 (33.3) Short antagonist 14 (23.7) 45 (76.3) 33 (89.2) 4 (10.8) Fertilization method IVF 14 (33.3) 28 (66.7) (83.3) 6 (16.7).39 ICSI 76 (35.0) 141 (65.0) 152 (76.0) 48 (24.0) Both 9 (40.9) 13 (59.1) 14 (87.5) 2 (12.5) Embryo transfer Fresh 70 (35.4) 128 (64.6) (81.0) 30 (19.0).12 Frozen 29 (34.9) 54 (65.1) 68 (72.3) 26 (27.7) Note: ICSI Intracytoplasmic sperm injection. Porat. Low initial hcg in IVF cycles. Fertil Steril Fertility and Sterility 85

94 FIGURE 2 Pregnancy success rate is correlated with early embryonic developmental delay both in the study group and the control group. The difference in days between calculated embryonic age and actual embryonic age as derived from measured CRL is represented in the x-axis. Porat. Low initial hcg in IVF cycles. Fertil Steril weight infants (9.5% vs. 14.2%, respectively, P.34). Cesarean section rates were relatively high in both study and control groups. The operative delivery was largely performed because of the IVF patient s request. Cesarean section rate was comparable in both groups (47.7% and 36.5%, respectively, P.09). DISCUSSION Early embryonic development is a precise multistep programmed biologic process. Pregnancy survival depends upon fully completing each step in a strict destined script. hcg levels represent trophoblastic mass and function. Its concentration grows steadily in a relatively narrow range of values at the early stages of pregnancy and every divergence from this predefined incremental curve raises a suspicion of abnormality (16 18). Our means to monitor normal pregnancy development are mainly by hcg measurements at the early stages of pregnancy and ultrasound parameters at later stages. Pregnancies with low initial hcg values were previously shown to have a poor prognosis in a multitude of studies (2 12). Ultrasonographic parameters have also been stressed as predictors of early pregnancy outcome (19 27). But in contrast to the wealth of literature in regard to early pregnancy prognosis, possible association between these predictors and long-term complications of pregnancy has been hardly investigated. Additionally, the patients and treatment s characteristics associated with low initial hcg have not been subjected to study. Our study corroborates previous studies showing that low initial hcg is tightly correlated with adverse pregnancy outcome (2 12). This result validated the significance of this case control study design. Our study results are also in agreement with reports that described well accepted sonographic markers of embryonic maldevelopment and impending abortion including smaller than expected gestational sac size (22, 24, 25, 27), yolk sac abnormalities (23, 26), and embryonal bradycardia (19 22, 25, 28). Here we showed that a lag 4 days was associated with a dramatic decrease in early pregnancy survival, and that both the biochemical and sonographic predictors are tightly correlated. The patient characteristics that were examined in this study were patient s age and endometrial thickness on the day HCG was administered. Age was proven to be a conceivable risk factor of low initial hcg level and early pregnancy failure. 86 Porat et al. Low initial hcg in IVF cycles Vol. 88, No. 1, July 2007

95 FIGURE 3 Comparison of preterm deliveries rate in study and control groups. P values are shown. Porat. Low initial hcg in IVF cycles. Fertil Steril The endometrium stripe was significantly thinner in the study group. Although the mean endometrial thickness of both groups was beyond the minimal normal limit, this difference may still have clinical relevance to better outcome. We examined the relationship between several treatment and patient characteristics to the development and prognosis of pregnancies with low initial hcg. The different treatment modalities were equally distributed in both study groups. These findings suggest that the treatment itself does not contribute to the development of such pregnancies. We could not find a substantial impact of the treatment variables upon the pregnancy outcome apart from a slight superiority of the long ovarian stimulation protocol in the study group. The slight inferiority of the short protocols in the study group may be a result of a possible oocyte factor or a nonreceptive endometrium. The disadvantage of short protocols in this regard may be a consequence of a selection bias, as use of short protocols is relatively more common in older women with a lower oocyte quality. An endometrial cause of failure could have been suspected if the antagonist protocol would have yielded worse results. But, because both short protocols (agonist and antagonist) were disadvantageous, an endometrial cause is probably not causative of pregnancy failure. Neither the fertilization method (ICSI vs. conventional IVF) nor type of ET (fresh vs. frozen thawed) impacted primary pregnancy outcome. We hypothesized that low levels of early hcg represent low placental mass. Hence, the occurrence of low birthweight that result from faulty placentation may be higher. Eventually the rate of Cesarean delivery was speculated to be higher in this subset of high risk pregnancies. However, we found no correlation between low birthweight and low initial hcg in this study. There was no difference in the prevalence of small for gestational age infants between the study and control groups. Hence, low initial hcg could not predict low birthweight. This finding is in agreement with observations of others (29, 30) who reported no relationship between first trimester maternal free hcg levels and retardation of fetal growth. Contrary to our findings were those of Hadad and colleagues (31), demonstrating a correlation between initial hcg and fetal growth. However, this impression was based on a relatively small sample size. Similarly, Krantz et al. (32) showed an increased risk of growth retardation when first trimester free hcg levels were below the first percentile. Therefore, we could speculate the only very low levels of hcg may impact fetal intrauterine growth, once the pregnancy survived until delivery. Fertility and Sterility 87

96 Cesarean section rate as another resultant of complicated pregnancies was not associated with lower initial serum hcg. In this study the rate of a Cesarean delivery was unusually high, probably because of older patients sample (mean age 31.7 years) and IVF-conceived pregnancies. The relationship between small gestational age fetuses with placental insufficiency and preterm deliveries was previously suggested (33, 34). Therefore, the rate of preterm labor was postulated to be associated with malplacentation and low initial serum hcg. It has also been shown that hcg may induce a myometrial quiescent state by several mechanisms (35 37). As a whole, preterm labor was not associated with lower initial serum hcg; however, extreme preterm labor ( 32 weeks) was found to be significantly more prevalent in the low initial serum hcg group. The etiology of preterm labor is divergent, and different factors may account for preterm labor during gestation. Although the sample size was small, it is conceivable that extreme preterm labor ( 32 weeks) may stem from faulty placentation represented by early low serum hcg and possible lower total levels of hcg during pregnancy. In conclusion, we have shown that low initial hcg correlated with pregnancy outcome as has previously been shown, and a single early measurement may serve a reliable prognosticator at early stages of pregnancy. At later stages of pregnancy, sonographic delay of embryonic development is another powerful tool of determining pregnancy prognosis. These two predictors are tightly correlated. To the best of our knowledge, no study thus far has dealt with the correlation between low hcg levels and the various IVF treatment aspects. We have shown here that the treatment itself does not have a contributive role in the development of such pregnancies. Secondary pregnancy outcome did not show correlation to early low hcg levels, apart from extreme preterm labor 32 weeks. A larger scale work might be needed to validate this finding. REFERENCES 1. Braunstein GD, Rasor JL, Engvall E, Wade ME. Interrelationships of human chorionic gonadotropin, human placental lactogen, and pregnancy-specific beta 1-glycoprotein throughout normal human gestation. Am J Obstet Gynecol 1980;138: Confino E, Demir RH, Friberg J, Gleicher N. The predictive value of hcg beta subunit levels in pregnancies achieved by in vitro fertilization and embryo transfer: an international collaborative study. Fertil Steril 1986;45: Daily CA, Laurent SL, Nunley WC Jr. The prognostic value of serum progesterone and quantitative beta-human chorionic gonadotropin in early human pregnancy. Am J Obstet Gynecol 1994;171: Schmidt LL, Asch RH, Frederick JL, Rojas FJ, Stone SC, Balmaceda JP. The predictive value of a single beta human chorionic gonadotropin in pregnancies achieved by assisted reproductive technology. Fertil Steril 1994;62: Zegers-Hochschild F, Altieri E, Fabres C, Fernandez E, Mackenna A, Orihuela P. Predictive value of human chorionic gonadotrophin in the outcome of early pregnancy after in-vitro fertilization and spontaneous conception. Hum Reprod 1994;9: Guth B, Hudelson J, Higbie J, Solomon B, Polley S, Thomas S, et al. Predictive value of hcg level 14 days after embryo transfer. J Assist Reprod Genet 1995;12, al-sebai MA, Diver M, Hipkin LJ. The role of a single free beta-human chorionic gonadotrophin measurement in the diagnosis of early pregnancy failure and the prognosis of fetal viability. Hum Reprod 1996; 11: Qasim SM, Callan C, Choe JK. The predictive value of an initial serum beta human chorionic gonadotropin level for pregnancy outcome following in vitro fertilization. J Assist Reprod Genet 1996;13: Homan G, Brown S, Moran J, Homan S, Kerin J. Human chorionic gonadotropin as a predictor of outcome in assisted reproductive technology pregnancies. Fertil Steril 2000;73: Sugantha SE, Webster S, Sundar E, Lenton EA. Predictive value of plasma human chorionic gonadotrophin following assisted conception treatment. Hum Reprod 2000;15: Poikkeus P, Hiilesmaa V, Tiitinen A. Serum HCG 12 days after embryo transfer in predicting pregnancy outcome. Hum Reprod 2002;17: Urbancsek J, Hauzman E, Fedorcsak P, Halmos A, Devenyi N, Papp Z. Serum human chorionic gonadotropin measurements may predict pregnancy outcome and multiple gestation after in vitro fertilization. Fertil Steril 2002;78: Simon A, Hurwitz A, Pharhat M, Revel A, Zentner BS, Laufer N. A flexible protocol for artificial preparation of the endometrium without prior gonadotropin-releasing hormone agonist suppression in women with functioning ovaries undergoing frozen-thawed embryo transfer cycles. Fertil Steril 1999;71: Robinson HP, Fleming JE. A critical evaluation of sonar crown rump length measurements. Br J Obstet Gynaecol 1975;82: Kramer MS, Platt RW, Wen SW, Joseph KS, Allen A, Abrahamowicz M, et al. A new and improved population-based Canadian reference for birth weight for gestational age. Pediatrics 2001;108:E Batzer FR, Schlaff S, Goldfarb AF, Corson SL. Serial beta-subunit human chorionic gonadotropin doubling time as a prognosticator of pregnancy outcome in an infertile population. Fertil Steril 1981;35: Lenton EA, Neal LM, Sulaiman R. Plasma concentrations of human chorionic gonadotropin from the time of implantation until the second week of pregnancy. Fertil Steril 1982;37: Pittaway DE, Wentz AC, Maxson WS, Herbert C, Daniell J, Fleischer AC. The efficacy of early pregnancy monitoring with serial chorionic gonadotropin determinations and real-time sonography in an infertility population. Fertil Steril 1985;44: Laboda LA, Estroff JA, Benacerraf BR. First trimester bradycardia. A sign of impending fetal loss. J Ultrasound Med 1989;8: Achiron R, Tadmor O, Mashiach S. Heart rate as a predictor of first-trimester spontaneous abortion after ultrasound-proven viability. Obstet Gynecol 1991;78: May DA, Sturtevant NV. Embryonal heart rate as a predictor of pregnancy outcome: a prospective analysis. J Ultrasound Med 1991; 10: Jun SA, Ahn MO, Lee YD, Cha KY. Predictable ultrasonographic findings of early abortion. J Korean Med Sci 1992;7: Lindsay DJ, Lovett IS, Lyons EA, Levi CS, Zheng XH, Holt SC, et al. Yolk sac diameter and shape at endovaginal US: predictors of pregnancy outcome in the first trimester. Radiology 1992;183: Tadmor OP, Achiron R, Rabinowiz R, Aboulafia Y, Mashiach S, Diamant YZ. Predicting first-trimester spontaneous abortion. Ratio of mean sac diameter to crown rump length compared to embryonic heart rate. J Reprod Med 1994;39: Falco P, Milano V, Pilu G, David C, Grisolia G, Rizzo N, et al. Sonography of pregnancies with first-trimester bleeding and a viable embryo: a study of prognostic indicators by logistic regression analysis. Ultrasound Obstet Gynecol 1996;7: Kucuk T, Duru NK, Yenen MC, Dede M, Ergun A, Baser I. Yolk sac size and shape as predictors of poor pregnancy outcome. J Perinat Med 1999;27: Porat et al. Low initial hcg in IVF cycles Vol. 88, No. 1, July 2007

97 27. Oh JS, Wright G, Coulam CB. Gestational sac diameter in very early pregnancy as a predictor of fetal outcome. Ultrasound Obstet Gynecol 2002;20: Ikegawa A. Prediction of first-trimester miscarriage from embryonic bradycardia and embryonic growth delay. J Obstet Gynaecol 1995; 21: Morssink LP, Kornman LH, Hallahan TW, Kloosterman MD, Beekhuis JR, de Wolf BT, et al. Maternal serum levels of free beta-hcg and PAPP-A in the first trimester of pregnancy are not associated with subsequent fetal growth retardation or preterm delivery. Prenat Diagn 1998;18: Yaron Y, Ochshorn Y, Heifetz S, Lehavi O, Sapir Y, Orr-Urtreger A. First trimester maternal serum free human chorionic gonadotropin as a predictor of adverse pregnancy outcome. Fetal Diagn Ther 2002;17: Haddad B, Abirached F, Louis-Sylvestre C, Le Blond J, Paniel BJ, Zorn JR. Predictive value of early human chorionic gonadotrophin serum profiles for fetal growth retardation. Hum Reprod 1999;14: Krantz D, Goetzl L, Simpson JL, Thom E, Zachary J, Hallahan TW, et al. Association of extreme first-trimester free human chorionic gonadotropin-beta, pregnancy-associated plasma protein A, and nuchal translucency with intrauterine growth restriction and other adverse pregnancy outcomes. Am J Obstet Gynecol 2004;191: Zeitlin J, Ancel PY, Saurel-Cubizolles MJ, Papiernik E. The relationship between intrauterine growth restriction and preterm delivery: an empirical approach using data from a European case control study. BJOG 2000;107: Bukowski R, Gahn D, Denning J, Saade G. Impairment of growth in fetuses destined to deliver preterm. Am J Obstet Gynecol 2001;185: Ambrus G, Rao CV. Novel regulation of pregnant human myometrial smooth muscle cell gap junctions by human chorionic gonadotropin. Endocrinology 1994;135: Eta E, Ambrus G, Rao CV. Direct regulation of human myometrial contractions by human chorionic gonadotropin. J Clin Endocrinol Metab 1994;79: Slattery MM, Brennan C, O Leary MJ, Morrison JJ. Human chorionic gonadotrophin inhibition of pregnant human myometrial contractility. BJOG 2001;108: Fertility and Sterility 89

98 Aneuploidy rates in embryos from women with prematurely declining ovarian function: a pilot study Andrea Weghofer, M.D., Ph.D., a,b,c,d David Barad, M.D., c,d,e,f Jianming Li, Ph.D., c,d and Norbert Gleicher, M.D. a,c,d a Department of Obstetrics, Gynecology, and Reproductive Sciences, Yale University School of Medicine, New Haven, Connecticut; b Department of Obstetrics and Gynecology, Medical University Vienna, Vienna, Austria; c Center for Human Reproduction, New York, New York; d Foundation for Reproductive Medicine, Chicago, Illinois; and e Department of Epidemiology and Social Medicine, and f Department of Gynecology and Women s Health, Albert Einstein College of Medicine, Bronx, New York Objective: Prematurely declining ovarian function (PDOF) affects approximately 10% of infertile females, and has been suggested to represent a shift of the normal ovarian aging curve toward younger age. Whether women with PDOF demonstrate an increased level of aneuploidy in their embryos, based on increasing aneuploidy rates with advancing female age, is unknown, and was the subject of this study. Design: Retrospective, case-control study. Setting: Academically affiliated private IVF center. Patient(s): Twenty women with PDOF, and 20 age-matched controls with age-appropriate ovarian function (AAOF), underwent IVF cycles and preimplantation genetic diagnosis (PGD) by fluorescence in situ hybridization for chromosomes X, Y, 13, 16, 18, 21, and 22 on day 3 after fertilization, and ET on day 5. Intervention(s): None. Mean Outcome Measure(s): Oocyte and embryo numbers, embryonic aneuploidy rates, pregnancies, and miscarriages. Result(s): Pregnancy rates (PRs) after initial fresh ET did not differ between patients with PDOF and those with AAOF. Among a total of 258 embryos analyzed by PGD, aneuploidy rates in PDOF and AAOF cycles were 52.6% and 52.2%, respectively. A trend toward lower ongoing PRs was noted in patients with PDOF (21% versus 41%), primarily attributable to higher clinical miscarriage rates (50% versus 13%) after detection of fetal heart motion. Conclusion(s): In this pilot study, the observation that PDOF is not characterized by an increased aneuploidy rate (controlled for age) suggests that PDOF does not represent a simple shift of the physiologically declining ovarian function curve toward younger age. This observation, indeed, suggests that the underlying pathophysiology of PDOF may vary from that of AAOF. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Aneuploidy, IVF, miscarriage, PGD, poor responder, prematurely declining ovarian function, premature ovarian failure Prematurely declining ovarian function (PDOF) occurs in approximately 10% of infertile females, and has been suggested to occur at an even higher prevalence in women with so-called unexplained infertility (1, 2). The diagnosis of PDOF should be suspected if women, at an inappropriately young age, already demonstrate evidence of diminished ovarian reserve, which can manifest itself either in abnormal ovarian function tests and/or through the presence of significant resistance to ovarian stimulation with gonadotropins (3 6). However, such clinical findings are also characteristic of the ovary that is aging physiologically and according to Received May 12, 2006; revised November 15, 2006; accepted November 17, This work was performed at the Center for Human Reproduction, New York, New York, the Foundation for Reproductive Medicine, Chicago, Illinois, and the Department of Obstetrics, Gynecology, and Reproductive Sciences, Yale University Medical School, New Haven, Connecticut. Reprint requests: Andrea Weghofer, M.D., Ph.D., Department of Obstetrics and Gynecology, Medical University Vienna, Waehringer Guertel 18 20, 1090 Vienna, Austria (FAX: ; andrea. weghofer@meduniwien.ac.at). age-appropriate ovarian function (AAOF) (7 9). Therefore, some investigators recently suggested that PDOF may simply represent a shift of the normal ovarian aging curve toward younger age (1, 10). After IVF, women with PDOF have a lower probability of pregnancy than expected for their age group (11 14). A number of recent reports suggested, however, that their prognosis may not have to be as poor as has been assumed. Such evidence first came from reports that demonstrated that elevated baseline FSH levels in young women had less negative predictive value for IVF cycle outcomes than in older women (15 17). We, as well as others, previously reported that pregnancy rates (PRs) after initial, fresh IVF cycles in young women with PDOF approached those of age-matched patients with AAOF, if PDOF patients received ovarian stimulation which was based on the women s ovarian function instead of chronological age (10, 18). These divergances from the expected IVF-cycle outcomes for older ovaries raise the question of whether PDOF 90 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

99 represents a shift of the normal, physiological ovarian aging curve toward younger age, or rather are the result of a distinct, and different, pathophysiology from AAOF. Assuming that PDOF reflects accelerated ovarian aging, one would not only expect the clinical features of diminishing ovarian reserve, such as lower oocyte numbers and abnormal ovarian function tests (19, 20), in PDOF patients, but also the well-described increase in aneuploidy rate with advancing female age (21 25). Whether aneuploidy rates are, in fact, increased in women with PDOF is unknown, and is the subject of the present case-control study. MATERIALS AND METHODS Using our center s computerized database, we identified 20 women with PDOF who had undergone preimplantation genetic diagnosis (PGD) in association with one IVF cycle. The women ranged in age between years, and represented consecutive cycles with a PDOF diagnosis that underwent IVF and PGD at our program between August 2003 and December 2004 (the study group). These patients and their cycles were matched with 20 women of identical ages, and with proven AAOF, who had also undergone IVF and PGD during the same time period. These patients were considered the control group. We considered patients to have a diagnosis of PDOF if they had a history of ovarian resistance or, in a minority of cases, elevated baseline FSH levels (day 2 and 3 FSH levels 10 mu/ml). Ovarian resistance was diagnosed if women with age-appropriate ovarian stimulation in the previous cycle (up to age 35 years, IU of gonadotropins per day; age years, 300 IU per day) produced 7 oocytes under age 30, 5 between ages years, and 3 between ages years. In contrast, AAOF was considered to be present if patients produced, with age-appropriate ovarian stimulation, normal age-appropriate oocyte numbers, defined as 8 oocytes under age 30 years, 6 oocytes between ages years, and 4 oocytes between ages years during this cycle, and showed baseline FSH levels 10 mu/ml. Indications for fertility treatment were tubal and male factor, ovulatory dysfunction, and advanced female age. In patients with PDOF, ovarian hyperstimulation was performed with a microdose agonist protocol. Starting on cycle day 2, 40 g of leuprolide acetate (Tap Pharmaceuticals, Lake Forest, IL) were administered SC twice daily, followed by a daily dose of either IU of recombinant FSH (recfsh) (Ares-Serono, Geneva, Switzerland), or IU of recfsh and 150 IU of hmg (Ares-Serono), after 3 days of agonist treatment. In addition, one patient received 75 mg of dehydroepiandrostenedione per day. Cycles with AAOF were treated with long agonist protocols, starting on day 21 of the previous cycle, with 500 g of leuprolide acetate (Tap Pharmaceuticals) twice daily (BID), followed by a daily dose of IU of recfsh (Ares-Serono), or 150 IU of recfsh and 150 IU of hmg (Ares-Serono). When the lead follicle diameter reached mm, follicular maturation was triggered with an injection of 10,000 IU of hcg, with oocyte retrieval 34 hours later. Patients with PDOF and AAOF mainly underwent PGD for gender selection. However, two couples in each group had PGD because of advanced female age. Preimplantation genetic diagnosis was performed by fluorescence in situ hybridization for chromosomes X, Y, 13, 16, 18, 21, and 22 on day 3 after fertilization, and ET at blastocyst stage, on day 5 after fertilization. All patients were represented by only one cycle, and the statistical analysis was performed using SPSS for Windows, standard version (SPSS, Inc., Chicago, IL). To assess the statistical power of our study in terms of clinical significance, we addressed the following considerations. The association between accelerated follicular loss and increasing aneuploidy is widely acknowledged (1, 22), and is believed to begin at approximately age 37 years (26). Eventually, menopause occurs before the follicular supply is depleted, currently at a mean age of 51 years (7). Premature ovarian failure (POF) is defined by the occurrence of menopause at 40 years of age (27), i.e., 11 years ahead of the current average age at menopause (7). Assuming that PDOF represents a shift of the ovarian aging curve toward younger age, one would expect the beginning of accelerated follicular loss, and increasing aneuploidy rates, in patients with PDOF at approximately age 26 years instead of age 37 years (1). If the hypothesis of PDOF as a process of accelerated ovarian aging is correct, then the patients with PDOF in our study group, who were aged years, should experience increased aneuploidy rates, compared with controls with AAOF. Based on published data on oocyte donors (24), we estimated that 50% of embryos obtained after ovarian stimulation from patients 35 years old would be aneuploid. We further estimated, in accordance with data presented by Taranissi et al. (25), that approximately 75% of embryos obtained from patients aged 40 years would be aneuploid. These results correspond to our center s own PGD data, which revealed aneuploidy rates of 45% (at 35 years of age), comparable to our study and control groups, and aneuploidy rates of 67% ( 40 years of age), irrespective of oocyte numbers. Therefore, we also tested the distribution of observed aneuploid and euploid embryos in patients with AAOF and those with PDOF against the expected distribution of approximately 50% and 75% aneuploidy, respectively, assuming that patients with PDOF were actually performing like older women. The rather low patient number cannot completely rule out a type II error. However, the fact that patients were matched for age, and that age is known to be the most important influencing factor for embryonic aneuploidy, reduced the likelihood of differences anticipated by power analyses. The significance of the difference in distribution Fertility and Sterility 91

100 between observed and expected rates was addressed by use of the chi-square test. Because this study was based on a retrospective data analysis, and because our institution s general informed consent, signed by all patients, allows for such analyses without further consent, no institutional review board approval was obtained. RESULTS Mean ages of patients with PDOF and those with AAOF were, in view of the age-based matching process, identical at a mean ( SD) of years (range, years). Patients with PDOF demonstrated significantly higher mean baseline FSH levels than did controls ( miu/ml versus miu/ml; P.04), and used significantly higher doses of medication ( versus [75 IU] ampules; P.001). The mean number of oocytes was lower in patients with PDOF ( versus ), though this difference was not significant. Six cycles in the PDOF group, and three cycles among patients with AAOF, did not reach ET, because of either an absence of euploid embryos or embryonic arrest. The mean number of embryos transferred was in the PDOF group, and in the control group (Table 1). Among a total of 258 embryos investigated by PGD, the aneuploidy rate in PDOF cycles was 52.6%, and 52.2% in patients with AAOF. The distribution of aneuploidy rates observed in PDOF and in patients with AAOF differed significantly from the expected distribution if patients with PDOF were to function like older women with AAOF ( 2 24; P.0001). In vitro fertilization in women with PDOF resulted in a clinical PR, per ET, of 43%. The analysis of control cycles yielded a clinical PR of 47% (Table 1). In both groups, only singleton pregnancies were achieved. A trend toward lower ongoing PRs in patients with PDOF was noted (PDOF: 21% versus AAOF: 41%), mostly attributable to an increased late miscarriage rate, after confirmation of positive fetal heartbeat (PDOF: 50% versus AAOF: 13%). DISCUSSION Our data confirm published reports that women with PDOF still have adequate chances for conception, especially after ovarian hyperstimulation is adjusted, based on a diagnosis of PDOF (10, 18, 28, 29). In addition, our results suggest that PDOF is not associated with an increased risk of aneuploidy. Indeed, the aneuploidy rates in both groups are not only comparable, but are significantly lower than rates that would have been expected among women of advanced reproductive age. This finding might explain the improved and satisfactory chances for conception in women with PDOF after adjustments in treatment according to their ovarian function, and corresponds to a number of recent reports that demonstrated a diminished negative predictive value of elevated baseline FSH levels in younger women (14 17). Standardized terminology to correctly define the various forms of declining ovarian function thus appears essential, and might simplify the ongoing discussions on this topic. As well as patient numbers, there is another potential weakness of our study: Patients with PDOF received a microdose agonist protocol, whereas women with AAOF un- TABLE 1 Baseline characteristics and outcome parameters of women with PDOF and AAOF. Patients with PDOF (n 20) Patients with AAOF (n 20) P Age (y) NS Weight (lb) NS Basal FSH (mu/ml) Basal E 2 (pg/ml) NS Peak E 2 (pg/ml) 2,171 1,156 2,984 1,721 NS Days of stimulation NS Ampoules of gonadotropins used No. of oocytes retrieved NS Aneuploid embryos (%) NS No. of embryos transferred NS Clinical PR per ET (%) NS Miscarriage (%) NS Delivery rate per ET (%) NS Babies birth weight (lb) NS Note: Values are expressed as mean SD. NS no significance. Weghofer. Aneuploidy rates and PDOF. Fertil Steril Weghofer et al. Aneuploidy rates and PDOF Vol. 88, No. 1, July 2007

101 derwent long protocol stimulation. It is entirely possible that such differences in stimulation may affect aneuploidy rates, and we are currently investigating this. However, the comparison of microdose and long agonist stimulation in almost 700 study subjects did not reveal a positive impact of microdose treatment on embryonic aneuploidy rates (30). This study also suggests a possible increased risk of late miscarriages in women with PDOF. This finding also requires further confirmation, and any such confirmation may help elucidate the pathophysiology behind PDOF, insofar as late pregnancy losses are usually associated with medical rather than genetic causes (31). If the present comparable PRs and aneuploidy rates in patients with PDOF and AAOF can be confirmed by further studies, they would challenge the perception that PDOF simply represents a shift of the normal, physiological ovarian aging curve toward younger age. Instead, they may suggest that PDOF represents a pathophysiology that differs from age-appropriate ovarian aging. Such a conclusion would have a significant impact on our understanding of the aging ovary, and should lead to more individualized treatment approaches. While the initial clinical presentation of PDOF, characterized by abnormal ovarian function tests and diminished ovarian reserve, mimics the presentation of AAOF, the lack of aneuploidy increase, as well as the trend toward late pregnancy loss in patients with PDOF, might shed further light on a different pathophysiology of PDOF. Acknowledgments: The authors acknowledge the help of the clinical and administrative staffs of the Center for Human Reproduction, New York, New York, in collecting part of the data. REFERENCES 1. Nikolaou D, Templeton A. Early ovarian ageing: a hypothesis. Detection and clinical relevance. Hum Reprod 2003;18: Nagy ZP, Rienzi LF, Ubaldi FM, Greco E, Massey JB, Kort HI. Effect of reduced oocyte aging on the outcome of rescue intracytoplasmic sperm injection. Fertil Steril 2006;85: Kok HS, van Asselt KM, van der Schouw YT, Grobbee DE, te Velde ER, Pearson PL, et al. Subfertility reflects accelerated ovarian ageing. Hum Reprod 2003;18: Nikolaou D, Templeton A. Early ovarian ageing. Eur J Obstet Gynecol Reprod Biol 2004;113: El-Toukhy T, Khalaf Y, Hart R, Taylor A, Braude P. Young age does not protect against the adverse effects of reduced ovarian reserve an eight year study. Hum Reprod 2002;17: Hansen KR, Morris JL, Thyer AC, Soules MR. Reproductive aging and variability in the ovarian antral follicle count: application in the clinical setting. Fertil Steril 2003;80: Wu JM, Zelinski MB, Ingram DK, Ottinger MA. Ovarian aging and menopause: current theories, hypotheses, and research models. Exp Biol Med 2005;230: Galey-Fontaine J, Cedrin-Durnerin I, Chaibi R, Massin N, Hugues JN. Age and ovarian reserve are distinct predictive factors of cycle outcome in low responders. Reprod Biomed Online 2005;10: Roberts JE, Spandorfer S, Fasouliotis SJ, Kashyap S, Rosenwaks Z. Taking a basal follicle-stimulating hormone history is essential before initiating in vitro fertilization. Fertil Steril 2005;83: Gleicher N, Barad D. Premature ovarian aging and ovarian resistance in young women. Clinical profile and IVF outcome. Fertil Steril. In press. 11. Sallam HN, Ezzeldin F, Agameya AF, Rahman AF, El-Garem Y. Defining poor responders in assisted reproduction. Int J Fertil Womens Med 2005;50: Ulug U, Ben-Shlomo I, Turan E, Erden HF, Akman MA, Bahceci M. Conception rates following assisted reproduction in poor responder patients: a retrospective study in 300 consecutive cycles. Reprod Biomed Online 2003;6: Qublan HS, Malkawi HY, Tahat YA, Areidah S, Nusair B, Khreisat BM, et al. In-vitro fertilisation treatment: factors affecting its results and outcome. J Obstet Gynaecol 2005;25: Akande VA, Fleming CF, Hunt LP, Keay SD, Jenkins JM. Biological versus chronological ageing of oocytes, distinguishable by raised FSH levels in relation to the success of IVF treatment. Hum Reprod 2002; 17: Abdalla H, Thum MY. An elevated basal FSH reflects a quantitative rather than qualitative decline of the ovarian reserve. Hum Reprod 2004;19: van Rooij IA, Bancsi LF, Broekmans FJ, Looman CW, Habbema JD, te Velde ER. Women older than 40 years of age and those with elevated follicle-stimulating hormone levels differ in poor response rate and embryo quality in in vitro fertilization. Fertil Steril 2003; 79: Check JH, Katsoff B. Three successful pregnancies with in vitro fertilization embryo transfer over an eight year time span despite elevated basal serum follicle stimulating hormone levels. Case report. Clin Exp Obstet Gynecol 2005;32: Schoolcraft W, Schlenker T, Gee M, Stevens J, Wagley L. Improved controlled ovarian hyperstimulation in poor responder in vitro fertilization patients with a microdose follicle-stimulating hormone flare, growth hormone protocol. Fertil Steril javascript:al_get(this, jour, Fertil Steril. ); 1997;67: Kwee J, Schats R, McDonnell J, Schoemaker J, Lambalk CB. The clomiphene citrate challenge test versus the exogenous folliclestimulating hormone ovarian reserve test as a single test for identification of low responders and hyperresponders to in vitro fertilization. Fertil Steril 2006;85: Shrim A, Elizur SE, Seidman DS, Rabinovici J, Wiser A, Dor J. Elevated day 3 FSH/LH ratio due to low LH concentrations predicts reduced ovarian response. Reprod Biomed Online 2006;12: Munne S, Alikani M, Tomkin G, Grifo J, Cohen J. Embryo morphology, developmental rates, and maternal age are correlated with chromosome abnormalities. Fertil Steril 1995;64: Munne S, Sandalinas M, Escudero T, Velilla E, Walmsley R, Sadowy S, et al. Improved implantation after preimplantation genetic diagnosis of aneuploidy. Reprod Biomed Online 2003;7: Pehlivan T, Rubio C, Rodrigo L, Romero J, Remohi J, Simon C, et al. Impact of preimplantation genetic diagnosis on IVF outcome in implantation failure patients. Reprod Biomed Online 2003;6: Baart EB, Martini E, van den Berg I, Macklon NS, Galjaard RJ, Fauser BC, et al. Preimplantation genetic screening reveals a high incidence of aneuploidy and mosaicism in embryos from young women undergoing IVF. Hum Reprod 2006;21: Taranissi M, El-Toukhy T, Gorgy A, Verlinsky Y. Influence of maternal age on the outcome of PGD for aneuploidy screening in patients with recurrent implantation failure. Reprod Biomed Online 2005;10: Speroff L Glass RH, Kase NG. Clinical gynecologic endocrinology and infertility. 6th ed. Baltimore, MD: Lippincott, Williams and Wilkins, Santoro N. Research on the mechanisms of premature ovarian failure. J Soc Gynecol Invest 2001;8(Suppl 1):S10 2. Fertility and Sterility 93

102 28. Fasouliotis SJ, Simon A, Laufer N. Evaluation and treatment of low responders in assisted reproductive technology: a challenge to meet. J Assist Reprod Genet 2000;17: Karande V, Gleicher N. A rational approach to the management of low responders in in-vitro fertilization. Hum Reprod 1999;14: Weghofer A, Munne S, Brannath W, Chen S, Cohen J, Gleicher N. The quantitative and qualitative impact of gonadotropin stimulation on human preimplantation embryos: a preliminary study. Fertil Steril 2006;86: Ancel PY, Saurel-Cubizolles MJ, Di Renzo GC, Papiernik E, Breart G. Risk factors for week abortions: a case-control study in Europe. The Europop Group. Hum Reprod 2000;15: Weghofer et al. Aneuploidy rates and PDOF Vol. 88, No. 1, July 2007

103 MENOPAUSE Postmenopausal hypoestrogenism increases vasoconstrictor neuropeptides and decreases vasodilator neuropeptides content in arterial-wall autonomic terminations Costantino Di Carlo, M.D., a Attilio Di Spiezio Sardo, M.D., a Giuseppe Bifulco, M.D., a Giovanni A. Tommaselli, M.D., a Germano Guerra, M.D., b Emilia Rippa, M.D., c Vincenzo D. Mandato, M.D., a and Carmine Nappi, M.D. a a Department of Gynecology and Obstetrics and Pathophysiology of Human Reproduction, b Department of Functional and Biomorphological Sciences, and c Department of Biochemistry, University of Naples Federico II, Naples, Italy Objective: To investigate the effects of postmenopausal hypoestrogenism on the content of autonomic vasoconstrictor (neuropeptide Y) and vasodilator neuropeptides (vasoactive intestinal peptide and substance P) at the arterial level. Design: Prospective, clinical study. Setting: Department of Gynecology and Obstetrics and Pathophysiology of Human Reproduction, University of Naples Federico II, Naples, Italy. Patient(s): Twenty premenopausal women and 20 postmenopausal women, matched for age and parity. Intervention(s): All patients underwent abdominal hysterectomy with bilateral oophorectomy for benign conditions. During surgery, a sample of uterine artery was obtained. The presence of E 2, estrogen receptor (ER ), neuropeptide Y (NPY), vasoactive intestinal peptide (VIP), substance P (SP), and S100 (a generic neuronal marker) was evaluated by means of immunohistochemistry and Western-blot analysis. Main Outcome Measure(s): Mean arterial content of E 2,ER, VIP, NPY, and SP. Result(s): Both immunohistochemical and Western-blot analysis showed that after menopause, the reduction in E 2 and ER in the uterine artery wall is associated with a decrease in vasodilator neuropeptides and an increase in vasoconstrictor NPY. A similar immunopositivity for S100 was observed in pre- and postmenopausal samples, which demonstrated similar total neuronal fiber contents. Conclusion(s): Postmenopausal hypoestrogenism seems to increase arterial vascular tone through a reduction of vasodilator neuropeptides and an increase in vasoconstrictor peptides in the arterial-wall termination of the autonomous system. These changes in neuropeptide content in the arterial walls might represent a new mechanism underlying the negative effects of menopause on the cardiovascular system. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Menopause, neuropeptides, estrogen, uterine artery It is well-known that women develop cardiovascular disease (CVD) on average years later in life than men. This has been attributed to the fall in female sex-steroid hormone levels at the time of menopause. Sex-steroid hormones and their receptors are key determinants of cardiovascular gender differences. It was demonstrated that estrogen (E) has favorable effects on most of the major risk factors for the development of CVD, such as plasma lipids profile, insulin resistance, body-fat Received July 12, 2006; revised November 8, 2006; accepted November 17, The authors report no conflict of interest. Reprint requests: Attilio Di Spiezio Sardo, M.D., Dipartimento di Scienze Ostetrico Ginecologiche, Urologiche e Fisiopatologia della Riproduzione Umana, Università degli Studi di Napoli Federico II, Via Sergio Pansini 5, Naples, Italy (FAX: ; cdispie@tin.it). distribution and inflammatory markers such as cytokines, and adhesion molecules (1). Moreover, other potential mechanisms of E protective action include calcium antagonism, induction of endothelium-derived relaxing factors, and suppression of contracting factors (2). It was also demonstrated that E may affect the vasodilatatory response to acetylcholine (3). Epidemiological, clinical, and biochemical data support the view that postmenopausal hypoestrogenism might exert its deleterious effects on the cardiovascular system through some or all of these mechanisms of action. On the other hand, recent randomized, controlled trials on the use of postmenopausal hormone replacement therapy (HT) failed to detect any benefit of this treatment on the risk of CVD (4). Very little is known on the effects of E on autonomic vasoconstrictor and vasodilator neuropeptides at the arterial level /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 95

104 Autonomic pathways are probably the major motor outflow of the nervous system. They play a critical role in regulating vascular resistance by allowing selective redistribution of blood flow to those parts which have a greater demand (5). The final motor neurons in vasomotor pathways contain a wide range of coexisting neurotransmitters which vary among different vascular areas. However, some general rules can be set down. In humans, cathecolamine-synthesizing vasoconstrictor neurons also express neuropeptide Y (NPY), while autonomic vasodilator neurons, besides synthesizing acetilcholine, utilize vasoactive intestinal peptide (VIP) and substance P (SP) (5). We recently demonstrated that in the nasal mucosa, postmenopausal hypoestrogenism led to a reduction in vasodilator peptides (VIP and SP) and to an increase in vasoconstrictor NPY. Replacement treatment with E and progestogen restored the premenopausal peptide content (6,7). Therefore, we investigated the effects of menopausal status on the content of vasoactive neuropeptides in the arterial wall. To address this issue, we evaluated the presence of NPY, VIP, SP, E 2, estrogen receptor (ER ), and S100 (a generic neuronal marker) in the uterine arteries of pre- and postmenopausal women of similar age. MATERIALS AND METHODS From January 2005 June 2005, we enrolled 20 premenopausal women (mean age, 49.7 years 3.2 years SD) and 20 postmenopausal women (mean age, 50.4 years 4.2 years SD), 12 months and 24 months after menopause, who were undergoing abdominal hysterectomy with bilateral oophorectomy for benign conditions (Table 1). In premenopausal patients, the surgical procedure was performed during the follicular phase of the cycle. Oophorectomy was performed in 17 premenopausal women because they were 45 years of age, and in the other three cases because of severe endometriosis involving both adnexa (n 1) and adnexal abnormalities (n 2). The two groups were matched for age and parity. This study was approved by our Institutional Review Board, and all patients gave informed consent. Postmenopausal status was confirmed by serum FSH levels 40 mui/ml and serum E 2 30 pg/ml. Exclusion criteria were body mass index 30 kg/m 2 and 18 kg/m 2, smoking patients, any serious medical condition, hypertension, current or recent ( 3 months) treatment with a general medication (i.e., antihypertensive drugs, hormonal therapies) that could interfere with vascular-tone regulation, and previous pelvic surgery (including cesarean section). At discharge (5 days after surgery), all patients underwent blood-pressure measurement. Specimens During hysterectomy, a sample of uterine artery was obtained and divided into two parts. The first part was immediately fixed in Bouin s solution and then embedded in paraffin for immunohistochemical studies. The second part was immediately frozen and stored at 80 C for Westernblot analysis. Immunohistochemistry Antisera The following monoclonal and polyclonal antibodies at the following dilutions were used as primary antisera: rabbit anti-e2 1:100 (Sigma, St. Louis, MO), mouse anti-human ER 1:50 (Zymed, San Francisco, CA), rabbit anti-sp 1:500 (RPMS, London, United Kingdom), rabbit anti-npy 1:500 (Sigma), rabbit anti-vip 1:500 (Biomeda Corp., Forster City, CA), and rabbit anti-s100 1:250 (Sigma). Biotinylated goat anti-mouse IgG (Becton & Dickinson, Milan, Italy) and goat anti-rabbit IgG (Calbiochem, Milan, Italy) were used as secondary antisera, at dilutions of 1:200 and 1:20,000, respectively. Avidin-biotin-peroxidase complex (ABC-HRP; Vector Laboratories, Burlingame, CA) was used to reveal antibodyantigen complexes. Immunoenzymatic method After deparaffinization, serial sections were fixed with acetone (4 C) for 10 minutes, air-dried, and circled with a wax pen (Dako, Carpenteria CA). Endogenous peroxidase was inhibited by 0.3% hydrogen peroxide in phosphate-buffered saline (PBS) for 30 minutes. Positive-control breast and brain sections were processed in the same way. Sections were then rinsed three times in PBS at ph 7.3 for 5 minutes, and incubated for 10 minutes with normal goat serum at a dilution of 1:20, and then overnight at room temperature TABLE 1 Indications for hysterectomy in enrolled patients. Indications Premenopause (n 20) Postmenopause (n 20) Abnormal uterine bleeding Myomas or uterine enlargement 1 2 Endometriosis 1 0 Pelvic pain 2 1 Uterine prolapse 3 3 Di Carlo. Menopause and vasoactive neuropeptides. Fertil Steril Di Carlo et al. Menopause and vasoactive neuropeptides Vol. 88, No. 1, July 2007

105 with the primary antisera. Negative-control sections were incubated with normal rabbit serum, while unrelated antisera such as monoclonal mouse anti-insulin 1:1,500 (Sigma) and polyclonal rabbit anti-glucagon 1:3,000 (Chemicon, Milan, Italy) were used to stain pancreatic tissue as a positive control for the immunoenzymatic reaction. Nickel-sulfate enhancement with di-amino-benzidine chromogen in the presence of 0.03% H 2 O 2 was used to reveal the antigens enzymatically. Sections were counterstained with haematoxylin. Computerized analysis of the image An advanced software for analysis of images (Quantimet 520, Leica, Solms, Germany) was used to quantify the immunopositivity of sections. Images were directly acquired by a Leitz Axiophot optic microscope (Leitz, Wetzlar, Germany) at 20 enlargement with the use of a specialized video camera (DC 200, Leica). The histologically examined areas were digitized and successively processed. The optic quality of these areas was optimized by modifying the brilliance and the contrast. Immunoreactive areas were highlighted by the program on the basis of their levels of gray, and measured. The surface occupied by antigens was expressed as the percentage of area positive for the specific immunohistochemical reaction compared with the total examined area (positive pixels/total pixels). This measurement was realized for five sections of each biopsy, and six fields were analyzed per section. The mean value of antigen amount derived by the analysis of all areas in the five sections was reported. Western Blot Analysis Protein extracts were prepared from surgical samples. Briefly, samples were incubated in a lysis buffer (50 mm Tris-HCl, ph 7.4, 250 mm NaCl, and 0.1% Triton X-100) supplemented with 250- L aliquots of protease inhibitors (complete mini-edtafree [Protease Inhibitor Cocktail Tablets, Roche Applied Science Indianapolis, IN] containing 10 g/ml leupeptin, 10 g/ml pepstatin A, 0.4 mg/ml phenylmethylsulfonyl fluoride, and 5 mg/ml EDTA) for 30 minutes. and then homogenized by centrifugation at g for 20 min. The supernatant protein concentration was determined by the BioRad Protein Assay (BioRad, Richmond, CO). Equivalent amounts of protein (80 g) were separated by electrophoresis on a 12% SDS-poliacrylamide gel. After electrophoresis, proteins were tasferred onto a nitrocellulose membrane (Millipore, Bedford, MA) by semidry electroblotting. Membranes were blocked with 5% (w/v) nonfat milk for 3 hours, and incubated overnight in the blocking solution with primary antibodies. Proteins were identified, using as primary antibodies the same ones used for immunohistochemistry (diluted 1:30,000). After washing, membranes were probed with a goat anti-horseradish peroxidase-conjugated IgG used as secondary antibody (diluted 1:20,000) (BioRad) in 3% nonfat milk for 1 hour. Visualization by chemiluminescence was obtained with an ECLplus kit (Amersham Biosciences, Little Chalfont, United Kingdom), followed by autoradiography. Computer-acquired images were quantified with the use of ImageQuant SoftwareQ (Amersham Biosciences). Data from immunohistochemical studies and of Westernblot analyses are expressed in arbitrary units as median (range). Comparisons between pre- and postmenopausal women for all parameters evaluated were performed by Mann-Whitney U test. RESULTS All surgical procedures were uneventful, and no major complications were reported. No patient presented a significant increase in blood pressure at discharge. The results of immunohistochemistry are given in Table 2. Compared to uterine artery samples from premenopausal women, those from postmenopausal women had significantly higher immunopositivity for NPY (Fig. 1A,B) and significantly lower immunopositivity for SP, VIP (Fig. 1C,D), E 2, and ER. A similar immunopositivity for S100 was observed in pre- and postmenopausal samples. The results of Western-blot analysis are given in Figure 2, and confirm an increase in NPY content and a decrease in TABLE 2 Immunohistochemistral evaluation of vasoactive intestinal peptide, substance P, neuropeptide Y, E 2, estrogen receptor, and S100. Groups VIP SP NPY E 2 ER S100 Premenopause (n 20) Postmenopause (n 20) ( ) a ( ) b ( ) a ( ) a ( ) a ( ) ( ) ( ) ( ) ( ) ( ) ( ) Note: Values are given as median (range) of arbitrary units. a P.01 versus postmenopause. b P.05 versus postmenopause. Di Carlo. Menopause and vasoactive neuropeptides. Fertil Steril Fertility and Sterility 97

106 FIGURE 1 (A) Immunostaining for VIP in uterine artery from a premenopausal woman: ABC-HRP method. Original magnification 400. (B) Immunostaining for VIP in uterine artery from a premenopausal woman: ABC-HRP method. Original magnification 400. (C) Immunopositivity for NPY in uterine artery from a postmenopausal woman: ABC-HRP method. Original magnification 400. (D) Immunopositivity for NPY in uterine artery from a postmenopausal woman: ABC-HRP method. Original magnification 400. Di Carlo. Menopause and vasoactive neuropeptides. Fertil Steril SP, VIP, E 2, and ER in samples from postmenopausal patients. No difference in S100 content was present. DISCUSSION In this study, we found a decrease in E 2 and ER content in the uterine arteries of postmenopausal women, compared to premenopausal subjects. Estrogens are well-known to induce their own receptors (8), and, thus a decrease in the E 2 and ER content in the tissues of postmenopausal women is the logical consequence of postmenopausal hypoestrogenism. Such a reduction in E 2 and ER in the uterine artery wall was associated with a decrease in SP and VIP, which are vasodilator neuropeptides, and with an increase in NPY, which is a well-known vasoconstrictor peptide. These results confirm our previous findings in the nasal mucosa, where we observed a decrease in VIP and SP, and an increase in NPY, after menopause (6,7). In that study, tissue-replacement treatment with E and progestogen was able to restore the normal content of vasoactive neuropeptides, improving both nasal symptomatology and function. The restoration of premenopausal levels of NPY, SP, and VIP in the human nasal mucosa after replacement treatment with E and progestogen suggests that the local levels of these vasoactive peptides are somehow controlled by Es. It is therefore attractive to speculate that in the uterine artery, the variations in neuropeptide content observed after menopause are also a consequence of hypoestrogenism. No difference in S100 content was observed between the two groups (S100 is a generic neuronal marker used to assess the content of neuronal fibers). Therefore, we can conclude that the differences in neuropeptide content that we observed are likely the consequence of a functional shift, rather than being caused by an alteration in the number of neuronal fibers. Whether these variations in vasoactive peptides really have a role in regulating vascular tone, and thus blood pressure, remains to be ascertained. Blood pressure is lower in premenopausal women than in age-matched men, and rises after menopause (9,10). Moreover, fluctuations in circulating E affect vasodilatation and blood pressure. All these data suggest that E plays a critical role in regulating blood pressure. Indeed, it is well-known 98 Di Carlo et al. Menopause and vasoactive neuropeptides Vol. 88, No. 1, July 2007

107 FIGURE 2 (A) Representative gels of Western blot for VIP (a), SP (b), and NPY (c); specimens from uterine artery of a premenopausal woman (1) and postmenopausal woman (2), respectively. (B) Optical densitometry evaluation of Western blots for VIP, SP, NPY, E 2,ER, and S100. Data are given as median and range of arbitrary units. The value is the average of three independent experiments. *P.01 versus postmenopause. Di Carlo. Menopause and vasoactive neuropeptides. Fertil Steril that Es cause vasodilatation through both rapid release of nitric oxide (a nongenomic mechanism) and long-term induction of nitric oxide synthase genes (a genomic mechanism) (11 13). Moreover, long-term administration of Es increases coronary vasodilatation after acetylcholine administration in postmenopasusal women (14). None of our patients developed hypertension after ovariectomy. However, 5 days might be too short a period to allow the detection of small variations. Moreover, small increases in mean pressure might require more sophisticated instruments to be detected (15). Our study suggests that postmenopausal hypoestrogenism may cause an increase in arterial vascular tone through a reduction of vasodilator peptides and an increase in vasoconstrictor peptides in the arterial-wall termination of the autonomous system. If our data are confirmed in other vascular beds, these changes in vasoactive-peptide content in the arterial walls may represent a new mechanism underlying the negative effects of menopausal hypoestrogenism on the cardiovascular system. REFERENCES 1. Carr MC. The emergence of the metabolic syndrome with menopause. J Clin Endocrinol Metab 2003;88: Mendelsohn ME, Karas RH. Molecular and cellular basis of cardiovascular gender differences. Science 2005;308: Keaney JF Jr, Shwaery GT, Xu A, Nicolosi RJ, Loscalzo J, Foxall TL, et al. 17 -Estradiol preserves endothelial vasodilator function and limits low-density lipoprotein oxidation in hypercholesterolemic swine. Circulation 1994;89: Speroff L. A clinician s review of the WHI-related literature. Int J Fertil Womens Med 2004;49: Gibbins IL, Jobling P, Morris JL. Functional organization of peripheral vasomotor pathways. Acta Physiol Scand 2003;177: Nappi C, Di Spiezio Sardo A, Guerra G, Bifulco G, Testa D, Di Carlo C. Functional and morphological evaluation of the nasal mucosa before and after hormone therapy in postmenopausal women with nasal symptoms. Fertil Steril 2003;80: Nappi C, Di Spiezio Sardo A, Guerra G, Di Carlo C, Bifulco G, Acunzo G, et al. Comparison of intranasal and transdermal estradiol on nasal mucosa in postmenopausal women. Menopause 2004;11: Speroff L, Fritz MA. Mechanism of action for steroids hormones. In: Speroff L, Fritz MA, eds. Clinical gynecologic endocrinology and infertility, 7th ed. Philadelphia: Lippincott Williams & Wilkins, 2005: Dubey RK, Oparil S, Imthurn B, Jackson EK. Sex hormones and hypertension. Cardiovasc Res 2002;53: Sader MA, Celermajer DS. Endothelial function, vascular reactivity and gender differences in the cardiovascular system. Cardiovasc Res 2002; 53: Mendelshon ME, Karas RH. The protective effects of estrogen on the cardiovascular system. N Engl J Med 1999;340: Edwards DP. Regulation of signal transduction pathways by estrogen and progesterone. Annu Rev Physiol 2005;67: Chambliss KL, Shaul PW. Estrogen modulation of endothelial nitric oxide synthase. Endocr Rev 2002;23: Herrington DM, Braden GA, Williams JK, Morgan TM. Endothelial dependent coronary vasomotor responsiveness in postmenopausal women with and without estrogen replacement therapy. Am J Cardiol 1994;73: Affinito P, Palomba S, Bonifacio M, Fontana D, Izzo R, Trimarco B, et al. Effects of hormonal replacement therapy in postmenopausal hypertensive patients. Maturitas 2001;40: Fertility and Sterility 99

108 Effects of testosterone and estrogen treatment on lipolysis signaling pathways in subcutaneous adipose tissue of postmenopausal women Hong Zang, M.D., a Mikael Rydén, M.D., PhD., b Kerstin Wåhlen, b Karin Dahlman-Wright, M.D., PhD., c Peter Arner, M.D., PhD., b and Angelica Lindén Hirschberg, M.D., PhD. a a Department of Woman and Child Health, Division of Obstetrics and Gynecology, Karolinska Institutet, b Department of Medicine, Karolinska University Hospital Huddinge, Karolinska Institutet, and c Department of Bioscience and Nutrition, Novum, Karolinska Institutet, Stockholm, Sweden Objective: The aim of this study was to investigate the treatment effects of testosterone and estrogen on the expression of proteins and genes involved in adipocyte signal transduction to lipolysis in abdominal subcutaneous adipose tissue of postmenopausal women. Design: An open, randomized clinical study with parallel group comparison. Setting: Women s health clinical research unit and a research laboratory at a university hospital. Patient(s): Thirty-six healthy naturally postmenopausal women. Intervention(s): The participants were randomly given testosterone undecanoate (40 mg every second day) or estradiol valerate (2 mg daily) for 3 months. Main Outcome Measure(s): Expression of proteins and genes involved in adipocyte signal transduction to lipolysis in abdominal subcutaneous adipose tissue, determined by quantitative real-time polymerase chain reaction and Western blot, respectively, and related to plasma glycerol before or during a euglycemic hyperinsulinemic clamp. Result(s): Testosterone treatment decreased the expression of hormone-sensitive lipase and increased the expression of phosphodiesterase-3b, whereas no effect of estrogen was observed. Testosterone-induced changes in hormone-sensitive lipase expression correlated positively with corresponding changes in basal or clampinduced plasma glycerol concentrations. Conclusion(s): Treatment with testosterone in postmenopausal women down-regulates hormone-sensitive lipase and up-regulates phosphodiesterase-3b expressions in abdominal subcutaneous adipose tissue in relation to changes in vivo of lipolytic activity, which may promote the accumulation of fat. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Testosterone, fat cell, catecholamines, insulin, Western blot, mrna, menopause During the past years there has been an increasing interest in androgen therapy in surgically or naturally menopausal women. Several studies have shown that testosterone therapy improves multiple aspects of sexual function in postmenopausal women (1 4). Androgen treatment has also been reported to have positive effects on initiative, energy, and well-being (2, 3), as well as beneficial effects on bone mass and body composition (4, 5). However, little is known about side effects and safety of androgens, and there are concerns about adverse effects on metabolism. Hyperandrogenism in women, such as in polycystic ovary syndrome (PCOs), is associated with android obesity, which is an independent risk factor for cardiovascular disease and type 2 diabetes (6). Received May 22, 2006; revised October 26, 2006; accepted November 16, This study was supported by grants from Swedish Research Council, Novo Nordic Foundation, Swedish Diabetes Association, and Swedish Heart and Lung Foundation. Reprint requests: Hong Zang, M.D., Department of Woman and Child Health, Division of Obstetrics and Gynecology, Karolinska Institutet, SE Stockholm, Sweden (FAX: ; hzang@ hotmail.com). There is evidence that sex hormones are involved in the regulation of lipolysis and body fat distribution (7 10). Sex hormones may influence lipolysis through interactions with signal transduction pathways for catecholamines or insulin in adipocytes. Insulin and catecholamines use the cyclic AMP (camp) system in the regulation of lipolysis (11). The catecholamine effects are mediated by several adrenergic receptor subtypes that stimulate ( 1-AR, 2-AR, and 3- AR) or inhibit ( 2-AR) formation of camp. Cyclic AMP activates the protein kinase A (PKA) complex, which in turn, causes phosphorylation and activation of hormone-sensitive lipase (HSL), so that lipolysis is activated. Insulin inhibits lipolysis through activation of phosphatidyl inositol-3 kinase (PI3K), which in turn, causes phosphorylation of phosphodiesterase 3B (PDE-3B), leading to reduced intracellular level of camp. Decreased phosphorylation of HSL is the final step in the antilipolytic effect of insulin. Several studies show important interactions between catecholamine-induced lipolysis and sex hormones. In vitro stimulation of human subcutaneous fat cells with either estrogen or testosterone blunts catecholamine-induced lipol- 100 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

109 ysis (9, 10). The estrogen effect has been linked to increased expression of the antilipolytic 2-AR and the testosterone effect is attributed to the decreased expression of both 2-AR and HSL (9, 10, 12). Very little is known about the in vivo effects of sex hormones on the adipocyte lipolytic regulating system in humans. Estrogen treatment decreased basal lipolysis in subcutaneous fat cells of male-to female transsexuals (13), whereas testosterone increased basal lipolysis in female-to-male transsexuals (13). Treatment of postmenopausal women with estrogen therapy caused blunted stimulated lipolytic effect of catecholamines (14). Hormone therapy with estrogen plus norethisterone acetate increased mrna expression of 2-AR in subcutaneous adipose tissue of postmenopausal women (10). However, in none of these investigations was there any report on the proteins involved in catecholamine signal transduction. There is lack of knowledge about effects of androgen therapy on adipose tissue metabolism in postmenopausal women. The present study was conducted to investigate the effect of treatment with testosterone or estrogen on the expression of proteins and genes involved in adipocyte signal transduction to lipolysis in abdominal subcutaneous adipose tissue of healthy naturally postmenopausal women. The expression of signaling proteins was set in relation to circulating glycerol levels that were used as an index of in vivo lipolytic activity. MATERIALS AND METHODS Subjects Healthy naturally postmenopausal women aged 44 to 64 years with body mass index (BMI) between 20 and 30 kg/m 2 were included in a study comparing metabolic effects of estrogen and testosterone alone or in combination (15). All had last menstrual bleeding 12 months before the study or FSH levels 30 IU/L. The women were subjected to the following washout periods: 8 weeks for oral hormone therapy, 4 weeks for transdermal hormone therapy or local estrogen applications, and 6 months for progestin implants or injections. Exclusion criteria were liver, bilary, or renal disease, uncontrolled high blood pressure, endocrine disorder, history or presence of thromboembolic disorder, and malignancy. Only nonsmokers were included in the study. None were completely sedentary or involved in athletics performances. All women gave their informed consent before participating in the study. The study was approved by the Ethics Committee of Karolinska University Hospital. Study Design The women were randomly assigned into three groups (1:1: 1). One group (n 21) received testosterone undecanoate (Organon, Oss, the Netherlands) 40 mg orally every second day (T group). The second group (n 22) was treated with oral estradiol valerate (Orion Pharma, Esbo, Finland) 2 mg daily (E group). The third group (n 20) received testosterone in combination with estradiol but was not included in the present study of adipose tissue. All women were treated for 3 months. Investigations were performed before and at the end of the treatment period. After an overnight fasting, they underwent a general health examination including registration of body weight and height to calculate BMI and waist/hip ratio. A fasting blood sample, which was obtained 12 or 36 hours after hormone administration, was drawn from a peripheral vein for the analysis of hormones in serum and glycerol in plasma. Serum and plasma were stored at 70 C pending analysis. Thereafter an abdominal adipose tissue biopsy ( 600 mg) was obtained by a subcutaneous needle aspiration as described (16) randomly from the left or right abdomen at the level of the umbilicus. Tissue biopsies were immediately washed in saline and divided into two portions of 300 mg. Each portion was frozen in liquid nitrogen and stored at 70 o C. For technical reasons it was only possible to obtain a sufficiently large fat biopsy (at least 300 mg) before as well as after sex hormone treatment in 18 women of the T group and in 18 women of the E group. Finally, a euglycemic, hyperinsulinemic clamp was performed exactly as previously described (15). In brief, insulin and glucose were infused for 120 minutes intravenously. During the last 110 minutes insulin was infused at 1 mu/ kg/min. Plasma glycerol was determined in duplicate before and during the clamp. Analysis of Serum and Plasma Analysis of insulin, sex hormones, and sex hormone binding globulin was done as described before (15). Glycerol was determined by bioluminescense (17). Because of technical mistakes, two glycerol measures in the T groups are missing. Glycerol was expressed as absolute concentration and as concentration corrected for total body fat. The latter was determined by dual-energy x-ray absorptiometry as previously described (15). Protein Isolation and Western Blot Analysis One frozen adipose tissue portion, 300 mg (minimum amount for Western blot analysis), was crushed and lysed in protein lysis buffer (1% Triton-X 100, Tris HCl ph 7.6, and 150 mmol/l NaCl, 4 C), supplemented with protease inhibitors (1 mmol/l phenylmethylsulfonyl fluoride and Complete [Boehringer Mannheim, Mannheim, Germany]), and homogenized using a microtome. The homogenate was centrifuged at 14,000 rpm for 30 minutes, and the infranatant was collected and saved. The protein content in each sample was determined using a kit of reagents from Pierce Biotech (Rockford, IL). One hundred micrograms of total protein was loaded on polyacrylamide gels and separated by standard sodium dodecyl sulphate-polyacrylamide gel. Baseline and after treatment samples from the same subject were run Fertility and Sterility 101

110 on the same gels and transferred to the same polyvinylidine fluoride membranes (Amersham Pharmacia Biotech, Little Chaffore, UK). Blots were blocked for 1 hour at room temperature in Tris-buffered saline with 0.1% Tween-20 and 5% nonfat dried milk. This was followed by an overnight incubation at 4 C in the presence of antibodies directed against 2-AR, 2-AR, HSL, the regulatory I (REG-I ) and II (REG-II ), -actin ( housekeeping protein) and PI3K. The antibodies other than HSL were from Santa Cruz Biotechnology (Santa Cruz, CA) for 2-AR and 2-AR, Transduction Laboratories (San Diego, CA) for REG-I and REG-II, Upstate Biotechnology (Billerica, MA) for PI3K, and Sigma (St. Louis, MO) for -actin. To confirm antibody specificity, positive controls were included in all experiments as provided by the manufacturer. Secondary antibodies conjugated to horseradish peroxidase were from Sigma ( -mouse 1:100,000, -rabbit, and -chicken). Antigen antibody complexes were detected by chemiluminescence using a kit of reagents form Pierce (Supersignal; Rockford, Rockford, IL), and blots were exposed to high-performance chemiluminescence film (Amersham, Little Chalfont, UK). Films were scanned, and the optical density (OD) of each specific band was analyzed using the Image program (National Institutes of Health, Bethesda, MD) and expressed as (OD mm g 1 of total protein). RNA Extraction and Real-Time Polymerase Chain Reaction Total RNA was extracted from 300 mg of adipose tissue using the RNeasy mini kit (Qiagen GmbH, Hilden, Germany) and the RNA concentration and purity were assessed spectrophotometrically. One microgram of total RNA from each sample was reverse transcribed to cdna using the Omniscript RT kit (Qiagen) and random hexamer primers (Invitrogen, Tåstrup, Denmark). The Agilent 2100 Bioanalyzer (Agilent Technologies, Kista, Sweden) was used to confirm the integrity of the RNA. In a final volume of 25 L, 5 ng of cdna was mixed with 2 SYBR green polymerase chain reaction (PCR) master mix (Bio-Rad Laboratories Inc., Hercules, CA), and primers (Invitrogen). The primer pairs were selected to yield a single amplicon based on dissociation curves and analysis by agarose gel electrophoresis. The primers for HSL were 5=-CTCAGTGTGCTCTCCAAGTG-3= (sense) and 5=-CACCCAGGCGGAAGTCTC-3= (antisense). The primers for PDE-3B were ATGAGCAGGAGATGAAGAAG (sense) and AACCAGCAGCATCATAGGAG (antisense). The primers for IRS-1 were TGCCAGCATCAGTTTCCAG (sense) and AGAAGAGGATTTGCTGAGGTC (antisense). Results were related to the reference rrna 18S, which was amplified with the following primers 5=-TGACTCAACACGGGAAACC-3= (sense) and 5=-TCGCTCCACCAACTAAGAAC-3= (antisense). Quantitative real-time PCR was performed in an icycler IQ (Bio-Rad Laboratories Inc.). The mrna levels were determined by a comparative C t method (see user bulletin #2, ABI Prism 7700, pp , available from Applied Biosystems, Foster City, CA). The subject with the highest C t value was used as a reference; all other C t values for the target gene and reference gene, respectively, were subtracted from this C t value. The C t values were then normalized to rrna for 18S. Statistics Results are expressed as mean standard deviation (SD), mean standard error (SE), or as median quartile range (P 25 P 75 ) according to distribution. Differences within groups were analyzed using Student s paired t test or Wilcoxon s signed rank test pending normal distribution or not. Bonferroni correction of P values was performed according to the formula number of comparisons minus 1 times the P value. Regression analysis by the method of least squares or Spearman correlation (when values were not normally distributed) was also employed. A value of P.05 was considered as statistically significant. RESULTS Clinical Data Baseline characteristics of the 18 postmenopausal women in the E and T groups, who completed the study regarding adipose biopsies, are shown in Table 1. The T and E groups were of comparable age, age at menopause, BMI, waist/hip ratio, plasma glycerol, and serum hormone or sex hormone binding globulin concentration at baseline. BMI range was kg/m 2 in the T group and kg/m 2 in the E group. Circulating levels of total and free testosterone increased significantly in the T group after treatment. There was a slight but significant increase in BMI in both treatment groups at the second examination. Plasma glycerol levels during the euglycemic hyperinsulinemic clamp (clamp glycerol) were significantly decreased by 15% (P.040) following testosterone treatment, and there was a similar tendency for basal glycerol (P.107). Similar results were obtained when glycerol concentration was corrected for total body fat (values not shown). Using this calculation testosterone treatment decreased clamp glycerol by 20% (P.022). Fasting serum insulin concentration was reduced by 40% after estrogen treatment but not altered by testosterone treatment. There was no apparent deviation in clinical findings among the few women in each group (three and four, respectively) who did not complete the study because of lack of adipose tissue compared with the subjects presented in Table 1. Western Blot Analysis Table 2 shows the optical density readings of Western blot for the signal transduction proteins 2-AR, 2-AR, REG-I, REG-II, PI3K, HSL, and the housekeeping protein, -actin. Protein for T and E groups were run on separate 102 Zang et al. Testosterone and fat cells in women Vol. 88, No. 1, July 2007

111 TABLE 1 Clinical characteristics, hormone and glycerol levels at baseline and after treatment with testosterone (T group) or estradiol (E group). T(n 18) E (n 18) Baseline After treatment Baseline After treatment Age (years) Age at menopause BMI (kg/m 2 ) ** * W/H ratio E 2 (pg/ml) 11 (9 12) 9 (8 15) FSH (IU/L) 79 (63 90) 68 (61 80) S-total T (ng/dl) 20 (16 28) 58 (35 83)*** 24 (21 33) 24 (18 29) S-free T (pg/ml) 2.6 ( ) 8.4 ( )*** 3.7 ( ) 1.9 ( ) S-SHBG (mg/l) *** S-insulin (mu/l) 3.1 ( ) 3.2 ( ) 2.8 ( ) 1.7 ( )** P-basal glycerol (mg/dl) P-clamp glycerol (mg/dl) * Note: FSH follicle stimulating hormone; P plasma; S serum. The values are mean SD or median (P 25 P 75 ). Significant differences from baseline are denoted by * P.05, ** P.01, *** P.001. Conversion factors to SI units; T, testosterone (nmol/l); Free T (pmol/l); E 2, estradiol 3.7 (pmol/l); SHBG, sex hormone binding globulin 10.9 (nmol/l), Glycerol, ( mol/l). Zang. Testosterone and fat cells in women. Fertil Steril blots, which might explain the baseline variation between groups for 2-AR and PI3K. Only one protein, namely HSL, was influenced by sex hormone therapy. HSL expression decreased by one half following administration of testosterone in the T group (P.0019). We investigated two modes of therapies on seven proteins, making 14 comparisons in total. Therefore, we made a very conservative correction of the P value using the Bonferroni method. The testosterone effect on HSL expression remained significant after this correction (P.025). One of the proteins (REG-I ) was expressed at very low and undetectable amounts in most of the women. There was considerable interindividual variation in PI3K values (Table 2). Therefore, OD readings for all study proteins were related to the reading of the housekeeping protein -actin. Regarding HSL, estrogen treatment did not influence HSL/ actin ratio, which was about 1.2. However, testosterone treatment decreased the ratio by half from to (P.0013). A Bonferroni correction of this P value gave P.017. None of the other protein ratios showed a significant influence of testosterone or estrogen treatment (values not shown). To study the relationship between HSL expression in adipose tissue and plasma concentration of glycerol a correlation analysis of these parameters was performed. Regarding absolute values, a weak but significant (r 0.37, P.036) relationship was observed at baseline between HSL expression and clamp glycerol values in the whole material (T E). On the other hand, the net changes (delta values) in plasma glycerol and HSL (after treatment minus before treatment) were strongly interrelated in the T group (Fig. 1). This was true for basal glycerol values (r 0.6, P.013) and clamp glycerol values (r 0.7, P.005). Real-Time-PCR To find out the importance of gene expression for the protein findings with HSL we measured mrna for HSL and related it to the housekeeping gene 18S and expressed data as a ratio of the two mrnas (Table 3). The absolute values of 18S mrna were not influenced by any of the treatments (values not shown). HSL/18S ratios were not influenced by testosterone or estrogen treatments (mean ratios ranged between 1.4 and 1.5). Because of technical and practical reasons we did not measure PDE-3B and IRS-1 proteins. However, the 18s ratio for the corresponding mrnas were determined, and data are presented in Table 3. IRS-1 gene expression was not influenced by testosterone or estrogen treatment; mean ratios varied between 5 and 9. However, relative mrna expression of PDE-3B was increased threefold by testosterone treatment. Influence of Age and BMI A correlation analysis was made between age or BMI, on the one hand, and values of glycerol, mrna or protein, on the Fertility and Sterility 103

112 TABLE 2 Protein amounts in subcutaneous adipose tissue at baseline and after treatment with testosterone (T group) or estradiol (E group). T(n 18) E (n 18) Baseline After treatment Baseline After treatment 2-AR 1, , , , AR 455 ( ) 163 (72 919) 364 (0 2,545) 149 (0 1,342) REG-I ND ND ND ND REG-II 1, , , PI3K 4,142 (2,007 18,502) 4,045 (1,414 13,341) 9,484 (1,883 13,514) 5,360 (1,191 14,905) HSL 1, ** actin , Note: 2-AR Beta 2 -adrenoreceptor; 2-AR Alpha 2 -adrenoreceptor; HSL hormone sensitive lipase; OD optical density; REG-I and II protein kinase A-regulatory subunits and ; PI3K phosphatidyl inositol 3 kinase; ND not detectable. Values are mean SE or median (P 25 P 75 ) (OD mm g 1 total protein). Significant difference from baseline is denoted by ** P.01. Zang. Testosterone and fat cells in women. Fertil Steril FIGURE 1 Correlation between the change of clamp glycerol (mg/dl, during euglycemic hyperinsulinemic clamp) and the change of adipose HSL (OD mm g 1) in the testosterone treatment group. Delta is the value after treatment minus before treatment. There was a significant positive correlation between HSL and clamp glycerol (r 0.7, P.01). Conversion factor to SI unit: Glycerol, ( mol/l). HSL, hormone-sensitive lipase. Zang. Testosterone and fat cells in women. Fertil Steril other hand. No statistically significant correlations were observed (values not shown). DISCUSSION Little is known about metabolic side effects of testosterone treatment in postmenopausal women, and there are concerns about adverse effects similar to PCOs, such as increased risk of android obesity and the metabolic syndrome. In this prospective randomized study, we treated postmenopausal women with testosterone or estrogen and examined the effects on expression of key proteins and/or genes involved in lipolysis regulation by catecholamines and insulin in abdominal subcutaneous adipose tissue. We found that treatment with testosterone, but not estrogen, influences signaling in adipose tissue with consequences for the lipolytic activity in vivo. Because of the limited amount of adipose tissue that was available, we could not perform a direct investigation of lipolysis in vitro. However, we believe that plasma glycerol is a valid indirect measure of lipolytic activity. Unlike fatty acids, the other end point of lipolysis, glycerol is not reused by adipose tissue in an important way. Regarding catecholamine signaling, the 2-AR mrna in fat cells is up-regulated by long-term hormone therapy (estradiol plus norethisterone acetate) in postmenopausal women (10). However, we found no effect of estrogen (or testosterone) on adipose protein expression of 2-AR. The difference in mode of therapy and in the duration of treatment might explain the differences in present and previous results. The 2-AR is a key receptor responsible for stimulation of lipolysis in human adipocytes as reviewed (11). In PCOs, the protein expression of 2 -AR is decreased in subcutaneous adipose tissue (18), and in vitro exposure of 104 Zang et al. Testosterone and fat cells in women Vol. 88, No. 1, July 2007

113 TABLE 3 Messenger RNA expressions in subcutaneous adipocytes at baseline and after treatment with testosterone (T group) or estradiol (E group). T(n 18) E (n 18) Baseline After treatment Baseline After treatment Phosphodiesterase-3B * Insulin receptor substrate Hormone sensitive lipase Note: Values are mean SE, mrna expression was standardized to 18S rrna. Significant difference from baseline is denoted by * P.05. Zang. Testosterone and fat cells in women. Fertil Steril human subcutaneous fat cells to testosterone down-regulates the protein expression of 2 -AR (9). However, neither testosterone nor estrogen altered 2 -AR expression in the present study. It is hard to explain the lack of effect of testosterone by a too small elevation of the circulating testosterone level. In our study, testosterone treatment increased circulating total testosterone to similar levels and free testosterone to nearly the same levels as seen in PCOs (19, 20). Furthermore, the treatment period was not too short because the in vitro effect of testosterone on 2-AR is observed after only a few days (9). It is possible that lack of testosterone effect is because of some compensatory mechanism occurring in vivo. Regarding insulin signaling, the expression of IRS-1 and PI3K were not influenced by testosterone or estrogen treatment. On the other hand, the final target in lipolysis for insulin, namely PDE-3B, was markedly influenced by testosterone treatment. Testosterone up-regulated gene expression of PDE-3B by threefold. Unfortunately, we cannot say how this relates to protein expression or enzyme activity of PDE-3B, although it is likely that such a marked increase in mrna would be accompanied by testosterone-induced increase of PDE-3B protein and function in adipose tissue. This notion is supported by our previous findings of a close relationship between PDE3B mrna levels and PDE3B enzyme activity in human fat cells (21). Because insulin activates PDE-3B, the present finding is compatible with the notion that testosterone treatment leads to increased antilipoltyic effect of insulin. Indeed, insulin, during euglycemic conditions, caused a 20% more pronounced lowering of plasma glycerol concentration after testosterone treatment, which is indicative of enhanced in vivo antilipolytic effect of insulin in fat tissue. Insulin and catecholamine signaling converge at camp, which in turn, stimulates the PKA complex. REG-II is a key component of the PKA complex. Depletion of REG-II in fat cells alters catecholamine-induced lipolysis (22, 23), and in hyperandrogenic PCOs the expression of this protein is decreased in subcutaneous adipose tissue (18). In the present study, REG-II expression was not influenced by any form of sex hormone therapy. This may suggest that other factors besides sex hormones are involved in dysregulation of REG-II adipocyte expression in PCOs. REG-I protein amounts are up-regulated in visceral fat cells but expressed at low or undetectable amounts in subcutaneous adipose tissue (18, 24). We could not detect this protein in most of the subjects in the T and E groups. HSL is the final rate-limiting step in lipolysis of fat cells, and marked down-regulation of this protein is obtained with in vitro exposure of human subcutaneous fat cells with testosterone (9, 12). Likewise, HSL protein expression is reduced by half in subcutaneous adipose tissue of PCOs women (18). The lipolytic capacity of human subcutaneous fat cell is proportional to the amount of HSL protein in these cells (25). In this study we observed that the HSL protein content of subcutaneous adipose tissue was reduced by half after testosterone. The present and previous data strongly favor the hypothesis that testosterone is a major regulator of HSL in humans by decreasing its protein expression in subcutaneous fat cells. This might cause the previously observed lipolytic catecholamine resistance in subcutaneous fat cells of hyperandrogenic PCOs women (26). Unfortunately, the limited amounts of adipose tissue that were available in the present study did not allow direct investigation of adipocyte lipolysis. However, there was indirect evidence of an in vivo effect of testosterone-induced down-regulation of HSL on lipolytic activity as evidenced by the findings on plasma glycerol before and during hyperinsulinemic euglycemic clamp. The testosterone-induced change in basal or clamp glycerol values correlated positively and strongly (r ) with corresponding changes in the amount of HSL protein. These data suggest a regulatory role of testosterone via HSL on lipolytic activity in vivo. Several factors could be responsible for the testosterone effect on HSL. The most likely one is posttranscriptional down-regulation of HSL production because mrna for HSL was not influenced by testosterone. On the other hand, Fertility and Sterility 105

114 increased protein degradation (not measured) could also be involved. Estrogen treatment had no effect on HSL expression. This further emphasizes the insensitivity of subcutaneous adipocyte lipolytic system to estrogen, at least in postmenopausal women. Age and BMI showed interindividual difference. This has most likely not been of importance for the present results. There is no published evidence for an influence of age on lipolysis regulation when women have entered the postmenopausal age. The same is true for BMI when only nonobese subjects are examined (as in the present study). Furthermore, there was no influence of age or BMI on plasma glycerol, mrna, or protein in the present study. In summary, treatment with testosterone but not estrogen down-regulates HSL expression and up-regulates PDE-3B expression in subcutaneous adipose tissue of postmenopausal women. This is related to changes of in vivo lipolytic activity, and emphasizes the role of testosterone regarding lipolysis and body fat distribution. A testosterone-induced downregulation of HSL may lead to lipolytic catecholamineresistance, and increased PDE-3B expression could improve the antilipolytic effect of insulin. Both these factors might increase fat accumulation in the subcutaneous adipose tissue. The clinical significance of these findings is, however, uncertain, and motivates long-term studies also with other testosterone preparations and doses. Acknowledgments: The HSL antibody was a generous gift from C. Holm (Lund University, Sweden). The authors would like to thank the personnel at the Women s Health Research Unit at the Karolinska University Hospital for their skillful technical assistance. REFERENCES 1. Burger H, Hailes J, Nelson J, Menelaus M. Effect of combined implants of oestradiol and testosterone on libido in postmenopausal women. Br Med J (Clin Res Ed) 1987;294: Sherwin BB. Affective changes with estrogen and androgen replacement therapy in surgically menopausal women. J Affect Disord 1988; 14: Flöter A, Nathorst-Böös J, Carlström K, von Schoultz B. Addition of testosterone to estrogen replacement therapy in oophorectomized women: effects on sexuality and well-being. Climacteric 2002;5: Davis SR, McCloud P, Strauss BJ, Burger H. Testosterone enhances estradiol s effects on postmenopausal bone density and sexuality. Maturitas 1995;21: Watts NB, Notelovitz M, Timmons MC, Addison WA, Wiita B, Downey LJ. Comparison of oral estrogens and estrogens plus androgen on bone mineral density, menopausal symptoms, and lipid-lipoprotein profiles in surgical menopause. Obstet Gynecol 1995;85: Cattrall FR, Healy DL. Long-term metabolic, cardiovascular and neoplastic risks with polycystic ovary syndrome. Best Pract Res Clin Obstet Gynaecol 2004;18: Lovejoy JC, Bray GA, Bourgeois MO, Macchiavelli R, Rood JC, Greeson C, et al. Exogenous androgens influence body composition and regional body fat distribution in obese postmenopausal women a clinical research center study. J Clin Endocrinol Metab 1996;81: Elbers JM, Asscheman H, Seidell JC, Megens JA, Gooren LJ. Longterm testosterone administration increases visceral fat in female to male transsexuals. J Clin Endocrinol Metab 1997;82: Dicker A, Ryden M, Naslund E, Muehlen IE, Wiren M, Lafontan M, et al. Effect of testosterone on lipolysis in human pre-adipocytes from different fat depots. Diabetologia 2004;47: Pedersen SB, Kristensen K, Hermann PA, Katzenellenbogen JA, Richelsen B. Estrogen controls lipolysis by up-regulating alpha2a-adrenergic receptors directly in human adipose tissue through the estrogen receptor alpha. Implications for the female fat distribution. J Clin Endocrinol Metab 2004;89: Arner P. Human fat cell lipolysis: biochemistry, regulation and clinical role. Best Pract Res Clin Endocrinol Metab 2005;19: Anderson LA, McTernan PG, Harte AL, Barnett AH, Kumar S. The regulation of HSL and LPL expression by DHT and flutamide in human subcutaneous adipose tissue. Diabetes Obes Metab 2002;4: Elbers JM, de Jong S, Teerlink T, Asscheman H, Seidell JC, Gooren LJ. Changes in fat cell size and in vitro lipolytic activity of abdominal and gluteal adipocytes after a one-year cross-sex hormone administration in transsexuals. Metabolism 1999;48: Lindberg UB, Crona N, Silfverstolpe G, Björntorp P, Rebuffé-Scrive M. Regional adipose tissue metabolism in postmenopausal women after treatment with exogenous sex steroids. Horm Metab Res 1990;22: Zang H, Carlström K, Peter A, Lindén Hirschberg A. Effects of treatment with testosterone alone or in combination with estrogen on insulin sensitivity in postmenopausal women. Fertil Steril 2006;86: Kolaczynski JW, Morales LM, Moore JH Jr, Considine RV, Pietrzkowski Z, Noto PF, et al. A new technique for biopsy of human abdominal fat under local anaesthesia with Lidocaine. Int J Obes Relat Metab Disord 1994;18: Hellmér J, Arner P, Lundin A. Automatic luminometric kinetic assay of glycerol for lipolysis studies. Anal Biochem 1989;177: Faulds G, Rydén M, Ek I, Wahrenberg H, Arner P. Mechanisms behind lipolytic catecholamine resistance of subcutaneous fat cells in the polycystic ovarian syndrome. J Clin Endocrinol Metab 2003;88: Holte J, Bergh T, Gennarelli G, Wide L. The independent effects of polycystic ovary syndrome and obesity on serum concentrations of gonadotrophins and sex steroids in premenopausal women. Clin Endocrinol (Oxf) 1994;41: Apridonidze T, Essah PA, Iuorno MJ, Nestler JE. Prevalence and characteristics of the metabolic syndrome in women with polycystic ovary syndrome. J Clin Endocrinol Metab 2005;90: Dicker A, Kaaman M, van Harmelen V, Åström G, Blanc KL, Rydén M. Differential function of the alpha2a-adrenoceptor and Phosphodiesterase-3B in human adipocytes of different origin. Int J Obes (Lond) 2005;29: Planas JV, Cummings DE, Idzerda RL, McKnight GS. Mutation of the RIIbeta subunit of protein kinase A differentially affects lipolysis but not gene induction in white adipose tissue. J Biol Chem 1999;274: Amieux PS, Cummings DE, Motamed K, Brandon EP, Wailes LA, Le K, et al. Compensatory regulation of RIalpha protein levels in protein kinase A mutant mice. J Biol Chem 1997;272: Ek I, Arner P, Rydén M, Holm C, Thörne A, Hoffstedt J, et al. A unique defect in the regulation of visceral fat cell lipolysis in the polycystic ovary syndrome as an early link to insulin resistance. Diabetes 2002;51: Large V, Arner P, Reynisdottir S, Grober J, Harmelen V, Holm C, et al. Hormone-sensitive lipase expression and activity in relation to lipolysis in human fat cells. J Lipid Res 1998;39: Ek I, Arner P, Bergqvist A, Carlström K, Wahrenberg H. Impaired adipocyte lipolysis in nonobese women with the polycystic ovary syndrome: a possible link to insulin resistance? J Clin Endocrinol Metab 1997;82: Zang et al. Testosterone and fat cells in women Vol. 88, No. 1, July 2007

115 OVULATION INDUCTION The prevalence and influence of luteinizing hormone surges in stimulated cycles combined with intrauterine insemination during a prospective cohort study Astrid E. P. Cantineau, M.D., a,b, and Bernard J. Cohlen, M.D., Ph.D., a on behalf of the Dutch IUI Study Group a Subfertility Unit, Department of Obstetrics and Gynaecology, Isala Clinics, Zwolle, the Netherlands; b Department of Obstetrics and Gynaecology, Medical Centre Leeuwarden, the Netherlands Objective: To reveal the prevalence of premature LH surges in an IUI program. Furthermore, to investigate whether these LH surges influence treatment outcome and whether the prevalence of LH surges differs between cycles stimulated with clomiphene citrate (CC) and cycles stimulated with recombinant follicle-stimulating hormone (rfsh). Design: Prospective cohort study. Setting: Subfertility patients in a tertiary institutional hospital. Patient(s): A total of 66 subfertile couples undergoing ovarian hyperstimulation combined with IUI. Intervention(s): The women were randomized through a central blocked computer system, either to receive CC (33 couples) or rfsh (33 couples), both combined with IUI. Blood for LH determination was drawn on the day of human chorionic gonadotropin administration. Main Outcome Measure(s): LH surges as well as pregnancy rates. Result(s): In a total of 153 cycles, LH was measured. In 36% of these cycles, LH surges were detected. The results showed that in 42% of the rfsh-stimulated cycles an LH surge was detected, compared with 30% in the cycles with CC (odds ratio 1.7, 95% confidence interval 0.9 to 3.3). There was a nonsignificant trend showing higher pregnancy rates in cycles without an LH surge (odds ratio 2.7, 95% confidence interval 0.6 to 13). Conclusion(s): Premature LH surges occur frequently, and they might influence treatment outcome negatively. Strategies to improve treatment outcome might focus on preventing premature LH surges. (Fertil Steril 2007; 88: by American Society for Reproductive Medicine.) Key Words: Intrauterine insemination, ovarian stimulation, premature LH surges, prospective, subfertility Received March 7, 2006; revised November 9, 2006; accepted November 21, Presented at the 21 st Annual Meeting of The European Society of Human Reproduction and Embryology, Copenhagen, Denmark, June 19 22, Present address: University Medical Centre Groningen, Groningen, the Netherlands. Reprint requests: Astrid Cantineau, M.D., University Medical Centre Groningen, Hanzeplein 1, 9700 RB Groningen, the Netherlands (FAX: ; aepcantineau@og.umcg.nl) When using ovarian stimulation protocols combined with IUI in treating subfertile couples, the final goal is a pregnancy ending in a live birth. To achieve this goal, ideally two to three dominant follicles should be achieved with mild ovarian stimulation, followed by a perfectly timed single insemination (1, 2). However, various confounding factors might influence the outcome of artificial insemination. These include, among others, couples characteristics (type of subfertility, women s age, semen quality), ovarian stimulation protocol, timing of insemination, and premature luteinization (3, 4). The influence of some of these factors still remains to be defined. Premature LH surges may also influence timing and therefore treatment outcome of IUI in cycles with ovarian stimulation. An endogenous LH increase, which occurred approximately in 50% of the cycles in couples stimulated within the framework of IVF (5), has been shown to occur also within IUI programs (4, 6, 7). A randomized study by Cohlen et al. (6) using gonadotrophins reported endogenous LH surges in 24% of the stimulated cycles. Thus, premature LH surges occur frequently in stimulated cycles. However, in most IUI programs LH levels are not determined at all and physicians might be unaware of the occurrence of LH surges and their influence /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 107

116 on treatment outcome. Until now, no prospective IUI study has been published that investigated the occurrence and influence of premature LH surges, as far as we know. The goal of this study was threefold: first, we wanted to investigate the prevalence of premature LH surges in an IUI program. Second, we wanted to investigate whether these LH surges influence treatment outcome when physicians are blinded to the results, and third, we wanted to investigate whether the occurrence of LH surges differs between cycles stimulated with clomiphene citrate (CC) and cycles stimulated with recombinant follicle-stimulating hormone (rfsh), which has never been investigated prospectively before. MATERIALS AND METHODS As part of a larger randomized multicenter IUI trial comparing the efficacy of two different stimulation protocols, we performed a single-center prospective cohort study to investigate the prevalence of LH surges in couples undergoing IUI in stimulated cycles. None of the other participating centers determined LH levels when hcg was administered, and the subject of this study therefore was no part of the large multicenter trial. Being unaware of the prevalence of LH surges in rfshstimulated cycles compared with CC-stimulated cycles, let alone their influence on treatment outcome, a power calculation could not be performed beforehand. It was chosen therefore to perform a prospective pilot study. A total of 66 subfertile couples with male factor or unexplained subfertility were included. All couples underwent a basic fertility workup consisting of a basal body temperature chart, early follicular FSH levels, ovulation detection with ultrasound, semen analysis, midluteal P levels, PRL levels, thyroid hormone levels, Chlamydia antibody titer, postcoital testing, and hysterosalpingography or diagnostic laparoscopy to exclude tubal pathology. Couples were asked to participate in this study when suffering from either male factor or unexplained primary subfertility for at least 2 years as defined by the World Health Organization (8). Semen criteria for normality were defined as sperm count above /ml, type A motility 25% or type A type B motility 50% and normal morphology 30%. Couples classified as having unexplained subfertility had a normal fertility workup. Exclusion criteria were defined as described in Table 1. The study was approved by the institutional review board. Couples were randomized through a central blocked computer system outside the participating clinics using random number tables with blinded allocation, either to receive CC or rfsh each for four consecutive cycles according to a parallel design. The CC was given from cycle day 3 to 7 starting with 100 mg/day orally. When monofollicular growth was achieved, the daily dose of CC was increased, with 50 mg during the next cycle. The rfsh was applied TABLE 1 Exclusion criteria Secondary subfertility Subfertility of 2 y Age of woman 38 y Tubal problems detected with HSG a or diagnostic laparoscopy Cycle disorders Fertility treatment in the past Persistent ovarian cysts a Hysterosalpingography. Cantineau. LH surges in stimulated cycles with IUI. Fertil Steril subcutaneously from cycle day 3 onward in a low-dose step-up protocol starting with 75 IU rfsh per day. When monofollicular growth was achieved, the patient received 37.5 IU additionally in the next cycle, until multifollicular growth was achieved. From cycle day 10 onward, ovarian stimulation was monitored regularly with a transvaginal ultrasound scan to determine the number and mean diameter of developing follicles. When the leading follicle(s) had reached a size of 18 mm, ovulation was triggered using 5,000 IU hcg. To minimize the adverse effects of ovarian stimulation, hcg was withheld if more than three follicles with a mean diameter of 15 mm or more were detected, or more than five follicles with a mean diameter larger than 10 mm. A single IUI with prepared semen was performed 38 hours after hcg administration. A gradient technique with sperm separation medium (Pure Sperm, NidaCon International AB, Göteborg, Sweden) was used for semen preparation, and 0.5 ml sperm suspension was placed in the uterine cavity using an IUI catheter. Blood for LH determination was drawn on the day of hcg administration before it was injected, unless this occurred during the weekend. An LH surge was considered when serum LH levels were 10 IU/L (COBAS, ELECSYS, ENZYMUM-test, Roche Diagnostics GmbH, Mannheim, Germany, interassay variability 5.2%). Results of LH determinations were blinded until patients finished their final treatment cycle, which made adjustment of timing of insemination impossible. No luteal support was applied. A biochemical pregnancy was defined as a positive hcg test result in urine. A clinical pregnancy was confirmed with a transvaginal ultrasound detecting an embryo with cardiac activity at approximately 7 weeks of pregnancy. At 12 weeks gestation, a second ultrasound was performed to confirm an ongoing pregnancy. Main outcome measures were premature LH surges, pregnancy rate per cycle, and pregnancy rate per couple. Multiple pregnancies, miscarriage rate, ovarian hyperstimulation syn- 108 Cantineau et al. LH surges in stimulated cycles with IUI Vol. 88, No. 1, July 2007

117 TABLE 2 Results Total group (n 66) CC group (n 33) FSH group (n 33) Total no. completed treatment cycles Pregnancies Total 20 (9.5%) 10 (9.5%) 10 (9.5%) Spontaneous 4 (1.9%) 2 (1.9%) 2 (1.9%) Ongoing Miscarriage Treatment-dependent 16 (7.6%) 8 (7.6%) 8 (7.6%) Ongoing 12 (5.7%) 6 (5.7%) 6 (5.7%) Miscarriage 4 (1.9%) 2 (1.9%) 2 (1.9%) No. cycles with LH measurements No. pregnancies/cycles with an 2/55 (3.6%) 1/23 (4.3%) 1/32 (3.1%) LH surge No. pregnancies/cycles without 9/98 (9.2%) 4/53 (7.5%) 5/45 (11.1%) an LH surge No. pregnancies/cycles with no LH determination 5/57 (8.8%) 3/29 (10.3%) 2/28 (7.1%) Cantineau. LH surges in stimulated cycles with IUI. Fertil Steril drome, and number of follicles 18 mm on the day of hcg were all counted. Statistical comparisons were performed using the Student s t-test when appropriate. Cox proportional hazards regression analysis was used to correct for the effect of dependent cycles (SPSS version 12.0 software, SPSS, Inc., Chicago, IL). Meta-analyses were performed using the software RevMan 4.1 for Windows (Cochrane Collaboration, 2000, Oxford, England). Significance was defined as P.05. RESULTS After randomizing 66 couples with male factor and unexplained subfertility, 33 received CC (unexplained n 11, male factor n 22) and 33 received rfsh (unexplained n 12, male factor n 21). The baseline characteristics, including age of participants (mean 31.8 years) and duration of subfertility (mean 3.1 years), were comparable for all subgroups. In total, 210 cycles were completed and LH was measured in 153 cycles (CC group 76, rfsh group 77). The most obvious reason for not measuring LH levels was hcg injection during weekends when laboratory services were not available. This nondifferential misclassification might have led to measurement bias, which is, however, the least important form of bias. Altogether nine patients (CC n 5, rfsh n 4) dropped out before completing four cycles, three patients (CC n 2, rfsh n 1) became pregnant after randomization but before starting the first treatment cycle, one patient became pregnant during a nontreatment cycle (rfsh), three patients dropped out for personal reasons, and two patients dropped out for other reasons (poor semen quality and insufficient endometrial response). Sixteen cycles were cancelled to prevent multiple pregnancies (CC n 8, rfsh n 8). Two cycles were cancelled because ovulation had already occurred (both rfsh cycles), and one cycle was cancelled because CC was used for 6 days instead of 5 days. In total, 20 pregnancies occurred during this cohort study. Unfortunately, for five pregnancies the LH levels on the day of hcg were not available. The results per treatment group are summarized in Table 2. In more than one third of the cycles an LH surge was detected. Pregnancy rates per cycle were stated for the group in which LH was measured. Changed in pregnancy rates per cycle for the total group of 210 cycles. Pregnancy rates in cycles with CC and in cycles with FSH were similar (9.5%). A nonsignificant tendency was observed for LH surges to occur more frequently during rfsh cycles compared with CC cycles (42% vs. 30%) (odds ratio [OR] 1.67, 95% confidence interval [CI] 0.86 to 3.25). Pregnancy rates per couple were comparable between male subfertility and unexplained subfertility (28% vs. 35%, respectively). Fertility and Sterility 109

118 When comparing pregnancy rates between cycles with and without LH surges, the results show a nonsignificant trend in favor of cycles without an LH surge (9.2% vs. 3.6%, OR 2.7, 95% CI 0.6 to 13). Using the observed difference in pregnancy rates, the study would have needed to contain 600 treatment cycles to reach statistical significance. Comparing pregnancy rates between the group of women without any LH surge in all of her cycles and the group of women with one or more LH surges showed lower pregnancy rates in the latter group without reaching statistical significance (OR 0.5, 95% CI 0.04 to 1.7). Furthermore, our analysis showed that women with a premature LH surge have a slightly higher chance (OR 1.06, 95% CI 0.98 to 1.16) of developing a premature LH surge in the following cycles, but at the same time this implies that an LH surge remains a poor predictor for the occurrence of LH surges in the following cycles. Comparing means of possible confounding factors that might influence the observed difference in pregnancy rates in cycles with and without an LH surge showed no statistically significant differences; semen quality after workup was lower in cycles without LH surges ( vs , P 0.37) but the average number of follicles was higher in the same group ( vs , P 0.62). A logistic regression did not show that one of the sperm parameters (volume, concentration, or motility) was predictive of pregnancy. The patient s baseline characteristics per group were not available because results were expressed per cycle. There was one twin pregnancy in the FSH group and none in the CC group. There were no high-order multiples. Four pregnancies ended in a spontaneous abortion (two in each ovarian stimulation group), and none of the patients developed ovarian hyperstimulation syndrome. DISCUSSION Intrauterine insemination combined with ovarian stimulation has become the first treatment option for mild male factor and unexplained subfertility (9, 10). Compared with IUI in natural cycles or ovarian stimulation combined with timed intercourse, IUI in cycles with ovarian stimulation improves treatment outcome significantly for these types of subfertility (9, 11 13). Others, however, are convinced that ovarian stimulation adds to the costs and increases the risk of multiple pregnancies without a significant improvement in pregnancy rates (14). Alternative assisted reproductive treatments such as IVF or intracytoplasmatic sperm injection are far more invasive and expensive compared with IUI with ovarian stimulation, but seem to be more effective on a per-cycle basis. However, at the end of a programmed treatment, IUI results in higher cumulative pregnancy rates as a result of lower dropout rates (13). To further improve pregnancy rates of IUI without increasing the risk of morbidity, various factors that might influence the outcome of artificial insemination negatively should be optimized or prevented. Among others, these factors include timing and the occurrence of premature LH surges. There is still an ongoing discussion about optimal timing of insemination. In natural cycles, the insemination is mostly timed using LH determination in urine or blood. In stimulated cycles, however, hcg is more often applied to time insemination 36 to 42 hours later. In these stimulated cycles, LH is often not measured and physicians are therefore unaware of premature LH surges that intervene with adequate timing. When an LH surge occurs, spontaneous ovulation will take place within 24 hours and not 36 to 42 hours later (15). In other words, the unawareness of LH surges might result in inseminations that are performed too late. But do these premature LH surges occur frequently? This prospective cohort study clearly showed a high prevalence of LH surges of 36% in stimulated IUI cycles. Previous studies that measured LH levels in blood (4, 6) reported a prevalence varying from 24% to 49%. Regarding the influence of these LH surges on treatment outcome, our study found a nonsignificant trend in favor of cycles without an LH surge (9.2% vs. 3.6%). Significance was not reached, probably because of a lack of power. An additional trial would need 300 cycles in each group to reach sufficient power. Alternatively, a meta-analysis can be performed. Therefore, we searched for randomized controlled trials using databases of Medline and Embase. One prospective study (6) only was found in which LH levels were measured in blood and results were expressed separately for cycles with or without LH surges. Pooling these results with our study shows a statistically significant difference in favor of cycles without a premature LH surge (OR 3.1, 95% CI 1.04 to 9.1). Although clinical heterogeneity exists, the studies are statistically homogenous. We should, however, take into account that this metaanalysis was based on approximately 300 cycles, which is still a small number, although this is the best available evidence until now. Our results showed a nonsignificant tendency for LH surges to occur more frequently in the group treated with rfsh (42%) compared with the CC group (30%), which might be explained by the rapidly increasing estrogen levels attained during the growth of multiple follicles in the rfsh group, whereas the occurrence of an LH surge in the CC group may indicate a healthy hypothalamopituitary axis (16). Because premature LH increase tends to influence treatment outcomes negatively, it might be useful to suppress this endogenous LH increase by administering a GnRH antagonist. Another strategy is to adjust timing of IUI when an LH surge is detected in urine or blood, or to apply hcg before the dominant follicle reaches the size of 18 mm or more, which makes it less likely that the LH surge already occurred. 110 Cantineau et al. LH surges in stimulated cycles with IUI Vol. 88, No. 1, July 2007

119 The difficulty with applying hcg before the dominant follicle reaches 18 mm is that more immature follicles will be present, which are probably less likely to result in a pregnancy (6). To be able to adjust the timing of IUI once a premature LH increase is detected, one should measure LH levels once or twice daily in urine or blood. The accuracy of the urinary LH test has been questioned because false-negative results can occur when peak levels are 40 IU/L, when women have surges of 10 hours in duration, or when diluted urine is tested (17). The study by Lloyd et al. (18) showed that when LH kits alone were used to time IUI, 36% of inseminations were timed incorrectly and 15% of women had already ovulated. The LH determination in blood is more accurate but will increase the costs. Furthermore, the study by Cohlen et al. (6) did adjust the timing of IUI once an LH increase in blood was detected, but pregnancy rates were still considerably lower in these cycles compared with cycles without an LH surge. The use of GnRH antagonists in an IUI program has been described before, and allows ovulation to be postponed because the antagonist will suppress gonadotrophin release and thus block the possibility of premature LH surges (7, 19-24). When pooling the results of small randomized controlled trials found using databases of Medline, Embase, and CEN- TRAL, it was shown that there has been until now no evidence of benefit in the addition of a GnRH antagonist compared with gonadotrophins alone (OR 1.56, 95% CI 0.86 to 2.84). This might be because of a lack of power, and larger multicenter randomized controlled trials are mandatory to draw final conclusions. Ideally, the GnRH antagonist should be administered only when LH increase is suspected. Because we showed that a premature LH surge is a poor predictor of the occurrence of a next LH surge, no selection can be made beforehand to select those women who would benefit from the administration of a GnRH antagonist. Cunha-Filho et al. (4) reported that the prevalence of premature luteinization was not associated with variables such as age, the dosage of ovarian stimulation drugs, E 2 levels, the number of follicles, or the size of follicles. Therefore, if we want to administer GnRH antagonists to improve treatment outcome, it should be done in all patients during all cycles. Results of two randomized controlled studies showed that the mean number of ampules of GnRH antagonist used per cycle was three (22, 23). We calculated the extra costs per cycle using a GnRH antagonist for 3 days to be US$ Cost effectiveness can be calculated if we combine this with the reported costs per live birth after ovarian hyperstimulation and IUI by Goverde et al. (13). In that study, the costs per live-born baby after ovarian hyperstimulation combined with IUI was calculated to be US$5,108. To make the use of a GnRH antagonist in ovarian hyperstimulation combined with IUI programs costeffective, it can be calculated that at least one extra live-born baby should be achieved in 29 cycles. The results of our pilot study confirmed the finding of others (4, 6) that the prevalence of LH surges in stimulated IUI cycles is high. This study is the first to show that in both CC-stimulated and rfsh-stimulated cycles these premature LH surges occur. Although a nonsignificant trend in favor of cycles without LH surges was found, the effect of LH surges could not be established definitely. Acknowledgments: The authors thank the Dutch IUI study group, consisting of T. Dankert, J. Kremer, P. van Dop, P. Pasker, and C. Hamilton; especially P. Pasker for assistance in statistical analysis and P. van Dop for comments on the manuscript. REFERENCES 1. Balasch J, Ballesca JL, Pimentel C, Creus M, Fabregues F, Vanrell JA. Late low-dose pure follicle stimulating hormone for ovarian stimulation in intra-uterine insemination cycles. Hum Reprod 1994;9: Cantineau AEP, Heineman MJ, Cohlen BJ. Single versus double intrauterine insemination in stimulated cycles for subfertile couples: a systematic review based on a Cochrane review. Hum Reprod 2003;18: Costello MF. Systematic review of treatment of ovulatory infertility with clomiphene citrate and intrauterine insemination. Aust N Z J Obstet Gynaecol 2004;44: Cunha-Filho JS, Kadoch J, Righini C, Fanchin R, Frydman R, Olivennes F. Premature LH and progesterone rise in intrauterine insemination cycles: analysis of related factors. Reprod Biomed Online 2003; 7: Urbancsek J, Rabe T, Grunwald K, Runnebaum B. [Diagnosis, incidence and clinical significance of premature LH rise/peak in patients of an in vitro fertilization and gamete transfer program] Geburtshilfe Frauenheilkd 1990;50: Cohlen BJ, te Velde ER, van Kooij RJ, Looman CWN, Habbema JDF. Controlled ovarian hyperstimulation and intrauterine insemination for treating male subfertility: a controlled study. Hum Reprod 1998;12: Goméz-Palomares JL, Julia B, Acevedo-Martín B, Martínez-Burgos M, Hernández ER, Richiarelli E. Timing of ovulation for intrauterine insemination with a GnRH antagonist. Hum Reprod 2005;20: World Health Organization. WHO Laboratory Manual for the Examination of Human Semen and Sperm-Cervical Mucus Interaction. 3rd ed. Cambridge: Cambridge University Press, Cohlen BJ. Should we continue performing intrauterine inseminations in the year 2004? Gynecol Obstet Invest 2005;59: Yavas Y, Selub MR. Intrauterine insemination (IUI) pregnancy outcome is enhanced by shorter intervals from semen collection to sperm wash, from sperm wash to IUI time, and from semen collection to IUI time. Fertil Steril 2004;82: Hughes EG. The effectiveness of ovulation induction and intrauterine insemination in the treatment of persistent infertility: a meta-analysis. Hum Reprod 1997;12: Guzick DS, Carson SA, Coutifaris C, Overstreet JW, Factor-Ltivak P, Steinkampf MP, et al. Efficacy of superovulation and intrauterine insemination in the treatment of infertility. N Engl J Med 1999;340: Goverde AJ, McDonnell J, Vermeiden JPW, Schats R, Rutten FFH, Schoenmaker J. Intrauterine insemination or in-vitro fertilisation in idiopathic subfertility and male subfertility: a randomised trial and cost-effectiveness analysis. Lancet 2000;355: Fauser BC, Devroey P, Macklon NS. Multiple birth resulting from ovarian stimulation for subfertility treatment. Lancet 2005;365: Martinez AR, Bernardus RE, Kucharska D, Schoemaker J. Urinary luteinizing hormone testing and prediction of ovulation in spontaneous, clomiphene citrate and human menopausal gonadotropin-stimulated cycles. A clinical evaluation. Acta Endocrinol (Copenh) 1991;124: Fertility and Sterility 111

120 16. Mitwally MF, Abdel-Razeq S, Casper RF. Human chorionic gonadotropins administration is associated with high pregnancy rates during ovarian stimulation and timed intercourse or intrauterine insemination. Reprod Biol Endocrinol 2004;2: Zreik TG, García-Velasco JA, Habboosh MS, Olive DL, Arici A. Prospective, randomized, crossover study to evaluate the benefit of human chorionic gonadotropins-timed vs. urinary luteinizing hormonetimed intrauterine inseminations in clomiphene citrate-stimulated treatment cycles. Fertil Steril 1998;71: Loydd R, Coulman CB. The accuracy of urinary luteinizing hormone testing in predicting ovulation. Am J Obstet Gynecol 1989;160: Albano C, Smitz J, Camus M, Riethmuller-Winzen H, Van Steirteghem A, Devroey P. Comparison of different doses of gonadotropin-releasing hormone antagonist Cetrorelix during controlled ovarian hyperstimulation. Fertil Steril 1997;67: Olivennes F, Alvarez S, Bouchard P, Fanchin R, Salat-Baroux J, Frydman R. The use of a GnRH antagonist (Cetrorelix) in a single dose protocol in IVF-embryo transfer: a dose finding study of 3 versus 2 mg. Hum Reprod 1998;13: Borm G, Mannaerts B. Treatment with the gonadotrophin-releasing hormone antagonist ganirelix in women undergoing ovarian stimulation with recombinant follicle stimulating hormone is effective, safe and convenient: results of a controlled randomized, multicentre trial. The European Orgalutran Study Group, Hum Reprod 2000;15: Lambalk CB, Leader A, Olivennes F, Fluker MR, Andersen AN, Ingerslev J, et al. Treatment with the GnRH antagonist ganirelix prevents premature LH rises and luteinisation in stimulated intrauterine insemination: results of a double-blind, placebo-controlled, multicentre trial. Hum Reprod 2006;21: Ragni G, Vegetti W, Baroni E, Colombo M, Arnoldi M, Lombroso G, Crosignani PG. Comparison of luteal phase profile in gonadotrophin stimulated cycles with or without a gonadotrophin-releasing hormone antagonist. Hum Reprod 2001;16: Williams RS, Hillard JB, De Vane G, Yeko T, Kipersztok S, Rhoton- Vlasak A, Sistrom C. A randomized, multicenter study comparing the efficacy of recombinant FSH vs recombinant FSH with ganirelix during superovulation/iui therapy. Am J Obstet Gynecol 2004;191: Cantineau et al. LH surges in stimulated cycles with IUI Vol. 88, No. 1, July 2007

121 POLYCYSTIC OVARY SYNDROME Evaluation of effects of an oral contraceptive containing ethinylestradiol combined with drospirenone on adrenal steroidogenesis in hyperandrogenic women with polycystic ovary syndrome Vincenzo De Leo, M.D., a Giuseppe Morgante, M.D., a Paola Piomboni, Ph.D., a Maria Concetta Musacchio, M.D., a Felice Petraglia, M.D., a and Antonio Cianci, M.D. b a Department of Pediatrics, Obstetrics and Reproductive Medicine, Section of Obstetrics and Gynecology, University of Siena, Siena, and b University of Catania, Catania, Italy Objective: To investigate whether the administration of an oral contraceptive containing the new antiandrogenic drospirenone is associated with reduced adrenal androgen synthesis in hyperandrogenic women with diagnosis of polycystic ovary syndrome. Drospirenone, an analogue of spironolactone and aldosterone antagonist, is a novel progestin under clinical development that is similar to the natural hormone progesterone, combining potent progestogenic with antimineralocorticoid and antiandrogenic activities. Design: Prospective study. Setting: Healthy volunteers in University Department of Obstetrics and Gynecology. Patient(s): Fifteen women ages 18 to 28 years with the diagnosis of polycystic ovary syndrome. Intervention(s): Three months of contraceptive use (30 mcg ethinylestradiol, 3 mg drospirenone). Main Outcome Measure(s): An adrenocorticotropic hormone test was performed before and after the study. Result(s): Adrenal production of cortisol was unchanged after therapy with oral contraceptives. An interesting observation was reduced basal concentrations of androgens such as androstenedione, dehydroepiandrosterone sulfate, testosterone, and free testosterone during therapy. The ratios of the areas of substrates to products before and after oral contraceptive administration were compared for differences in 17 -hydroxylase (17-hydroxyprogesterone/progesterone) and 17,20-lyase (androstenedione/17-hydroxyprogesterone); activities were significantly reduced, indicating a reduction in the activities of these enzymes. Conclusion(s): The present results show for the first time that oral contraceptives containing drospirenone affect adrenal steroidogenesis by reducing synthesis and release of androgens in response to adrenocorticotropic hormone, leaving adrenal production of cortisol unchanged. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: PCOS, oral contraceptive, drospirenone, adrenal steroidogenesis, hyperandrogenism Hirsutism and related signs such as acne, alopecia, and menstrual irregularity are androgen-dependent conditions that respond to antiandrogen therapy (1, 2). Polycystic ovary syndrome (PCOS) is the most common cause of female hyperandrogenism in adolescents and adults (3). In its fully developed form, PCOS is characterized by menstrual abnormalities, hirsutism, obesity, hyperandrogenism, ultrasonographic evidence of polycystic ovaries, and elevated plasma levels of LH or an increased LH/FSH ratio (4, 5). Received March 30, 2006; revised November 23, 2006; accepted November 27, Reprint requests: Vincenzo De Leo, M.D., Institute of Obstetrics and Gynecology, University of Siena, Policlinico Le Scotte, Viale Bracci, Siena (SI) Italy (FAX: ; deleo@unisi.it) It has long been acknowledged that many women with PCOS have an excess of adrenal androgens which may be associated with elevated levels of serum markers such as DHEAS (6). Drospirenone (DRSP), an analogue of spironolactone and aldosterone antagonist, is a novel progestin in the process of clinical development. It is similar to natural progesterone, combining potent progestogenic with antimineralocorticoid and antiandrogenic activities (7). It was developed to reduce the side effects of oral contraceptives (OCs) (8 10). Clinical studies have shown that the DRSP/ethinylestradiol (EE) regimen provides effective oral contraception and excellent cycle control. It is well tolerated with positive effects on skin condition and body weight, /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 113

122 especially in women who tend to gain weight from water retention when taking OCs (11, 12). In a previous study we showed that androgens may have an enhancing effect on adrenal androgen production, and when this is blocked by a pure antiandrogen such as flutamide, adrenal androgen levels decrease (13). The goal of the present study was to investigate whether administration of an OC containing the new antiandrogenic DRSP is associated with reduced adrenal androgen synthesis in hyperandrogenic women. MATERIALS AND METHODS The study was prospective, and its protocol was approved by the ethics committee before the study started. All patients gave their informed consent before enrolment in the study. We recruited 15 women (ages 18 to 28 years, mean age 24 years) diagnosed with PCOS. The clinical diagnosis of PCOS was made according to the consensus criteria of Rotterdam (May 2003), including clinical and biochemical signs of hyperandrogenism, chronic anovulation and/or oligomenorrhea, and polycystic ovaries (The Rotterdam ES- HRE/ASRM-sponsored PCOS consensus workshop group 2004). All women had chronic oligomenorrhea (fewer than six menstrual periods in the previous 12 months) or amenorrhea and hyperandrogenemia (elevated serum free T concentrations). None had virilization. Congenital adrenal hyperplasia was excluded by an ACTH stimulation test. Basal hormone concentrations assayed before treatment showed anovulatory cycles, increased serum concentrations of LH, an increased LH/FSH ratio, and androstenedione (A) and T concentrations at the upper limits of the normal range. A baseline ultrasound scan was performed to evaluate the uterus and ovaries. Ovarian volumes were calculated from the maximum longitudinal anteroposterior and transverse diameters. Ultrasonographic diagnosis of PCOS was based on the presence of 10 or more follicles (2 to 10 mm in diameter) in one or both ovaries. All women were normoprolactinemic, normotensive, and without evidence of any other major medical disorder. All had normal thyroid function. Before starting therapy, multiscreen blood chemistry evaluation was performed, including liver function tests, lipid profile, renal parameters, and blood count. Before treatment and at the end of the 3-month period, two basal blood samples were taken 10 minutes apart. Blood samples were obtained before ( 15 and 0 minutes) and after (15, 30, 45, and 60 minutes) the administration of ACTH (250 g). Plasma was separated within 1 hour by centrifuging in a refrigerated centrifuge and stored at 20 C until assay. The ACTH stimulation test was performed before the study and after 3 months of contraceptive use (30 mcg EE, 3 mg DRSP, Yasmin, Schering s.p.a, Milan, Italy). Hormone Assays The LH, FSH, E 2, estrone (E 1 ), P, total plasma T (T), free T (ft), A, 17-hydroxyprogesterone (17-OHP), dehydroepiandrosterone sulfate (DHEAS), cortisol (F), and pituitary ACTH response were evaluated by RIA using Radim Kits (Rome, Italy) for F, A, and DHAS, DPC kits (Los Angeles, CA) for ACTH and 17-OHP, and Sorin kits (Saluggia, Italy) for T. The samples were assayed in duplicate at two dilutions. All samples from each subject were included in each assay. Quality control pools at low, medium, and high hormone levels were also included in each assay. The assay detection limits were 0.2 IU/L for LH, 0.18 IU/L for FSH, 18 pmol/l for E 2, 4.4 pmol/l for E 1, 0.16 nmol/l for P, 0.52 pmol/l for ft, 277 pmol/l for T, 104 pmol/l for A, 0.21 nmol/l for 17-OHP, 0.05 mol/l for DHEAS, 2.4 nmol/l for F, and 1.7 pmol/l for ACTH. The intra-assay and interassay variations were 7.8% and 8.2% for LH, 6.2% and 6.5% for FSH, 4.2% and 4.9% for E 2, 5.6 and 11.1% for E 1, 8.5% and 10.8% for P, 3.4% and 4.6% for T, 3.2% and 3.4% for ft, 5.6% and 6.4% for A, 4% and 4.8% for 17-OHP, 4.9% and 7.2% for DHEAS, 4.8% and 6% for F, and 4.9% and 9.7% for ACTH. Analytic methods were highly specific for each hormone with extremely low cross-reactivity ( 0.05% ) to other naturally occurring hormones or therapeutic drugs that may have been present in patients samples. Statistical Analysis Results are expressed as mean SD. To assess response to therapy, hormone basal levels, maximum increments (the maximum increase above baseline), and the areas under the curve (cumulative increase above baseline) before and after therapy were compared using Student s two-tailed t-test. Areas under the curves above baseline were calculated using the trapezoidal method. The ratios of the areas of substrates to products before and after OC administration were compared for differences in 17 -hydroxylase (17-OHP/P) and 17,20-lyase (A/17-OHP) activities. Differences were considered significant for P.05. RESULTS Hormonal data before and after OC administration is shown in Table 1. Hormonal responses to ACTH before and after therapy are shown in Figure 1. Cortisol Basal levels of cortisol decreased from to ng/ml, and the difference was not significant. No significant changes were observed in cortisol response to ACTH before and after OC therapy. A, DHEAS, T and ft, 17-OHP Basal concentrations of A and DHEAS were not significantly lower after OC therapy. A statistically significant reduction in A response to ACTH ( max 60=) was observed after OC treatment. The response of A to ACTH decreased from 1, to 1, pg/ml (25%) after OC (P.05) (Fig. 1). 114 De Leo et al. Drospirenone and polycystic ovary syndrome Vol. 88, No. 1, July 2007

123 TABLE 1 Basal hormonal data of 15 women with PCOS before and after 3 months OC containing drospirenone treatment. Study group Variable Before treatment After treatment % F (ng/ml) T (pg/ml) a 54 ft (pg/ml) a OHP (pg/ml) 1, , DHEAS ( g/ml) A (pg/ml) 1, , Note: Values are mean SD. a P.05 vs. before treatment. De Leo. Drospirenone and polycystic ovary syndrome. Fertil Steril There were significant reductions in basal concentrations and responses of T and ft after ACTH (Table 1): basal T and ft decreased from to pg/ml (54%) and from 16 5to10 3 pg/ml (37.5%) before and after OC treatment, respectively (P.05). There was a reduction from to pg/ml (64%) and ft from 31 6to 16 4 pg/ml (49%) after OC therapy (P.05). Statistically significant changes in 17-OHP were observed (Fig. 1) in response to ACTH (a reduction from 2, FIGURE 1 The responses of A, T, FT, and 17-OHP to the administration of ACTH were significantly lower after OC treatment (circle before; square after) *P.05. Values are mean SD. De Leo. Drospirenone and polycystic ovary syndrome. Fertil Steril Fertility and Sterility 115

124 FIGURE 2 The ratio of 17-OHP to P, which indicates 17-hydroxylase activity (A), and the ratio of A to 17-OHP, which indicates 17,20-lyase activity (B), were significantly lower after OC treatment. *P.05. Values are mean SD. De Leo. Drospirenone and polycystic ovary syndrome. Fertil Steril to 1, (38%, P.05), whereas basal values were unchanged before and after OC. 17-OHP/P and A/17-OHP The ratios of the areas of substrates to products before and after OC administration compared for differences in 17 -hydroxylase (17-OHP/P) and 17,20-lyase (A/17-OHP) activities were both significantly lower after OC treatment, indicating a reduction in the activities of these enzymes (Fig. 2). DISCUSSION These results show for the first time that OCs containing DRSP affect adrenal steroidogenesis by reducing synthesis and release of androgens in response to ACTH. Adrenal production of F was unchanged after therapy with OC. In the past it was shown that F levels were significantly higher in women treated with OCs. This probably was related to the type of androgen progestin (norethindrone) used (14). An interesting observation of the present study was reduced basal concentrations of androgens such as T and ft during therapy. Several published studies have shown that OC administration leads to reduced adrenal androgens secretion (15 17). In a study investigating the effect of OCs containing EE and gestodene or norgestimate, time-dependent suppression of serum DHEAS by 20% to 30% was found, whereas A levels were reduced by 25%. There were also significant decreases in total T and free T (by 30% to 35% and 60%, respectively) (16). In the present study we investigated basal and ACTHstimulated adrenal steroidogenesis (18, 19). The observation of smaller increases in adrenal androgen concentrations after administration of ACTH suggests that OCs containing DRSP affect adrenal steroidogenesis. The ratios of the areas of substrates to products before and after OC administration were compared for differences in 17 -hydroxylase (17- OHP/P) and 17,20-lyase (A/17-OHP) activities were significantly reduced, indicating a reduction in the activities of these enzymes. Many studies have dealt with the antiandrogenic activity of DRSP comparing this compound with the gold standards cyproterone acetate and less potent antiandrogens, such as spironolactone and others. DRSP antagonizes endogenous and exogenous androgens dose-dependently almost to castration level (20). It antagonizes the effects of endogenous and exogenous androgens in animal models (21). Its antiandrogenic power is superior to that of spironolactone, which is used therapeutically as an antiandrogen in humans, but it less than that of cyproterone acetate. Beneficial effects of DRSP have been seen in women with hyperandrogenemia (22). Because androgen receptors exist in the adrenal glands (23), the antiandrogen DRSP may affect adrenal steroid biosynthesis through interaction with adrenal androgen receptors. There is some evidence suggesting that androgens may directly affect adrenal hormonal secretion. Azziz et al. (24) reported an increase in DHEAS and A levels and a reduction in DHEA after administration of T for 3 weeks in ovariectomized women. Vermesh et al. (25) described an increase in A response to ACTH in normal women after administration of T for 5 hours. Thus DRSP may influence adrenal production by blocking the normal enhancing effect of androgens on adrenal androgen production. It is more difficult to interpret the reduction in basal concentrations of T because this androgen is of both adrenal and ovarian origin. The reduction in basal levels of T must depend on reduced ovarian and/or adrenal secretion. 116 De Leo et al. Drospirenone and polycystic ovary syndrome Vol. 88, No. 1, July 2007

125 A major limit of this study was that no comparison was made with OCs containing other progestins. It therefore is not possible to determine from our results whether DRSP exerts higher antiandrogenic activity than other progestins. A follow-up study with a larger statistical sample size and a control group is contemplated. The reductions in adrenal androgens presumably have clinical significance. The OC containing DRSP reduced ovarian and adrenal androgen secretion, and quickly improved clinical hyperandrogenic symptoms. In conclusion, the results of the present study show that the drug is effective in the treatment of hyperandrogenism, not only causing blockade of ovarian steroid production, but also acting on the adrenals to reduce adrenal androgen synthesis. REFERENCES 1. Hammerstein J, Meckies J, Leo-Rossberg I, Moltz L, Zielske F. Use of cyproterone acetate (CPA) in the treatment of acne, hirsutism and virilism. J Steroid Biochem 1975;6: Tremblay RR. Treatment of hirsutism with spironolactone. Clin Endocrinol Metab 1986;15: Dunaif A. Insulin resistance and the polycystic ovary syndrome: mechanism and implications for pathogenesis. Endocr Rev 1997;18: Goldzieher JW. Polycystic ovarian disease. Fertil Steril 1981;35: Yen SS. The polycystic ovary syndrome. Clin Endocrinol (Oxf) 1980; 12: Barnes R, Rosenfield RL. The polycystic ovary syndrome: pathogenesis and treatment. Ann Intern Med 1989;110: Fuhrmann U, Krattenmacher R, Slater EP, Fritzemeier KH. The novel progestin drospirenone and its natural counterpart progesterone: biochemical profile and antiandrogenic potential. Contraception 1996;54: Krattenmacher R. Drospirenone: pharmacokinetics of a unique progestogen. Contraception 2000;62: Ludicke F, Johannisson E, Helmerhorst FM, Campana A, Foidart J, Heithecker R. Effect of a combined oral contraceptive containing 3 mg of drospirenone and 30 g of ethinyl estradiol on the human endometrium. Fertil Steril 2001;76: Mansour D. Yasmin a new oral contraceptive, a new progestogen: the reasons why. Eur J Contracept Reprod Health Care 2000;5: Oelkers W, Foridart JM, Dombrovicz M, Welter A, Heithecker R. Effect of a new oral contraceptive containing an antimineralocorticoid progestrogen, drospirenone, on the rennin-aldosterone system, body weight, blood pressure, glucose tolerance, and lipid metabolism. J Clin Endocrinol Metab 1995;80: Foidart JM, Wuttke W, Bouw GM, Gerlinger C, Heithecker R. A comparative investigation of contraceptive reliability, cycle control and tolerance of two monophasic oral contraceptives containing either drospirenone or desogestrel. Eur J Contracept Reprod Health Care 2000; 5: De Leo V, la Marca A, Lanzetta D, Cariello PL, D Antona D, Morgante G. Effects of flutamide on pituitary and adrenal responsiveness to corticotrophin releasing factor (CRF). Clin Endocrinol (Oxf) 1998;49: Carr BR, Parker CR Jr, Madden JD, MacDonald PC, Porter JC. Plasma levels of adrenocorticotropin and cortisol in women receiving oral contraceptive steroid treatment. J Clin Endocrinol Metab 1979;49: Acien P, Mauri M, Gutierrez M. Clinical and hormonal effects of the combination gonadotrophin-releasing hormone agonist plus oral contraceptive pills containing ethinyl-oestradiol (EE) and cyproterone acetate (CPA) versus the EE-CPA pill alone on polycystic ovarian disease-related hyperandrogenisms. Hum Reprod 1997;12: Wiegratz I, Jung-Hoffmann C, Kuhl H. Effect of two oral contraceptives containing ethinylestradiol and gestodene or norgestimate upon androgen parameters and serum binding proteins. Contraception 1995; 51: Pasinetti E, Falsetti L. Triphasic pills: variability of endocrine parameters and of sex steroid-binding globulins. Acta Eur Fertil 1993;24: Coenen CM, Thomas CM, Borm GF, Hollanders JM, Rolland R. Changes in androgens during treatment with four low-dose contraceptives. Contraception 1996;53: Moutos D, Smith S, Zacur H. The effect of monophasic combinations of ethinyl estradiol and norethindrone on gonadotropins, androgens and sex hormone binding globulin: a randomized trial. Contraception 1995; 52: Muhn P, Fuhrmann U, Fritzemeier KH, Krattenmacher R, Schillinger E. Drospirenone: a novel progestogen with antimineralocorticoid and antiandrogenic activity. Ann. NY Acad Sci 1995;761: Muhn P, Krattenmacher R, Beier S, Elger W, Schillinger E. Drospirenone: a novel progestogen with antimineralocorticoid and antiandrogenic activity. Pharmacological characterization in animal models. Contraception 1995;51: Blode H, Wuttke W, Loock W, Roll G, Heithecker R. A 1-year pharmacokinetic investigation of a novel oral contraceptive containing drospirenone in healthy female volunteers. Eur J Contracept Reprod Health Care 2000;5: Hirst JJ, West NB, Brenner RM, Novy MJ. Steroid hormone receptors in the adrenal glands of fetal and adult rhesus monkeys. J Clin Endocrinol Metab 1992;75: Azziz R, Gay FL, Potter SR, Bradley E Jr, Boots LR. The effects of prolonged hypertestosteronemia on adrenocortical biosynthesis in oophorectomized women. J Clin Endocrinol Metab 1991;72: Vermesh M, Silva PD, Rosen GF, Vijod AG, Lobo RA. Effect of androgen on adrenal steroidogenesis in normal women. J Clin Endocrinol Metab 1988;66: Fertility and Sterility 117

126 Lack of effect of short-term diazoxide administration on luteinizing hormone secretion in women with polycystic ovary syndrome William S. Evans, M.D., a Ann E. Taylor, M.D., b David G. Boyd, M.S., c Michael L. Johnson, Ph.D., d Dennis W. Matt, Ph.D., e Yarisie Jimenez, B.A., b and John E. Nestler, M.D. f a Departments of Medicine and Obstetrics and Gynecology, National Science Foundation Center for Biological Timing, and Center for Biomathematical Technology, University of Virginia, Charlottesville; b Reproductive Endocrine Unit and National Center for Infertility Research, Massachusetts General Hospital, Boston; c Department of Medicine, University of Virginia, Charlottesville; d Departments of Pharmacology and Medicine and Center for Biomathematical Technology, University of Virginia, Charlottesville; e Department of Obstetrics and Gynecology and f Department of Medicine, Medical College of Virginia of Virginia Commonwealth University, Richmond Objective: To test the hypothesis that an acute reduction in circulating insulin affects LH secretion in women with polycystic ovary syndrome (PCOS). Design: Prospective study in normal and PCOS women. Setting: General Clinical Research Centers at the University of Virginia, the Medical College of Virginia, and the Massachusetts General Hospital. Patient(s): Six normal women and five women with PCOS. Intervention(s): Administration of diazoxide to lower circulating insulin concentrations. Main Outcome Measure(s): Characteristics of LH secretion as appraised by multiparameter deconvolution and estimation of approximate entropy. Result(s): Short-term administration of diazoxide had no effect on the secretion of LH in women with PCOS. Conclusion(s): Hyperinsulinemia resulting from insulin resistance in women with PCOS may not have a direct effect on gonadotropin secretion. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: PCOS, LH secretion, hyperinsulinemia, diazoxide Although the relationship between insulin resistance and polycystic ovary syndrome (PCOS) has become well recognized over the past several years (1), the mechanisms through which insulin resistance and subsequent hyperinsulinemia subserve abnormalities in reproductive function remain to be fully elucidated. In particular, whether hyperinsulinemia acts directly on the ovary to stimulate P450c17 activity and/or indirectly to increase the secretion of GnRH/LH is unclear. With regard to the latter, it has been generally accepted that serum concentrations of LH are higher in women with PCOS than in normal women (2, 3). However, the elevation in serum LH appears to be more pronounced and more common in lean women than in obese women with PCOS, and LH is inversely correlated with Received February 13, 2006; revised and accepted November 21, Supported in part by National Institutes of Health (NIH) grants RR to the General Clinical Research Center at the University of Virginia, RR to the General Clinical Research Center at the Massachusetts General Hospital, R03-HD and R29-HD to Dr. Taylor, U54 HD to the Reproductive Endocrine Unit at the Massachusetts General Hospital, RR to the General Clinical Research Center at the Medical College of Virginia of Virginia Commonwealth University, and R01HD36529 to Dr. Nestler. Reprint requests: William S. Evans, M.D., Box , University of Virginia Health System, Charlottesville, VA (FAX: ; wse2p@virginia.edu). body mass index (BMI) (3, 4). The inverse relationship between BMI and LH secretion appears to be primarily related to LH pulse amplitude rather than frequency. Because body weight is also highly correlated with hyperinsulinemia, insulin resistance, and body fat, it has been difficult to discern from the observational studies which metabolic abnormality is most tightly related to LH secretion. To test our primary hypothesis that it is hyperinsulinemia per se that influences LH secretion and explains the decrease in LH secretory burst amplitude (i.e., maximum secretory rate) in obese women with PCOS, we administered diazoxide to induce an acute reduction in circulating insulin without a concomitant change in the gonadal hormone milieu or peripheral insulin sensitivity. Both normal and PCOS women were treated with a 3-day course of diazoxide, a medication known to directly suppress insulin secretion. The secretory characteristics of LH before and after diazoxide were assessed with multiparameter deconvolution analysis. Deconvolution procedures were used also to test the secondary hypothesis that the frequency of LH secretory bursts (i.e., secretory events separated from the confounding effects of clearance) is increased in women with PCOS. Furthermore, we estimated approximate entropy in the serum LH concentration-time series to address an additional secondary 118 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

127 hypothesis that abnormalities in the feedforward and/or feedback signals regulating the GnRH/LH axis are evident in adult women with PCOS and are restored toward normal by the administration of diazoxide. MATERIALS AND METHODS Subjects Six normal women reporting regular menstrual cycles were selected for study at Massachusetts General Hospital. All of the women were in good health, as assessed by routine history and physical examination, and were taking no medications. None of the women were participating in a rigorous exercise program. All volunteers reviewed and signed consent forms approved by the Institutional Review Board at the Massachusetts General Hospital. Five women with PCOS were selected for study at the Medical College of Virginia of Virginia Commonwealth University. All of the PCOS women had oligomenorrhea (fewer than 6 menstrual periods in the preceding year) and hyperandrogenemia (elevated total and free T concentrations). All had normal serum PRL concentrations and normal thyroid function tests. Late-onset adrenal hyperplasia was ruled out by a morning serum 17 -hydroxyprogesterone concentration below 200 mg/dl. None of the PCOS women exhibited impaired glucose tolerance, as determined by a 2-hour 75-g oral glucose tolerance test. No subject had taken any medication for at least 2 months before the study. All volunteers reviewed and signed consent forms approved by the Institutional Review Board at the Medical College of Virginia of Virginia Commonwealth University. Protocol Both normal women and those with PCOS were studied under identical conditions at the General Clinical Research Centers (GCRC) of the Massachusetts General Hospital (normal cohort) and the Medical College of Virginia (PCOS cohort). Normal women were studied during the early follicular phase of the menstrual cycle and admitted 2 6 days from the onset of menses. On study day 1, blood samples were obtained for LH at 10-minute intervals and for glucose and insulin (PCOS group only) at 30-minute intervals for 24 hours through an indwelling heparin-lock cannula. All subjects ate breakfast, lunch, and dinner, and identical meals were served on both the pre- and post-diazoxide study days. Water was allowed ad libitum. Both normal and PCOS women were administered 100 mg diazoxide orally every 8 hours for 3 days (study days 2 4) to suppress insulin release. All subjects were readmitted to the GCRC on study day 4 for repeat 10-minute sampling for LH for 24 hours in an identical fashion to study day 1. Serum samples were frozen at 70 C pending measurement of LH. Assays In serum samples obtained from the normal women, LH was measured by RIA using the second international reference preparation (IRP) hmg standard. The intraassay coefficients of variation of LH in this assay were 10.4% for 5 8 IU/L, 12.1% for 8 11 IU/L, and 6.6% for IU/L second IRP hmg (3). Serum LH in the samples obtained from women with PCOS was measured using the Allegro LH Immunoradiometric Assay (IRMA) (Nichols Institute Diagnostics, San Juan Capistrino, CA). The sensitivity of the IRMA is 0.1 miu/ml (World Health Organization [WHO] first IRP 68/ 40) and the intra- and interassay cofficients of variation are 4.4% and 7.1%, respectively. Importantly, LH values in the RIA run approximately twofold higher than values measured in the IRMA owing to the use of the different standards, because the WHO standard is approximately double the potency. Serum insulin was measured by a highly specific RIA (Diagnostic Products, Los Angeles, CA) that had crossreactivity with proinsulin of approximately 40% at midcurve. Biomathematical Modeling Techniques Deconvolution analysis Serum LH concentrations reflect the combination of an underlying pituitary secretory event and endogenous (subject-specific) metabolic clearance. The pituitary event variables are duration, maximal secretory rate (amplitude), and temporal locations of all significant LH secretory bursts. Multiparameter deconvolution analysis allows for simultaneous determination of these quantitative properties of underlying secretory bursts and endogenous hormone half-life (5). The mathematical relationship of endogenous clearance kinetics to half-lives (T 1/2 is represented by MCR (Ln2/T 1/2 ) Vd, where MCR is the metabolic clearance rate and Vd is the volume of distribution. An LH secretory event is approximated algebraically by a gaussian distribution of instantaneous molecular secretory rates centered around a particular point in time and dispersed with a finite SD. Use of this method allows one to determine individual secretory burst parameters and a subject-specific hormone half-life for each individual. In addition, basal hormone secretion is estimated by simultaneous maximumlikelihood parameter estimation. Assessment of approximate entropy To quantify the degree of orderliness in the LH concentration-time series, estimation of approximate entropy was undertaken using the biomathematical technique ApEn (6). The ApEn technique is complementary to pulse and secretory burst detection procedures in that it evaluates both dominant and subordinate patterns in data. Notably, it will detect changes in underlying episodic behavior not reflected in peak occurrences or amplitudes and provides an explicit barometer of feedback system change in many coupled systems. To do so, ApEn assigns a nonnegative number to a time series, with larger values corresponding to greater apparent serial irregularity or disorderliness in hormone release patterns over time. Two input parameters, m and r, must be specified to compute approximate entropy, which then measures the logarithmic likelihood that runs in the patterns that are close (within r) for m contiguous obser- Fertility and Sterility 119

128 TABLE 1 Baseline mean ( SEM) clinical and hormonal characteristics of normal women and women with polycystic ovary syndrome (PCOS). Characteristic Normal women PCOS women P value a Age (yrs) NS Body mass index Glucose (mg/dl) Insulin ( U/mL) NA a Mean values for normal women were compared with mean values for PCOS women using the two-sample t test and assuming equal variance for age and glucose. For body mass index, the means were compared using the two-sample t test assuming unequal variance based on the F test of the two-sample variances (P.03). Evans. Effect of diazoxide on LH in PCOS women. Fertil Steril vations remain close (within the same tolerance with r) on the next incremental comparisons. In the present study we calculated approximate entropy (m, r) values for all data sets, m 1, and r 20% of the SD of the individual subject s hormone concentration time series. Normalizing r to each time-series SD gives approximate entropy a translation in scale and variance to absolute serum LH concentration levels. Previous studies that included both theoretical analysis and clinical applications have demonstrated that these input parameters produce good statistical validity for approximate entropy applied to time-series of the links considered herein. Three hundred Monte Carlo simulations were used for each series to estimate the SD of approximate entropy in each subject by perturbing each original LH concentration-time series with random experimental variation defined by the dose-dependent within-sample SD. Statistical Analysis Mean values for age and glucose in the normal women were compared to mean values for PCOS women using the twosample t test and assuming equal variance. For BMI, the means were compared using the two-sample t test assuming unequal variance based on the F test of the two-sample variances (P.03). These tests were performed using SAS 9.1 PROC TTEST (SAS Institute, Cary, NC). Analysis of the LH secretion data in the present study was complicated by the fact that serum LH concentrations for each group were assayed using two different instruments. Although comparisons within each group (i.e., normal and PCOS women) were straightforward, comparisons between the groups were more complex. The two parameters that would not be expected to be influenced by assay type are frequency of LH secretory bursts and estimation of approximate entropy. For these between-group analyses a two-way analysis of variance (ANOVA) was performed using SAS 9.1 PROC MIXED with main effects group (normal vs. PCOS), treatment (control vs. diazoxide), and the interaction of group and treatment. For those between-group comparisons likely to be influenced by assay type, effects of diazoxide administration were derived as the difference between the diazoxide admission value and the control admission value. These effects were then log transformed to normalize distributions for small sample sizes. The log transformed effects were then compared in a one-way ANOVA of group (normal vs. PCOS) using SAS 9.1 PROC MIXED. RESULTS Clinical and Hormonal Characteristics As is shown in Table 1, normal and PCOS subjects were matched for age. Women with PCOS had a higher BMI (P.008). Mean serum glucose concentrations were also higher in the PCOS than in the normal women (P.006) and are consistent with impaired fasting glucose as currently defined. As noted in the preceding, however, impaired glucose tolerance was tested for but not found to be present in this group of subjects. The mean glucose-to-insulin ratio in the PCOS women of 3.33 was, however, considered to be consistent with the diagnosis of insulin resistance. Serum LH Concentrations Mean ( SEM) 24-hour serum concentrations of LH in the normal and PCOS women before and after administration of diazoxide are shown in Table 2. Because of differences in the assays used to measure LH, serum concentrations were approximately twofold higher in the normal than in the PCOS women. Short-term administration of diazoxide had no effect on mean serum concentration of LH in either the normal or the PCOS women. Deconvolution of LH Concentration-Time Series Representative serum LH concentration-time profiles and deconvolution-resolved discrete LH secretory bursts observed in one normal and one PCOS woman before and after treatment with diazoxide are shown in Figure 1. The mean ( SEM) number of LH secretory bursts resolved from the 120 Evans et al. Effect of diazoxide on LH in PCOS women Vol. 88, No. 1, July 2007

129 TABLE 2 Mean ( SEM) serum concentrations of LH (miu/ml) in normal and polycystic ovary syndrome (PCOS) women before and after short-term treatment with diazoxide. a Normal women PCOS women Before diazoxide After diazoxide a Serum LH was measured using different assay systems for the normal and the PCOS groups. Because of the standard used, the normal group would be expected to run up to twofold higher than the PCOS group. Evans. Effect of diazoxide on LH in PCOS women. Fertil Steril respective concentration-time curves (using deconvolution analysis as described in Materials and Methods) obtained in six normal and five PCOS women before and after diazoxide are shown in Figure 2. Deconvolution-resolved LH secretory burst characteristics, including maximal secretory rate, halfduration, and mass are shown in Table 3, together with estimated half-life and basal secretion. Because of differences in the assay used to measure LH in the normal and the PCOS women, only the LH secretory burst number could be compared directly. As can be seen in Figure 2, women with PCOS had a greater LH secretory burst frequency than normal women both before ( vs ) and after ( vs ) diazoxide administration (P.003 for group factor in a two-way ANOVA by group, normal vs. PCOS and treatment, control vs. diazoxide). However, as is shown in Table 3, there was no effect of diazoxide on the LH secretory parameters within each group. Given the fact that LH pulse frequency has been shown to decrease in normal early follicular phase women during sleep (7), the data were also analyzed as 12-hour day/night series. No differences were detected in terms of secretory burst frequency or maximal secretory rates between the two 12-hour series, and no differences were found between the 12-hour series and the 24-hour series when adjusted for sampling interval (data not shown). Assessment of Approximate Entropy The results obtained with application of the ApEn technique to assess approximate entropy within the serum LH concentration-time series are shown in Figure 3. As can be seen, approximate entropy was found to be higher in the women with PCOS ( vs , PCOS vs. normal women, respectively; P.03). However, there was no effect of diazoxide on approximate entropy estimates in either the normal or the PCOS women. DISCUSSION Many years ago Adashi et al. (8) reported that insulin potentiates GnRH-stimulated LH secretion by rat anterior pituitary glands. More recently, Burcelin et al. (9), also using a rodent model, reported that hyperinsulinemia is associated with enhanced LH secretion and, using an in vitro culture system, that insulin potentiates both the expression and secretion of GnRH by hypothalamic neurons. Therefore, it seems reasonable to hypothesize that hyperinsulinemia, as a consequence of insulin resistance, may amplify LH secretion, and possibly explain the excess LH secretion observed in women with PCOS. The clinical observation that mean LH and LH pulse amplitude were instead inversely related to BMI (3) was unexpected. To test whether this inverse relationship could be explained by differences in insulin levels, we wished to manipulate in a selective manner the insulin environment without changes in body fat, weight, or sex steroid milieu. We opted to administer diazoxide to acutely reduce insulin secretion using a protocol previously reported by Nestler et al. (10). Importantly, diazoxide manifests no known effects on the production of gonadal hormones nor on gonadotropin secretion directly (11). Moreover, diazoxide is not known to acutely alter insulin sensitivity in humans. To date, the majority of studies focused on LH release in women with PCOS have used standard pulse detection algorithms which identify and characterize episodic fluctuations in serum LH concentration-time series rather than discrete secretory bursts. In contrast, in the present study we used a multiparameter deconvolution procedure which allows separation of LH secretory events from the effects of clearance (5). Using this experimental approach, the present study failed to disclose any significant effect of short-term administration of this insulin-lowering medication on any characteristic of LH secretion in women with PCOS, including LH secretory burst amplitude. Thus, these data suggest that the inverse relationship between BMI and LH in women with PCOS is not mediated directly by insulin levels. Obviously, the present study does not rule out the possibility that a longer interval of a normal insulin environment may be needed to elicit a change in the episodic activity of the GnRH neuronalgonadotropic axis. To address this issue, Genazzani et al. (12) appraised LH pulse frequency and amplitude in lean women with PCOS before and after 6 months of metformin administration, which would be expected to both improve insulin sensitivity and decrease circulating insulin. Although no effect of metformin on LH pulse frequency was noted, LH pulse amplitude was in fact decreased during chronic administration of this insulin sensitizing medication in the absence of a significant change in body weight. Given that many women with PCOS begin to ovulate within 3 6 months after initiation of metformin treatment, the change in LH pulse amplitude could very well represent a physiologic response to the inhibitory effects of ovarian steroid production. With regard to our secondary hypothesis related to LH secretory burst frequency (as distinct from pulse frequency), this is, to our knowledge, the first study in adult women with Fertility and Sterility 121

130 FIGURE 1 Representative serum LH concentration-time profiles and deconvolution-resolved discrete LH secretory bursts in a normal (top) and a PCOS (bottom) woman before and after short-term treatment with diazoxide. Evans. Effect of diazoxide on LH in PCOS women. Fertil Steril PCOS to demonstrate an increase in LH secretory burst frequency and is consistent with an earlier investigation undertaken in adolescent girls with PCOS (13). Taken together, these two studies using deconvolution procedures are consistent with previous observations using standard hormone pulse analysis techniques which have suggested that, in women with PCOS, the GnRH pulse generator fires more frequently compared with normal women (2 4, 14 19). However, the mechanisms responsible for this apparent increase in the activity of the GnRH pulse generator in women 122 Evans et al. Effect of diazoxide on LH in PCOS women Vol. 88, No. 1, July 2007

131 FIGURE 2 Mean ( SEM) number of deconvolution-resolved LH secretory bursts in normal women (left) and women with PCOS (right) before and after diazoxide. For each experimental group, values identified with different superscripts differ significantly (P.003). FIGURE 3 Mean ( SEM) estimates of approximate entropy as assessed with the ApEn technique in normal (left) and PCOS (right) women before and after administration of diazoxide. For each experimental group, values identified with different superscripts differ significantly (P.03). Evans. Effect of diazoxide on LH in PCOS women. Fertil Steril Evans. Effect of diazoxide on LH in PCOS women. Fertil Steril with PCOS are not entirely clear. Recent work by Marshall and Eagleson (20) suggests that the GnRH pulse generator in PCOS women may be less sensitive to the feedback effects of progesterone than in normal women, i.e., physiologic concentrations of progesterone fail to decrease the frequency of GnRH pulses to the usual degree, although higher concentrations of this gonadal hormone can suppress GnRH pulse frequency into the normal range. It has been argued that a more rapid GnRH pulse frequency is less favorable for the synthesis of FSH and may result in abnormal follicular recruitment and development and thus anovulation (21). However, a putative abnormality in the feedback effect of progesterone on GnRH neuronal activity in women with PCOS does not preclude the possibility that other factors may contribute to abnormalities in the function of the GnRH system. Such factors could be hormonal (of gonadal or other origin) or nonhormonal in nature and could represent alterations in the characteristics of the input signal itself and/or in the signal transduction process at the neuronal level. Within this context, it has been suggested that the orderliness or regularity of hormone secretion can be assessed by estimation of approximate entropy in hormone TABLE 3 LH secretory burst maximal secretory rate, half-duration, and mass together with estimated halflife and basal secretory rate in normal and polycystic ovary syndrome (PCOS) women before (control) and after administration of diazoxide. When compared as change from baseline, there was no effect of diazoxide on any parameter. Normal women PCOS women Control Diazoxide Control Diazoxide Maximal secretory rate (miu/ml/min) Half-duration (min) Mass (miu/ml) Half-life (min) Basal secretory rate (miu/ml/min) Evans. Effect of diazoxide on LH in PCOS women. Fertil Steril Fertility and Sterility 123

132 concentration-time series (6). In turn, the degree of approximate entropy is thought to reflect the combination of both feedforward (in the present case GnRH) and feedback (e.g., gonadal products) effects on hormone secretion. In the present study approximate entropy as assessed by ApEn in the PCOS women was found to be higher than in the control women. This observation is consistent with the findings of Garcia-Rudaz et al. (13) in adolescent girls with PCOS, suggesting that both girls and women with this disorder do in fact have abnormalities in feedforward and/or feedback signaling. However, the present study did not disclose any effect of diazoxide on approximate entropy associated with LH secretion in either group. Therefore, whatever mechanisms are responsible for the alterations in feedfoward/feedback control of GnRH/LH secretion in women with PCOS do not seem to be modified by short-term treatment with diazoxide. In conclusion, the present study demonstrates that acute changes in insulin do not impact LH burst frequency or amplitude. Using LH secretory burst activity as a marker, we confirmed that the GnRH pulse generator fires at an increased frequency in women with PCOS than in non-pcos women. Whether a longer-term reduction of insulin resistance and hyperinsulinemia will alter pituitary or hypothalamic function in obese women with PCOS remains to be determined. Acknowledgments: We thank Ms. Martha Burner for her expert assistance with preparation of the manuscript. REFERENCES 1. Nestler JE. Insulin resistance syndrome and polycystic ovary syndrome. Endocr Pract 2003;Suppl 2: Rebar R, Judd HL, Yen SS, Rakoff J, Vandenberg G, Naftolin F. Characterization of the inappropriate gonadotropin secretion in polycystic ovary syndrome. J Clin Invest 1976;57: Taylor AE, McCourt B, Martin KA, Anderson EJ, Adams JM, Schoenfeld D, et al. Determinants of abnormal gonadotropin secretion in clinically defined women with polycystic ovary syndrome. J Clin Endocrinol Metab 1997;82: Morales AJ, Laughlin GA, Butzow T, Maheshwari H, Baumann G, Yen SS. Insulin, somatotropic, and luteinizing hormone axes in lean and obese women with polycystic ovary syndrome: common and distinct features. J Clin Endocrinol Metab 1996;81: Veldhuis JD, Carlson ML, Johnson ML. The pituitary-gland secretes in bursts appraising the nature of glandular secretory impulses by simultaneous multiple-parameter deconvolution of plasma-hormone concentrations. Proc Natl Acad Sci USA1987;84: Pincus SM. Approximate entropy as a measure of system-complexity. Proc Natl Acad Sci USA1991;88: Filicori M, Santoro N, Merriam GR, Crowley WF Jr. Characterization of the Physiological pattern of episodic gonadotropin secretion throughout the human menstrual cycle. J Clin Endocrinol Metab 1986;62: Adashi EY, Hsueh AJ, Yen SS. Insulin enhancement of luteinizing hormone and follicle-stimulating hormone release by cultured pituitary cells. Endocrinology 1981;108: Burcelin R, Thorens B, Glauser M, Gaillard RC, Pralong FP. Gonadotropin-releasing hormone secretion from hypothalamic neurons: stimulation by insulin and potentiation by leptin. Endocrinology 2003;144: Nestler JE. Sex hormone-binding globulin: a marker for hyperinsulinemia and/or insulin resistance? [comment]. J Clin Endocrinol Metab 1993;76: Nestler JE, Singh R, Matt DW, Clore JN, Blackard WG. Suppression of serum insulin level by diazoxide does not alter serum testosterone or sex hormone-binding globulin levels in healthy, nonobese women. Am J Obstet Gynecol 1990;163: Genazzani AD, Battaglia C, Malavasi B, Strucchi C, Tortolani F, Gamba O. Metformin administration modulates and restores luteinizing hormone spontaneous episodic secretion and ovarian function in nonobese patients with polycystic ovary syndrome. Fertil Steril 2004;81: Garcia-Rudaz MC, Ropelato MG, Escobar ME, Veldhuis JD, Barontini M. Augmented frequency and mass of LH discharged per burst are accompanied by marked disorderliness of LH secretion in adolescents with polycystic ovary syndrome. Eur J Endocrinol 1998;139: Burger CW, Korsen T, van Kessel H, van Dop PA, Caron FJ, Schoemaker J. Pulsatile luteinizing hormone patterns in the follicular phase of the menstrual cycle, polycystic ovarian disease (PCOD) and nonpcod secondary amenorrhea. J Clin Endocrinol Metab 1985;61: Filicori M, Campaniello E, Michelacci L, Pareschi A, Ferrari P, Bolelli G, et al. Gonadotropin-releasing hormone (GnRH) analog suppression renders polycystic ovarian disease patients more susceptible to ovulation induction with pulsatile GnRH. J Clin Endocrinol Metab 1998;66: Venturoli S, Porcu E, Fabbri R, Magrini O, Gammi L, Paradisi R, et al. Episodic pulsatile secretion of FSH, LH, prolactin, oestradiol, oestrone, and LH circadian variations in polycystic ovary syndrome. Clin Endocrinol 1988;28: Waldstreicher J, Santoro NF, Hall JE, Filicori M, Crowley WF Jr. Hyperfunction of the hypothalamic-pituitary axis in women with polycystic ovarian disease: indirect evidence for partial gonadotroph desensitization. J Clin Endocrinol Metab 1988;66: Imse V, Holzapfel G, Hinney B, Kuhn W, Wuttke W. Comparison of luteinizing hormone pulsatility in the serum of women suffering from polycystic ovarian disease using a bioassay and five different immunoassays. J Clin Endocrinol Metab 1992;74: Berga SL, Guzick DS, Winters SJ. Increased luteinizing hormone and alpha-subunit secretion in women with hyperandrogenic anovulation. J Clin Endocrinol Metab 1993;77: Marshall JC, Eagleson CA. Neuroendocrine aspects of polycystic ovary syndrome. Endocrinol Metab Clin North Am 1999;28: Haisenleder DJ, Dalkin AC, Marshall JC. Regulation of gonadotropin gene expression. In: Knobil E, Neill J, eds. The Physiology of reproduction. 2nd ed. New York: Raven Press, 1994: Evans et al. Effect of diazoxide on LH in PCOS women Vol. 88, No. 1, July 2007

133 Administration of exogenous ghrelin in obese patients with polycystic ovary syndrome: effects on plasma levels of growth hormone, glucose, and insulin Maurizio Guido, M.D., Ph.D., a Daniela Romualdi, M.D., a Laura De Marinis, M.D., b Teresa Porcelli, M.D., b Maddalena Giuliani, M.D. a Barbara Costantini, M.D., a and Antonio Lanzone, M.D. a,c a Department of Obstetrics and Gynecology, and b Department of Endocrinology, Università Cattolica del Sacro Cuore, Rome; and c OASI Institute for Research, Troina, Italy Objective: To assess the effects of the administration of exogenous ghrelin, a peptide with potent GH-releasing activity and glucose-enhancing and insulin-lowering properties, in obese patients with polycystic ovary syndrome (PCOS). Design: Prospective, controlled study. Setting: Academic research environment. Patient(s): Twenty obese women with PCOS, and 15 obese controls. Intervention(s): Oral glucose tolerance test (OGTT) and ghrelin test (1 g/kg IV bolus). Main Outcome Measure(s): Basal hormonal assays, including ghrelin, were performed. Glucose, insulin, and C-peptide were assessed in a fasting condition and during the OGTT. Growth hormine, insulin, and glucose were measured basally and every 15 minutes for 90 minutes after the injection of ghrelin. Result(s): Both groups showed an insulin response to the glucose load above the normal range. Significantly lower levels of ghrelin were detected in patients with PCOS compared to controls ( Fmol/mL versus Fmol/mL). Administration of ghrelin markedly enhanced GH levels in both groups (1, , ng/ml and 1, ng/ml per 90 minutes as GH area under the curve, respectively), with a peak occurring 30 minutes after injection. Ghrelin also induced a trend toward an increase in plasma glucose levels, and a significant decrease in insulin concentrations in both groups. Conclusion(s): The injection of ghrelin seems to override the GH secretion defect in obese women with PCOS, and to induce glucoinsulinemic changes in both controls and obese patients with PCOS. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: GH, insulin, ghrelin, obesity, PCOS Ghrelin is the long-sought endogenous ligand for the orphan growth hormone-secretagogues receptor (GHS-R) (1). This 28 amino-acid peptide is predominantly produced by the stomach, whereas substantially lower amounts are released by other tissues, such as the bowel, pancreas, pituitary, kidneys, and placenta (2). The most important functions of ghrelin are a potent GH-releasing activity, as well as orexant and adipogenic activity in energy balance (3,4). Other functions of ghrelin include significant PRL-, ACTH-, and cortisol-releasing activity (5); the stimulation of gastric-acid secretion and motility (6); direct effects on the cardiovascular and reproductive systems (7); and antiproliferative activity in neoplastic cell lines (8). Received September 28, 2005; revised November 9, 2006; accepted November 20, Supported by a grant (RC 2004/5 PREV.1.5 IRCCS [Istituto di Ricerca e Cura a Carattere Scientifico] Troina) from the program La Prevenzione dell Handicap Mentale of the Ministry of Public Health and by a grant from Ministero dell Università e della Ricerca (MUIR, Rome, Italy) Reprint requests: Maurizio Guido, M.D., Ph.D., Department of Obstetrics and Gynecology, Università Cattolica del Sacro Cuore, Largo Agostino Gemelli 8, Rome, Italy (FAX: ; maurizioguido@ libero.it). Circulating levels of ghrelin are regulated by both shortand long-term changes in nutritional status. Plasma levels of this peptide increase on fasting and decrease after habitual feeding, thus showing a pattern reciprocal to that of insulin (9). Also, the chronic feeding state influences ghrelin levels, which are negatively correlated with percent body fat or body mass index (BMI). Elevated levels of ghrelin are found in conditions such as starvation, cachexia, and anorexia nervosa (10), whereas low concentrations of this hormone are usually associated with states of positive energy balance such as obesity (11). Previous studies demonstrated that administration of exogenous ghrelin in humans is able to markedly increase GH secretion, to enhance glycemic levels, to inhibit insulin secretion, and to induce hunger and imagination of food (4,12). Polycystic ovary syndrome (PCOS) represents an interesting model for the study of ghrelin functions. In fact, obesity and hyperinsulinemia are common features of this disorder, affecting 50% of women with PCOS (13). On the other hand, several studies demonstrated a blunted GH response to a variety of stimuli in these patients (14). Moreover, women with PCOS exhibit a derangement of the GH response to the /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 125

134 GH-releasing hormone (GHRH) in relation to food intake (15). The impairment of GH secretion in PCOS seems only partially related to the presence of obesity and hyperinsulinemia, as it was also found in normal-weight normoinsulinemic patients (16). We previously demonstrated that other factors, such as an altered opioid tone, could be involved in such imbalances. In particular, in obese patients with PCOS, the additive effect of excess body weight, hyperinsulinism, and profound alteration of opioid tone leads to a persistent state of hyposomatropism (17). Few studies have been published on levels of ghrelin in PCOS. Most of them documented low levels of ghrelin in this syndrome (18 20), though there are reports of normal (21) or even high (22) levels of ghrelin in PCOS. An interaction between ghrelin and steroid synthesis was also suggested in these patients (19). Assuming an involvement of ghrelin in the modulation of steroidogenesis, in the regulation of GH secretion, and in energy balance, we analyzed for the first time the effects of an administration of exogenous ghrelin on GH secretion and glucoinsulinemic parameters in obese patients with PCOS. MATERIALS AND METHODS In this study, we enrolled 20 obese women with PCOS (age range, years) and 15 obese control women (age range, years). All patients had spontaneous onset of puberty and normal sexual development. All were euthyroid, and none had taken medications known to affect carbohydrate metabolism and plasma sex-steroid levels for 3 months before the study. In accordance with the Rotterdam Consensus Criteria (23), PCOS was diagnosed in the presence of at least two of three clinical findings: chronic anovulation, clinical and/or biochemical evidence of hyperandrogenism, and an ultrasonographic appearance of polycystic ovaries. In particular, the ovarian morphology was defined as polycystic in the presence of bilateral normal or enlarged ovaries with 10 microcysts (2 8-mm diameter) from the inner margin to the outer margin in longitudinal cross-section, associated with an augmented stromal area:total area ratio (24,25). The representation of different PCOS phenotypes in our population was as follows: all of them exhibited an ultrasonographic appearance of polycystic ovaries, with an augmented ovarian stromal area:total area ratio; 15 of them also showed biochemical and clinical signs of hyperandrogenism, along with chronic anovulaion; five of them, besides polycystic ovaries, had clinical or biochemical signs of hyperandrogenism and oligomenorrhea or amenorrhea. Obese patients who did not match the diagnostic criteria for PCOS were included in the study as control subjects. In particular, none of the obese control patients had ultrasonographic evidence of either polycystic ovaries or multifollicular ovaries (transvaginally). Four patients, however, presented irregular menses (three with oligomenorrhea, and one with amenorrhea). Just two (one with regular menstrual cycles, and one with oligomenorrhea) had T levels slightly above normal range. Five exhibited mild hirsutism, according to the Ferriman-Gallwey score (26). Obesity was defined as a BMI of 27 kg/m 2 (normal range, kg/m 2 ). For the determination of waist-to-hip ratio, waist circumference was obtained as the minimum value between the iliac crest and the lateral costal margin, whereas hip circumference was determined as the maximum value over the buttocks. A normal LH:FSH ratio was not considered an exclusion criterion. The presence of adrenal enzymatic defects was excluded by a corticotrophin test, according to the criteria of New et al. (27). Informed consent was obtained from each patient. The study protocol was approved by ethics board of our department. Studies were conducted during the early follicular phase of menstrual cycles (spontaneous or progestin-induced cycles). Patients were hospitalized to undergo baseline evaluation. After fasting overnight for hours, blood samples were collected for hormone plasma concentrations: ghrelin, LH, FSH, 17 -E 2, 17-hydroxyprogesterone (17-OHP), sex hormone-binding globulin (SHBG), DHEAS, androstenedione (A), and T. After an overnight fast, a forearm IV catheter was inserted, and 1 g/kg ghrelin (Clinalfa, Läufelfingen, Switzerland) was injected as a single IV bolus. Blood samples were taken at 15, 30, 45, 60, 75, and 90 minutes after infusion of ghrelin. All women underwent an oral glucose tolerance test (OGTT) (75 g). Glycemia, insulin, and C-peptide were assayed every 30 minutes for 4 hours after glucose ingestion. A normal insulinemic response to OGTT was defined as a threshold area-under-the-curve (AUC) value of 15,000 IU/mL per 240 minutes, as previously described (13). Venous blood samples were collected into vacutainer icechilled ethylenediaminetetraacetic-acid plasma tubes containing aprotinin (Trasylol, Bayer, Toronto, Ontario, Canada) (0.6 TIU/mL blood) for measurement of ghrelin. Each sample was centrifuged, and the serum was stored at 70 C until the time of the assay. Each sample was assayed with the use of a commercial RIA (Phoenix Pharmaceuticals, Belmont, CA). Plasma immunoreactive ghrelin levels were measured in duplicate with the use of [ 125 I]-labeled bioactive ghrelin as a tracer, and a rabbit polyclonal antibody raised against fulllength octanoylated human ghrelin. The sensitivity was 23 pg/tube; the intra-assay coefficient of variation (CV) was 3%, and the interassay CV was 10%. Plasma concentrations of GH, insulin, and glucose were measured at each time point. All blood samples were promptly centrifuged, and the plasma was stored at 20 C until being assayed. Levels of 126 Guido et al. Effects of ghrelin in obese women with PCOS Vol. 88, No. 1, July 2007

135 LH, FSH, E 2, T, 17-OHP, A, DHEAS, and SHBG were measured in duplicate by radioimmunoassay methods with the use of a commercial kit (Radim, Pomezia, Italy). Growth hormone was analyzed by a immunoradiometric assay with the use of commercial kits (Radim); the lowest amount of GH detected was 0.04 ng/ml. Insulin was dosed by use of a recombinant immunoassay. Plasma glucose was determined by the glucose oxidase method. Intraassay and interassay CVs were as follows: LH, 5.6% and 9.1%; FSH, 6.9% and 8.4%; E 2, 2.3% and 3.5%; A and T, 6.1% and 9.3%; insulin, 5.1% and 6.2%; SHBG, 6.9% and 8.5%; and GH, 2.5% and 5.8%, respectively. Statistical Methods All data are presented as mean SD. Descriptive statistics, including the number of observations, mean, standard deviation, minimum, and maximum, were presented for continuous data at each visit. For the main efficacy variables, an analysis of variance model for repeated measures was applied to describe the within-subjects time profile during the study. For all analyses, an -level for statistically significant differences was set at RESULTS The main clinical and endocrine features of the studied groups are shown in Table 1. No significant differences were found between groups in terms of age, gonadotropins, E 2, and SHBG levels. As expected, women affected by PCOS exhibited higher T and A plasma levels as well. In both groups, the mean AUC for insulin in response to the oral glucose load was suggestive of a state of hyperinsulinism. Peripheral levels of ghrelin measured in basal conditions before breakfast were significantly lower in patients with PCOS compared to obese controls ( Fmol/mL versus Fmol/mL, P.01). Figure 1 shows the GH response to an injection of ghrelin in the two studied groups at each time point, and the absolute mean values of the AUC for GH of each group. Intravenous administration of ghrelin markedly enhanced GH levels in both women with PCOS and controls, with a peak in plasmatic concentrations of the hormone occurring about 30 minutes after injection of ghrelin (GH peak, ng/ml and ng/ml for women with PCOS and controls, respectively). When the data were analyzed as AUCs for GH, values obtained from patients with PCOS tended to slightly overtake those from the control group (1, , ng/ml and 1, ng/ml per 90 minutes, respectively), albeit not significantly. As shown in Figure 2, administration of exogenous ghrelin also induced a significant increase in levels of plasma glucose and a specular significant decrease in insulin circulating concentrations in both groups. The glycemia-enhancing effect reached its peak 30 minutes after administration of ghrelin, with no statistically significant differences being observed between women with PCOS and controls (peak values, mg/dl and , respectively). TABLE 1 Main clinical and endocrine features of patients with PCOS and controls. Obese patients with PCOS Obese controls P value Age (y) NS BMI (kg/m 2 ) NS Waist-to-height ratio NS FSH (miu/ml) NS LH (miu/ml) NS E 2 (pg/ml) NS T (ng/ml) PRL (ng/ml) NS DHEAS (ng/ml) 2, , NS 17-OHP (ng/ml) NS Cortisol (ng/ml) NS A (ng/ml) SHBG (nmol/l) NS Insulin-like growth factor I (ng/ml) NS AUC for insulin ( IU/mL per , , , , NS minutes) Ghrelin (Fmol/mL) Note: NS no significance. Guido. Effects of ghrelin in obese women with PCOS. Fertil Steril Fertility and Sterility 127

136 FIGURE 1 Growth-hormone response to injection of ghrelin, expressed as absolute value at each time point and as AUC in subjects with PCOS (, solid bar) and in controls ( , open bar). Values indicate mean SD. *P.01 versus baseline for both controls and patients. Besides a central role in linear growth, GH has important effects such as facilitation of fat-mass utilization for energy stores, the building and sustaining of lean body mass, and the maintenance of bone mineral density (30). Furthermore, both in vitro and in vivo evidence suggest that GH is required for normal follicular development and ovulation rate (31,32). Obese patients with PCOS have a low diurnal GH secretion (33), and were proven to be severely hyporesponsive to a variety of GH-releasing stimuli. A significantly lower GH response to exercise was demonstrated in patients with PCOS, with a negative correlation between GH response and BMI (34). Both the mean peak value of GH and the total GH response to GHRH plus arginine were found to be significantly lower in obese patients with PCOS than in healthy obese women (35). Obese women with PCOS show a markedly decreased GH response to the administration of GHRH (14) in basal conditions. Food intake, which was proven to elicit an enhancement of GHRH-induced GH secretion in obese controls, was unable to affect the blunted GH production in obese women with PCOS (15). By contrast, in the present study, administration of ghrelin markedly increased GH levels in these patients, with no FIGURE 2 Guido. Effects of ghrelin in obese women with PCOS. Fertil Steril The decrease in insulin plasmatic levels was evident 15 minutes after injection of ghrelin in both groups: the statistical difference versus baseline values was maintained throughout the 90 minutes of observation in obese control patients, whereas subjects with PCOS showed a slow and progressive recovery in insulin mean concentrations, producing the loss of a significant contrast compared to baseline at 90 minutes. Changes in glucose (top) and insulin (bottom) plasma levels after injection of ghrelin (time 0 minutes) in subjects with PCOS ( ) and in obese controls ( ) *P.01 versus baseline. **P.05 versus baseline. DISCUSSION The breakthrough discovery of ghrelin in 1999 further complicated the picture of the central regulation of GH secretion and energy balance. In this regard, ghrelin could represent an important endocrine signal connecting peripheral mechanisms that sense caloric intake with the brain centers controlling energy homeostasis and the growth needs of the body. This molecule represents the specific endogenous ligand for the GHS-R, which is distinct from that of GHRH and somatostatin, and whose activation is responsible for the stimulation and amplification of pulsatile GH release (28). The potent GH-releasing activity, and the orexant and adipogenic activity in energy balance, seem to be performed through two independent pathways. Indeed, ghrelin was shown to modify energy homeostasis in GHdeficient rats (29). Guido. Effects of ghrelin in obese women with PCOS. Fertil Steril Guido et al. Effects of ghrelin in obese women with PCOS Vol. 88, No. 1, July 2007

137 significant difference in comparison with the control group. On the basis of the known physiopathologic mechanism of the action of ghrelin, this finding contains relevant implications. Most of ghrelin-induced GH secretion, in fact, involves mediation through GHRH, which seems to be essential for the full expression of the stimulatory effect. In this regard, some investigators previously demonstrated the absence of a significant increase of GH induced by ghrelin after the administration of GHRH antiserum (36,37), or in cases of GHRH receptor defects. This evidence strongly indicates that the GH response to ghrelin in vivo requires an intact GHRH system, as hypothalamic GHRH-producing neurons seem to be the principal target of ghrelin. Hence, our study supports the hypothesis of an intrinsically functional GHRH-GH axis in obese women with PCOS, and strengthens the contention that other modulating factors, such as insulin and opioids, could have a detrimental effect on GH release at the central level. These findings are in line with previous observations, in obese patients with PCOS, that dealt with the possibility of overriding the defect in GH secretion with the administration of the GHS GHRP-6 (38). Based on these data, the hypothesis that ghrelin could be responsible for the down-regulation of the somatotrophic axis in obese subjects with PCOS cannot be ruled out. The finding of decreased levels of ghrelin in these women, as reported in this and other studies, further supports this contention. However, the GH hyporesponsiveness found in obese patients with PCOS to direct stimulation with GHRH, which theoretically should bypass the lack of a sufficient stimulation by ghrelin in the hypothalamus, does not match such a supposition. Furthermore, the physiologic relevance of an influence of ghrelin on GH secretion is not completely acknowledged by most authors. In fact, the ghrelin knockout mouse is not affected by dwarfism (39). Moreover, ghrelin seems not to be subjected to feedback control by GH levels (28), indicating that the physiological role of this peptide in the regulation of GH secretion remains to be clarified. By contrast, ghrelin levels seem to be mainly under metabolic control, and, in turn, its major actions are seen in the metabolism. In fact, ghrelin expression and secretion by the stomach decrease under conditions of positive energy balance, such as hyperglycemia, feeding, and obesity (2). In this last condition, an ineffective compensatory modulation of ghrelin levels is suggested, rather than a causative role (40). It was postulated that a candidate factor involved in the down-regulation of ghrelin secretion in obese patients could be the high insulin levels found in these subjects: Saad et al. (41) elegantly demonstrated that changes in insulinemia, even within the physiological range, are associated with swift and reciprocal changes in plasma ghrelin. Likewise, insulin appears to be the mediator of the effects of chronic changes in nutritional status on plasma ghrelin levels. Furthermore, insulin and ghrelin are thought to influence each other. Ghrelin and its receptor are expressed in normal and neoplastic cells of the endocrine pancreas (42), and several studies demonstrated a direct inhibitory effect of this system on insulin secretion. Such interference is exerted at the postreceptorial level, and seems not to be mediated by GH. After exogenous infusion of ghrelin, we observed an increase in glycemic levels and a significant decrease in insulin levels in both studied groups. The degree of glucoinsulinemic changes induced by ghrelin in our patients is similar to that previously observed by other investigators in normalweight subjects (12). The effect of ghrelin on glycemic levels could reflect an enhancement in glycogenolitic activity in the liver, although GHS receptors have not been detected at this level (2). On the other hand, a stimulatory effect on glucagon secretion seems unlikely, since it would be followed by a compensatory increase in insulin levels, which was not observed in this and other studies. We did not observe significant differences in glycemic levels at each time point between subjects with PCOS and controls. This finding has to be interpreted with an exploratory intention, since the high SDs, narrow range of glycemic variations, and relatively small samples under evaluation could reduce the statistical impact of the differences. Finally, we measured the basal levels of ghrelin in obese patients with PCOS. Our results confirm the finding of lower levels of this peptide in such patients compared to controls, as previously reported (18 20). While some of these studies attributed a putative role in the inhibition of ghrelin secretion to the common presence of obesity and hyperinsulinemia in PCOS, the same conclusion cannot be drawn on the basis of our observations. Therefore, factors other than obesity and hyperinsulinemia might account for the decreased ghrelin levels in women with PCOS. In conclusion, this study suggests that ghrelin can abolish the differences in GH-stimulated secretion between obese patients with PCOS and obese subjects without PCOS. The novelty of this finding stems from the previous observations regarding the marked differences in the function of the GH-axis in these typologies of patients. In particular, when compared to that of obese controls, the somatotrophic system of obese PCOS subjects was proven to respond in a different fashion to a variety of stimuli either in relation to their intrinsic endocrine-metabolic characteristics and in relation to transitory conditions (e.g., food intake, exercise). In the complex combination of the endocrine-metabolic alterations of PCOS, ghrelin may represent the link between glucoinsulinemic imbalance and the profound derangement of GH secretion. However, this novel peptide needs to be further studied to clarify these and other aspects of its multiple actions. REFERENCES 1. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 1999;9: Fertility and Sterility 129

138 2. Ariyasu H, Takaya K, Tagami T, Ogawa Y, Hosoda K, Akamizu T, et al. Stomach is a major source of circulating ghrelin, and feeding state determines plasma ghrelin-like immunoreactivity levels in humans. J Clin Endocrinol Metab 2001;86: Arvat E, Di Vito L, Broglio F, Papotti M, Muccioli G, Dieguez C, et al. Preliminary evidence that ghrelin, the natural GH secretagogue (GHS)- receptor ligand, strongly stimulates GH secretion in humans. J Endocrinol Invest 2000;23: Wren AM, Small CJ, Ward HL, Murphy KG, Dakin CL, Taheri S, et al. The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 2000;141: Arvat E, Maccario M, Di Vito L, Broglio F, Benso A, Gottero C, et al. Endocrine activities of ghrelin, a natural growth hormone secretagogue (GHS), in humans: comparison and interactions with hexarelin, a nonnatural peptidyl GHS, and GH-releasing hormone. J Clin Endocrinol Metab 2001;86: Masuda Y, Tanaka T, Inomata N, Ohnuma N, Tanaka S, Itoh Z, et al. Ghrelin stimulates gastric acid secretion and motility in rats. Biochem Biophys Res Commun 2000;276: De Ambrogi M, Volpe S, Tamanini C. Ghrelin: central and peripheral effects of a novel peptydil hormone. Med Sci Monit 2003;9:RA van der Lely AJ, Tschop M, Heiman ML, Ghigo E. Biological, physiological, pathophysiological, and pharmacological aspects of ghrelin. Endocr Rev 2004;25: Arosio M, Ronchi CL, Beck-Peccoz P, Gebbia C, Giavoli C, Cappiello V, et al. Effects of modified sham feeding on ghrelin levels in healthy human subjects. J Clin Endocrinol Metab 2004;89: Tanaka M, Nakahara T, Kojima S, Nakano T, Muranaga T, Nagai N, et al. Effect of nutritional rehabilitation on circulating ghrelin and growth hormone levels in patients with anorexia nervosa. Regul Pept 2004;122: Marzullo P, Verti B, Savia G, Walker GE, Guzzaloni G, Tagliaferri M, et al. The relationship between active ghrelin levels and human obesity involves alterations in resting energy expenditure. J Clin Endocrinol Metab 2004;89: Broglio F, Arvat E, Benso A, Gottero C, Muccioli G, Papotti M, et al. Ghrelin, a natural GH secretagogue produced by the stomach, induces hyperglycemia and reduces insulin secretion in humans. J Clin Endocrinol Metab 2001;86: Ciampelli M, Lanzone A. Insulin and polycystic ovary syndrome: a new look at an old subject. Gynecol Endocrinol 1998;12: Lanzone A, Villa P, Fulghesu AM, Pavone V, Caruso A, Mancuso S. The growth hormone response to growth hormone-releasing hormone is blunted in polycystic ovary syndrome: relationship with obesity and hyperinsulinaemia. Hum Reprod 1995;10: Villa P, Soranna L, Mancini A, De Marinis L, Valle D, Mancuso S, et al. Effect of feeding on growth hormone response to growth hormone-releasing hormone in polycystic ovarian syndrome: relation with body weight and hyperinsulinism. Hum Reprod 2001;16: Comim FV, Spritzer PM. Increased growth hormone response to clonidine in nonobese normoinsulinemic patients with polycystic ovary syndrome. Fertil Steril 2004;81: Guido M, Romualdi D, Mancini A, Lattanzi F, Villa P, Barini A, et al. Effect of the opioid blockade on the feeding-induced growth hormone response to growth hormone-releasing hormone in women with polycystic ovary syndrome. Fertil Steril 2002;78: Schofl C, Horn R, Schill T, Schlosser HW, Muller MJ, Brabant G. Circulating ghrelin levels in patients with polycystic ovary syndrome. J Clin Endocrinol Metab 2002;87: Pagotto U, Gambineri A, Vicennati V, Heiman ML, Tschop M, Pasquali R. Plasma ghrelin, obesity, and the polycystic ovary syndrome: correlation with insulin resistance and androgen levels. J Clin Endocrinol Metab 2002;87: Moran LJ, Noakes M, Clifton PM, Wittert GA, Tomlinson L, Galletly C, et al. Ghrelin and measures of satiety are altered in polycystic ovary syndrome but not differentially affected by diet composition. J Clin Endocrinol Metab 2004;89: Orio F Jr, Lucidi P, Palomba S, Tauchmanova L, Cascella T, Russo T, et al. Circulating ghrelin concentrations in the polycystic ovary syndrome. J Clin Endocrinol Metab 2003;88: Wasko R, Komarowska H, Warenik-Szymankiewicz A, Sowinski J. Elevated ghrelin plasma levels in patients with polycystic ovary syndrome. Horm Metab Res 2004;36: The Rotterdam ESHRE/ASRM-sponsored PCOS consensus workshop group Rotterdam 1: revised 2003 consensus on diagnostic criteria and long term health risks related to polycystic ovary syndrome (PCOS). Hum Reprod 2004;19: Fulghesu AM, Ciampelli M, Belosi C, Apa R, Pavone V, Lanzone A. A new ultrasound criterion for the diagnosis of polycystic ovary syndrome: the ovarian stroma/total area ratio. Fertil Steril 2001;76: Belosi C, Selvaggi L, Apa R, Guido M, Romualdi D, Fulghesu AM, et al. Is the PCOS diagnosis solved by ESHRE/ASRM 2003 consensus or could it include ultrasound examination of the ovarian stroma? Hum Reprod 2006;21: Ferriman D, Gallwey JD. Clinical assessment of body hair growth in women. J Clin Endocrinol Metab 1961;21: New MI, Lorenzen F, Lerner AJ, Kohn B, Oberfield SE, Pollack MS, et al. Genotyping steroid 21-hydroxylase deficiency: hormonal reference data. J Clin Endocrinol Metab 1983;57: Petersenn S. Growth hormone secretagogues and ghrelin: an update on physiology and clinical relevance. Horm Res 2002;58(Suppl 3): Nakazato M, Murakami N, Date Y, Kojima M, Matsuo H, Kangawa K, et al. A role for ghrelin in the central regulation of feeding. Nature 2001;409: Carrel AL, Allen DB. Effects of growth hormone on body composition and bone metabolism. Endocrine 2000;12: Bevers MM, Izadyar F. Role of growth hormone and growth hormone receptor in oocyte maturation. Mol Cell Endocrinol 2002;197: Apa R, Lanzone A, Miceli F, Mastrandrea M, Caruso A, Mancuso S, et al. Growth hormone induces in vitro maturation of follicle- and cumulus-enclosed rat oocytes. Mol Cell Endocrinol 1994;106: Kazer RR, Unterman TG, Glick RP. An abnormality of the growth hormone/insulin-like growth factor-i axis in women with polycystic ovary syndrome. J Clin Endocrinol Metab 1990;71: Jaatinen TA, Anttila L, Erkkola R, Koskinen P, Laippala P, Ruutiainen K, et al. Hormonal responses to physical exercise in patients with polycystic ovarian syndrome. Fertil Steril 1993;60: Orio F Jr, Palomba S, Colao A, Russo T, Dentico C, Tauchmanova L, et al. GH release after GHRH plus arginine administration in obese and overweight women with polycystic ovary syndrome. J Endocrinol Invest 2003;26: Inui A. Ghrelin: an orexigenic and somatotrophic signal from the stomach. Nat Rev Neurosci 2001;2: Takaya K, Ariyasu H, Kanamoto N, Iwakura H, Yoshimoto A, Harada M, et al. Ghrelin strongly stimulates growth hormone release in humans. J Clin Endocrinol Metab 2000;85: Micic D, Kendereski A, Popovic V, Sumarac M, Zoric S, Macut D, et al. Growth hormone response to GHRH, GHRP-6 and GHRH GHRP-6 in patients with polycystic ovary syndrome. Clin Endocrinol (Oxf) 1996;45: Ghigo E, Broglio F, Me E, Prodam F, Ragazzoni F. Ghrelin: more than a new frontier in neuroendocrinology. J Endocrinol Invest 2004; 27(Suppl 6): Hansen TK, Dall R, Hosoda H, Kojima M, Kangawa K, Christiansen JS, et al. Weight loss increases circulating levels of ghrelin in human obesity. Clin Endocrinol (Oxf) 2002;56: Saad MF, Bernaba B, Hwu CM, Jinagouda S, Fahmi S, Kogosov E, et al. Insulin regulates plasma ghrelin concentration. J Clin Endocrinol Metab 2002;87: Volante M, Allia E, Gugliotta P, Funaro A, Broglio F, Deghenghi R, et al. Expression of ghrelin and of the GH secretagogue receptor by pancreatic islet cells and related endocrine tumors. J Clin Endocrinol Metab 2002;87: Guido et al. Effects of ghrelin in obese women with PCOS Vol. 88, No. 1, July 2007

139 Pioglitazone reduces the adrenal androgen response to corticotropin-releasing factor without changes in ACTH release in hyperinsulinemic women with polycystic ovary syndrome Daniela Romualdi, M.D., a Maddalena Giuliani, M.D., a Gaetano Draisci, M.D., b Barbara Costantini, M.D., a Francesca Cristello, M.D., a Antonio Lanzone, M.D., a,c and Maurizio Guido, M.D., Ph.D. a a Department of Obstetrics and Gynaecology and b Department of Anesthesiology and Intensive Care, Università Cattolica del Sacro Cuore, Rome, Italy; and c Oasi Institute for Research, Troina, Italy Objective: The hypothalamic-pituitary-adrenal (HPA) axis seems to hyperfunction at both central and peripheral levels in polycystic ovary syndrome (PCOS). Hyperinsulinemia is involved in the adrenal hyper-responsiveness to ACTH. The present study was performed to investigate the role of insulin in the derangement of the hypothalamic-pituitary compartment of the HPA axis in PCOS. Design: Prospective clinical study. Setting: Academic research center. Patient(s): Fifteen hyperinsulinemic PCOS women. Intervention(s): Hormonal and lipid assays, oral glucose tolerance test, and corticotropin-releasing factor (1 g/kg CRF) test before and after 4 months of treatment with the insulin sensitizer pioglitazone (30 mg/day). Main Outcome Measure(s): Glycemic and insulinemic response to glucose load; pituitary and adrenal response to CRF. Result(s): We observed a significant reduction in insulin secretion after therapy. Pioglitazone administration did not modify ACTH and cortisol response to CRF. A significant reduction in the adrenal CRF-induced secretion of androstenedione (A) (area under the curve [AUC] ng/ml 90 minutes to ng/ml 90 minutes) and 17OH-progesterone (AUC ng/ml 90 minutes to ng/ml 90 minutes=) occurred after treatment. A trace response to CRF was observed for DHEAS and testosterone both before and after pioglitazone. Conclusion(s): In PCOS subjects, insulin may enhance adrenal steroidogenesis by acting directly on the peripheral gland, with no significant effects on the pituitary response to CRF stimulation. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Adrenal, CRF, insulin, PCOS, pioglitazone Polycystic ovary syndrome (PCOS) is one of the most common endocrinopathies in female subjects, affecting about 6% 15% of women of reproductive age. Hyperandrogenism, chronic anovulation, and infertility are the main hallmarks of this heterogeneous condition (1 2). Received July 31, 2006; revised and accepted November 17, Supported by a grant from the Ministry of Public Health La prevenzione dell handicap mentale RC 2004 PREV 1 4 IRCCS, Troina, and a grant from Ministero dell Università e della Ricerca (MIUR) Reprint requests: Maurizio Guido, M.D., Ph.D., Department of Obstetrics and Gynecology, Università Cattolica del Sacro Cuore, L.go Agostino Gemelli, Rome, Italy (FAX: ; maurizioguido@libero.it). The pathogenesis of the syndrome is still unclear, although insulin resistance and the concomitant hyperinsulinemia frequently found in these patients are believed to play a paramount role. Hyperinsulinemia contributes to the clinical and biochemical manifestations of the hyperandrogenism by affecting various levels of the hypothalamicpituitary-ovarian axis as well as the hepatic production of SHBG (3). Although the ovary is considered the principal source of androgen excess in PCOS, several lines of evidence suggest that adrenal steroid production might take part in determining the androgenic milieu of the syndrome. Elevated adrenal androgens and a hyper-responsiveness of the gland to ACTH, in fact, were found in a percentage ranging from 25% to 70% of PCOS patients in different series (4 5). We previously demonstrated that PCOS patients with high insulin circulating levels are those who exhibit the highest basal and ACTH-stimulated adrenal androgen levels when compared to both normoinsulinemic PCOS women and control subjects (6). Furthermore, it was reported that insulin infusion enhances 17OH-progesterone (P) and 17OH-pregnenolone secretion after ACTH in hyperandrogenic women (7), thus providing evidence for a direct stimulatory effect of insulin on the adrenal gland /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 131

140 Concordant with these findings, the pharmacologic lowering of insulin levels by insulin sensitizing agents was proven to decrease the adrenal androgen response to ACTH in studies by us and other investigators (8 10). However, in PCOS, the hypothalamic-pituitary-adrenal (HPA) axis seems to be up-regulated also at the central level: a higher ACTH response to corticotropin-releasing hormone (CRH) was observed in PCOS compared with normo-ovulatory women (11), and this abnormality appeared to be correlated with the presence of obesity (12), a feature strictly linked to the severity of hyperinsulinism in such patients. This observation led to the hypothesis of an involvement of insulin in the dysregulation of the HPA axis also at the central level in PCOS women. Earlier reports in the literature regarding non-pcos subjects further support this contention: insulin is able to cross the blood-brain barrier (13); ACTH levels are increased during high-insulin clamp studies (14); and there is a positive correlation between CRH-stimulated ACTH levels and homeostasis insulin resistance indexes (15). Therefore, to improve our understanding of this aspect, the present study was undertaken to investigate the effects of the treatment with the insulin sensitizer pioglitazone on the pituitary-adrenal response to CRH in a cohort of obese hyperinsulinemic PCOS women. MATERIALS AND METHODS We recruited 15 caucasian obese women (body mass index [BMI] 27 kg/m 2 ) with PCOS (age range years) attending our divisional outpatients services. All of the women had spontaneous onset of puberty and normal sexual development, and all had oligomenorrhea with chronic anovulation since puberty. None had thyroid diseases nor had taken medications known to affect plasma sex steroid levels for at least 3 months before entering the study. In accordance with the Rotterdam Consensus Criteria (16), polycystic ovary syndrome was diagnosed in the presence of at least two of the three following clinical findings: chronic anovulation, clinical and/or biochemical evidence of hyperandrogenism, and ultrasonographic appearance of polycystic ovaries. In particular, the ovarian morphology was defined as polycystic in the presence of bilateral normal or enlarged ovaries with at least 10 microcysts (2 8 mm diameter) from the inner margin to the outer margin in longitudinal cross-section associated with an augmented stromal area/total area ratio (17). Pregnancy or possibility of pregnancy and nursing, significant liver (aspartate aminotransferase [AST], alanine aminotransferase [ALT], total bilirubin, or alkaline phosphatase 2 times the upper limit of normal) or renal (serum creatinine mol/l) impairment, neoplasm, cardiovascular disease, and unstable mental illness were considered exclusion criteria. Because of the impact of body fat distribution on androgen levels and glucose metabolism (18, 19), waist-to-hip ratios were measured. Waist circumference was obtained as the minimum value between the iliac crest and the lateral costal margin, and hip circumference was determined as the maximum value over the buttocks. All patients also underwent a transvaginal ultrasonography, and the grade of hirsutism was detected using the Ferriman-Gallwey score ( 8: no hirsutism; 8 16: low hirsutism; score value 17 24: moderate hirsutism; 24: severe hirsutism) (20). Informed consent was obtained from each patient, and the study protocol was approved by our Institutional Review Board. Studies were conducted during the early follicular phase of spontaneous or induced (10 mg/day medroxyprogesterone acetate for 7 days) menstrual cycles (day 3 7). On the first visit, the patients were hospitalized and underwent a gynecologic and medical examination. After following a standard carbohydrate diet (300 g/day) for 3 days and fasting overnight for hours, blood samples were collected to perform the following laboratory investigations: basal hormone assessment, ALT, AST, alkaline phosphatase, cholesterol, lipoproteins, total protein, albumin, creatinine, nitrogen urea, Ca, Na, K, partial thromboplastin time, and fibrinogen. Patients then underwent an oral glucose tolerance test (OGTT). The OGTT was performed as follows: at 9:00 AM after overnight fasting, an indwelling catheter was inserted into the antecubital vein of one arm. Blood samples were collected basally and, after ingestion of 75 g glucose in 150 ml water within 5 min, at 30, 60, 90, 120, 180, and 240 minutes. Insulin, glucose, and C-peptide were assayed in all samples. The following day, after another overnight fasting, a CRF test was performed as follows: At 7:00 AM, an indwelling catheter was inserted into the antecubital vein and saline solution was infused slowly throughout the test to keep the vein patent. Blood samples were collected just before (0) and 15, 30, 60, and 90 minutes after the injection of 1 g/kg CRF (Clinalfa, Laufeifingen, Switzerland). Plasma cortisol (F), DHEAS, ACTH, A, T, and P were assayed. The first day of the following menstruation, therapy with pioglitazone (Actos, Takeda, Italy) was started: one pill of 30 mg daily in the morning for 4 months. During the study, chronically stabilized therapies not interfering with the parameters under evaluation were permitted. The use of antidiabetic and estroprogestinic drugs was not allowed. Patients were recommended not to modify their usual diet. Main parameters of liver function were monitored each month during the treatment. 132 Romualdi et al. HPA-axis in PCOS: effect of pioglitazone Vol. 88, No. 1, July 2007

141 After the pioglitazone treatment, all patients had a second hospitalization during the early follicular phase of a spontaneous or induced (10 mg/day medroxyprogesterone acetate for seven days) menstrual cycle (day 3 7) and repeated the same protocol study. On each visit, the compliance with treatment was checked with a questionnaire about the side effects and a subjective evaluation of the tolerability of the administered drug; the patients were also asked about incidental missed administrations, but all reported to have correctly followed the scheduled treatment. A count of capsules returned was made on each control visit. Assays Plasma samples for glucose concentration were collected in tubes containing an inhibitor of glycolysis (sodium fluoride) to be analyzed within 5 hours. Plasma samples for insulin and C-peptide concentrations were placed in tubes standing in ice, centrifuged for 10 min at 1,000g using a 4226 ALC centrifuge (ALC, Milan, Italy) and remained frozen at 30 C until assayed. Glucose plasma concentrations were determined by the glucose oxidase technique with a glucose analyzer (Beckam, Fullerton, CA). All hormone assays were performed with commercial radioimmunoassay kits (Radim, Rome, Italy). The intraassay and interassay coefficients of variation for all hormones were 8% and 15% respectively. For each determination, all samples from the same patient were assayed simultaneously. Total cholesterol and triglyceride concentrations were determined by an enzymatic assay (Bristol, Paris, France). High-density lipoprotein (HDL) concentrations were determined after precipitation of chylomicrons, very low-density lipoprotein (VLDL), and low-density lipoprotein (LDL) (Boehringer, Mannheim, Germany). The VLDL was separated (as the supernatant) from LDL and HDL by lipoprotein ultracentrifugations. A magnesium chloride/phosphotungstic acid technique was used to precipitate LDL from the bottom fraction after ultracentrifugation. Nonesterified free fatty acids (NEFA) were determined by an acyl coenzyme A oxidase based colorimetric method. All lipid assays were performed according to our standard laboratory procedures. Data Analysis All data are presented as mean SD. The OGTT data were analyzed as area under the curve (AUC) after the glucose ingestion, calculated by the trapezoidal rule and expressed as pmol/l 240 minutes for insulin and C-peptide and nmol/l 240 minutes for the glucose plasma levels. The glycemic responses were defined in accordance with the criteria of the National Diabetes Data Group (21). A normal insulinemic response to OGTT was considered to be at a threshold AUC value of 15,000 UI/L 240 minutes, as previously described (22). Descriptive statistics per visit and analysis of variance were used in the evaluation of the clinical features. The significance of differences among the visits measures was determined with the use of one-way analysis of variance, and any significant difference was identified by using the Bonferroni correction for multiple comparisons. For all analyses, P.05 was considered to indicate statistical significance. The incidence rates of adverse events were evaluated and calculated by MEDDRA code (23). RESULTS All patients completed the study therapy without major protocol violation as far as inclusion and exclusion criteria were concerned. No adverse events were reported by the treated subjects, and no abnormalities were detected in hepatic or renal chemistries, in complete blood counts, or in electrocardiograms throughout the treatment. Table 1 shows the clinical and metabolic features of studied subjects before and after pioglitazone treatment. As expected, no differences were found in BMI and hirsutism score. Mean tryglicerides and total cholesterol levels were in the normal range at baseline and were not modified by pioglitazone treatment. Nevertheless, we observed a trend toward reduction in plasma LDL and VLDL concentrations and a significant (P.01) rise in HDL levels. Similarly, serum NEFA decreased in response to pioglitazone treatment, although not significantly. Pioglitazone administration was able to significantly reduce insulin secretion as well as C-peptide levels in terms of AUC after OGTT (P.01 and P.05, respectively), with no changes being observed in the glycemic response to the glucose load. Table 2 shows the main hormonal parameters before and after pioglitazone treatment. A trend toward reduction was seen for plasma T levels, although it was not statistically significant. Sex hormone binding globulin plasma values were significantly higher (P.05) than basal when evaluated after pioglitazone administration. The insulin-lowering treatment induced a significant decrease in the basal plasmatic concentrations of A and P (P.05 for both). Gonadotropins, E 2, and the remnant basal hormonal plasma levels were comparable before and after the study protocol. CRF Test Figure 1 shows ACTH and F response to CRF stimulus before and after pioglitazone administration. The ACTH secretion showed an increase of 118% as a peak 15 minutes after CRF injection and then declined, recovering values similar to baseline about 1 hour after the stimulus. No differences were found when ACTH response to CRF was Fertility and Sterility 133

142 TABLE 1 Main changes induced by pioglitazone treatment in clinical and metabolic parameters in hyperinsulinemic PCOS women. Data are presented as mean SD. Pre-treatment Post-treatment Age (ys) BMI (kg/m 2 ) Score Total cholesterol (mg/dl) Triglycerides (mg/dl) HDL (mg/dl) b LDL (mg/dl) AUC insulin ( UI/mL/240=) 23, , , , b AUC glucose (mg/dl/240=) 28, , , , AUC C-peptide (ng/ml/240=) 1, , a Note: AUC area under the curve after oral glucose load; BMI body mass index; HDL high-density lipoprotein; LDL low-density lipoprotein; PCOS polycystic ovary syndrome. a P.05; b P.01. Romualdi. HPA-axis in PCOS: effect of pioglitazone. Fertil Steril evaluated after pioglitazone treatment in terms of plasma levels at each time point as well as in terms of AUC. Adrenal F secretion showed an increment of 53% as a peak 15 minutes after CRF stimulus, then plateaued and slowly returned to basal level after 90 minutes; pioglitazone administration did not modify adrenal F production after CRF injection when evaluated either as plasma levels or by AUC. Figure 2 shows the androgen response to CRF administration before and after pioglitazone treatment. Androstenedione plasma levels showed an increment 15 minutes after CRF injection and returned to basal values after 60 minutes. After treatment, the maximum CRF-induced increase in A levels occurred at 30 minutes. Pioglitazone administration was able to markedly reduce the adrenal discharge of A after CRF stimulus, as evidenced by the significant difference (P.01) in AUC values before and after treatment. Furthermore, we observed a statistically significant decrease in plasma A levels at each time point of the curve. The plasma 17-OHP response to CRF showed a peak in the plasma concentrations 15 minutes after CRF injection TABLE 2 Hormonal changes induced by pioglitazone treatment in hyperinsulinemic PCOS women. Data are presented as mean SD. Pre-treatment Post-treatment E 2 (pg/ml) P (ng/ml) FSH (mui/ml) LH (mui/ml) SHBG (nmol/l) a A (ng/ml) T (ng/ml) OH-P (ng/ml) DHEAS (ng/ml) 2, , Note: PCOS polycystic ovary syndrome. a P.05. Romualdi. HPA-axis in PCOS: effect of pioglitazone. Fertil Steril Romualdi et al. HPA-axis in PCOS: effect of pioglitazone Vol. 88, No. 1, July 2007

143 FIGURE 1 ACTH and cortisol response to the CRF test in PCOS women before (squares/solid bars) and after (circles/ clear bars) 4 months of pioglitazone therapy. Left panel: curves of secretion. Right panel: AUC values. Romualdi. HPA-axis in PCOS: effect of pioglitazone. Fertil Steril and returned to basal values after 90 minutes. After pioglitazone therapy, a significantly lower peak of 17-OHP discharge occurred 30 minutes after the CRF bolus; both the plasma concentrations at each time point and the absolute AUC values were significantly decreased in the post-treatment evaluation. Exogenous CRF administration did not modify either DHEAS or T production (maximum variation in detected plasmatic concentrations during the test 0.6% and 1.7%, respectively). The same pattern was observed after pioglitazone treatment, which seemed to be unable to affect the adrenal production of these steroids (AUC for testosterone: pretreatment ng/ml 90 minutes, post-treatment ng/ml 90 minutes; AUC for DHEAS: pretreatment 164, ,425.4 ng/ml 90 minutes; posttreatment 170, ,998.6 ng/ml 90 minutes). DISCUSSION Several lines of evidence suggest that an alteration in the adrenal steroidogenesis could be present in patients with PCOS, so that some investigators have hypothesized that an adrenal defect could underlie the pathogenesis of the syndrome (4, 6). This abnormality is believed to originate from a hyper-responsiveness of the gland to normal ACTH circulating concentrations (5, 24) more than from a pituitary corticotropin hyperproduction (25). However, several years ago, we found that a stimulation of the HPA axis, both directly by exogenous CRF and indirectly by naloxone, led to higher ACTH and F production in PCOS than in control subjects (11, 26). Because the ACTH/F ratio was near to unity, we concluded that the hyper-responsiveness of the HPA axis in PCOS women could be central in origin. On the other hand, the possibility of an abnormal drive on the adrenals by factors other than ACTH has not been ruled out. In this regard, previous studies suggest that the PCOSrelated hyperinsulinism may bring a substantial contribution to this derangement. In fact, hyperinsulinemic patients with PCOS were demonstrated to respond to an ACTH stimulus more than normoinsulinemic and control women in terms of both A and P (6). These data were supported by the evidence that a decrease in insulin levels, obtained through an amelioration of insulin hepatic clearance by naltrexone treatment (8) as well as through an improvement of insulin secretion and peripheral sensitivity by insulin-lowering drugs (9, 10), is able to reduce the adrenal androgen response to ACTH stimulus in PCOS women with hyperinsulinism. Pioglitazone, a new insulin sensitizing agent belonging to the thiazolidinedione class, is able to enhance insulin activity with a post insulin receptor mechanism of action (27). The different chemical structure of this compound, which exhibits a higher affinity to the specific receptor peroxisome proliferators activated receptor, allows a more potent insulin sensitizing effect with a much lower hepatotoxicity compared with troglitazone and rosiglitazone (28). In the current study, to investigate at which level of the HPA axis insulin may exert its steroidogenic effect, we evaluated the adrenal response to CRF stimulus in a selected population of hyperinsulinemic PCOS patients before and after pioglitazone therapy. In accordance with our previous studies (10, 29), a 4-month pioglitazone treatment was ef- Fertility and Sterility 135

144 FIGURE 2 Response to the CRF test in terms of A and P in PCOS women before (squares/solid bars) and after (circles/clear bars) treatment with pioglitazone. Left panel: curves of secretion. Right panel: AUC values. *P.05 post-treatment vs. pre-treatment; **P.01 post-treatment vs. pre-treatment. Romualdi. HPA-axis in PCOS: effect of pioglitazone. Fertil Steril fective in markedly reducing insulin pancreatic secretion. This effect was followed by a significant decrease in P and A levels and by an increase in SHBG plasma concentrations, the latter attributable to the decreased insulin inhibitory action on the hepatic synthesis of this protein (3). A trend toward improvement was seen for the T and lipid profiles. The pathogenetic role of insulin in PCOS seems not to be limited to its interference on the peripheral endocrine glands. It is well known, in fact, that insulin receptors are localized in several structures of the central nervous system, where they are implicated in the signaling pathways of the neuroendocrine regulation of the reproductive system (30). The pituitary is one of the most important sites of insulin action. In particular, in women with PCOS, the insulin/insulin-like growth factor (IGF) 1 system seems to be involved in the dysregulation of the LH secretory pattern (31, 32). The present study is the first report in the literature investigating the effect of a decrease in insulin levels on the pituitary response to CRF in PCOS. On the basis of our results, the marked drop in insulinstimulated levels obtained with pioglitazone treatment was not able to affect either basal and CRF-stimulated ACTH levels. This finding indirectly suggests that the insulin influence on the adrenal steroidogenesis does not originate from an enhancement of ACTH secretion at pituitary levels, thus supporting the finding of comparable plasma corticotropin levels in hyperinsulinemic women with PCOS and control subjects. Similarly, adrenal F production seems not to have been affected by insulin reduction due to pioglitazone treatment. These data are in accordance with several previous studies hypothesizing a possible selective role of hyperinsulinism in sex steroid adrenal production (6, 8). Most authors, indeed, agree that cytochrome (c) P450-17, a key enzyme for the synthesis of ovarian and adrenal androgens, could be involved in the hyperproduction of 17-OHP and A in hyperinsulinemic women with PCOS (33). In fact, the insulin/igf system might represent the trigger factor responsible for the hyperstimulation of cp450 17, leading to the dysregulation of the two sequential enzymatic steps (17-hydroxylase and 17,20-lyase) necessary for adrenal 17-OHP and A synthesis (7, 34). Consequently, in line with our previous study on the effect of pioglitazone on the adrenal response to ACTH stimulus, the administration of this drug for 4 months was able to significantly reduce the secretion of androstenedione and P. Furthermore, it could not be undervalued that thiazolidinediones display a direct inhibitory effect on the enzymatic activities of cp and 3 -hydroxysteroid dehy- 136 Romualdi et al. HPA-axis in PCOS: effect of pioglitazone Vol. 88, No. 1, July 2007

145 drogenase type 2 (35). Among the members of this drug family, troglitazone is the compound with the most relevant enzymatic inhibitory activity, whereas rosiglitazone and pioglitazone were reported to exert a direct but weaker interference on both cp and 3 -hydroxysteroid dehydrogenase type 2. No responses to CRF stimulus were seen in plasma levels of T and DHEAS, neither before nor after pioglitazone treatment. This finding is not easily explained, because little data are available in the literature dealing with the ability of exogenous CRF stimulation to influence the plasma levels of these two steroids (36, 37). It could be speculated that the 90 minutes after CRF stimulation was not an adequate period to observe significant changes in T and DHEAS production. In conclusion, this study, which for the first time analyzed the effect of a decrease in insulin levels on the pituitary response to CRF in PCOS, seems to suggest that the insulin interference on HPA-axis is mainly exerted directly on the adrenal steroidogenesis. REFERENCES 1. Hart R, Hickey M, Franks S. Definitions, prevalence and symptoms of polycystic ovaries and polycystic ovary syndrome. Best Pract Res Clin Obstet Gynaecol 2004;18: Homburg R. Polycystic ovary syndrome from gynaecological curiosity to multisystem endocrinopathy. Hum Reprod 1996;11: Dunaif A. Insulin resistance and polycystic ovary syndrome: mechanism and implications for pathogenesis. Endocr Rev 1997;18: Moran C, Azziz R. The role of the adrenal cortex in polycystic ovary syndrome. Obstet Gynecol Clin North Am 2001;28: Azziz R, Black V, Hines GA, Fox LM, Boots LR. Adrenal androgen excess in the polycystic ovary syndrome: sensitivity and responsivity of the hypothalamic-pituitary-adrenal axis. J Clin Endocrinol Metab 1998; 83: Lanzone A, Fulghesu AM, Guido M, Fortini A, Caruso A, Mancuso S. Differential androgen response to adrenocorticotropic hormone stimulation in polycystic ovary syndrome: relationship with insulin secretion. Fertil Steril 1992;58: Moghetti P, Castello R, Negri C, Tosi F, Spiazzi GG, Brun E, et al. Insulin infusion amplifies 17 alpha-hydroxycorticosteroid intermediates response to adrenocorticotropin in hyperandrogenic women: apparent relative impairment of 17,20-lyase activity. J Clin Endocrinol Metab 1996;81: Lanzone A, Fulghesu AM, Guido M, Ciampelli M, Caruso A, Mancuso S. Differential androgen response to adrenocorticotrophin hormone stimulation and effect of opioid antagonist on insulin secretion in polycystic ovarian syndrome. Hum Reprod 1994;9: Arslanian SA, Lewy V, Danadian K, Saad R. Metformin therapy in obese adolescents with polycystic ovary syndrome and impaired glucose tolerance: amelioration of exaggerated adrenal response to adrenocorticotropin with reduction of insulinemia/insulin resistance. J Clin Endocrinol Metab 2002;87: Guido M, Romualdi D, Suriano R, Giuliani M, Costantini B, Apa R, et al. Effect of pioglitazone treatment on the adrenal androgen response to corticotrophin in obese patients with polycystic ovary syndrome. Hum Reprod 2004;19: Lanzone A, Petraglia F, Fulghesu AM, Ciampelli M, Caruso A, Mancuso S. Corticotropin-releasing hormone induces an exaggerated response of corticotropic hormone and cortisol in polycystic ovary syndrome. Fertil Steril 1995;63: Guido M, Ciampelli M, Fulghesu AM, Pavone V, Barini A, De Marinis L, et al. Influence of body mass on the hypothalamic-pituitary-adrenal axis response to naloxone in patients with polycystic ovary syndrome. Fertil Steril 1999;71: Schwartz MW, Sipols A, Kahn SE, Latterman DF, Taborsky GJ Jr, Bergman RN, et al. Kinetics and specificity of insulin uptake from plasma into cerebrospinal fluid. Am J Physiol 1990;259:E Fruehwald-Schultes B, Kern W, Bong W, Wellhoener P, Kerner W, Born J, et al. Supraphysiological hyperinsulinemia acutely increases hypothalamic-pituitary-adrenal axis secretory activity in humans. J Clin Endocrinol Metab 1999;84: Vicennati V, Pasquali R. Abnormalities of the hypothalamic-pituitaryadrenal axis in nondepressed women with abdominal obesity and relations with insulin-resistance: evidence for a central and peripheral alteration. JCEM 2000;85: Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Workshop Group. Revised 2003 consensus on diagnostic criteria and long term health risks related to polycystic ovary syndrome (PCOS). Hum Reprod 2004;19: Fulghesu AM, Ciampelli M, Belosi C, Apa R, Pavone V, Lanzone A. A new ultrasound criterion for the diagnosis of polycystic ovary syndrome: the ovarian stroma/total area ratio. Fertil Steril 2001;76: Ciampelli M, Fulghesu AM, Cucinelli F, Pavone V, Ronsisvalle E, Guido M, et al. Impact of insulin and body mass index on metabolic and endocrine variables in polycystic ovary syndrome. Metabolism 1999; 48: De Simone M, Verrotti A, Iughetti L, Palumbo M, Farello G, Di Cesare E, et al. Increased visceral adipose tissue is associated with increased circulating insulin and decreased sex hormone binding globulin levels in massively obese adolescent girls. J Endocrinol Invest 2001;24: Ferriman D, Gallwey JD. Clinical assessment of body hair growth in women. J Clin Endocrinol Metab 1961;21: National Diabetes Data Group. Classification and diagnosis of diabetes mellitus and other categories of glucose intolerance. Diabetes 1979;28: Ciampelli M, Fulghesu AM, Cucinelli F, Pavone V, Caruso A, Mancuso S, et al. Heterogeneity in beta cell activity, hepatic insulin clearance and peripheral insulin sensitivity in women with polycystic ovary syndrome. Hum Reprod 1997;12: Brown EG, Wood L, Wood S. The medical dictionary for regulatory activity (MedDRA). Drug Saf 1999;20: Gonzalez F. Adrenal involvement in polycystic ovary syndrome. Semin Reprod Endocrinol 1997;15: Horrocks PM, Kandeel FR, London DR, Butt WR, Lynch SS, Holder G, et al. ACTH function in women with the polycystic ovarian syndrome. Clin Endocrinol (Oxf) 1983;19: Lanzone A, Guido M, Ciampelli M, Fulghesu AM, Pavone V, Proto C, et al. Evidence of a disturbance of the hypothalamic-pituitary-adrenal axis in polycystic ovary syndrome: effect of naloxone. Clin Endocrinol (Oxf) 1996;45: Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA. An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator activated receptor gamma (PPAR gamma). J Biol Chem 1995;270: Gillies PS, Dunn CJ. Pioglitazone. Drugs 2000;60:333 43; discussion Romualdi D, Guido M, Ciampelli M, Giuliani M, Leoni F, Perri C, et al. Selective effects of pioglitazone on insulin and androgen abnormalities in normo- and hyperinsulinaemic obese patients with polycystic ovary syndrome. Hum Reprod 2003;18: Unger JW, Livingston JN, Moss AM. Insulin receptors in the central nervous system: localization, signalling mechanisms and functional aspects. Prog Neurobiol 1991;36: Adashi EY, Hsueh AJ, Yen SS. Insulin enhancement of luteinizing hormone and follicle-stimulating hormone release by cultured pituitary cells. Endocrinology 1981;108: Soldani R, Cagnacci A, Paoletti AM, Yen SS, Melis GB. Modulation of anterior pituitary luteinizing hormone response to gonadotropin- Fertility and Sterility 137

146 releasing hormone by insulin-like growth factor I in vitro. Fertil Steril 1995;64: Ehrmann DA, Rosenfield RL, Barnes RB, Brigell DF, Sheikh Z. Detection of functional ovarian hyperandrogenism in women with androgen excess. N Engl J Med 1992;327: Rosenfield RL, Barnes RB, Cara JF, Lucky AW. Dysregulation of cytochrome P450c 17 alpha as the cause of polycystic ovarian syndrome. Fertil Steril 1990;53: Arlt W, Auchus RJ, Miller WL. Thiazolidinediones but not metformin directly inhibit the steroidogenic enzymes P450c17 and 3beta hydroxysteroid dehydrogenase. J Biol Chem 2001;276: Muller OA, Dorr HG, Hagen B, Stalla GK, von Werder K. Corticotropin releasing factor (CRF) stimulation test in normal controls and patients with disturbances of the hypothalamo-pituitary-adrenal axis. Klin Wochenschr 1982;60: Heinrich N, Meyer MR, Furkert J, Sasse A, Beyermann M, Bonigk W, Berger H. Corticotropin-releasing factor (CRF) agonists stimulate testosterone production in mouse Leydig cells through CRF receptor-1. Endocrinology 1998;139: Romualdi et al. HPA-axis in PCOS: effect of pioglitazone Vol. 88, No. 1, July 2007

147 Serum insulin-like growth factor I (IGF-I) and IGF-binding protein 3 (IGFBP-3) in IVF patients with polycystic ovary syndrome: correlations with outcome Katherine D. Schoyer, M.D., a Hung-Ching Liu, Ph.D., a Steven Witkin, Ph.D., b Zev Rosenwaks, M.D., a and Steven D. Spandorfer, M.D. a a Center for Reproductive Medicine and Infertility, and b Division of Immunology and Infectious Diseases, Department of Obstetrics and Gynecology, Weill Cornell Medical College, New York, New York Objective: To evaluate serum insulin-like growth factor I (IGF-I) and IGF-binding proteing 3 (IGFBP-3) levels during stimulation in polycystic ovary syndrome (PCOS) and control populations as factors predictive of IVF outcome. Design: Observational study. Setting: Academic medical center based IVF practice. Patient(s): Forty-three PCOS and 33 male-factor control patients undergoing IVF from 2002 to Intervention(s): Treatment with a dual suppression protocol incorporating oral contraceptive pills (OCPs) and GnRH agonist suppression followed by low-dose gonadotropin therapy. Main Outcome Measure(s): The PCOS and control patients serum IGF-I and IGFBP-3 levels were compared and correlated with IVF outcome. Result(s): PCOS and control patients were comparable in terms of demographics and IVF outcome. In both, mean serum IGF-I levels increased during stimulation. PCOS patients whose IGF-I levels decreased from day 3 to day of hcg had a significantly higher mean number of immature oocytes retrieved ( vs ; P.02). IGFBP-3 levels increased during stimulation in PCOS patients but tended to decrease in control patients. In PCOS patients, an increase in IGFBP-3 levels during stimulation was associated with a greater likelihood of becoming pregnant (P.03) and of ongoing pregnancy (P.02). Conclusion(s): The bioavailability of IGF-I appears to play a key role in oocyte maturation in PCOS patients. Alterations in IGFBP-3 concentration during stimulation may be a critical mechanism in modulating IGF-I activity. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: PCOS, IGF-I, IGFBP-3, IVF Clinical research has suggested a key role for insulin-like growth factors (IGFs) and IGF-binding proteins (IGFBPs) in follicular selection in PCOS patients (1). Normal ovarian cyclicity is regulated by gonadotropins as well as intraovarian and systemic growth factor systems, and abnormalities in these systems are postulated to play a role in the pathogenesis of PCOS (2). Insulin-like growth factor I, a 70 amino acid polypeptide largely synthesized by the liver, synergizes with gonadotropins in stimulating granulosa cell function and promotes follicular survival and development (3 7). Although follicular fluid IGF-I levels correlate with those in serum (8 9), IGF-I is thought to function largely as a paracrine factor, with minimal synthesis by human granulosa cells (10 11). The activities of IGF-I are largely modulated by IGF-binding proteins (IGFBPs) (12 14). Insulin-like growth factor binding protein 3 has been demonstrated in follicular fluid in normally cycling women and appears to be the primary Received January 16, 2006; revised and accepted November 21, Reprint requests: Katherine D. Schoyer, M.D., 505 East 70th Street HT 340, New York, NY (FAX: ; kgd2002@ med.cornell.edu). intraovarian and serum binding protein (15). Serum IG- FBP-3 has been shown to decrease during stimulation in normal control subjects (16 17) and may be a factor predictive of IVF outcome (18, 19). The purpose of the present study was to examine serum IGF-I and IGFBP-3 levels in PCOS and control patients during controlled ovarian hyperstimulation (COH) with the dual-suppression low-dose gonadotropin protocol to determine if these factors are predictive of IVF outcome. MATERIALS AND METHODS We analyzed serial serum levels of IGF-I and IGFBP-3 from PCOS and control patients between the ages of 22 and 38 years undergoing IVF with the dual-suppression low-dose gonadotropin protocol (no more than 225 IU). Results were reviewed from patients IVF attempts with this protocol if they had no more than one failed IVF attempt. Weill Medical College of Cornell University Institutional Review Board approval was obtained for this study. Patients were included if they met the definition of PCOS with at least two of the following criteria, as established by the Rotterdam Consensus Workshop (20): oligomenorrhea /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 139

148 (defined as menstrual intervals greater than 35 days) or amenorrhea (the absence of periods for a total of at least 3 of the preceding cycle intervals or 6 months of no menses) (21), PCO-like ovaries on ultrasound (as described by at least ten peripherally located cystic structures 2 10 mm in diameter with an increased central ovarian stroma) (22), and/or hyperandrogenism (as defined by elevated serum androgens or clinical features such as acne or hirsutism). The PCOS patients were included from those who attempted IVF during a 2-year period ( ) with the specific protocol. There were no cases of diabetes mellitus. In 18 PCOS cycles, (28.1%) patients were concurrently treated with metformin owing to obesity or an elevated fasting insulin level at the discretion of their physician. No coasted cycles were included. The control population was identified by a search in our IVF database for patients between the ages of 22 and 38 years who had attempted IVF for severe male factor during the same period and had been treated with the dual-suppression low-dose gonadotropin protocol. Male factor cases included severe oligoasthenospermia, obstructive azospermia, and nonobstructive azospermia treated by testicular sperm extraction. Control subjects were normally ovulating patients who were excluded if they had more than one failed IVF cycle at our institution, had a history of an elevated random day 3 FSH ( 12 miu/ml), had PCO-like ovaries, or were coasted or underwent preimplantation genetic diagnosis with blastomere biopsy during the cycle of interest. The treatment protocol has been described previously (23). Patients started combination oral contraceptive pills (OCPs) containing 35 g ethinyl E 2 /1 mg norethindrone (Ortho-Novum 1/35; Ortho Pharmaceutical Co., Raritan, NJ) after onset of a spontaneous menstrual period or progestininduced withdrawal bleeding. Oral contraceptives were taken daily for 28 days. Leuprolide acetate (Lupron; TAP Pharmaceutical, Deerfield, IL) was started on day 21 at a daily dosage of 1 mg subcutaneous and overlapped the contraceptive pill for 7 days. Patients presented on the third day of withdrawal bleeding after cessation of OCPs for pelvic ultrasound and serum hormonal assessment of E 2, FSH, and LH. If findings were within normal limits (normal pelvic ultrasound, E 2 50 pg/ml), patients decreased their leuprolide dosage to 0.5 mg and started low-dose gonadotropin stimulation ( total IU purified FSH, alone or with hmg). The daily gonadotropin dosage was decreased in an incremental step-down fashion once initial follicular recruitment was established (serum E pg/ml, follicles measuring at least mm mean diameter). Patients were not treated with growth hormone. Human chorionic gonadotropin was administered ( ,000 IU) when at least two lead follicles reached or exceeded 17 mm mean diameter as measured by transvaginal ultrasound. Oocytes were harvested by transvaginal ultrasound guided follicular puncture 35 hours after hcg administration. Patients received hcg at a dose based upon their serum E 2 levels. Conventional oocyte insemination or micromanipulation was performed as indicated. The best morphologically appearing embryos were transfered into the uterine cavity 3 or 5 days after retrieval, depending on the embryologists assessment of embryo development. The number of embryos transfered depended on maternal age, according to our standard protocol and guidelines of the Society for Assisted Reproductive Technology (24). Methylprednisolone (16 mg/day) and tetracycline (250 mg every 6 hours) were administered for 4 days to all patients starting on the day of oocyte retrieval. Progesterone supplementation was initiated on the day after retrieval (25 50 mg /day) and was continued until sonographic assessment of the pregnancy at days of gestation as determined by the day of oocyte insemination. Serum samples were cryopreserved at 80 C and subsequently assayed for IGF-I and IGFBP-3 levels on day 3 and the day of hcg. Care was taken to avoid serial thaw and freeze cycles. A clinical pregnancy was defined as the presence of a fetal heartbeat at the 7-week sonogram. The ongoing pregnancy rate was defined as pregnancies developing beyond 12 weeks. Implantation rate was defined as number of gestational sacs per the number of embryos transfered. Laboratory Analysis Serum sample hormonal levels were measured by the commercially available Immulyte 2000 assay method. Levels of IGF-I and IGFBP-3 were measured using Quantikine ELISAs (R&D Systems, Minneapolis, MN), with minimal detectable doses of ng/ml and ng/ ml, respectively. The coefficients of variation for IGF-I were 4.5% for intra-assay precision and 8.5% for interassay precision. The coefficients of variation for IGFBP-3 were 5.0% for intra-assay precision and 8.0% for interassay precision. In the bloodstream, IGFBP-3 circulates bound to IGF-I and IFG-2 in 140-kDA ternary complexes (25). Limited proteolysis of IGFBP-3 generates fragments of IGFBP-3 (26), and the relative abundance of these different fragments varies in different physiologic conditions (27). The ability of the Quantikine ELISA for IGFBP-3 to distinguish between the intact and proteolysed forms has not been evaluated, and therefore it does not reflect solely the concentration of IG- FBP-3 capable of sequestering IGFs in the bloodstream. Statistical Analysis Outcome measures included cycle parameters and pregnancy rates (PR) described as frequencies. Statistical analysis included Student t and chi-squared tests. P.05 was considered to be statistically significant. Analysis of variance 140 Schoyer et al. Serum IGF-I and IGFBP-3 in PCOS IVF patients Vol. 88, No. 1, July 2007

149 (ANOVA), regression analyses, chi-squared test, and t test were done using SPSS version 10.0 for Windows (SPSS, Chicago, IL). RESULTS Serum was prospectively collected from control subjects (n 33) and PCOS patients (n 43) undergoing IVF cycles (57 PCOS and 43 control cycles) with the dual-suppression low-dose gonadotropin protocol during the defined period and cryopreserved for later analysis. All patients were oligomenorrheic and had PCO-like ovaries. Twenty-six PCOS patients (60.5%) had hyperandrogenism: 18 (69.2%) had clinical features (hirsutism or acne), 4 (15.4%) had clinical features and hyperandrogenemia, and 6 (26.1%) had hyperandrogenemia alone. According to the World Health Organization (WHO) definitions of BMI (28), 75.7% of control subjects were of normal weight, 5.4% were overweight, and 10.8% were obese. Out of the PCOS patients, 65.0% were normal weight, 25% overweight, and 4% obese. Male factor control subjects had a diversity of etiologies: 2 cycles (4.7%) with congenital bilateral absence of the vas deferens, 13 (30.2%) with nonobstructive azospermia, 23 (53.5%) with oligoasthenoteratospermia, and 5 (11.6%) with teratospermia. Sperm sources were ejaculate in 29 (67.4%), midepididymal sperm aspiration in 2 (4.7%), testicular sperm extraction in 10 (23.2%), and a combination of testicular sperm extraction and ejaculate in 2 (4.7%). For comparison of patient and cycle parameters between the two groups, see Table 1. Three of the PCOS cycles (4.7%) were canceled before retrieval owing to a drop in serum E 2, and two (3.3%) did not proceed with embryo transfer owing to poor fertilization or development. Five PCOS patients (7.8%) were coasted during stimulation and not included in analysis. Thirty-seven control patients (86%) and 44 PCOS patients (72%) had day 3 embryo transfers (P.45). Total, clinical, and multiple pregnancy rates were comparable between the groups: 61.4%, 57.9%, and 25.7%, respectively for PCOS; and 72.1%, 62.8%, and 35.5%, respectively, for control patients. For both groups, mean serum IGF-I levels increased during stimulation (day3 vs. day of hcg: PCOS: ng/ml vs ; P.0001; Control: vs ng/ml; P.002) (Fig. 1). The IGF-I levels were comparable between PCOS and control patients on day 3 and day of hcg. PCOS patients who had a decrease in IGF-I levels from day 3 to day of hcg had higher mean numbers of oocytes retrieved, although not statistically significant ( vs ; P.1). However, PCOS patients whose IGF-I levels fell during stimulation had a higher number of immature oocytes ( vs ; P.02) and percentage of immature oocytes (33.9% vs. 20.0%; P.07). Control patients whose IGF-I levels rose or fell during stimulation had comparable numbers of oocytes ( vs , rise vs. fall, respectively, of IGF-I; P.9) and percent- TABLE 1 Cycle characteristics for completed cycles. Parameter PCOS (n 57) Control (n 43) P value Age (yrs)* NS Body mass index (kg/m 2 ) Mean no. ampules NS Days of stimulation NS Mean E 2 day of hcg (pg/ml) 1, , Mean no. oocytes NS Mean no. mature oocytes NS Mature oocytes (%) NS Mean no. 2PN embryos NS Fertilization rate (%) NS Mean no. embryos transfered NS Implantation rate (%) NS Pregnancy rate (%) NS Clinical pregnancy rate (%) NS Ongoing pregnancy rate (%) NS Multiple pregnancy rate (%) NS Note: Means are expressed standard error. NS not significant. * t test. 2. Schoyer. Serum IGF-I and IGFBP-3 in PCOS IVF patients. Fertil Steril Fertility and Sterility 141

150 FIGURE 1 IGF-I levels (ng/ml) during stimulation. Schoyer. Serum IGF-I and IGFBP-3 in PCOS IVF patients. Fertil Steril ages of immature oocytes (19.7% vs. 20.6%, rise vs. fall, respectively, of IGF-I; P.9). After adjustment for BMI as a continuous variable in a multivariate linear regression model, there was evidence of an independent association between rise in IGF-I levels and number of immature oocytes (adjusted model, rise vs. fall of IGF-I: vs ; P.007) and percentage of immature oocytes (adjusted model, rise vs. fall of IGF-I: 20.0% vs. 36.8%; P.04) in PCOS patients. If only nonobese PCOS patients not on metformin were included in the analysis, those whose IGF-I levels fell during stimulation still had a higher number of immature oocytes ( vs ; P.01). Metformin treatment did not significantly affect day 3 or day of hcg levels of IGF-I or IGFBP-3 or the significant trends of IGF-I and IGFBP-3 during stimulation. The PCOS patients whose IGF-I levels rose during stimulation had comparable peak E 2 levels with those whose IGF-I levels fell (1, pg/ml vs. 1, , rise vs. fall, respectively, of IGF-I; P.9). Linear regression analysis demonstrated that neither age, BMI, ampules of medications, days of stimulation, maximum E 2 levels, number of oocytes, nor number of mature oocytes independently predicted the change in IGF-I levels during stimulation in either PCOS or control patients. Multivariate linear regression analysis confirmed that these variables were not predictive. The IGFBP-3 levels increased during stimulation in PCOS patients but tended to decrease in control subjects (day3 vs. day of hcg: PCOS: 1, vs. 1, ng/ml; P.003; control: 2, vs. 2, ng/ml; P.12] (Fig. 2). The IGFBP-3 levels were significantly higher for control patients than for PCOS patients for day 3 (P.0001) and day of hcg (P.002). In PCOS patients, an increase in IGFBP-3 levels during stimulation was associated with a greater likelihood of becoming pregnant (P.03) and of ongoing pregnancy (P.02). Conversely, in controls, a decrease in IGFBP-3 levels during stimulation was associated with a greater likelihood of pregnancy (P.03) and of ongoing pregnancy (P.01). DISCUSSION We report the dynamic changes of serum IGF-I and IG- FBP-3 during COH and evaluate their value as factors predictive of IVF outcome in age- and protocol-matched PCOS and control patients. Overall, mean IGF-I levels increased during COH. However, the subset of PCOS patients whose IGF-I levels decreased during stimulation had a higher number of immature oocytes retrieved. The IGFBP-3 levels were higher in control patients and increased during stimulation in PCOS patients but tended to decrease in control patients. In PCOS patients, an increase in levels of IGFBP-3 during stimulation was associated with a higher likelihood of pregnancy, whereas in control patients, a decrease in IGFBP-3 levels was associated with a higher likelihood of pregnancy. Our study groups had similar proportions of mature oocytes. The association of a fall in IGF-I levels with a higher number of immature oocytes in PCOS patients suggests that the bioavailability of IGF-I is integral to the mature oocyte in these patients. Several authors have found that in normally ovulating patients, follicular fluid IGF-I concentrations correlated with the degree of oocyte maturity (8, 9, 29) We did detect significantly different levels of IGFBP-3 and discrepant trends of serum IGFBP-3 levels during stimulation in PCOS and control patients. Serum IGFBP-3 levels decrease during FSH stimulation in normally ovulating patients (16, 17, 30). This reduction of IGFBP-3 may be a critical mechanism in modulating IGF-I activity in normally ovulating patients (16). In vivo data suggest that IGFBP-3 neutralizes the actions of gonadotropins and IGF-I, likely by sequestering IGF-I (31). If IGF-I concentrations increase or are stable, a decrease in IGFBP-3 levels would increase free IGF-I levels, resulting in follicular growth and a rise in serum E 2 levels (1). We speculate that lower IGFBP-3 levels in PCOS patients during COH allow for increased free IGF-I, further enhancing its bioavailability. An increase in IGFBP-3 during COH could stabilize extracellular IGF-I, prolong its half-life (32), and potentiate the actions of IGF-I (19, 33). Additionally, interactions between IGF-I and IGFBP-3 are regulated by FIGURE 2 IGFBP-3 levels (ng/ml) during stimulation. Schoyer. Serum IGF-I and IGFBP-3 in PCOS IVF patients. Fertil Steril Schoyer et al. Serum IGF-I and IGFBP-3 in PCOS IVF patients Vol. 88, No. 1, July 2007

151 post-translational modifications, including phosphorylation, glycosylation, and proteolysis (32, 34). Proteolysis of IG- FBP-3 appears to regulate IGFBP-3 activity, because it limits active IGFBP-3 and releases sequestered IGF-I (33, 35). Thus, despite an increase in total IGFBP-3, proteolysis of IGFBP-3 may concomitantly limit active IGFBP-3, allowing for increased IGF activity. In light of this, it is interesting that the rise in IGFBP-3 levels was predictive of pregnancy rates in PCOS patients. It is possible that this association was seen because a majority of PCOS patients (63.8%) became pregnant, and a majority also demonstrated a rise in serum IGFBP-3 levels during stimulation (65%). Similarly, a majority of control patients became pregnant (72.1%), and a majority demonstrated a fall in serum IGFBP-3 levels (61.5%). However, serum IGFBP-3 levels were not predictive of other IVF outcome parameters such as number of ampules of gonadotropins, oocytes, mature oocytes, fertilized embryos, or fertilization or implantation rates in either of the populations studied. The strengths of the present study include the strict PCOS inclusive criteria as defined by the Rotterdam Consensus Workshop (20). We attempted to match PCOS patients and control subjects for major confounders of IVF outcome: treatment protocol and age. The dual-suppression low-dose gonadotropin protocol permits controlled stimulation, and in no cases were patients coasted. Age and normal day 3 FSH levels comprised our attempts to match for ovarian reserve. These similarities in stimulation and outcome permit identification of insightful differences in IGF patterns. One weakness is that PCOS and control patients were not matched for BMI. In normal-weight PCOS patients, IGF bioavailability may be increased by mechanisms such as insulin-induced hepatic and ovarian IGFBP-1 suppression and growth hormone induced hepatic IGF-I stimulation (36). In obese PCOS patients, IGF-I bioavailability may be comparatively reduced because of low growth hormone and high insulin levels. However, when we adjusted for BMI, we still found a significant relationship between oocyte immaturity and a fall in serum IGF-I levels in PCOS patients. It should also be noted that in both patient groups the mean BMI was within the normal range by the WHO definition (28). Because metformin usage has been found to increase follicular fluid IGF-I levels and modulate intraovarian androgens (37), the use of metformin among a subset of PCOS patients may also be a confounder. However, when patients on metformin were excluded, we still found a significant association between oocyte immaturity and a fall in IGF-I levels in PCOS patients. In the present study we chose to examine IGF-I and IGFBP-3 because they are serum proteins. Insulin-like growth factor II also is a significant ovarian growth factor, and it has been shown to be synthesized by granulosa cells in a hormonally sensitive manner (10) and to be the principal IGF within the ovarian follicle. However, it functions primarily in an autocrine manner on granulosa cells in dominant follicles (37). Of note, the IGF and IGFBP system is a very complex system, and the aim of this paper was not to wholly summarize dynamics within it during COH. Future directions include studying patterns of IGFBPs 1 4 and IGF-II in PCOS and control patients during stimulation. In conclusion, we observed that in PCOS patients, a decrease in serum IGF-I levels during stimulation with the dual suppression-low dose gonadotropin protocol was associated with a higher number of immature oocytes, suggesting a key role for IGF-I in oocyte maturation. An increase in IGFBP-3 levels during stimulation in PCOS patients, which was associated with pregnancy, may be a mechanism critical to the modulation of IGF-I activity (38). REFERENCES 1. San Roman GA, Magoffin DA. Insulin-like growth factor binding proteins in ovarian follicles from women with polycystic ovarian disease: cellular source and levels in follicular fluid. J Clin Endocr Metab 1992;75: Poretsky L, Cataldo NA, Rosenwaks Z, Giudice LC. The insulin-related ovarian regulatory system in health and disease. Endocr Rev 1999;20: Adashi EY. The ovarian follicle: life cycle of a pelvic clock. In: Adashi EY, Rock JA, Rosenwaks Z, eds. Reproductive endocrinology, surgery, and technology. Vol. 1. Philadelphia: Lippincott-Raven, 1996: Davoren JB, Kasson BG, Li CH, Hsueh AJW. Specific insulin-like growth factor I and II binding sites on rat granulosa cells: relation to IGF action. Endocrinology 1986;119: Davoren JB, Hsueh AJW, Li CH. Somatomedin C augments FSHinduced differentiation of cultured rat granulose cells. Am J Physiol 1985;249:E Adashi EY, Resnick CE, D Ercole AJ, Svoboda ME, Van Wyk JJ. Insulin-like growth factors as intraovarian regulators of granulosa cell growth and function. Endocr Rev 1985;6: Chun SY, Billig H, Tilly JL, Furuta I, Tsafriri A, Hsue AJ. Gonadotropin suppression of apoptosis in cultured preovulatory follicles: mediatory role of endogenous insulin-like growth factor I. Endocrinology 1994;135: Eden JA, Jones J, Carter GD, Alaghband-Zadeh J. A comparison of follicular fluid levels of insulin-like growth factor-1 in normal dominant and cohort follicles, polycystic and multicystic ovaries. Clin Endocrinol 1988;29: Rabinovici J, Dandekar P, Angle MJ, Rosenthal S, Martin MC. Insulinlike growth factor I (IGF-I) levels in follicular fluid from human revelatory follicles: correlation with serum IGF-I levels. Fertil Steril 1990;54: Voutilainen R, Miller WL. Coordinate tropic hormone regulation of mrnas for insulin-like growth factor II and the cholesterol side-chaincleavage enzyme, P450ssc, in human steroidogenic tissues. Proc Natl Acad Sci U S A 1987;84: Artini PG, Battaglia C, D Ambrogio G, Barreca A, Droghini F, Volpe A, et al. Relationship between human oocyte maturity, fertilization and follicular fluid growth factors. Hum Reprod 1994;9: Shimasaki S, Ling N. Identification and molecular characterization of insulin-like growth factor binding proteins. Prog Growth Factor Res 1991;3: Giudice LC. Insulin-like growth factors and ovarian follicular development. Endocr Rev 1992;13: Rechler MM, Brown AL. Insulin-like growth factor binding proteins: gene structure and expression. Growth Regul 1992;2: Fertility and Sterility 143

152 15. San Roman GA, Magoffin DA. Insulin-like growth factor binding proteins in healthy and atretic follicles during natural menstrual cycles. J Clin Endocrinol Metab 1993;76: Amato G, Izzo A, Tucker A, Bellastella A. Insulin-like growth factor binding protein-3 reduction in follicular fluid in spontaneous and stimulated cycles. Fertil Steril 1998;70: Amato G, Izzo A, Tucker AT, Bellastella A. Lack of insulin-like growth factor binding protein-3 variation after follicle-stimulating hormone stimulation in women with polycystic ovary syndrome undergoing in vitro fertilization. Fertil Steril 1999;72: Stadtmauer L, Vidali A, Lindheim SR, Sauer MV. Follicular fluid insulin-like growth factor-i and insulin-like growth factor-binding protein-1 and -3 vary as a function of ovarian reserve and ovarian stimulation. J Assist Reprod Gen 1998;15: Salobir B, Prezelj J, Meden-Vrtovec H, Kocijancic A, Osredkar J. Insulin-like growth factor binding protein-3 serum concentrations and ovarian responsiveness in in-vitro fertilization. Hum Reprod 1996;11: Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Workshop Group. Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome. Fertil Steril 2004; 81: Speroff L, Fritz MA. Clinical gynecologic endocrinology and infertility. 7th ed. Philadelphia: Lippincott Williams & Wilkins, Adams J, Polson DW, Abdulwahid N, Morris DV, Franks S, Mason HD, et al. Multifollicular ovaries: clinical and endocrine features and response to pulsatile gonadotropin releasing hormone. Lancet 1985;21/ 28: Damario MA, Barmat L, Liu HC, Davis OK, Rosenwaks Z. Dual suppression with oral contraceptives and gonadotropin releasing-hormone agonists improves in-vitro fertilization outcomes in high responder patients. Hum Reprod 1997;12: Practice Committee of the Society for Assisted Reproductive Technology and the American Society for Reproductive Medicine. Guidelines on the number of embryos transferred. Fertil Steril 2004;82: Lassarre C, Binoux M. Measurement of intact insulin-like growth factor binding protein 3 in human plasma using a ligand immunofunctional assay. J Clin Endocrinol Metab 2001;86: Lalou C, Silve C, Rosato R, Segovia B, Binoux M. Interactions between insulin-like growth factor-i (IGF-I) and the system of plasminogen activators and their inhibitors in the control of IGF binding protein production and proteolysis in human osteosarcoma cells. Endocrinology 1994;135: Maile L, Brown AL, Holly JMP. IGF binding protein proteolysis in various clinical states. In: Rosenfeld RG, Roberts CT Jr, eds. The IGF system: molecular biology, physiology and clinical applications. Totowa, NJ: Humana Press, 1999: World Health Organization. Global strategy on diet, physical activity and health: obesity and overweight Available at: who.int/dietphysicalactivity/publications/facts/obesity/en/. Accessed: November 7, Pellegrini S, Fuzzi B, Pratesi S, Mannelli M, Criscuoli L, Messeri G et al. In-vivo studies on ovarian insulin-like growth factor I concentrations in human preovulatory follicles and human ovarian circulation. Hum Reprod 1995;10: Dorn C, Reinsberg J, Kupka M, van der Ven H, Schild RL. Leptin, VEGF, IGF-I, and IGFBP-3 concentrations in serum and follicular fluid of women undergoing in vitro fertilization. Arch Gynecol Obstet 2003; 268: Ui M, Shimonaka M, Shimasaki S, Ling N. An insulin-like growth factor-binding protein in ovarian follicular fluid blocks follicle-stimulating hormone stimulated steroid production by ovarian granulosa cells. Endocrinology 1989;125: Lamson G, Giudice LC, Rosenfeld RG. Insulin-like growth factor binding proteins: structural and molecular relationships. Growth Factors 1991;5: Grimes RW, Hammond JM. Proteolytic degradation of insulin-like growth factor (IGF) binding protein-3 by porcine ovarian granulose cells in culture: regulation by IGF-I. Endoc 1994;134: Nonoshita LD, Wathen NC, Dsupin BA, Chard T, Giudice LC. Insulinlike growth factors (IGFs), IGF-binding proteins (IGFBPs), and proteolyzed IGFBP-3 in embryonic cavities in early human pregnancy: their potential relevance to maternal-embryonic and -fetal interactions. J Clin Endocrinol Metab 1994;79: Schmid C, Rutishauser J, Schlapfer I, Froesch ER, Zapf J. Intact but not truncated insulin-like growth factor binding protein-3 (IGFBP-3) blocks IGF-I induced stimulation of osteoblasts: control of IGF signaling to bone cells by IGFBP-3 specific proteolysis? Biochem Biophys Res Commun 1991;179: Brismar K, Fernqvist-Forbes E, Wahren J, Hall K. Effect of insulin on the hepatic production of insulin-like growth factor binding protein-1 (IGFBP-1), IGFBP-3, and IGF-I in insulin-dependent diabetes. J Clin Endocr Metab 1994;79: Stadtmauer LA, Toma SK, Riehl RM, Talbert LM. Metformin treatment of patients with polycystic ovary syndrome undergoing in vitro fertilization improves outcomes and is associated with modulation of insulin-like growth factors. Fertil Steril 2001;75: El-Roeiy A, Chen X, Roberts VJ, LeRoith D, Roberts CT Jr, Yen SS. Expression of insulin-like growth factor-i and IGF-II and the IGF-I, IGF-II, and insulin receptor genes and localization of the gene products in the human ovary. J Clin Endocrinol Metab 1993;77: Schoyer et al. Serum IGF-I and IGFBP-3 in PCOS IVF patients Vol. 88, No. 1, July 2007

153 Discovery of distinct protein profiles for polycystic ovary syndrome with and without insulin resistance by surface-enhanced laser adsorption/ionization time of flight mass spectrometry Shuyun Zhao, M.D., a,b Jie Qiao, M.D., a Meizhi Li, M.D., a Xiaowei Zhang, Ph.D., a Jiekai Yu, Ph.D., c and Rong Li, M.Sc. a a Department of Obstetrics and Gynecology, Peking University Third Hospital, Beijing; b Department of Obstetrics and Gynecology, Affiliated Hospital of Guiyang Medical College, Guiyang; and c Cancer Institute, the Second Affiliated Hospital of Zhejiang University, College of Medicine, Hangzhou, People s Republic of China Objective: To screen the serum protein expression profiles in patients having polycystic ovary syndrome (PCOS) with or without insulin resistance (IR) and search for discriminatory proteins. Design: Cross-sectional study. Setting: Reproductive Center of Peking University Third Hospital. Patient(s): Thirty patients with PCOS with IR, 30 patients with PCOS without IR, and 30 control individuals. Intervention(s): Fasting serum samples. Main Outcome Measure(s): Serum protein peak spectrum. Result(s): There were 27 differential protein peaks between patients with PCOS and IR and controls, 17 between patients with PCOS without IR and controls, and 19 between patients with PCOS and IR and patients without IR. Marker proteins from differentially expressed proteins were screened out with use of a support vector machine and were used to establish three diagnostic models for PCOS IR, PCOS non-ir, and IR, respectively. Conclusion(s): There were statistically significantly different serum proteomic patterns in different types of PCOS. With use of ProteinChip combined with the support vector machine, computer diagnostic models for PCOS with and without IR were set up quickly and efficiently. These discriminatory proteins may help us understand the proteomic changes in serum and find out potential biomarkers of PCOS and IR. (Fertil Steril Ò 2007;88: Ó2007 by American Society for Reproductive Medicine.) Key Words: Polycystic ovary syndrome, insulin resistance, protein profile, surface-enhanced laser adsorption/ ionization time of flight mass spectrometry, weak cation exchange protein chip Polycystic ovary syndrome (PCOS) affects 6% to 8% of women of reproductive age (1) and may have a substantial impact on women at multiple life stages. For adolescent women, PCOS may cause menstrual disorder, hirsutism, obesity, or acne and may influence their well-being greatly (2). For reproductive-age women, PCOS may account for 75% of anovulatory infertility and significantly increase the risk of recurrent pregnancy loss, gestational diabetes (up to 46%), and gestational hypertension (3). Recent studies have demonstrated that PCOS threatens the long-term health of women. It substantially increases the risk of type 2 diabetes, Received April 7, 2006; revised November 16, 2006; accepted November 20, Supported by grants from the Chinese National Natural Science Foundation ( ) and Key Project of Chinese National Programs for Fundamental Research and Development (973 program, 2001CB5103), Beijing, People s Republic of China. Presented at the Conjoint Annual Meeting of the American Society for Reproductive Medicine and the Canadian Fertility and Andrology Society, Montreal, Quebec, Canada, October 15 19, Reprint requests: Jie Qiao, M.D., Department of Obstetrics and Gynecology, Peking University Third Hospital, No. 49 HuaYuan Bei Road, HaiDian District, Beijing, People s Republic of China (FAX: ; jie.qiao@263.net). hypertension, dyslipidemia, cardiovascular diseases, and endometrial cancer. In particular, the risk of type 2 diabetes increases threefold to sevenfold (4), even fivefold to tenfold (5). Although nearly 70 years of intensive research has made great achievements at the cellular and molecular levels about PCOS, the etiology of PCOS remains unclear, and effective biomarkers for monitoring the diagnostic and therapeutic effects are still unavailable. The emergence of proteomics and methodologic advances provide us with a sound platform for studying PCOS at the protein level to search for potential biomarkers. Proteomic methods have been used to study polygenetic diseases, such as tumors and cardiovascular diseases, especially in biomarkers discovery (6). Surface-enhanced laser adsorption/ ionization (SELDI)-ProteinChip technology, which uses chromatography and mass spectrometry, is an effective approach for diagnosing proteomic patterns to discover new biomarkers in serum samples. It is suitable for large-scale and high-throughput clinical research and applications. By comparing global changes of proteins under physiologic and pathologic conditions, or under different treatments, we may be able to improve the diagnosis and treatment of polygenetic diseases (7). As Bako et al. have pointed out, new /07/$32.00 Fertility and Sterility â Vol. 88, No. 1, July doi: /j.fertnstert Copyright ª2007 American Society for Reproductive Medicine, Published by Elsevier Inc.

154 genomic and proteomic technologies will accelerate the research on PCOS (8). This was the first time that SELDI ProteinChip was used in PCOS study. We set out to find differentially expressed proteins by comparing changes in serum protein patterns of PCOS IR and non-ir and to identify potential biomarkers for early diagnosis and risk prediction of PCOS. MATERIALS AND METHODS Study Subjects Subjects The research protocol was approved by the Ethics Committee of Peking University Third Hospital. Written informed consent was obtained from every participant before the subject was enrolled and the blood was withdrawn. Sixty patients with PCOS who visited the Reproductive Center of Peking University Third Hospital from March to July 2004 and were willing to participate in the study were enrolled. There were 30 patients with IR and 30 patients without IR. Thirty women who visited the center because of their spouses fertility problems were enrolled as controls during the same period. Inclusion criteria Cases of PCOS were collected according to the diagnostic criteria revised at the European Society of Human Reproduction and Embryology/American Society for Reproductive Medicine (ESHRE/ASRM) Rotterdam Conference (4). Insulin resistance was judged by using the homeostatic model IR index (HOMA-IR) (9, 10), and 2.69 was selected as a cutoff point (9). The selection criteria for control women were as follows: regular menstrual cycles, no clinical or biochemical evidence of hyperandrogenism, no polycystic ovaries, and without IR. Sample collection Two milliliters of fasting venous blood was drawn in the morning and rested at room temperature for 1 to 2 hours. Then the serum was fractionated and stored at 80 C. Methods Instruments and chip The ProteinChip Reader used was Protein Biology System PBS-IIc SELDI time of flight mass spectrometry (TOF-MS) system. After pilot study and comparison with H4 protein chip, the weak cation exchange 2 protein chip (Ciphergen, Fremont, CA) was selected for its higher capture ability and higher signal-to-noise ratio (S/N). The weak cation exchange array has active spots, which contain a weak anionic carboxylate group that can interact with the serum protein s positive charges on the surface, for example, lysine, arginine, or histidine. Sample preparation Serum samples were thawed in an ice bath and centrifuged at 8,000 g/min for 2 minutes at 4 C. Ten microliters of supernatant was added into 20 ml U9 (9 mol/l urea, 2% 3-cholaminopropyl diethylammonio- 1-propane sulfonate, 50 mmol/l tris(hydroxymethyl)aminomethane (Tris)-HCl, ph 9.0), it was vortexed for 30 minutes at 4 C, and then centrifuged at 1,600 g/min for 5 minutes. Ten microliters of supernatant was then added into 110 ml binding buffer (50 mmol/l NaAC, ph 4.0) and mixed quickly. To equilibrate the chip, 200 ml binding buffer was applied to each chip spot. The chip was shaken at 500 g/min for 5 min. Excess buffer was removed from the spots without touching the active surface. The procedure was repeated once. One hundred microliters of prepared serum was then added into each Bioprocessor well, and the chip was incubated and shaken at 400 g/min in a 4 C humidity chamber for 1 hour. Excess buffer was removed from the wells. Two hundred microliters of binding buffer was added into each well and shaken at room temperature for 5 minutes. The above procedure was repeated once. Each spot was washed with 200 ml of deionized water. Then 0.5 ml of saturated l3, 5-dimethoxy-4-hydroxycinnamic acid was applied to each spot while it was still moist. The chip was allowed to air dry. The last step was repeated, and the chip was air dried again. The chips were detected in the ProteinChip Reader. Detection For parameter setting, the highest molecular weight was set as 100,000 d; priming range as 2,000 to 80,000 d; laser intensity as 167, and detect sensitivity as 8. Each sample was activated 65 times. Calibration was done by using standard protein chip, and the error range of molecular weight was controlled at <0.1%. Intrachip and interchip quality controls were set. The coefficient of variation (CV) was controlled at <0.05% for molecular weight and at <25% for peak amplitude. Bioinformatics Analysis Software screening Biomarker Wizard software was used for initial screening of protein peaks. Their mass chromatograms of all samples were subjected to S/N filtration twice, namely, 15 S/N and 2 S/N. The protein peaks should be present in more than 10% of the samples, and the deviation of a certain protein should be lower than 0.3% in various samples. Statistical analysis Protein peaks were presented as mean SD, and data were analyzed with use of the SPSS Statistical Package, version 10.0 for windows (SPSS Inc., Chicago). Statistical comparison was performed by using Student s t-test or the Mann-Whitney test, wherever these tests were appropriate. Correlation analyses were performed by using Pearson or Kendall s tau-b tests wherever they were appropriate. The significance level was set as P<.05. SVM analysis SVM, a new classification methodology brought up by Vapnik et al. in 1995 (11), solves the problems in the pattern recognition of intermediate or small samples, such as pattern extrapolation, pattern recognition, over fitting, and curse of dimensionality. The strength of SVM lies in the theoretical justification that margin maximization is an effective mechanism for alleviating the curse-of-dimensionality problem. Therefore, SVM is able to successfully solve classification problems with extremely high attribute dimensionality. Moreover, SVM is easier to control and apply than neural networks. SVM has been extensively used in 146 Zhao et al. Protein profiles of PCOS with and without IR Vol. 88, No. 1, July 2007

155 biological fields, particularly in microarray analysis (12). This SVM classifier was implemented by the shareware program OSU_SVM v.3.00 Toolbox of Junshui Ma and Yi Zhao. SVM adopts nonlinear sorter and radial based kernel as kernel function. In this study, the parameters were set as follows: the width of the Gaussian was 0.6, the tolerance for outliers was 19, the output value for control was 0, and the goal output for patient was 1. The overall accuracy of the established model was evaluated by threefold cross-validation. The population was randomized into three subsets. Each time, one subset was used for testing and the other two subsets were used for training. This was repeated twice, and the average of the three values was obtained. The model was evaluated by using the accuracy of test subset. The training and testing samples were independent, which made the accuracy of the model more reliable. The relative significance of each mass/charge value (M/Z) peak for each sample division was evaluated by using P value. SVM was first drilled from the protein peak with the smallest P value, and the M/Z peak number was then added gradually. After different combinations, a group of protein peaks that had the highest predictive accuracy was thus screened out. RESULTS General Characteristics of the Patients Some clinical and biochemical characteristics of the three groups were shown in Table 1. Age, levels of FSH, E 2, and PRL were matched in three groups. Levels of LH, LH/FSH, T, and androstenedione (A) were matched in IR and non-ir groups (Table 1), and they were significantly higher than those in the controls. Body mass index (BMI) and HOMA-IR of patients with PCOS and IR were significantly higher than in the non-ir group and controls. Three patients with PCOS and IR were identified incorporated with type 2 diabetes. Correlation analyses between the patients biochemical characteristics and the significant protein peaks showed the following results. Testosterone level was correlated with M/Z 6,629 d (r ¼ 0.383, P¼.000), 2,046 d (r ¼ 0.346, P¼.001), 3,469 d (r ¼ 0.309, P¼.003), 2,818 d (r ¼ 0.304, P¼.004), 6,835 d (r ¼ 0.287, P¼.006), and 3,265 d (r ¼ 0.212, P¼.003) proteins. Androstenedione level was correlated with M/Z 6,629 d (r ¼ 0.323, P¼.004), 2,046 d(r¼ 0.273, P¼.000), 3,287 d (r ¼ 0.269, P¼.018), and 6,835 d (r ¼ 0.206, P¼.008) proteins. Luteinizing hormone level was correlated with M/Z 3,611 d (r ¼ 0.282, P¼.007), 6,629 d (r ¼ 0.222, P¼.035), and 2,046 d (r ¼ 0.214, P¼.003) proteins. Body mass index and HOMA-IR were correlated with M/Z 9,292 d protein; its correlation coefficients were (P¼.010) and (P¼.028), respectively. Serum Protein Profiles of PCOS at Different States Two hundred thirty-one protein peaks were screened out from 90 serum samples; M/Z ranged from 2,007 to 66,642 d. Changes of protein peak spectrum in PCOS IR Twenty-seven differential protein peaks were screened out compared with the controls. Seventeen of them were up-regulated, and 10 were down-regulated (Table 2). An optimal diagnostic model was established by combining the first eight differential proteins with the most significant differences. Of these proteins, six were up-regulated and two were down-regulated. The accuracy, specificity, sensitivity, and positive predictive value were 100% for the drill subset. TABLE 1 Clinical and biochemical characteristics of three groups. Control Non-IR IR Age (y) FSH (U/L) LH (U/L) a a LH/FSH a E 2 (pmol/l) PRL (nmol/l) T (nmol/l) a a A (nmol/l) a a BMI (kg/m 2 ) a,b HOMA-IR a,b Note: Data are expressed as mean SD. a Compared with control, P<.05. b Compared with non-ir, P<.05. Zhao. Protein profiles of PCOS with and without IR. Fertil Steril Fertility and Sterility â 147

156 Threefold cross-validation was used to validate the model by the test subset. The accuracy, specificity, sensitivity, and positive predictive value were 83.33%, 80.00%, 86.67%, and 84.62%, respectively. Kappa value was Changes of protein peak spectrum in PCOS non- IR Seventeen differential protein peaks were screened out compared with the controls. Sixteen of them were upregulated, and one was down-regulated (Table 3). An optimal diagnostic model was established by combining the first six differential proteins with the most significant differences. All of the six proteins were up-regulated. The accuracy, specificity, sensitivity, and positive predictive value were 100% for the drill subset. The accuracy, specificity, sensitivity, and positive predictive value of the test subset were 88.33%, 86.67%, 90.00%, and 88.33%, respectively. Kappa value was Changes in protein peak spectrum between IR and non-ir groups Nineteen differential protein peaks were identified. Eleven of 19 proteins were up-regulated, and eight were down-regulated in the IR group (Table 4). An optimal IR model was set up by the first three differentially expressed proteins. All of them were up-regulated. The accuracy, specificity, sensitivity, and positive predictive value were 100% for the drill subset and 85.00%, 90.00%, 80.00%, and 89.18% for the test subset, respectively. Kappa value was Changes of the M/Z 6629d protein Mass/charge 6,629 protein was significantly up-regulated in the IR and non-ir groups. It ranked first in the IR group. Discriminating PCOS with IR from normal by using this protein alone, the accuracy, specificity, sensitivity, and positive predictive value were 63.33%, 70.00%, 56.67%, 68.18%, respectively. In the non-ir group, this protein ranked third. Using this protein alone to discriminate PCOS without IR from normal, the accuracy, specificity, sensitivity, and positive predictive value were 71.67%, 66.67%, 73.73%, and 69.69%, respectively. Its peak amplitude maps and simulated gelatin maps are shown in Figure 1. Quality control Intrachip and interchip quality control of protein molecular weight and amplitude demonstrated that intrachip CVs were 0.036% and 13.56% and interchip CVs were 0.005% and 20.62%, respectively. DISCUSSION There are two subphenotypes of PCOS, IR and non-ir. The clinical characteristics, risk prediction, and therapeutic measures are totally different for these two subphenotypes. In recent decades, it has been demonstrated that various degrees of IR occur in 50% to 70% of women with PCOS (4). Insulin resistance is the major cause of hyperandrogenemia and chronic anovulation, and it plays a significant role in the occurrence and development of PCOS. Moreover, IR is an important risk factor for type 2 diabetes, hypertension, dyslipidemia, and heart diseases in patients with PCOS, and it threatens long-term health in women (5). Therefore, we should emphasize not only the treatment of PCOS but also early diagnosis, risk prediction, and prevention of PCOS. TABLE 2 Comparison of serum discriminatory protein peaks between PCOS IR and control. Peak amplitude Peak amplitude a Peak (M/Z) Control IR P Peak (M/Z) Control IR 6, <.01 4, , <.01 4, , <.01 4, , <.01 3, , <.01 3, , <.05 2, , <.05 5, , <.05 3, , <.05 3, , <.05 2, , <.05 13, , <.05 4, , <.05 2, , <.05 Note: Data are expressed as mean SD. a P<.05, Control versus IR. Zhao. Protein profiles of PCOS with and without IR. Fertil Steril Zhao et al. Protein profiles of PCOS with and without IR Vol. 88, No. 1, July 2007

157 TABLE 3 Comparison serum discriminatory protein peaks between PCOS non-ir and control. Peak amplitude Peak amplitude a Protein (M/Z) Control Non-IR P Protein (M/Z) Control Non-IR 6, <.01 8, , <.01 3, , <.01 5, , <.01 2, , <.01 2, , <.01 3, , <.01 3, , <.01 8, , <.05 Note: Data are expressed as mean SD. a P<.05, Control versus non-ir. Zhao. Protein profiles of PCOS with and without IR. Fertil Steril More and more studies have shown that the serum proteome is an essential resource, which contains a number of biomarkers for physiologic and pathologic conditions and is largely unexplored. The biomarkers are frequently lower molecular weight proteins or peptide segments, which can be detected by mass spectrometric analysis technology but not by previously used methods (13). When analyzed by a bioinformatics tool, a pattern of multiple biomarkers may be screened out. The multiple biomarkers may contain a higher level of discriminatory information than a single biomarker alone across large heterogeneous patient populations and for complex multistage diseases. Mass spectrometric analysis technology has been used successfully to study the diagnostic markers for tumors, such as ovarian cancer and prostate cancer. In recent years, it has also been used in the study of cardiovascular diseases and diabetes (14). Plebani has predicted that mass spectrometry will play a central role in the laboratory in the future (15). Here we observed the changes in the serum protein mass spectrum between IR and non-ir in patients with PCOS by using a SELDI weak cation exchange 2 chip. We used HOMA-IR to evaluate IR. We made constant reference to a national investigation and adopt its cutoff point, which may be more representative for the Chinese population. The cutoff point (2.69) as a HOMA-IR was established after screening the 75th percentile of the distribution in a Chinese TABLE 4 Comparison of serum discriminatory protein peaks between PCOS IR and PCOS non-ir. Peak amplitude Peak amplitude a Protein (M/Z) Non-IR IR P Protein (M/Z) Non-IR IR 9, <.01 5, , <.01 7, , <.01 2, , <.01 2, , <.01 2, , <.01 7, , <.01 2, , <.01 2, , <.05 4, , <.05 Note: Data are expressed as mean SD. a P<.05, Non-IR versus IR. Zhao. Protein profiles of PCOS with and without IR. Fertil Steril Fertility and Sterility â 149

158 FIGURE 1 Derivation of an optimum discriminatory protein derived from mass spectroscopy protein M/Z value. A representative SELDI-TOF-MS is shown with the molecular weight calculation (M/Z value) along the x- axis and relative intensity along the y-axis. The spectrum is represented as a mass chromatogram (left) or simulated gelatin maps (right). Zhao. Protein profiles of PCOS with and without IR. Fertil Steril population of 10,147 (9). In the PCOS IR state, 17 of 27 serum proteins were up-regulated, and 10 were downregulated; in the PCOS non-ir state, 16 of 17 serum proteins were up-regulated and 1 was down-regulated. These data imply that different disease states have variable protein compositions in serum. Many low molecular weight proteins may be closely related to the progress of diseases (14). Correlation analyses showed that elevated T, A, and LH levels were correlated with at least one of the following proteins: M/Z 6,629, 2,046, 6,835, 3,469, 2,818, 3,565, 3,611, and 3,287 d. It indicates that many biochemical characteristics of PCOS may be caused by a group of proteins but not a single protein. The interactions among these proteins may be involved in the pathogenesis of PCOS, and maybe there were some other factors that also participated in this procedure. Out of these proteins, three proteins with M/Z 6,629, 2,046, and 6,835 d may relate more closely to the biochemical characters of PCOS. Meanwhile, elevated BMI and HOMA-IR were correlated with one protein (M/Z 9,292 d). Further identification and functional study on these proteins may help us understand the pathogenesis of PCOS and IR. To understand the significance of these differentially expressed proteins in discriminating PCOS IR from non-ir and to test whether they can be used as biomarkers, we performed cluster analysis using SVM. SVM is an artificial intelligence-type algorithm that could sort through the information contained in thousands of data points and recognize and expose disease portraits. The diagnostic models were established by combining eight proteins (six up-regulated and two down-regulated) in PCOS IR and six proteins (all up-regulated) in PCOS non-ir. They can be used to diagnose and predict both conditions with an accuracy of more than 80%. It is not perfect, but we know that PCOS is, by its nature, a heterogeneity disease. Consequently, there is not a gold standard for reference. We just rely on its clinical and/or biochemical abnormalities. Therefore, the two models can be viewed as serum protein fingerprintings of PCOS IR or non- IR. After large-scale verification, these proteins may be used as biomarkers for clinical diagnosis, severity evaluation, and prediction of risk of long-term complications. We found three proteins, M/Z 6,629 d, 3,611 d, and 3,333 d, coexpressed and up-regulated in either PCOS IR or non-ir groups. Out of them, the M/Z 6,629 d protein was highly up-regulated and ranked first in the IR group and third in the non-ir group, respectively. Using this protein alone to discriminate PCOS IR or PCOS non-ir from normal, the accuracy, sensitivity, specificity, and positive predictive value were all more than 50%. Nevertheless, the positive predictive value of the ovary cancer biomarker CA125 alone is only 10%, and the value reaches only 20% with combined B ultrasonography (16). The correlation analyses also show that M/Z 6,629 protein correlated with three main biochemical characters (elevated T, A, and LH) of PCOS. These data strongly suggest that M/Z 6,629 d protein is closely associated with the occurrence of PCOS and that it may be used as a biomarker for PCOS. We matched the M/Z 6,629 d protein with a member of the apolipoprotein C family, named apolipoprotein C-I (ApoC-I), by searching the Swiss-Prot Protein Database. ApoC-I inhibits lipoprotein metabolism in the liver, which prolongs the retention time of lipoprotein in blood circulation and transforms it into more low-density lipoprotein, thus increasing the risk of cardiovascular disease (17). The gene encoding of ApoC-I locates at 19q13.2. This gene is also a candidate for the blood pressure regulating gene (18). Urbanek et al. found a gene marker of PCOS located at 19p13.3 (19), just 1 megabase centromerically away from the IR gene. Further investigation will be carried out to elucidate the relations between these two genes. Meanwhile, we compared the serum protein patterns of PCOS IR and non-ir groups. Of the nineteen proteins, 11 were up-regulated and 8 were down-regulated in the IR group, suggested that changes of this set of proteins may be associated with the occurrence of IR in patients with PCOS. Cluster analysis demonstrated that there were three protein peak combinations that were significantly upregulated in the IR state and that this set of proteins can discriminate IR from non-ir, suggesting a closer association of them with the occurrence of IR. There are some limitations of SELDI serum protein mass spectrometry, such as reproducibility and reliability. It is thought that routine clinical use of this technology still has some obstacles. For instance, uniform and standard laboratory protocols or standardized instruments are still unavailable. Many proteins observed, most of which are low molecular weight proteins, are still unknown; the 150 Zhao et al. Protein profiles of PCOS with and without IR Vol. 88, No. 1, July 2007

159 identification of them may take a long time (20). In our study, we carried out sample collection and preparation procedures rigidly, the procedures were done once by two researchers, and intrachip and interchip quality controls were set up, so as to minimize errors and guarantee the reliability of the experiments. Recently, Kozak et al. and Malik et al. have reported that they identified and verified some peaks correlated with observed SELDI-TOF-MS M/Z values (21, 22). Experts are confident about this technology after it is standardized. It should be encouraged by the potential value as an analytic tool in the future. Furthermore, the ongoing Human Plasma Project, which is sponsored by the Human Proteome Organization (HUGO), has generated a core dataset, which is a publicly available database (23). Its ultimate goal is to identify some potential biomarkers that can be used either alone or in combination to better diagnose human diseases. We believe that developing technologies for protein isolation and analysis will provide an array of tools for multidimensional protein profiling, which will accelerate linking genome to diseases and increase the capability of disease diagnosis (24). Acknowledgements: The authors are grateful to Zhenghong Wang and Yanbin Jiang, medical technologists at the Department of Obstetrics and Gynecology, Peking University Third Hospital, for their assistance with sample collection. The authors thank Xiaoqin Ye, Ph.D., at the Scripps Research Institute for her helpful suggestions. REFERENCES 1. Azziz R, Yildiz B, Woods KS, Reyna R, Key TJ, Stephens KC, et al. The prevalence of polycystic ovary syndrome among unselected consecutive premenopausal women. J Clin Endocrinol Metab 2004;89: Homburg R. Polycystic ovary syndrome in adolescence: new insights in pathophysiology and treatment. Endocr Dev 2005;8: Glueck CJ, Wang P, Goldenberg N, Sieve-Smith L. Pregnancy outcomes among women with polycystic ovary syndrome treated with metformin. Hum Reprod 2002;17: The Rotterdam ESHRE/ASRM-Sponsored PCOS Work Group. Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome. Fertil Steril 2004;81: Ovalle F, Azziz R. Insulin resistance, polycystic ovary syndrome, and type 2 diabetes mellitus. Fertil Steril 2002;77: Hanash S. Disease proteomics. Nature 2003;422: Issaq HJ, Veenstra TD, Conrads TP, Felschow D. Breakthroughs and views: The SELDI-TOF MS approach to proteomics: protein profiling and biomarkers identification. Biochem Biophys Res Commun 2002;292: Bako AU, Morad S, Atiomo WA. Polycystic ovary syndrome: an overview. Rev Gynaecol Pract 2005;5: Xing XY, Yang WY, Yang ZJ. The diagnostic significance of homeostasis model assessment of insulin resistance in metabolic syndrome among subjects with different glucose tolerance. Chinese Journal of Diabetes 2004;12: Tai ES, Lim SC, Chew SK, Tan BY, Tan CE. Homeostasis model assessment in a population with mixed ethnicity: the 1992 Singapore National Health Survey. Diabetes Res Clin Pract 2000;49: Cortes C, Vapnik V. Support vector network. Mach Learn 1995;20: Lee Y, Lee CK. Classification of multiple cancer types by multicategory support vector machines using gene expression data. Bioinformatics 2003;19: Liotta LA, Ferrari M, Petricoin EF. Written in blood. Clinical proteomics. Nature 2003;425: Dayal B, Ertel NH. ProteinChip technology: a new and facile method for the identification and measurement of high density lipoproteins apoa-i and apoa-ii and their glycosylated products in patients with diabetes and cardiovascular disease. J Proteome Res 2002;1: Plebani M. Proteomics: the next revolution in laboratory medicine? Clin Chim Acta 2005;357: Petricoin EF, Ardekani AM, Hitt BA, Levine PJ, Fusaro VA, Steinberg SM, et al. Use of proteomic patterns in serum to identify ovarian cancer. Lancet 2002;359: Brewer HB. Hypertriglyceridemia: changes in the plasma lipoproteins associated with an increased risk of cardiovascular disease. Am J Cardiol 1999;83:3F Shachter NS. Apolipoproteins C-I and C-III as important modulators of lipoprotein metabolism. Curr Opin Lipidol 2001;12: Urbanek M, Legro RS, Driscoll DA, Azziz R, Ehrmann DA, Norman J, et al. Thirty-seven candidate genes for polycystic ovary syndrome: strongest evidence for linkage is with follistatin. Proc Natl Acad Sci 1999;96: Rocken C, Ebert MP, Roessner A. Proteomics in pathology, research and practice. Pathol Res Pract 2004;200: Kozak KR, Su F, Whitelegge JP, Faull K, Reddy S, Farias-Eisner R. Characterization of serum biomarkers for detection of early stage ovarian cancer. Proteomics 2005;5: Malik G, Ward MD, Gupta SK, Trosset MW, Grizzle WE, Adam BL, et al. Serum levels of an isoform of apolipoprotein A-II as a potential marker for prostate cancer. Clin Cancer Res 2005;11: Omenn GS, States DJ, Adamski M, Blackwell TW, Menon R, Hermjakob H, et al. Overview of the HUPO Plasma Proteome Project: results from the pilot phase with 35 collaborating laboratories and multiple analytical groups, generating a core dataset of 3020 proteins and a publicly-available database. Proteomics 2005;5: Steel LF, Haab BB, Hanash SM. Methods of comparative proteomic profiling for disease diagnostics. J Chromatogr B 2005;815: Fertility and Sterility â 151

160 REPRODUCTIVE ENDOCRINOLOGY Serum human chorionic gonadotropin level after ovulation triggering is influenced by the patient s body mass index and the number of larger follicles Laura Detti, M.D., Mohamed F. M. Mitwally, M.D., Anuradha Rode, M.D., Frank D. Yelian, M.D., Ph.D., Michael Kruger, M.A., Michael P. Diamond, M.D., and Elizabeth E. Puscheck, M.D. Department of Obstetrics and Gynecology, Division of Reproductive Endocrinology and Infertility, and the University Women s Center, Wayne State University School of Medicine, Detroit, Michigan Objective: To identify determinants of the serum concentration of hcg levels after triggering of ovulation with exogenous hcg during controlled ovarian stimulation cycles for in vitro fertilization with or without intracytoplasmic sperm injection. Design: Retrospective cohort study. Setting: University Medical Center. Patient(s): One hundred-fifteen women who underwent conventional in vitro fertilization/intracytoplasmic sperm injection cycles from March 2003 to March Intervention(s): All patients underwent ovarian hyperstimulation with gonadotropins and GnRH-antagonist for pituitary downregulation. Patients were started on oral contraceptives 1 month before the stimulation. Gonadotropins were administered from stimulation day 1 until the day of the hcg trigger, and GnRH-antagonist was added from the day when at least one follicle reached 14 mm in diameter and continued until hcg administration. The hcg was administered in 5,000-IU, 10,000-IU, or 15,000-IU doses on the day of ovulation triggering. Main Outcome Measure(s): We performed a stepwise multiple regression analysis to predict which variable would influence the serum concentration of hcg when measured the day after the administration of exogenous hcg. Result(s): Body mass index (kg/m 2 ) and number of follicles 14 mm were the only determinants of the hcg concentration (cumulative R ; P.001). Patient age, estradiol peak, number of oocytes retrieved, length of stimulation, and length of GnRH-antagonist administration in days were not associated with serum hcg levels. Conclusion(s): Knowing that the number of larger follicles and the patient s BMI are the major determinants of the hormone s clearance in the body can help in the hcg dose titration during ovarian stimulation. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: hcg, ovulation induction, in vitro fertilization, BMI, serum level Received November 15, 2006; revised and accepted November 21, Reprint requests: Laura Detti, M.D., Wayne State University, 3750 Woodward Ave., Suite 200-D, Detroit, MI (FAX: ; ldetti@med.wayne.edu) Human chorionic gonadotropin, normally produced by the trophoblastic tissue for the maintenance of pregnancy, has been used for ovulation induction in animal models since the 1950s, and in infertile patients since the 1960s (1 3). It subsequently became the routine oocyte maturation trigger in in-vitro fertilization cycles in the 1970s (4). Human chorionic gonadotropin has been shown to have multiple effects on the gonads as well as in extragonadal tissues acting at the level of the LH receptors (LH/hCG receptors), because it shares most of the molecular composition with the endogenous LH (5). In the ovary, LH/hCG receptors are expressed in the thecal cells of small preovulatory follicles, but they have also been found in the granulosa cells of the larger preovulatory follicles ( 10 mm). It has been shown that follicular maturation does not progress in LH/hCG receptor knockout mice, even if they show normal prenatal ovarian development (6). In the uterus, the endometrium expresses LH/hCG receptors during the implantation period (7). Moreover, it has been seen that LH/hCG and progesterone receptors in the uterus show a mutual enhancement of expression during this period (8, 9). The hcg was shown to improve the uterine receptivity by enhancing endometrial decidualization and stimulating endometrial neoangiogenesis by upregulating vascularendothelial growth factor function (8). This endometrial maturation is also enhanced during the follicular phase by administration of LH (and, similarly, administration of hcg) in ovulation induction cycles characterized by a regimen of gonadotropin releasing hormone agonist (GnRH-a) plus human menopausal gonadotropins (10). Recently, hcg has been shown to be effective in continuing ovulation induction after a shortened gonadotropin priming, and before the routine high-dose hcg triggering that is administered 35 to 36 hours before the oocyte retrieval (11). The hcg shows 152 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

161 TABLE 1 Characteristics of the study population subdivided into three groups based on hcg ovulation trigger dose. Variable hcg 5,000 N 21 hcg 10,000 N 19 hcg 15,000 N 75 Significance Age (y) NS Body mass index (kg/m 2 ) NS No. days on antagonist NS Length of stimulation (d) NS Total gonadotropin dose (IU) 3,537 1,499 6,254 4,856 4,994 4,019 NS E 2 on hcg day (pg/ml) 4, , , P.05 a Total no. follicles 14 mm P.05 b hcg levels after hcg trigger (miu/ml) P.05 a Normalized hcg levels (miu/ml) c Ns No. oocytes retrieved P.05 b Note: Data are reported as mean SD. Ns not significant. a All groups are different. b 5,000-IU group different from 10,000-IU and 15,000-IU groups. c Normalized to 5,000 IU. Detti. BMI and larger follicles impact serum hcg level. Fertil Steril a higher receptor affinity and a longer half-life (24 hours) as compared with endogenous LH, which has a half-life of only approximately 60 minutes (12). Because hcg has shown promising ovulation induction properties and because little of its pharmacokinetics is known, the aim of the current study was to identify the major determinants of the level of serum hcg levels after midcycle single-dose administration. MATERIALS AND METHODS The study was approved by the Institutional Review Board at Wayne State University. In this retrospective study, we evaluated 115 consecutive women who underwent conventional IVF/ intracytoplasmic sperm injection (ICSI) cycles from March 2003 to March All patients underwent controlled ovarian hyperstimulation with gonadotropins and GnRH-a for pituitary downregulation. Patients were started on oral contraceptives approximately 1 month before the stimulation. Gonadotropins (mainly recombinant FSH [r-fsh] and preparations containing an equal amount of FSH and LH) were administered from stimulation day 1 until the day of the hcg trigger, and GnRH-a was added when at least one follicle reached 14 mm in diameter and continued daily until the day of hcg ovulation triggering dose. The hcg was administered in a 5,000-IU, 10,000-IU, or 15,000-IU dose depending on the combination of number of follicles and estradiol level. In the presence of more preovulatory follicles and higher serum estradiol levels ( 3,000 pg/ml), a lower hcg dose would decrease the risk of ovarian hyperstimulation syndrome (OHSS). However, the minimum requirement to administer hcg was the presence of at least two follicles measuring 18 mm in diameter. In the presence of fewer ovarian follicles and lower serum estradiol levels, a higher hcg dose was administered (10,000 or 15,000 IU). We then measured the serum hcg level the day after the administration of exogenous hcg, about 10 to 14 hours after the intramuscular injection (7:30 PM to 12:30 AM, median time 9:30 PM). This approach allowed us to detect those patients who did not self-administer the intramuscular injection and cancel or delay the oocyte retrieval, thus eliminating the surgical risks of a procedure when the yield of obtaining mature oocytes would be poor and a high risk of no oocyte or immature oocytes exists (hcg triggers oocyte maturation with the completion of the first meiotic division). To adjust for the exogenous hcg dose administered, the serum hcg concentration obtained the day after the hcg trigger was divided by 2 or 3 if the patient received 10,000 IU or 15,000 IU of hcg, respectively. This allowed us to evaluate the patients as if they all had received the normalized dose of 5,000 IU of hcg. We performed Pearson product moment correlations and stepwise multiple regression analyses to determine which variables would influence the serum hcg level after a single administration. The variables evaluated were: age, body mass index (BMI, in kg/m 2 ), estradiol peak, number of follicles 14 mm, number of oocytes retrieved, length of stimulation, and length of GnRH-a administration in days. A significance level of P.05 was considered statistically significant. All statistical analyses were conducted with SPSS for Windows, version 13.0 (SPSS Inc., Chicago, IL). RESULTS The demographics of the patients are described in Table 1. Of the 115 patients evaluated, an exogenous hcg dose of 5,000 IU was self-administered by 21 patients, 10,000 IU by 19 patients, Fertility and Sterility 153

162 TABLE 2 Characteristics of the patients in whom OHSS developed. Variable No. 1 a No. 2 a No. 3 a No. 4 a No. 5 b No. 6 a Age (y) Body mass index No. days on antagonist Length of stimulation (d) E 2 on hcg day (pg/ml) 5,539 4,280 4,550 3,759 2,773 3,512 Total no. follicles 14 mm hcg levels after hcg trigger (miu/ml) c 68 No. oocytes retrieved a Patients received 5,000-IU hcg dose for ovulation trigger. b Patient received 15,000-IU hcg dose. c Normalized hcg level was 247. Detti. BMI and larger follicles impact serum hcg level. Fertil Steril and 15,000 IU by 75 patients. Six of 115 patients (5.2%) who developed OHSS and did not undergo embryo transfer were included in our analysis. Five of them received 5,000 IU hcg as ovulation trigger; they had a mean estradiol level of 4,069 pg/ml (3512 to 5539 pg/ml). One received 15,000 IU hcg when the estradiol peak was 2,773 pg/ml (Table 2). As expected, serum hcg levels after the 15,000-IU triggering dose were higher than the levels after the two lower dosages (P.05). After adjusting the serum hcg level for the dose administered, the Pearson correlation identified that BMI, total number of follicles 14 mm on the day of hcg administration, and total number of oocytes retrieved are all negatively correlated with the serum hcg level (r 0.54, 0.22, and 0.21, respectively; P.05). Stepwise logistic regression identified BMI and total number of follicles 14 mm on the day of hcg administration as the only predictors of the hcg serum level (R ), with the BMI representing the largest contributor (BMI R ; P.001; total number of follicles R , P.05) (Fig. 1). In particular, a higher BMI and a higher number of larger follicles were related to a lower serum hcg after 10 to 14 hours. Patient age, estradiol peak, number of oocytes retrieved, length of stimulation, and length of GnRH-a administration in days were not correlated with the serum concentration. CONCLUSIONS Patient BMI and total number of follicles 14 mm were the only predictors of the hcg concentration in the body when measured 10 t 14 hours after exogenous hcg administration. We did not evaluate serum hcg decrement over time because this was beyond the scope of our clinical inquiry. However, BMI likely reflects the volume of distribution, although other mechanisms such as modified enzymatic transportation and binding cannot be excluded in explaining this phenomenon. Our findings will help in deciding the correct hcg trigger dose based on the patient s BMI, because leaner patients will reach higher serum hcg levels than overweight patients with comparable ovulation induction characteristics; as previously suggested, this might make these women more susceptible to developing OHSS (13). Future studies will be needed to determine whether titration of the hcg trigger dose based on the patient s BMI and number of bigger follicles could help prevent the development of OHSS. We do not have an explanation for why a more successful stimulation (i.e., higher number of follicles 14 mm in diam- FIGURE 1 Scatterplot of adjusted hcg serum level and body mass index. Detti. BMI and larger follicles impact serum hcg level. Fertil Steril Detti et al. BMI and larger follicles impact serum hcg level Vol. 88, No. 1, July 2007

163 eter) would be related to a lower hcg level after single-dose administration, even if in our results this accounts for a minimal relative risk (R ). Moreover, a higher number of bigger follicles is strictly related to a higher serum estradiol level; although our study confirmed this highly significant correlation (P.001), it is surprising that we failed to find a relationship between serum hcg concentration and estradiol level similar to the one shown for the total number of follicles 14 mm. In our study population, women with a higher number of bigger follicles (more than 10 follicles mean) and a lower serum hcg concentration ( 116 miu/ml mean) were also those with a greater BMI (26 6 kg/m 2 ), compared with the BMI of the patients with 10 bigger follicles and a higher hcg concentration (23 3 kg/m 2 ). We could speculate that BMI, being such a big predictor of the serum hcg concentration on its own, might falsely make the number of follicles 14 mm appear as another predictor in our analysis. The purified gonadotropins that are used to induce follicle maturation may contain traces of hcg, which is naturally present in the postmenopausal urine from which the gonadotropins are extracted (14). In our analysis, we did not control for this parameter. However, even considering the long half-life of hcg compared with LH, the amount of serum hcg reached during ovulation induction would be very modest (and comparable among the patients) compared with the high dose used for ovulation trigger. Early reports described the use of multiple hcg doses sequentially or overlapping the standard ovulation induction with gonadotropins (15). Recently there has been a revitalized interest in hcg function and its promising role in ovulation induction cycles. A pioneering study by Filicori et al. (11) on the use of hcg as the substance of choice for complete ovulation induction regimens described a single daily dose of 200 IU for the last 3 to 5 days of the cycle after pretreating the patients with standard regimens of recombinant FSH or of hmg for a few days until a threshold estradiol value and a fixed number of follicles reached 12 mm in diameter. The hcg daily dose was not titrated during the stimulation period, and it was followed by the administration of a standard ovulation-triggering hcg dose of 10,000 IU. The mean serum hcg level reached during the days of hcg administration was IU/L. The 200-IU daily hcg dose was arbitrarily chosen based on a previous prospective randomized study on ovarian stimulation with different hcg doses in various combinations with r-fsh after an initial stimulation with r-fsh alone (16). However, all of the patients in both studies were lean with minimal variation in the BMI ( kg/m 2, range 21 to 25 kg/m 2 ). Although in this study hcg was administered subcutaneously, it has been shown that this route gives analogous responses when compared with the intramuscular administration (17). Our study shows that patients of different BMIs will have different serum hcg levels when treated with a single hcg dose. In a nonhomogeneous patient population, the final outcome of a fixed regimen could be very dissimilar, even considering the long half-life of hcg. In the United States, patient weight is more varied than it is in Europe, as can be readily envisioned by the BMI reported in our study (25 5 kg/m 2, cumulative for the 3 groups of patients, range 17 to 42 kg/m 2 ). Knowing that the concentration of hcg in the body is dependent on the patient s BMI can help the endocrinologist in titrating the hcg trigger or daily dose when the patient population is not homogeneous. REFERENCES 1. Eto T, Imamichi T. On the induction of ovulation in mice and rats by the single subcutaneous injection of human chorionic gonadotropin. Endocr J 1955;2: Gasparri F, Ingrassia F, Serra E. On the possibility of inducing ovulation by means of treatment with association of preestrogens, chorionic gonadotropin and cortisonics. Riv Ostet Ginecol 1964;19: Jones GS, De Moraes-Ruehsen M. Induction of ovulation with human gonadotropins and with clomiphene. Fertil Steril 1965;16: Jones GS, Garcia JE, Rosenwaks Z. The role of pituitary gonadotropins in follicular stimulation and oocyte maturation in the human. J Clin Endocrinol Metab 1984;59: Kessler MJ, Reddy MS, Shah RH, Bahl OP. Structures of N-glycosidic carbohydrate units of human chorionic gonadotropin. J Biol Chem 1979;254: Zhang FP, Poutanen M, Wilbertz J, Huhtaniemi I. Normal prenatal but arrested postnatal sexual development of luteinizing hormone receptor knockout (LuRKO) mice. Mol Endocrinol 2001;15: Licht P, Russu V, Lehmeyer S, Wissentheit T, Siebzehnrubl E, Wildt L. Cycle dependency of intrauterine vascular endothelial growth factor levels is correlated with decidualization and corpus luteum function. Fertil Steril 2003;80: Reshef E, Lei ZM, Rao CV, Pridham DD, Chegini N, Luborsky JL. The presence of gonadotropin receptors in nonpregnant human uterus, human placenta, fetal membranes, and decidua. J Clin Endocrinol Metab 1990; 70: Srisuparp S, Strakova Z, Brudney A, Mukherjee S, Reierstad S, Hunzicker-Dunn M, et al. Signal transduction pathways activated by chorionic gonadotropin in the primate endometrial epithelial cells. Biol Reprod 2003;68: Bourgain C, Smitz J, Camus M, Erard P, Devroey P, Van Steirteghem AC, et al. Human endometrial maturation is markedly improved after luteal supplementation of gonadotrophin-releasing hormone analogue/human menopausal gonadotrophin stimulated cycles. Hum Reprod 1994;9: Filicori M, Cognigni GE, Gamberini E, Parmegiani L, Troilo E, Roset B. Efficacy of low-dose human chorionic gonadotropin alone to complete controlled ovarian stimulation. Fertil Steril 2005;84: Huhtaniemi IT, Catt KJ. Differential binding affinities of rat testis luteinizing hormone (LH) receptors for human chorionic gonadotropin, human LH, and ovine LH. Endocrinology 1981;108: Navot D, Relou A, Birkenfeld A, Rabinowitz R, Brzezinski A, Margalioth E. Risk factors and prognostic variables in the ovarian hyperstimulation syndrome. Am J Obstet Gynecol 1988;159: Stokman PG, de Leeuw R, van den Wijngaard HA, Kloosterboer HJ, Vemer HM, Sanders AL. Human chorionic gonadotropin in commercial human menopausal gonadotropin preparations. Fertil Steril 1993;60: Starup J, Sele V. The effect of different doses of human chorionic gonadotrophin in the treatment of anovulation with human gonadotrophins. Acta Endocrinol 1972;71: Filicori M, Cognigni GE, Tabarelli C, Pocognoli P, Taraborrelli S, Spettoli D, et al. Stimulation and growth of antral ovarian follicles by selective LH activity administration in women. J Clin Endocrinol Metab 2002;87: Stelling JR, Chapman ET, Frankfurter D, Harris DH, Oskowitz SP, Reindollar RH. Subcutaneous versus intramuscular administration of human chorionic gonadotropin during an in vitro fertilization cycle. Fertil Steril 2003;79: Fertility and Sterility 155

164 Influence of hysterectomy on long-term fracture risk L. Joseph Melton III, M.D., a Sara J. Achenbach, M.S., b John B. Gebhart, M.D., c Ebenezer O. Babalola, M.D., c Elizabeth J. Atkinson, M.S., b and Adil E. Bharucha, M.D. d a Division of Epidemiology and b Division of Biostatistics, Department of Health Sciences Research, c Department of Obstetrics and Gynecology, and d Division of Gastroenterology, Department of Internal Medicine, Mayo Clinic College of Medicine, Rochester, Minnesota Objective: To assess long-term fracture risk after hysterectomy, with or without oophorectomy. Design: Population-based, cohort study. Setting: Olmsted County, Minnesota. Patient(s): Women residing in Olmsted County (n 9,258) who underwent hysterectomy in , compared to an equal number of age- and sex-matched community controls. Intervention(s): Observational study of the effect of hysterectomy for various indications on subsequent fractures. Main Outcome Measure(s): Fractures of any type, and at osteoporotic sites (e.g., hip, spine, or wrist) alone, as assessed by electronic review of inpatient and outpatient diagnoses in the community. Result(s): Compared with controls, there was a significant increase (hazard ratio [HR], 1.21; 95% confidence interval [CI], ) in overall fracture risk among the women with a hysterectomy, but osteoporotic fracture risk was not elevated (HR, 1.09; 95% CI, ). Most hysterectomy indications were associated with fractures generally, although these were not often statistically significant. Only operations for a uterine prolapse were associated with osteoporotic fractures (HR, 1.33; 95% CI, ). Oophorectomy was not an independent predictor of fracture risk (HR, 1.0; 95% CI, ). Conclusion(s): Hysterectomy does not appear to pose much long-term risk for fractures, but the association of fractures with surgery for uterine prolapse deserves further attention. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Hysterectomy, fracture, cohort study, oophorectomy, pelvic prolapse Received July 25, 2006; revised November 8, 2006; accepted November 17, Supported in part by research grants (AG04875, HD41129, and AR30582) from the U.S. Public Health Service, National Institutes of Health, Bethesda, Maryland. Reprint requests: L. J. Melton III, M.D., Division of Epidemiology, Department of Health Sciences Research, Mayo Clinic, 200 First Street Southwest, Rochester, Minnesota (FAX: ; melton.j@mayo.edu). We previously showed that osteoporotic fracture risk was elevated 1.5-fold among 340 women who underwent a bilateral oophorectomy after natural menopause (1). To the extent that the ovaries contribute to postmenopausal production of estrogen (E) via extragonadal conversion of ovarian androgens to E (2), oophorectomy might have exacerbated bone loss in these women and increased their risk of fracture. However, this association could not be confirmed in a subsequent analysis performed among elderly women in the Study of Osteoporotic Fractures, even though serum testosterone (T) levels were reduced among women who had undergone a bilateral oophorectomy after menopause compared with unoperated women (3). One possible explanation for the apparent discrepancy is that subjects in our study were 6 years older on average at the time of their oophorectomy. On closer inspection, there was a 20% reduction in age-adjusted fracture risk among the subset of these postmenopausal women who had an elective oophorectomy in the course of a hysterectomy for endometrial cancer or vaginal bleeding. By contrast, there was a 1.4-fold increase in osteoporotic fracture risk in the subset whose bilateral oophorectomy was elective in the course of a hysterectomy for uterine prolapse (L.J. Melton, unpublished data), which is more frequently an indication for surgery among older women (4). Because almost all bilateral oophorectomies are performed in conjunction with hysterectomy (5,6), the possibility arises that the observed association between postmenopausal oophorectomy and fractures was not actually related to age at surgery, but rather was attributable to (i.e., confounded by) the indication for the underlying hysterectomy. To address this possibility more directly, we assessed long-term fracture risk in a large cohort of women residing in Olmsted County, Minnesota, who had a hysterectomy in , including pre- and postmenopausal women, those with and without an oophorectomy, and those with vaginal as well as abdominal hysterectomies. MATERIALS AND METHODS Population-based epidemiologic research can be conducted in Olmsted County because medical care is virtually selfcontained within the community, and complete (inpatient and outpatient) medical records for county residents are available for review (7). After approval by the Mayo Clinic s Institutional Review Board, we used this unique database (the Rochester Epidemiology Project) to identify all women 156 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

165 in Olmsted County who had undergone a hysterectomy between January 1, 1965 December 31, As reported previously (8), 9,893 hysterectomies were performed in this population. However, 615 patients from the hysterectomy file (6%) who refused to authorize the use of their medical records for research (9) were excluded from the original study, and an additional 20 women declined to participate in this follow-up analysis. After further approval from our Institutional Review Board, the remaining 9,258 women with a hysterectomy were individually matched by age (98% within 1 year of birth year) to women in Olmsted County without a history of hysterectomy. The hysterectomy cases and their agematched controls were then followed forward in time through their linked medical records in the community (retrospective cohort study). Each subject s complete inpatient and outpatient medical record at each local provider of medical care was searched electronically for the occurrence of any fracture through the comprehensive diagnostic and surgical indices that are part of the Rochester Epidemiology Project (7). Follow-up continued until death or the most recent clinical contact. Fractures were classified by anatomical site, but information on the degree of trauma involved in each fracture event was not available. Thus, osteoporotic fractures were considered those of the proximal femur, lumbar and thoracic vertebrae, or distal forearm, the skeletal sites traditionally linked to osteoporosis (10). By convention, these are further defined as fractures because of moderate trauma, but nothing about osteoporosis protects bones from severe trauma, and this convention is now being questioned (11). Among the cases, the type of, and indications for, hysterectomy were identified electronically with the use of specific procedure and diagnostic codes, as described elsewhere (8). For the purpose of this study, hysterectomies were broadly categorized as abdominal or vaginal. Where there were multiple diagnoses, the principal indication for surgery was assigned with the use of the hierarchical system established by the Centers for Disease Control and Prevention, Atlanta, Georgia (4). If cancer of the reproductive tract was one of the listed diagnoses, it was deemed the primary indication. Next, if debulking of cancer of the urinary or intestinal tract was listed, it was assigned as the indication. In the absence of a diagnosis of cancer, a precancerous condition (e.g., endometrial hyperplasia) was designated if present. The diagnoses were then scanned for uterine leiomyoma, endometriosis, or uterine prolapse, and the first of these diagnoses listed was assigned as the primary indication. The same approach was used for menstrual disorders (e.g., menorrhagia), menopausal disorders (e.g., postmenopausal bleeding), and inflammatory diseases of the pelvis. The remaining records were placed in the other category. The influence of hysterectomy on subsequent fracture risk was evaluated using three basic methods of analysis, all performed with the Statistical Analysis System (SAS Institute, Inc., Cary, NC). In the primary analysis, the risk of fractures in the cases was compared directly with that in their matched controls, by use of a stratified proportional hazards model with the case and control pairs forming the strata (12). In such analyses, the follow-up of both members of a pair is censored at the earliest event (i.e., fracture) or follow-up date of either member. Hazard ratios (HRs) compared the rate of occurrence of fractures in cases versus controls. In the second method of analysis, the cumulative incidence of a new fracture (1 minus the probability of survivalfree-of-fracture) was projected for up to 30 years following the index date (date of hysterectomy for each case and her matched control) with the use of product-limit methods (13). In comparing cases and controls, follow-up was censored at the earlier of the two last dates of follow-up for each casecontrol pair. A log-rank test was used to compare cumulative fracture incidence (14). In the final approach, Cox proportional hazards models (12) were used to assess the impact of various covariates (e.g., age, calendar year of surgery, type of hysterectomy, indication, or oophorectomy) on the subsequent risk of fractures among the cases alone. Univariate relationships between the risk of specific fractures and each clinical characteristic under consideration were first assessed. Stepwise methods with forward selection and backward elimination were then used to choose independent variables for the final models. The dependent variable was time until fracture, and the independent variables were the clinical characteristics at baseline, with oophorectomy and pelvic-floor repair (which could have occurred before or after the hysterectomy) handled as time-dependent covariates. For the final multivariable models, as well as for the univariate models, the assumption of proportional hazards was examined and was not violated for the variables considered. RESULTS During the 38-year study period, 9,893 hysterectomies were performed in this population, but 635 women did not authorize the use of their medical records for research purposes. Thus, 9,258 hysterectomies were included in this analysis. Of these, 6,353 (69%) were performed as a single procedure, while 2,905 (31%) were combined with a pelvic-floor repair procedure. An additional 215 pelvic-floor repairs were performed before or after the hysterectomy. Altogether, 5,141 (56%) hysterectomies were performed vaginally, and 4,117 (44%) were abdominal operations. Fifty (1%) of the vaginal hysterectomies were laparoscopically assisted, while subtotal (i.e., supracervical, n 57) and radical (n 78) hysterectomies comprised negligible proportions of the abdominal hysterectomies. The indications for hysterectomies are listed in Table 1. As would be expected, surgery for uterine fibroids was the most common indication for hysterectomy. Otherwise, Fertility and Sterility 157

166 TABLE 1 Indications for hysterectomy, by type, among women in Olmsted County, Minnesota, Indication Abdominal n (%) Vaginal n (%) Total n (%) Cancer of reproductive tract 637 (15.5) 312 (6.1) 949 (10.3) Debulking of urinary or gastrointestinal cancer 104 (2.5) 22 (0.4) 126 (1.4) Precancerous conditions 971 (23.6) 1,202 (23.4) 2,173 (23.5) Uterine leiomyomata 1,262 (30.7) 1,345 (26.2) 2,607 (28.2) Endometriosis 437 (10.6) 268 (5.2) 705 (7.6) Uterine or vaginal prolapse 45 (1.1) 1,094 (21.3) 1,139 (12.3) Menstrual disorders 347 (8.4) 770 (15.0) 1,117 (12.1) Menopausal disorders 42 (1.0) 37 (0.7) 79 (0.9) Inflammatory diseases of pelvis 202 (4.9) 68 (1.3) 270 (2.9) Other indications 70 (1.7) 23 (0.4) 93 (1.0) All indications 4,117 (100) 5,141 (100) 9,258 Note: n number of procedures. % percentage per column. Melton. Hysterectomy and long-term fracture risk. Fertil Steril cancer-related indications dominated the abdominal hysterectomies, whereas prolapse and menstrual disorders were more often indications for vaginal hysterectomy. The median age at hysterectomy was 44 years (mean SD, years), and the operated women were subsequently followed for 139,831 person-years (median, 13.6 years per subject). During this period of observation, 2,639 subjects experienced at least one fracture, for a crude fracture incidence rate of 18.9 per 1,000 person-years. Women in the control group were of comparable age ( years) because of the matching, and were followed for a total of 144,321 person-years (median, 14.0 years per subject). When censored so as to be identical for each member of a case-control pair, follow-up totaled 112,825 person-years (median, 9.5 years; range, 0 40 years) in each group. During this more restricted period of observation, the number of women who experienced a fracture was not much greater among cases (2,135, 23%) than controls (1,879, 20%), but the cumulative incidence of any subsequent fracture differed significantly (P.001) between the two groups, given the large sample size (Fig.1). Compared to controls, the overall risk of fracture was elevated 1.21-fold (95% confidence interval [CI], ) among the women with a hysterectomy. There were statistically significant increases in the HR for fractures of the hands and feet, and also of the vertebrae (Table 2). However, no increase was seen in fractures of the distal forearm or proximal femur, and the risk of a fracture at any of the traditional osteoporotic fracture sites (i.e., hip, spine, or distal forearm) was not significantly elevated (HR, 1.09; 95% CI, ). The relative risk of any fracture, and of osteoporotic fractures alone, by indication for the hysterectomy is shown in Table 3. Statistically significant increases in overall fracture risk were seen for women operated upon for cancer debulking, endometriosis, uterine prolapse, and menstrual disorders. However, only prolapse was associated with a statistically significant increase in osteoporotic fracture risk. In a multivariate analysis (Table 4), the independent predictors of any fracture among the women with a hysterectomy included increasing age (HR per 10-year increase, 1.30; 95% CI, ), timing of surgery (HR per 10-year FIGURE 1 Cumulative incidence of any fracture among 9,258 women in Rochester, Minnesota, after a hysterectomy performed between , and 9,258 age-matched controls. Follow-up began at time of hysterectomy (or comparable date in controls), and was censored at the earlier time of fracture or last follow-up for each member of a case-control pair. Melton. Hysterectomy and long-term fracture risk. Fertil Steril Melton et al. Hysterectomy and long-term fracture risk Vol. 88, No. 1, July 2007

167 TABLE 2 Number of fractures observed by skeletal site among 9,258 women in Olmsted County, Minnesota, after a hysterectomy in (cases), compared directly with 9,258 age-matched community controls, with the count of each group affected (n) and the HR from a stratified hazards model. Site Cases n Controls n HR (95% CI) Skull and face ( ) Hands and fingers ( ) Distal forearm ( ) Other arm ( ) Clavicle, scapula, and sternum ( ) Ribs ( ) Vertebrae ( ) Pelvis ( ) Proximal femur ( ) Other leg ( ) Feet and toes ( ) Any site 2,135 1, ( ) Note: Follow-up of both members of a case-control pair was censored at the earliest follow-up date for either. Subjects were censored by death, emigration from the community, or occurrence of the indicated fracture. Melton. Hysterectomy and long-term fracture risk. Fertil Steril increase in calendar year, 1.14; 95% CI, ), and an indication for hysterectomy of uterine or vaginal prolapse (HR, 1.16; 95% CI, ). The latter association was independent of age, despite the fact that prolapse was a more frequent indication for surgery among older than younger women (i.e., 27% of hysterectomies at age 70 years compared to 17% at ages years, and only 10% at ages 50 years). By contrast, pelvic-floor repair was not a significant predictor of fracture risk after adjusting for the prolapse indication. There was no overall increase in fracture risk associated with vaginal versus abdominal hysterectomy (HR, 1.00; 95% CI, ) or with oophorectomy in 6,093 women (66%) as a time-dependent variable (HR, 1.06; 95% CI, ), although 94% of them occurred within 1 year of the hysterectomy. DISCUSSION Given the equivocal results of the Women s Health Initiative (15), treatment with E, when used at all (16), may be in- TABLE 3 Fracture risk after hysterectomy in among 9,258 women in Olmsted County, Minnesota, compared with 9,258 age-matched community controls, by indication for surgery. Indication (n) Any fracture, HR (95% CI) a Osteoporotic fracture, HR (95% CI) a Cancer of reproductive tract (949) 1.21 ( ) 1.03 ( ) Debulking of urinary or gastrointestinal cancer (126) 1.82 ( ) 2.00 ( ) Precancerous conditions (2,173) 1.10 ( ) 0.97 ( ) Uterine leiomyomata (2,607) 1.12 ( ) 0.99 ( ) Endometriosis (705) 1.46 ( ) 1.38 ( ) Uterine or vaginal prolapse (1,139) 1.28 ( ) 1.33 ( ) Menstrual disorders (1,117) 1.50 ( ) 1.23 ( ) Menopausal disorders (79) 0.93 ( ) 0.57 ( ) Inflammatory diseases of pelvis (270) 1.18 ( ) 1.44 ( ) Other indications (93) 1.29 ( ) 1.50 ( ) a Hazard ratio from a stratified hazards model. Melton. Hysterectomy and long-term fracture risk. Fertil Steril Fertility and Sterility 159

168 TABLE 4 Univariate and multivariate HRs a for the development of any new fracture among 9,258 women in Olmsted County, Minnesota, after a hysterectomy in Risk factor b Univariate HR (95% CI) Multivariate HR (95% CI) Age at surgery (per 10-year increase) 1.32 ( ) 1.30 ( ) Calendar year (per 10-year increase) 1.16 ( ) 1.14 ( ) Uterine prolapse indication (yes versus no) 1.25 ( ) 1.16 ( ) Pelvic-floor repair (yes versus no) 1.13 ( ) a Proportional hazards models where the event is a fracture, and the dependent variable is survival time (days) free of fracture. b Only risk factors that were significant in the univariate and/or multivariate analyses are included. Melton. Hysterectomy and long-term fracture risk. Fertil Steril creasingly restricted to women at high risk of fracture (17). Of particular interest is the risk of fracture among the 633,000 women who undergo hysterectomy annually (18). Hysterectomy was shown to be equivalent to postmenopausal status in doubling the risk of fracture over a 2-year period in perimenopausal women (19), but it is necessary to quantify fracture risk long-term, and not just in the perimenopausal period where short-term use of E may be indicated for relief of menopausal symptoms. In the present study, spanning all ages and with follow-up extending to 40 years, overall fracture risk was elevated by 21% among the women who had undergone a hysterectomy. This raises two general possibilities: [1] that the hysterectomy was causally related to the increase in risk, and [2] that it was only an indicator of an underlying predisposition (confounding). Hysterectomy per se could have an adverse effect on the skeleton by compromising the ovarian blood supply, thus causing premature ovarian failure (20,21); and serum bioavailable levels of T, but not bioavailable levels of E 2, are reduced among women with a hysterectomy and ovarian conservation (22). With few exceptions (23 25), however, most studies found no excessive bone loss following hysterectomy alone (26 34). Moreover, if premature sex-steroid deficiency were the predominant mechanism, one would expect fracture risk to increase with younger age at surgery (35). The opposite was true in this analysis, and the association of fractures with increasing age, as documented here, is well-known (10). In addition, we found no difference in subsequent fracture risk between the two surgical approaches to hysterectomy. On the other hand, most indications for hysterectomy were associated with some increase in overall fracture risk, although the increases were statistically significant in only 4 of 10 indications, despite the large number of women involved. Even where significant, the effect sizes were modest (HR 1.8), and there was little increase in fracture risk among women operated upon for leiomyomata or premalignant conditions, who together accounted for 50% of all hysterectomies. The indication most closely associated with overall fracture risk, and the only one significantly associated with osteoporotic fractures, was uterine prolapse. This condition may be a marker for E deficiency (36,37), although oral contraceptive use and hormone replacement therapy appear not to be protective (38,39). If so, the association with fractures previously seen with postmenopausal oophorectomy (1), which was also most evident in the subset of women with prolapse, is likely an indirect one due to confounding by the indication for the concomitant hysterectomy. Indeed, the present results are consistent with data from the Study of Osteoporotic Fractures (3) in concluding that oophorectomy is not independently associated with risk of osteoporotic fracture among women with a hysterectomy. In this analysis, we lacked any information about the use of treatment with E, which could have masked an adverse effect of oophorectomy on fracture risk in these women. However, in a separate study, we showed that E replacement had only a modest effect among premenopausal women with a bilateral oophorectomy, because few of them were treated beyond the usual age of natural menopause (6). Likewise, in an observational study, there was little influence of E on subsequent fractures among women who were already postmenopausal at the time of oophorectomy (1), whereas significant reductions in hip, spine, and wrist fractures were seen in a randomized, controlled trial of treatment with E among older women (15). One of the strengths of our study was the use of a large, population-based inception cohort that includes almost all of the women in the community who underwent a hysterectomy. In addition, controls were selected from an enumeration of the Olmsted County population, and therefore should have been representative of community residents generally (7). Furthermore, patients were followed forward from the date of their operation for up to 40 years (median, 13.6 years), and fractures were ascertained using the resources of the Rochester Epidemiology Project (7), which allowed access to all outpatient and inpatient data so that outcomes could be assessed comparably in cases and controls. 160 Melton et al. Hysterectomy and long-term fracture risk Vol. 88, No. 1, July 2007

169 There are also corresponding limitations of a study based on a review of electronic medical records. In particular, we were unable to specify the actual mechanisms that might influence fracture risk because there was no routine evaluation of bone loss, bone turnover, or other measures of bone quality, or any assessment of sex-steroid levels. Such studies are needed, particularly among women with uterine prolapse. Nonetheless, our overall results indicate that osteoporotic fractures do not represent a substantial problem for most women undergoing hysterectomy, whether or not an oophorectomy is performed, and this is consistent with most previous studies showing little excessive bone loss after a hysterectomy. These observations may be germane to the controversy concerning prophylactic oophorectomy in these women (40). Acknowledgments: The authors thank Mrs. Mary Roberts for preparing the manuscript. REFERENCES 1. Melton LJ III, Khosla S, Malkasian GD, Achenbach SJ, Oberg AL, Riggs BL. Fracture risk after bilateral oophorectomy in elderly women. J Bone Miner Res 2003;18: Riggs BL, Khosla S, Melton LJ III. Sex steroids and the construction and conservation of the adult skeleton. Endocr Rev 2002;23: Antoniucci DM, Sellmeyer DE, Cauley JA, Ensrud K, Schneider JL, Vesco KK, et al. Postmenopausal bilateral oophorectomy is not associated with increased fracture risk in older women. The Study of Osteoporotic Fractures Research Group. J Bone Miner Res 2005;20: Lepine LA, Hillis SD, Marchbanks PA, Koonin LM, Morrow B, Kieke BA, et al. Hysterectomy surveillance United States, MMWR CDC Surveill Summ 1997;46: Brett KM, Pokras R, Madans JH, Peterson HB. National trends in bilateral oophorectomy, J Womens Health 1994;3: Melton LJ III, Crowson CS, Malkasian GD, O Fallon WM. Fracture risk following bilateral oophorectomy. J Clin Epidemiol 1996;49: Melton LJ III. History of the Rochester Epidemiology Project. Mayo Clin Proc 1996;71: Babalola EO, Bharucha AE, Schleck CD, Gebhart JB, Zinsmeister AR, Melton LJ III. Decreasing utilization of hysterectomy: a populationbased study in Olmsted County, Minnesota, Am J Obstet Gynecol. In press. 9. Melton LJ III. The threat to medical-records research. N Engl J Med 1997;337: Cummings SR, Melton LJ. Epidemiology and outcomes of osteoporotic fractures. Lancet 2002;359: Sanders KM, Pasco JA, Ugoni AM, Nicholson GC, Seeman E, Martin TJ, et al. The exclusion of high trauma fractures may underestimate the prevalence of bone fragility fractures in the community: The Geelong Osteoporosis Study. J Bone Miner Res 1998;13: Cox DR. Regression models and life-tables (with discussion). J R Stat Soc [B] 1972;34: Kaplan EL, Meier P. Non-parametric estimation from incomplete observations. J Am Stat Assoc 1958;53: Kalbfleisch JD, Prentice RL. The statistical analysis of failure time data. New York: John Wiley & Sons, Jackson RD, Wactawski-Wende J, LaCroix AZ, Pettinger M, Yood RA, Watts NB, et al. Effects of conjugated equine estrogen on risk of fractures and BMD in postmenopausal women with hysterectomy: results from the Women s Health Initiative Randomized Trial. J Bone Miner Res 2006;21: U.S. Preventive Services Task Force. Hormone replacement therapy for primary prevention of chronic conditions: recommendations and rationale. October Rockville, MD: Agency for Healthcare Research and Quality ( 17. Nguyen TV, Center JR, Eisman JA. Association between breast cancer and bone mineral density: the Dubbo Osteoporosis Epidemiology Study. Maturitas 2000;36: Kozak LJ, Hall MJ, Owings MF. National Hospital Discharge Survey: 2000 annual summary with detailed diagnosis and procedure data. National Center for Health Statistics. Vital Health Stat 2002;13: Torgerson DJ, Campbell MK, Thomas RE, Reid DM. Prediction of perimenopausal fractures by bone mineral density and other risk factors. J Bone Miner Res 1996;11: Siddle N, Sarrel P, Whitehead M. The effect of hysterectomy on the age at ovarian failure: identification of a subgroup of women with premature loss of ovarian function and literature review. Fertil Steril 1987; 47: Dean S. Hysterectomy and bone mineral density. Br J Hosp Med 1997;57: Laughlin GA, Barrett-Connor E, Kritz-Silverstein D, von Mühlen D. Hysterectomy, oophorectomy, and endogenous sex hormone levels in older women: the Rancho Bernardo Study. J Clin Endocrinol Metab 2000;85: Hreshchyshyn MM, Hopkins A, Zylstra S, Anbar M. Effects of natural menopause, hysterectomy, and oophorectomy on lumbar spine and femoral neck bone densities. Obstet Gynecol 1988;72: Watson NR, Studd JW, Garnett T, Savvas M, Milligan P. Bone loss after hysterectomy with ovarian conservation. Obstet Gynecol 1995;86: Duraes Simões R, Chada Baracat E, Szjenfeld VL, de Lima GR, Jose Goncalves W, Bortoletto C. Effects of simple hysterectomy on bone loss. Rev Paul Med 1995;113: Johansson C, Mellström D, Milsom I. Reproductive factors as predictors of bone density and fractures in women at the age of 70. Maturitas 1993;17: Ravn P, Lind C, Nilas L. Lack of influence of simple premenopausal hysterectomy on bone mass and bone metabolism. Am J Obstet Gynecol 1995;172: Tuppurainen M, Kröger H, Saarikoski S, Honkanen R, Alhava E. The effect of gynecological risk factors on lumbar and femoral bone mineral density in peri- and postmenopausal women. Maturitas 1995;21: Carranza-Lira S, Murillo-Uribe A, Martinez Trejo N, Santos-González J. Changes in symptomatology, hormones, lipids, and bone density after hysterectomy. Int J Fertil Womens Med 1997;42: Larcos G. Hysterectomy with ovarian conservation: effect on bone mineral density. Aust N Z J Obstet Gynaecol 1998;38: Grainge MJ, Coupland CA, Cliffe SJ, Chilvers CE, Hosking DJ. Reproductive, menstrual and menopausal factors: which are associated with bone mineral density in early postmenopausal women? Osteoporos Int 2001;12: Forsmo S, Schei B, Langhammer A, Forsén L. How do reproductive and lifestyle factors influence bone density in distal and ultradistal radius of early postmenopausal women? The Nord-Trondelag Health Survey, Norway. Osteoporos Int 2001;12: Cheng S, Sievänen H, Heinonen A, Uusi-Rasi K, Carbone L, Tylavsky F, et al. Does hysterectomy with ovarian conservation affect bone metabolism and density? J Bone Miner Metab 2003;21: Kritz-Silverstein D, von Mühlen DG, Barrett-Connor E. Hysterectomy and oophorectomy are unrelated to bone loss in older women. Maturitas 2004;47: van Der Voort DJ, van Der Weijer PH, Barentsen R. Early menopause: increased fracture risk at older age. Osteoporos Int 2003;14: Smith P, Heimer G, Norgren A, Ulmsten U. Localization of steroid hormone receptors in the pelvic muscles. Eur J Obstet Gynecol Reprod Biol 1993;50:83 5. Fertility and Sterility 161

170 37. Lang JH, Zhu L, Sun ZJ, Chen J. Estrogen levels and estrogen receptors in patients with stress urinary incontinence and pelvic organ prolapse. Int J Gynaecol Obstet 2003;80: Mant J, Painter R, Vessey M. Epidemiology of genital prolapse: observations from the Oxford Family Planning Association Study. Br J Obstet Gynaecol 1997;104: Nygaard I, Bradley C, Brandt D. Pelvic organ prolapse in older women: prevalence and risk factors. The Women s Health Initiative (WHI). Obstet Gynecol 2004:104: Parker WH, Broder MS, Liu Z, Shoupe D, Farquhar C, Berek J. Ovarian conservation at the time of hysterectomy for benign disease. Obstet Gynecol 2005;106: Melton et al. Hysterectomy and long-term fracture risk Vol. 88, No. 1, July 2007

171 Do sex hormones influence features of the metabolic syndrome in middle-aged women? A populationbased study of Swedish women: The Women s Health in the Lund Area (WHILA) Study Yasameen A. Shakir, M.D., Ph.D., a Göran Samsioe, M.D., Ph.D., a Per Nyberg, Ph.D., b Jonas Lidfeldt, M.D., Ph.D., b Christina Nerbrand, M.D., Ph.D., b and Carl-David Agardh, M.D., Ph.D. b a Departments of Clinical Sciences in Lund and b Malmö, Lund University, Lund, Sweden Objective: To outline perceived associations between various sex hormones and risk markers for cardiovascular disease in middle-aged women, with an emphasis on features of the metabolic syndrome (MS). Design: Cross-sectional analysis. Setting: Women s Health in the Lund Area Study. Patient(s): Population-based cohort. Intervention(s): A generic questionnaire, physical examinations, and laboratory assessments were completed by 6,917 women aged years living in the Lund area of southern Sweden. Women at or above defined cutoff limits for the MS were considered positively screened. After exclusion of women using hormone therapy (HT), 2,038 women with (MS ) and 2,054 women without features of the MS (MS ) were included. The ELISA techniques were used for the determination of serum androstendione (A), E 2, T, sex hormone-binding globulin (SHBG), cortisol, insulin, and leptin levels. Serum lipids and lipoproteins were determined by conventional methods. Multiple linear regression analyses were performed, controlling for age, body mass index (BMI), and smoking habits. Main Outcome Measure(s): Features of the MS, sex steroids, cardiovascular risk markers. Result(s): In the MS group, a positive association was seen between A and systolic blood pressure. Estradiol was negatively associated with total cholesterol and diastolic blood pressure. The SHBG was negatively associated with triglycerides, blood glucose, and diastolic blood pressure and positively with high-density lipoprotein (HDL). In the MS- group, there were positive associations between A, blood glucose, and systolic blood pressure. Testosterone was positively associated with HDL. Estradiol was negatively associated with total cholesterol and positively with systolic blood pressure. The SHBG was positively associated with HDL and negatively with triglycerides and diastolic blood pressure. There were positive associations between cortisol, low-density lipoprotein (LDL) cholesterol, blood glucose, and systolic blood pressure and a negative association with triglycerides in both MS and MS- groups. Conclusion(s): Androstendione, E 2, and T levels were associated with cardiovascular risk factors in middle-aged women. Effects by sex steroids on cardiovascular risk markers seem to be different in women with or without features of the MS. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Metabolic syndrome, sex hormones, SHBG, cortisol, middle-aged women Cardiovascular disease (CVD) is the leading cause of death in women in Western societies. Compelling evidence from both prospective and retrospective observational studies suggests that estrogen (E) monotherapy as well as sequential hormone therapy (HT) reduce the risk of CVD in healthy postmenopausal women (1). However, the Women s Health Initiative (WHI) and other randomized studies (2, 3) did not confirm these results and changed our understanding of risks Received December 19, 2005; revised November 10, 2006; accepted November 21, Supported by grants from the Skane County Council Foundation for Research and Development, and the Faculty of Medicine, Lund University. Reprint requests: Yasameen A. Shakir, M.D., Ph.D., Department of Gynecology and Obstetrics, Lund University Hospital, S Lund, Sweden (FAX: ; Yasameen.Shakir@med.lu.se). and benefits associated with HT. A postmenopausal woman with diabetes is three times more likely to develop CVD or stroke than a healthy woman (4, 5). Obesity, hypertension, hyperlipidemia, or hyperglycemia augment the risk to develop type 2 diabetes as well as CVD. A combination of these risk factors further increases this risk (6). Estrogen, T, and sex hormone-binding globulin (SHBG) have been suggested to further influence the risk pattern, but possible interactions with other risk factors are less well known. Data on associations between SHBG and CVD have been contradictory. Low SHBG levels have been associated with low serum high-density lipoprotein (HDL) cholesterol (7) as well as an increased risk of diabetes (8), whereas in the Rancho Bernardo Study, SHBG levels were not associated with cardiovascular mortality when adjusted for body mass index /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 163

172 (BMI) (9). In another study, low SHBG levels were associated with a higher risk of CVD among women who did not use HT, but this relationship was not independent of BMI (10). In case-control studies, low plasma levels of SHBG were associated with a higher likelihood of atherosclerosis (11) and carotid intimal medial thickness (12). However, one angiographic case-control study failed to find an association (13). High androgen levels may increase CVD risk in women, possibly mediated by effects on lipids, blood pressure, and glucose metabolism (14, 15). In one cross-sectional study, T levels were associated with the amount of coronary atherosclerosis, as verified by angiography (16). The aim of the present study was to outline perceived associations between various sex hormones and risk factors for cardiovascular disease in middle-aged women with emphasis on subjects with features of the metabolic syndrome (MS). MATERIALS AND METHODS This report is an analysis from The Women s Health in the Lund Area (WHILA) Study. The WHILA project covered all women (n 10,766) born between December 2, 1935, and December 1, 1945, and living in the Lund area, Sweden, by December 1, 1995.The Lund area is located in southern Sweden and composed of a university town with about 100,000 inhabitants, and its surrounding rural areas, mainly farmland with a population of about 50,000 inhabitants. Women were invited to a screening procedure, which took place between 1996 and Details from the study have been published elsewhere (17). A population register comprising all inhabitants identified women eligible for study. Informed consent was obtained and the ethics committee at Lund University approved the study. A specially trained midwife nurse collected the questionnaires at the time of the examinations and personally interviewed each woman, and potential problems were addressed. At the interview, 19% of the subjects made some corrections in their written answers caused by mistakes or misunderstandings when filling out the forms. The questionnaires were answered before the laboratory results were obtained. The physical examination included measurements of body weight, height, minimal waist and maximal hip circumference (WHR), systolic and diastolic blood pressure, random capillary blood glucose, and a lipid profile. Blood pressure was measured twice in the right arm after 15 minutes of rest in the seated position using a mercury sphygmomanometer with a cuff size adjusted to the circumference of the arm. Korotkoff phase V was taken as the diastolic blood pressure. The average of two recordings, measured to the nearest 2 mm Hg, was the blood pressure used for statistical calculations. TABLE 1 Number and percentage of women with screening variables at or above the cutoff levels (alone or in combination), (n 2,038). Screening variables and cutoff levels Positive screening outcome No. % of total group Random capillary blood glucose 8.0 mmol/l Nonfasting serum triglycerides 2.3 mmo/l BMI 30 kg/ m WHR SBP 160 or DBP mm Hg Family history of diabetes mellitus a Drug treatment of hypertension Drug treatment of hyperlipidemia a Women with family history of diabetes as only screening variable excluded. Shakir. Features of the metabolic syndrome and sex hormones. Fertil Steril Subjects The cutoff values for the primary screening procedure are shown in the Table 1. Women with one (women with family history of diabetes mellitus as only screening were excluded) or more of the eight factors for positive primary screening were defined as having features of the MS. Altogether 3,309 women (47.8%) had a positive screening outcome (18, 19). According to the hormonal situation, the participating women (n 6,917) were divided into three groups (i.e., 492 [7.1%] premenopausal [PM] with regular menstruation, 3,600 [52.1%] postmenopausal without HT [PM0], and 2,816 [40.8%] with use of HT [PMT]). Menopause was defined as a bleed-free interval of at least 12 months. After exclusion of the PMT group, 2,038 women with features of the MS (MS ) (994 women had one of those eight factors of positive primary screening and 1,044 women had a combination) and 2,054 women without features of the MS (MS ) were included (Fig. 1). Fasting serum insulin and leptin levels were analyzed in a random group of every third women in the positive screening group (570 women were included). Laboratory Analysis Blood glucose, as well as and serum levels of triglycerides, total cholesterol, HDL-cholesterol and low-density lipopro- 164 Shakir et al. Features of the metabolic syndrome and sex hormones Vol. 88, No. 1, July 2007

173 FIGURE 1 Population study. PM premenopause; PM0 postmenopause without using hormone therapy; PMT postmenopause with use of hormone therapy. Multiple linear regression analyses, controlling for age, BMI, and smoking habits (method stepwise) were performed to evaluate associations between variables of the MS and sex steroids. The P values.05 were regarded as statistically significant. Calculations were performed using the statistical program SPSS version 11.5 (SPSS Inc., Chicago, IL). RESULTS The population comprised 10,766 women, of whom 6,917 (64.2%) completed the examinations and formed the basis for the present report. Age distribution was similar between responders and nonresponders. More nonresponders than responders died during the period (2.6% vs. 0.2%, P.001), as well as during the next 2 years, (1.5% vs. 0.3%, P.001). The main causes of death were cancer and CVD. An analysis of nonresponders has been published previously (17). Shakir. Features of the metabolic syndrome and sex hormones. Fertil Steril tein (LDL)-cholesterol were measured by a Cholestech LDX instrument (Cholestech Corporation, Hayward, CA) on capillary whole blood. The ELISA techniques were used for the determination of serum androstendione (A), SHBG, cortisol, insulin, and leptin levels. Commercial ELISA methods using monoclonal antibodies were purchased from the DRG Instrument GmbH (Marburg, Germany). KRYPTOR-Testosterone, KRYPTOR- Estradiol 17 (E 2 ) are a kit designed for KRYPTOR automated immunofluorescent assays of T and E 2 in human serum. (B.R.A.H.M.S Ag., Hennigsdorf, Germany). KRYPTOR uses TRACE (Time Resolved Amplified Cryptate Emission) technology, based on a nonradioactive transfer of energy. This transfer takes place between two fluorescent tracers. Detection limits and coefficient of variations for hormones were as follow: E 2 : 3.5 pmol/l and 7.1%, T: 0.15 nmol/l and 6.4%, A: 0.15 nmol/l and 5.14%, cortisol: 6.9 nmol/l and 9.59%, SHBG: 0.2 nmol/l and 3.0%, insulin: 1.5 IU/mL and 4.11%. Insulin resistance was expressed through the homeostasis assessment model (HOMA-IR) and calculated by the equation of fasting insulin x fasting glucose/22.5 (20). A T index was defined as T/SHBG x 100. The E 2 index was calculated as E 2 /SHBG x 100. These indices were calculated to consider also free and protein bound steroids (21). STATISTICS For continuous variables, when normally distributed, Student s t-test was used for determination of differences between groups. When not normally distributed, the Mann- Whitney test was used. Median levels of E 2 (P.006) and SHBG (P.001) were lower in the MS group, whereas serum levels of E 2 index and T index (P.001 for both) were higher compared to the MS- group (Table 2). By definition, systolic and diastolic blood pressures, total serum cholesterol, LDL-cholesterol, triglycerides and blood glucose level were higher and HDL-cholesterol was lower in the MS compared to the MS- group (P.001 for all) (Fig. 2). Multiple Linear Regression Analyses Multiple linear regression analyses were controlled for age, BMI, and smoking habits. All subjects Multiple linear regression analyses revealed positive associations between A, blood glucose (P.05), and systolic blood pressure (P.001). Estradiol was negatively associated with total cholesterol (P.001) and triglycerides (P.02). The SHBG was negatively associated with triglycerides (P.001), blood glucose (P.004), and diastolic blood pressure (P.001), but positively with HDLcholesterol (P.001). Cortisol was positively associated with LDL, blood glucose, and systolic blood pressure, but negatively with triglycerides (P.001 for all). Testosterone index was positively associated with triglycerides (P.001) and negatively with HDL (P.003). We could not find any association with T and E 2 index (Table 3). Subjects with features of the metabolic syndrome In the MS group, a positive association was seen between A and systolic blood pressure (P.03). Estradiol was negatively associated with total cholesterol (P.001) and diastolic blood pressure (P.05). The SHBG was negatively associated with triglycerides (P.001), blood glucose (P.01), and diastolic blood pressure (P.007), and positively with HDL (P.001). Positive associations were also found between cortisol and LDL-cholesterol (P.037), systolic blood pressure and Fertility and Sterility 165

174 TABLE 2 Median levels (interquartile range) of sex hormone in the total, MS and MS groups. Sex hormones All groups (n 4092) MS (n 2038) MS (n 2054) P value Androstendione (nmol/l) 4.1 (3.1) 4.1 (3.2) 4.1 (2.9).6 Estradiol (pmol/l) 17.4 (37.3) 16.5 (31.8) 18.2 (41.5).006 Estradiol index 35.9 (81.7) 39.7 (82.5) 31.3 (79.5).001 Testosterone(nmol/L) 2.1 (1.8) 2.08 (1.8) 2.1 (1.9).6 Testosterone index 3.7 (4.6) 4.3 (5.5) 3.2 (3.8).001 SHBG(nmol/L) 52.4 (38.4) 44.0 (34.0) 60.3 (37.6).001 Cortisol (nmol/l) (182.1) (189.8) (173.4).09 Note: P value regarding differences between MS and MS (Mann-Whitney test). Shakir. Features of the metabolic syndrome and sex hormones. Fertil Steril blood glucose (P.001 for both) and a negative association with triglycerides (P.001). Estradiol index was negatively associated with total cholesterol (P.001). Testosterone index was positively associated with triglycerides, and negatively with HDL (P.001for both) (Table 4). When we added insulin concentrations, insulin resistance and leptin levels to the multiple linear regressions in the MS group, a negative association between T index and leptin levels was found (P.007). Subjects without features of the metabolic syndrome There were positive associations between A, blood glucose (P.005) and systolic blood pressure (P.001). Testosterone was positively associated with HDL (P.02). Estradiol was negatively associated with total cholesterol (P.004) and positively with systolic blood pressure (P.01). The SHBG was positively associated with HDL (P.001) and negatively with triglycerides (P.001) and diastolic blood pressure (P.001). There were positive associations between cortisol and LDL-cholesterol, blood glucose (P.001 for both) and systolic blood pressure (P.006) and a negative association with triglycerides (P.001). There were positive associations between T index, LDL (P.02), and triglycerides (P.003). We could not find any associations with E 2 index (Table 5). FIGURE 2 Mean levels of lipids, glucose, systolic (SBP), and diastolic (DBP) blood pressure in MS (n 2,038) and MS- (n 2,054) groups. ***P.001. TC serum total cholesterol; HDL high-density lipoprotein; LDL low-density lipoprotein; TG triglycerides. Shakir. Features of the metabolic syndrome and sex hormones. Fertil Steril Shakir et al. Features of the metabolic syndrome and sex hormones Vol. 88, No. 1, July 2007

175 Fertility and Sterility TABLE 3 Associations of potential risk factors by different sex hormones, SHBG, and cortisol in the total group (n 3,672). Androstendione E 2 T SHBG Cortisol E 2 index T index B coefficient B coefficient B coefficient B coefficient B coefficient B coefficient B coefficient Serum total cholesterol (mmol/l) c Serum HDL cholesterol (mmol/l) c b Serum LDL cholesterol (mmol/l) c Serum triglycerides (mmol/l) a c 14.6 c c Glucose 0.06 a b 9.9 c Systolic blood pressure 0.01 c c Diastolic blood pressure c Note: Multiple linear regression analysis controlling for age, BMI, and smoking habits. a P.05; b P.01; c P.001. Shakir. Features of the metabolic syndrome and sex hormones. Fertil Steril TABLE 4 Associations of potential risk factors by different sex hormones, SHBG, and cortisol in women with features of the metabolic syndrome (MS ) (n 1,972). Androstendione E 2 T SHBG Cortisol E 2 index T index B coefficient B coefficient B coefficient B coefficient B coefficient B coefficient B coefficient Serum total cholesterol (mmol/l) c 0, c 0.3 Serum HDL cholesterol (mmol/l) c c Serum LDL cholesterol (mmol/l) a Serum triglycerides (mmol/l) c 11.7 b c Glucose b 8.4 c Systolic blood pressure a c Diastolic blood pressure a b Note: Multiple linear regression analysis controlling for age, BMI, and smoking habits. a P.05; b P.01; c P Shakir. Features of the metabolic syndrome and sex hormones. Fertil Steril 2007.

176 TABLE 5 Associations of potential risk factors by different sex hormones, SHBG, and cortisol in women without features of the metabolic syndrome (MS ) (n 1,748). Androstendione E 2 T SHBG Cortisol E 2 index T index B coefficient B coefficient B coefficient B coefficient B coefficient B coefficient B coefficient Serum total cholesterol (mmol/l) b Serum HDL cholesterol (mmol/l) a 7.4 c Serum LDL cholesterol (mmol/l) c a Serum triglycerides (mmol/l) c 29.4 c b Glucose 0.2 b c Systolic blood pressure 0.02 c 0.5 b b Diastolic blood pressure c Note: Multiple linear regression analysis controlling for age, BMI, and smoking habits. a P.05; b P.01; c P.001. Shakir. Features of the metabolic syndrome and sex hormones. Fertil Steril DISCUSSION The present study demonstrated that E 2, A, and T were associated with risk factors for CVD in middle-aged women. Our results are in accordance with previous studies (22, 23) suggesting that women with the MS have lower levels of serum E 2 and SHBG and higher androgens. To our knowledge, another analysis of differences between women with and without features of the MS in relation to gonadal hormones has not been carried out. In the MS women, there was a negative association between E 2 and diastolic blood pressure. This finding indicates that women with MS would benefit more from E administration than the MSgroup. Also in the MS group, E 2 index was negatively associated with total cholesterol, but there was no association in the MS group. The SHBG levels were lower in the MS than in the MS group. Hence the free fractions of all sex steroids were greater in the MS group compared to the MS group and the direct influence of hormones greater in the MS group. Blood glucose was the only factor that differed in its association with SHBG. There was a negative association between blood glucose and SHBG in the MS group, which was not found in the MS group (Table 6). Among nondiabetic Australian women (21) not using hormone or lipid-lowering medications, no relationship between serum E 2 and HDL-cholesterol, LDL-cholesterol, triglycerides, or diastolic blood pressure levels was found, whereas free androgen index was positively associated with LDLcholesterol. After controlling for confounding variables, we found a negative association between E 2 and total cholesterol and a positive one with systolic blood pressure in the MS group. Our data confirm other studies that found no association between T and HDL cholesterol (24). Also we could not find any association whether in the total group or in the MS or MS groups. Korhonen et al. (25) demonstrated that a hyperandrogenic hormone profile appeared to be a typical feature in premenopausal females with the MS, even without the polycystic ovary syndrome (PCOS). Previous studies did not determine which components of the MS are most strongly related to T levels in postmenopausal women, mainly due to a small sample size (26) or lack of data on certain components of the MS (27). In the MS- group, there was a positive association between T and HDL, which probably indicates a favorable effect of endogenous androgen on the risk marker for CVD. Also there were different influences by T index, that is, a negative association with HDL-cholesterol and a positive association with triglycerides in the MS, whereas in the MS group, there were positive associations with LDL and triglycerides. In women, compared to men, relationships between endogenous androgens and obesity, insulin, and cardiovascular risk factors have been contradictory. In cross-sectional studies, serum levels of T had positive correlations with BMI and 168 Shakir et al. Features of the metabolic syndrome and sex hormones Vol. 88, No. 1, July 2007

177 Fertility and Sterility TABLE 6 Comparison of findings by multiple linear regressions in the MS and MS groups. Androstendione E 2 T SHBG Cortisol E 2 index T index MS MS MS MS MS MS MS MS MS MS MS MS MS MS Serum total cholesterol (mmol/l) Serum HDL cholesterol (mmol/l) Serum LDL cholesterol (mmol/l) Serum triglycerides (mmol/l) Glucose Systolic blood pressure Diastolic blood pressure * P.05; ** P.01; *** P.001. pos pos ** pos *** neg *** neg ** neg ** pos ** pos * neg *** neg *** neg ** pos *** pos *** neg ** pos * neg ** pos *** pos *** pos *** neg *** pos *** pos ** neg *** neg *** pos *** pos ** pos *** Shakir. Features of the metabolic syndrome and sex hormones. Fertil Steril

178 leptin levels in women (22, 28). Low serum levels of SHBG, which could be an indirect measure of female hyperandrogenism, were found to be associated with high BMI and WHR as well as with high serum levels of leptin and insulin and low serum levels of HDL-cholesterol (29, 30). Leptin has been shown to be positively associated with many metabolic variables and insulin resistance (31), but the levels of leptin have been similar in subjects with diabetes and those without (32, 33). In one study, plasma leptin was lower in women with IGT and type 2 diabetes compared to women with normal glucose tolerance test (34). We also found a negative association between T index and leptin levels in the MS group, but we have limited data in the MS group. Hence, T index seems to have a negative impact on risk factors for CVD in women with features of the MS. However, no relationship with A was found. One study showed that a high free androgen index was associated with insulin resistance (35). Moreover, in a large prospective study, 20% of women with SHBG levels below the fifth percentile developed type 2 diabetes during a 12-year follow-up period (36). Psychological stress has been linked to the MS and diabetes (37). Stress mechanisms have been suggested to activate central nervous centers, by hypothalamic stimulation and elevated cortisol, and may be involved in the pathogenesis of abdominal obesity and metabolic abnormalities (38, 39). Another study (40) showed that hypercortisolemic patients with depression display resistance to insulin and increased visceral fat. We found the same associations with cortisol (i.e., a positive association with LDL-cholesterol, systolic blood pressure, and blood glucose) but a negative one with triglycerides in the MS and MS- groups. The pathophysiological mechanisms and perceived clinical significance need to be investigated further. In conclusion, sex hormone levels seem to be of importance for features of the MS in middle-aged women. Impacts by sex steroid on cardiovascular risk markers were different in women with or without features of the MS. REFERENCES 1. Grodstein F, Stampfer MJ, Manson JE, Colditz GA, Willett WC, Rosner B, et al. Postmenopausal estrogen and progestin use and the risk of cardiovascular disease. N Engl J Med.1996;335: Grady D, Herrington D, Bittner V, Blumenthal R, Davidson M, Hlatky M, et al, for the HERS Research Group. Cardiovascular disease outcomes during 6 8 years of hormone therapy: Heart and Estrogen/ progestin Replacement Study follow-up (HERS II). JAMA 2002;288: The Writing Group for the Women s Health Initiative investigators. Risks and benefits of estrogen plus progestin in healthy postmenopausal women. JAMA 2002;288: Goldberg RJ, Larson M, Levy D. Factors associated with survival to 75 years of age in middle aged men and women. The Framingham Study. Arch Intern Med 1996;156: Kannel WB, McGee DL. Diabetes and cardiovascular disease. The Framingham Study. JAMA 1979;241: Alberti KG, Zimmet PZ. Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: Diagnosis and classification of diabetes mellitus: provisional report of a WHO consultation. Diabet Med 1998;15: Haffner SM, Moss SE, Klein BE, Klein R. Sex hormones and DHEA- SO4 in relation to ischemic heart disease mortality in diabetic subjects: the Wisconsin Epidemiologic Study of Diabetic Retinopathy. Diabetes Care 1996;19: Haffner SM, Valdez RA, Morales PA, Hazuda HP, Stern MP. Decreased sex hormone-binding globulin predicts noninsulin-dependent diabetes mellitus in women but not in men. J Clin Endocrinol Metab 1993;77: Goodman-Gruen D, Barrett-Connor E. A prospective study of sex hormone-binding globulin and fatal cardiovascular disease in Rancho Bernardo men and women. J Clin Endocrinol Metab 1996;81: Rexrode KM, Manson JE, Lee IM, Ridker PM, Sluss PM, Cook NR, et al. Sex hormone levels and risk of cardiovascular events in postmenopausal women. Circulation 2003;108: Reinecke H, Bogdanski J, Woltering A, Breithardt G, Assmann G, Kerber S, et al. A Relation of serum levels of sex hormone binding globulin to coronary heart disease in postmenopausal women. Am J Cardiol 2002;90: Bernini GP, Sgro M, Moretti A, Argenio GF, Barlascini CO, Cristofani R, et al. Endogenous androgens and carotid intimal-medial thickness in women. J Clin Endocrinol Metab 1999;84: Hauner H, Bognar E, Blum A. Body fat distribution and its association with metabolic and hormonal risk factors in women with angiographically assessed coronary artery disease: evidence for the presence of a metabolic syndrome. Atherosclerosis 1994;105: Liu Y, Ding J, Bush TL, Longenecker JC, Nieto FJ, Golden SH, et al. Relative androgen excess and increased cardiovascular risk after menopause: a hypothesized relation. Am J Epidemiol 2001;154: Haffner SM, Newcomb PA, Marcus PM, Klein BE, Klein R. Relation of sex hormones and dehydroepiandrosterone sulfate (DHEA-SO4) to cardiovascular risk factors in postmenopausal women. Am J Epidemiol 1995;142: Phillips GB, Pinkernell BH, Jing TY. Relationship between serum sex hormones and coronary artery disease in postmenopausal women. Arterioscler Thromb Vasc Biol 1997;17: Lidfeldt J, Nerbrand C, Samsioe G. The women s health in the Lund area (WHILA) study. In: Schneider HFG, Naftolin F, eds. Climacteric medicine where do we go? London & New York: Taylor and Francis, 2005: Lidfeldt J, Nerbrand C, Samsioe G, Schersten B, Agardh C-D. A screening procedure detecting high-yield candidates for OGTT. The Women s Health in the Lund Area (WHILA) study: a population based study of middle-aged Swedish women. Eur J Epidemiol 2001;17: Shakir YA, Samsioe G, Nerbrand C, Lidfeldt J. Combined hormone therapy in postmenopausal women with features of metabolic syndrome. Results from a population-based study of Swedish women: Women s Health in the Lund Area study. Menopause 2004:11: Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 1985;28: Shelley JM, Green A, Smith AM, Dudley E, Dennerstein L, Hopper J, et al. Relationship of endogenous sex hormones to lipids and blood pressure in mid-aged women. Ann Epidemiol 1998;8: Acien P, Quereda F, Matallin P, Villarroya E, Lopez-Fernandez JA, Acien M, et al. Insulin, androgens, and obesity in women with and without polycystic ovary syndrome: a heterogeneous group of disorders. Fertil Steril 1999;72: Björntorp P. Hyperandrogenicity in women a prediabetic condition? J Intern Med 1993;234: Noyan V, Yucel A, Sagsoz N. The association of androgenic sex steroids with serum lipid levels in postmenopausal women. Acta Obstet Gynecol Scand 2004;83: Shakir et al. Features of the metabolic syndrome and sex hormones Vol. 88, No. 1, July 2007

179 25. Korhonen S, Hippelainen M, Vanhala M, Heinonen S, Niskanen L. The androgenic sex hormone profile is an essential feature of metabolic syndrome in premenopausal women: a controlled community-based study. Fertil Steril 2003;79: Kumagai S, Kai Y, Sasaki H. Relationship between insulin resistance, sex hormones and sex hormone-binding globulin in the serum lipid and lipoprotein profiles of Japanese postmenopausal women. J Atheroscler Thromb 2001;8: Oh JY, Barrett-Connor E, Wedick NM, Wingard DL. Rancho Bernardo Study. Endogenous sex hormones and the development of type 2 diabetes in older men and women. Diabetes Care 2002;25: Rouru J, Anttila L, Koskinen P, Penttila TA, Irjala K, Huupponen R, et al. Serum leptin concentrations in women with polycystic ovary syndrome. J Clin Endocrinol Metab 1997;82: Hergenc G, Schulte H, Assmann G, von Eckardstein A. Associations of obesity markers, insulin, and sex hormones with HDL-cholesterol levels in Turkish and German individuals. Atherosclerosis 1999;145: Sherif K, Kushner H, Falkner BE. Sex hormone-binding globulin and insulin resistance in African-American women. Metabolism 1998;47: Ruigi JB, Dekker JM, Blum WF, Stehouwer CD, Nijpels G, Mooy J, et al. Leptin and variables of body adiposity, energy balance, and insulin resistance in a population-based study. The Hoorn Study. Diabetes Care 1999;22: Saladin R, De Vos P, Guerre-Millo M, Leturque A, Girard J, Staels B, et al. Transient increase in obese gene expression after food intake or insulin adminstration. Nature 1995;377: Flier JS. Clinical review 94. What s in a name? In search of leptin s physiologic role. J Clin Endocrinol Metab 1998;83: Panarotto D, Ardilouze JL, Tessier D, Maheux P. The degree of hyperinsulinemia and impaired glucose tolerance predicts plasma leptin concentrations in women only: a new exploratory paradigm. Metabolism 2000;49: Golden SH, Ding J, Szklo M, Schmidt MI, Duncan BB, Dobs A. Glucose and insulin components of the metabolic syndrome are associated with hyperandrogenism in postmenopausal women: the atherosclerosis risk in communities study. Am J Epidemiol 2004; 160: Lindstedt G, Lundberg P, Lapidus L, Lundgren H, Bengtsson C, Björntorp P. Low sex hormone binding globulin concentration as an independent risk factor for development of NIDDM: 12 yr follow up of population study of women in Gothenburg. Diabetes 1991:40: Raikkonen K, Keltikangas-Jarvinen L, Adlercreutz H, Hautanen A. Psychological stress and the insulin resistance syndrome. Metabolism 1996;45: Björntorp P. Behaviour and the metabolic disease. Int J Behav Med 1996;3: Björntorp P. Do stress reactions cause abdominal obesity and comorbidities? Obes Rev 2001;2: Weber-Hamann B, Hentschel F, Kniest A, Deuschle M, Colla M, Lederbogen F, et al. Hypercortisolemic depression is associated with increased intra-abdominal fat. Psychosom Med 2002;64: Fertility and Sterility 171

180 Clinicopathologic characteristics of uterine adenomyoma in pregnant women Jian-Hua Wang, M.D., Xiao-Hong He, M.D., Rui-Jin Wu, Ph.D., M.D., and Xiang-Rong Xu, M.D. Department of Obstetrics and Gynecology, Women s Hospital, The School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People s Republic of China Objective: To study the clinicopathologic characteristics and the treatment means of pregnant women with uterine adenomyoma. Design: Retrospective, consecutive, controlled study. Setting: University hospital for obstetrics and gynecology. Patient(s): Eighteen pregnant women with uterine adenomyoma. Intervention(s): Data collection and statistical analysis. Main Outcome Measure(s): Eighteen pregnant women with uterine adenomyoma were diagnosed by excision of adenomyoma tissue during cesarean section and histopathology. The 18 subjects were retrospectively divided into treatment group (achieving this pregnancy by treatment; 10 cases) and control group (having no difficulty conceiving; 8 cases). The clinicopathologic characteristics and treatment means of the patients were analyzed retrospectively. Result(s): The mean volume of uterine adenomyoma in the treatment group was larger than that of the control group. The methods of treating women with uterine adenomyoma-associated infertility include GnRH agonist (GnRH-a: 6 cases), GnRH-a and IVF and embryo transfer (3 cases), and traditional Chinese medicines (1 case). Conclusion(s): Severe uterine adenomyoma correlate with infertility in women of childbearing age. GnRH-a is effective in treating women with uterine adenomyoma-associated infertility. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Adenomyosis, adenomyoma, cesarean section, pregnancy, infertility, histopathology, surgery Received July 30, 2006; revised November 1, 2006; accepted November 16, Reprint requests: Jian-Hua Wang, M.D., Department of Obstetrics and Gynecology, Women s Hospital, The School of Medicine, Zhejiang University, Hangzhou , China (FAX: ; wjh421@163.com). Adenomyosis is a common gynecological disorder with unclear etiology and has a peak incidence in women in their forties and fifties (1). There are two distinct forms of adenomyosis focal adenomyosis (adenomyoma) and diffuse adenomyosis. The patients presented with abnormal uterine bleeding, secondary dysmenorrhea, a diffusely or focal enlarged uterus (diffuse adenomyosis or adenomyoma) on ultrasound, infertility, or a combination of these symptoms. The main reason for seeing a doctor is not infertility for most of these patients (1, 2). At present, more women are delaying their first pregnancy until later in their thirties or forties (1, 2), and more women have undergone one or more induced abortion before they intended to have their first babies. Risk for adenomyosis and subfecundity odds ratio increases after termination of pregnancy (3, 4). Consequently, adenomyosis is encountered more frequently by infertility patients. Adenomyosis is suggested to be rare in the pregnant uterus. There is a possibility of an association between adenomyosis and infertility (2). At present, only case reports are available about pregnancy after treatment of adenomyosis with a GnRH agonist (GnRH-a) or other therapy (5 7), and there are no comparative studies for pregnancy women with uterine adenomyoma. This study was designed to study the clinicopathologic characteristics and the treatments of pregnant women with uterine adenomyoma. MATERIALS AND METHODS From January 1, 1996 to May 31, 2006, 18 Chinese pregnant women consecutively underwent low cervical transverse cesarean section and excision of uterine adenomyoma tissue at Women s Hospital, School of Medicine, Zhejiang University, People s Republic of China. Information on the presence of uterine adenomyoma was obtained from histopathology records by the presence of ectopic endometrial glands and stroma in the myometrium with adjacent smooth muscle hyperplasia. Macroscopic appearance of the uterine adenomyoma included focal mass of hypertrophic myometrium with small myometrial cysts or spaces scattered throughout the cut surface of the thickened myometrium, the chocolatelike fluid in the adenomyotic cysts, and the absence of circular vascularization at the border of the lesion. The criteria for estimating the extent of the resection needed were the excision of focal adenomyoma. The excision of adenomyoma tissue during cesarean section include: [1] after the baby is removed and the amniotic fluid is pumped out completely, a vasopressin should be 172 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

181 injected immediately into the uterine myometrium; [2] after placental expulsion, if uterine atony or unsatisfactory uterine contraction are still present, bimanual uterus compression followed by uterotonic therapy (such as prostaglandin medicine) should be done; [3] if the adenomyoma focus lies on the upper side of the cesarean section incision, an elastic strip should be strapped above the cesarean section incision to temporarily stop the upper branch of the uterine artery and reduce uterine hemorrhage, then the excision of adenomyoma tissue should be performed; and [4] a compression suture of the cavity of adenomyoma tissue excision should be done first and then the cesarean section incision (to explore the lesion of the adenomyoma). The 18 subjects were retrospectively divided into a treatment group (achieving this pregnancy by treatment; 10 cases) and a control group (having no difficulty conceiving; 8 cases). In the treatment group, there are 6 patients who had a history of primary infertility (without one previous pregnancy) and 4 patients who had a history of secondary infertility (with at least one previous pregnancy). The infertility criteria for inclusion in this study were the inability to conceive after a minimum of 24 months of unprotected intercourse. The clinical characteristics of patients in the two groups were summarized in Table 1. The volume of adenomyoma tissue was estimated according to the following equation on the assumption that the lesion mass was ellipsoid in shape: V (L T W) /6, where V is the mass volume, L is the maximum craniocaudal length, T is the maximum dorsoventral thickness, W is the maximum lateral width, and 3.14 (8). The presence of dysmenorrhea and menorrhagia were determined as described previously (1, 9 11). The research protocol was approved by the Medical Research Review Board of the Women s Hospital, School of Medicine, Zhejiang University, Hangzhou, People s Republic of China. A fully informed consent was obtained from all subjects participating in the study. Statistical analyses were done with SPSS for Windows (version 12.0; SPSS, Inc., Chicago, IL). The volumes of adenomyoma were analyzed by t-test analysis. Case frequencies were evaluated between the two groups using a Pearson s 2 test. A two-tailed significance test was used for all comparisons, and statistical significance was defined as P.05. RESULTS Eight patients in control group without a history of infertility achieved this pregnancy spontaneously. Ten patients in the treatment group with a history of infertility achieved pregnancy by different methods. Six patients got pregnant after GnRH-a therapy for 4 6 months, 3 patients by GnRH-a therapy for 3 5 months and subsequently IVF and embryo transfer, and 1 patient used traditional Chinese medicines (components of alternative herbs) for 6 months. The mean length of infertility is 5.6 years (range, 3 9 years). Uterine adenomyoma was the only cause of infertility in the treatment group. Of the 10 cases with uterine adenomyoma in treatment group, 7 cases were diagnosed with adenomyosis by transvaginal ultrasonography, and 3 cases were diagnosed by transvaginal ultrasonography and laparoscopy (2 of them underwent biopsy and were diagnosed by histopathology) before infertility treatment. The eight patients in control group were not diagnosed with adenomyosis before this pregnancy. There was no significant difference between the two groups concerning the frequency of dysmenorrhea or menorrhagia (all P.05) (Table 1). During the operation, we found single (13 cases) and multiple focal adenomyoma (5 cases) in the myometrium. The texture of these lesions was solid. The uterine adenomyoma were distributed as follows: anterior uterine walls (5 cases), posterior uterine walls (15 cases), and uterine fundus (3 cases). The lesion volume of adenomyoma in the two groups of patients is summarized in Table 2. The mean lesion volumes (the cubic space taken up by the adenomyoma) in the treatment group was larger than that of the control group (P.05). TABLE 1 The clinical characteristics of patients with uterine adenomyoma in the two groups. Groups No. (%) Age (y) Gestational weeks Primiparous/ multiparous (no.) Symptom before this pregnancy no. (%) Dysmenorrhea Menorrhagia Treatment 10 (55.6) 35 (30 40) 36 (29 39) 8/2 6 (60.0) 3 (30.0) Control 8 (44.4) 30 (25 32) 39 (37 41) 7/1 3 (37.5) 1 (12.5) Total 18 (100) 33 (25 40) 37 (29 41) 15/3 9 (50) 4 (22.2) Note: Values are mean (minimum maximum). Wang. Pregnancy in women with uterine adenomyoma. Fertil Steril Fertility and Sterility 173

182 TABLE 2 The lesion volume of uterine adenomyoma in the two groups. Groups No. Lesion volume of adenomyoma (cm 3 ) a Treatment ( ) b Control ( ) Total ( ) a The volumes of more than one uterine adenomyoma Summation of each lesion volumes, values are mean (minimum maximum). b P.01 vs. control group. Wang. Pregnancy in women with uterine adenomyoma. Fertil Steril There were no intraoperative and postoperative complications (e.g., postpartum hemorrhage, late postpartum hemorrhage, uterine wound hematoma and infection, and uterus rupture). No therapy-related complications developed. Duration of follow-up was 56 months (range, months). Sixteen patients were recruited in the follow-up program, and 2 patients were lost to follow-up. Three postpartum women in treatment group did not choose any contraceptive method and became pregnant spontaneously, and the other 13 postpartum women in the treatment and control groups chose contraceptive methods and did not achieve pregnancy. DISCUSSION It is difficult to diagnose adenomyosis before surgery, because there are no signs, symptoms, or physical findings (2). The accuracy of ultrasonography for the diagnosis of adenomyosis was 74.1%, and magnetic resonance imaging (MRI) had a diagnostic accuracy of 87.5% (12). Therefore, histopathology should be the gold standard for diagnosis of adenomyosis. Adenomyosis is more common in parous than in nonparous women. Moreover, the incidence age of adenomyosis was later than that of endometriosis, therefore infertility was not evident for adenomyosis. But because more women are delaying intended pregnancies, the frequency of adenomyosis with infertility increases (1). Our study indicated an infertility history frequency of 55.6% in pregnant women with uterine adenomyoma at term, and the possible reason for all women were adenomyoma. Thus, infertility induced by uterine adenomyoma should be considered. Our study demonstrated that the volume of uterine adenomyoma in the treatment group was significantly larger than that of the control group (P.05). Although it is possible that the lesions of uterine adenomyoma changed during the pregnancy, all subjects experienced the same amount of gestational weeks (P.05). Therefore, the finding of uterine adenomyoma at the time of cesarean section could reflect the situation that existed before this pregnancy. Our study showed that the volumes of the uterine adenomyoma were positively associated with infertility women with greater volumes of uterine adenomyoma suffered from infertility more easily. Therefore, these women should see an infertility doctor as soon as possible if they were not using contraception and had not achieved a pregnancy within 1 year. The therapies of GnRH-a or GnRH-a and IVF-embryo transfer are effective in treating adenomyosis patients with infertility (13 16). Severe adenomyosis not only brought on infertility, but also resulted in spontaneous abortion (17). The causes have not been clarified completely. The eutopic endometrium in women with adenomyosis showed higher levels of nitric oxide than that of the control group, and as a result, uterine or endometrial receptivity for embryos was reduced (13, 14). In our study, one patient in the treatment group had a history of spontaneous abortion, and two patients experienced threatened abortion or preterm labor at 16 and 29 gestational weeks. Uterine adenomyoma should not be an indication of cesarean delivery. In our study no patient required cesarean delivery because of the uterine adenomyoma, but during cesarean section, excision of adenomyoma tissue should be performed. In our study there were no intraoperative or postoperative complications. Excision of the adenomyoma tissue during cesarean section can clean or reduce the adenomyoma foci and make a histopathologic diagnosis. If a cesarean delivery had not been done, then the uterine adenomyoma should be treated after pregnancy and delivery. Our follow-up showed that because of the excision of the adenomyoma tissue, three postpartum women in treatment group, who did not choose any contraceptive method, became pregnant spontaneously. It showed that pregnancy rates improved after gestation and resection of adenomyosis. Adenomyosis is a progressive, estrogen (E)-dependent disease and occurs nearly exclusively in menstruating women of reproductive age. There was also ample evidence of adenomyosis demonstrating progesterone (P) effects within the hormonal milieu of pregnancy (18). Histopathology revealed typical ectopic decidua in the adenomyoma in four patients in this study. Gestation could cause atrophy of ectopic endometrium (adenomyosis foci). The conservative surgery (excision of adenomyoma tissue) can clean or reduce the adenomyoma lesion, and reduce uterine volume. Therefore pregnancy and excision of adenomyoma tissue play a role in the treatment of uterine adenomyoma. In conclusion, this study suggests that severe uterine adenomyoma correlate with infertility in women of childbearing age. The treatment with GnRH-a is effective in women with uterine adenomyoma-associated infertility. However, more cases are required to validate it. 174 Wang et al. Pregnancy in women with uterine adenomyoma Vol. 88, No. 1, July 2007

183 REFERENCES 1. Devlieger R, D Hooghe T, Timmerman D. Uterine adenomyosis in the infertility clinic. Hum Reprod Update 2003;19: Matalliotakis IM, Katsikis IK, Panidis DK. Adenomyosis: what is the impact on fertility? Curr Opin Obstet Gynecol 2005;17: Hassan MA, Killick SR. Is previous aberrant reproductive outcome predictive of subsequently reduced fecundity? Hum Reprod 2005;20: Curtis KM, Hillis SD, Marchbanks PA, Peterson HB. Disruption of the endometrial myometrial border during pregnancy as a risk factor for adenomyosis. Am J Obstet Gynecol 2002;187: Wang PH, Yang TS, Lee WL, Chao HT, Chang SP, Yuan CC. Treatment of infertile women with adenomyosis with a conservative microsurgical technique and a gonadotropin-releasing hormone agonist. Fertil Steril 2000;73: Lin JF, Sun CX, Zheng HM. Gonadotropin-releasing hormone agonists and laparoscopy in the treatment of adenomyosis with infertility. Chin Med J 2000;113: Kim MD, Kim NK, Kim HJ, Lee MH. Pregnancy following uterine artery embolization with polyvinyl alcohol particles for patients with uterine fibroid or adenomyosis. Cardiovasc Intervent Radiol 2005;28: Ohara K, Tanaka Y, Tsunoda H, Nishida M, Sugahara S, Itai Y. Assessment of cervical cancer radioresponse by serum squamous cell carcinoma antigen and magnetic resonance imaging. Obstet Gynecol 2002;100: Warner PE, Critchley HO, Lumsden MA, Campbell-Brown M, Douglas A, Murray GD. Menorrhagia II: is the 80-mL blood loss criterion useful in management of complaint of menorrhagia? Am J Obstet Gynecol 2004;190: Feitoza SS, Gebhart JB, Gostout BS, Wilson TO, Cliby WA. Efficacy of thermal balloon ablation in patients with abnormal uterine bleeding. Am J Obstet Gynecol 2003;189: Sulak PJ, Kuehl TJ, Ortiz M, Shull BL. Acceptance of altering the standard 21-day/7-day oral contraceptive regimen to delay menses and reduce hormone withdrawal symptoms. Am J Obstet Gynecol 2002; 186: Bazot M, Cortez A, Darai E, Rouger J, Chopier J, Antoine JM, et al. Ultrasonography compared with magnetic resonance imaging for the diagnosis of adenomyosis: correlation with histopathology. Hum Reprod 2001;16: Wang JH, Zhou FZ, Dong MY, Wu RJ, Qian YL. Prolonged gonadotropinreleasing hormone agonist therapy reduced expression of nitric oxide synthase in the endometria in women with endometriosis and infertility. Fertil Steril 2006;85: Kamada Y, Nakatsuka M, Asagiri K, Noguchi S, Habara T, Takata M, et al. GnRH agonist-suppressed expression of nitric oxide synthases and generation of peroxynitrite in adenomyosis. Hum Reprod 2000;15: Huang FJ, Kung FT, Chang SY, Hsu TY. Effects of short-course buserelin therapy on adenomyosis. A report of two cases. J Reprod Med 1999;44: Silva PD, Perkins HE, Schauberger CW. Live birth after treatment of severe adenomyosis with a gonadotropin-releasing hormone agonist. Fertil Steril 1994;61: Parazzini F, Vercellini P, Panazza S, Chatenoud L, Oldani S, Crosignani PG. Risk factors for adenomyosis. Hum Reprod 1997;12: Azziz R. Adenomyosis in pregnancy. A review. J Reprod Med 1986; 31: Fertility and Sterility 175

184 REPRODUCTIVE BIOLOGY Different degrees of vascularization and their relationship to the expression of vascular endothelial growth factor, placental growth factor, angiopoietins, and their receptors in first-trimester decidual tissues Margreet Plaisier, M.D., a,b Sharon Rodrigues, M.S., b Florian Willems, M.D., c Pieter Koolwijk, Ph.D., a Victor W. M. van Hinsbergh, Ph.D., d and Frans M. Helmerhorst, M.D., Ph.D. b a Department of Biomedical Research, TNO-Quality of Life, Leiden; b Department of Gynecology and Reproductive Medicine, Leiden University Medical Center, Leiden; c Stichting Medisch verantwourdezwangerschaps Onderbreking Plus Clinic, the Hague; and d Department of Physiology, Institute for Cardiovascular Research, VU University Medical Center, Amsterdam, the Netherlands Objective: To evaluate vascular adaptation to implantation by studying vascularization and angiogenic factors in the decidua basalis (DB), decidua parietalis, and decidual secretory endometrium of first-trimester pregnancies. Comparison of these tissues provides information about the regulation of vascularization by pregnancy-induced hormones and/or the extravillous trophoblast (EVT). Design: Prospective study. Setting: Leids University Medical Center (LUMC). Patient(s): Women (n 32) undergoing voluntarily first-trimester termination of pregnancy. Intervention(s): Decidual samples from vacuum-aspiration. Main Outcome Measure(s): Evaluation of vascularization, determined by CD34 immunohistochemistry, and vascular endothelial growth factor-a, placental growth factor (PlGF), vascular endothelial growth factor receptor 1 (Flt-1), vascular endothelial growth factor receptor 2, angiopoietin-1 (Ang-1), angiopoietin-2 (Ang-2), and TIE-2 protein and messenger RNA (mrna) expression, determined by reverse transcriptase-polymerase chain reaction and immunohistochemistry, in serial paraffin sections. Result(s): Pregnancy-induced hormones and EVT influence vascularization by enhancing the vascular and luminal surface, and by reducing vessel density at the implantation site. These changes correlate with differences in gene and protein expression. Placental growth factor mrna and PlGF and Flt-1 protein expressions were elevated in DB under the influence of EVT. In addition, the angiopoietins were differentially expressed, in favor of Ang-2, in DB. Conclusion(s): The EVT and pregnancy-induced hormones might be associated with the regulation of vascularization and the expression of angiogenic factors in decidua. The induction of PlGF and Flt-1, and the Ang-2:Ang-1 ratio in DB, suggest that these factors play a role in regulating angiogenesis at the implantation site. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Decidua, growth factors, implantation, steroid hormones, trophoblast Vascularized, receptive endometrium is essential for implantation and for the success of the embryo-maternal interaction (1). Disturbances in vascular development may play an important role in frequently occurring pathologies during pregnancy, such as early-pregnancy wastage, preeclampsia, and intrauterine growth restriction (1 3). Received May 21, 2006; revised November 15, 2006; accepted November 17, Reprint requests: F.M. Helmerhorst, M.D., Ph.D., Department of Gynecology and Reproductive Medicine, Leiden University Medical Center P.O. Box 9600, 2300 RC Leiden, the Netherlands (FAX: ; E- mail: F.M.Helmerhorst@LUMC.nl). Endometrial adaptation to implantation starts during the menstrual cycle by means of stromal decidualization and the induction of angiogenesis, i.e., the formation of new vessels from the existing vasculature. These processes continue after conception under the influence of estrogen, progesterone, hcg, cytokines, and growth factors derived from the corpus luteum, endometrium, and implanting embryo. Angiogenic changes of the decidua include proliferation, migration, and increased vascular permeability (4, 5). After week 6 of gestation, the arterioles are remodeled from low- 176 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

185 capacitance, high-resistance vessels to high-capacitance, low-resistance vessels, and by week 12, maternal blood flow to the intervillous space is established (6, 7). In general, angiogenesis is a multistep process (8 11). Numerous factors are able to regulate angiogenesis, of which the vascular growth factors, vascular endothelial growth factor-a (VEGF-A) and placental growth factor (PlGF), are probably the most well-known. Vascular endothelial growth factor interacts with vascular endothelial growth factor receptor 1 (VEGFR-1; Flt-1) and vascular endothelial growth factor receptor 2 (VEGFR-2; KDR) to promote endothelial cell proliferation, cell migration, and vascular permeability. In rabbits, VEGF, together with its receptor Flt-1, plays an active role in the angiogenic process during implantation (12). Placental growth factor shares biochemical and functional features with VEGF, and interacts with Flt-1. Placental growth factor and VEGF have synergistic effects in terms of angiogenesis, but vessels induced by PlGF are more mature and stable than vessels induced by VEGF (13, 14). Placental growth factor is abundantly expressed in human placenta, and may be an important paracrine regulator of decidual angiogenesis and an autocrine mediator of trophoblast function (15). A second family of growth factors, the angiopoietins, and their receptor TIE-2 are also known for their regulating capacities regarding angiogenesis. The two ligands bind with equal affinity to TIE-2, but have different functions. Angiopoietin-1 (Ang-1) maintains vessel integrity and plays a role in the later stages of vascular remodeling (16). Transgenic overexpression of Ang-1 in mice results in the development of more complex vascular networks (17). Angiopoietin-2 (Ang-2) is a functional antagonist of Ang-1, and leads to loosening of cell/cell interactions and allows access to angiogenic inducers such as VEGF (18). Coexpression of VEGF and Ang-2 induces angiogenesis, but Ang-2 results in vascular regression in the absence of angiogenic signals (19). Angiopoietin-1 is widely expressed in the adult, whereas Ang-2 is selectively expressed at sites of active angiogenesis, such as the ovary, uterus, and placenta (18, 20). Vascular adaptation to implantation and its regulation were studied thoroughly with regard to arterial remodeling and placental vascularization (21, 22). However, it is unknown how maternal decidual vascularization is regulated, and whether regulatory signals originate from the extravillous trophoblast and/or from pregnancy-induced hormones. Therefore, the present study was performed in three first-trimester decidual tissues: decidual secretory endometrium (DSE), decidua basalis (DB), and decidua parietalis (DP). By comparing these decidual tissues within subjects, the changes that occur independently of trophoblast invasion, i.e., pregnancy-induced hormones, can be separated from the FIGURE 1 Schematic representation of influences of EVT and pregnancy-induced hormones on decidual tissues of first-trimester pregnancies. Plasier. Vascularization in human first-trimester decidua. Fertil Steril influence of the invasive extravillous trophoblast (EVT, Fig. 1). The vascularization pattern and expressions of VEGF-A, PlGF, Flt-1, KDR, Ang-1, Ang-2, and TIE-2 were determined in these three decidual tissues. In this way, decidual vascular adaptation to embryonic implantation can be studied in detail. MATERIALS AND METHODS Materials Lysis buffer (20 mm Tris, ph 7.4, 1 mm EDTA, ph 8.0, and 2% SDS), 20 mg/ml proteinase K (Life Technologies, GIBCO BRL, Gaithersburg MD), and solution D (4 M guanidium isothiocyanate, 0.75 M sodium citrate, 10% sarkosyl, and 2-mercapto-ethanol) were used for RNA isolation. Complementary DNA (cdna) synthesis was performed using Ready-to-Go You-Prime first-strand beads (Amersham Biosiences, Buckinghamshire, United Kingdom). Primer and probe (6-carboxyfluorescein [FAM]/tetramethly-6-carboxyrhodamine [TAMRA] double-labeled) sets for VEGF-A, VEGFR-1 (Flt-1), VEGFR-2 (KDR), PlGF, Ang-1, Ang-2, TIE-2, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (VIC -labeled) were purchased from Applied Biosystems (Foster City, CA). The following first antibodies were used: broad-spectrum polyclonal rabbit anti-cytokeratin (1:2,000, Z0622; DAKO, Glostrup, Denmark), monoclonal mouse anti-cd34 (1:1,000, QBend/10; Novocastra, Newcastle upon Tyne, United Kingdom), polyclonal rabbit anti-vegf-a (1:100, sc-152; Santa Cruz Biotechnology, Santa Cruz, CA), polyclonal rabbit anti-vegfr-1 (Flt-1, 1:50, sc-316; Santa Cruz Biotechnology), monoclonal anti-vegfr-2 (KDR, 1:50, sc-6251; Santa Cruz Biotechnology), polyclonal goat anti-plgf (1:200, sc-1880, Santa Cruz Biotechnology), polyclonal goat anti-angiopoietin-1 (1:50, sc-6319; Santa Cruz Biotechnology), polyclonal goat anti-angiopoietin-2 (1:50, sc-7016; Santa Cruz Biotechnology), and polyclonal rabbit anti-tie-2 (1:100, sc-9026; Santa Cruz Biotechnology). The following second antibodies were used: biotinylated horse anti-mouse antibody (1:300, BA-2000; Vector, Bur- Fertility and Sterility 177

186 lingame, CA), biotinylated donkey anti-rabbit antibody (1: 300, RPN1004; Amersham Biosciences, Buckinghamshire, United Kingdom), and biotinylated rabbit anti-goat (1:300, E-0466; DakoCytomation, Glostrup, Denmark). Immunohistochemical reactions were visualized with the use of the avidin-biotin complex (DakoCytomation) and NovaRED (Vector). Study Group Decidua samples were obtained from women (n 32) with healthy, viable intrauterine gravidity, who were undergoing vacuum aspiration because of a legal, voluntary abortion. The study was approved by the Institutional Review Board and the Ethics Committee of the Leiden University Medical Center (Leiden, the Netherlands), and informed consent was provided by all study subjects. Fetal cardiac activity and gestational age were confirmed by ultrasound. Women with symptoms of a missed abortion, such as vaginal bleeding, and women with underlying pathologies were excluded. Inconsistency between the ultrasound-determined gestational age and the known last day of menstruation also led to exclusion. Two groups were formed based on gestational age (GA). We created two distinct groups with mean GA 8 9 weeks and 8 9 weeks. This cutoff of GA 8 9 weeks was chosen because evidence exists that this period is associated with changes in placental vascularization (7). After 8 9 weeks of GA, the intervillous space is gradually filled with maternal blood, causing the oxygen level and oxidative stress to rise, thereby stimulating placental differentiation and vascularization. This process is thought to be largely completed at 12 weeks of gestation. This cutoff was the basis for the early group (n 25) with a mean GA of 45.3 days (6 weeks and 3 days), and the late group (n 8) with a mean GA of 90.1 days (12 weeks and 6 TABLE 1 Characteristics of study subjects. Characteristic Group 1 a (n 25), mean SD Group 2 b (n 8), mean SD Maternal age (y) Gestational age (d) Gestational age (wk) Number of pregnancies Number of miscarriages a Early first-trimester group with GA 8 9 weeks. b Late first-trimester group with GA 8 9 weeks. Plasier. Vascularization in human first-trimester decidua. Fertil Steril days). Maternal age and number of previous pregnancies and miscarriages did not differ significantly between the two groups. Characteristics of the patients in the study groups are given in Table 1. Tissue Samples Decidua samples were obtained from aspirated tissue, fixed in formaldehyde, and embedded in paraffin. Hematoxylin phloxin safrane (HPS) staining was used to differentiate between decidua and DSE, which microscopically resembles secretory endometrium during the menstrual cycle. The DSE was obtained from the curettement, and thus originates from the same depth and area of the uterine wall as the DP and DB. The DB and DP were differentiated by the presence or absence of extravillous trophoblasts with the use of anticytokeratin staining (Fig. 2). Only subjects with a complete set of DSE, DB, and DP were included. Serial sections of the paraffin-embedded tissue samples were used for all experiments, and all outcome measures were compared between tissues within subjects. RNA isolation and cdna synthesis The RNA was extracted from paraffin-embedded tissue samples, based on methods described by Specht et al. (23). In short, 5- m sections were mounted on RNase-free glass slides. The first and last sections were used to verify the presence of tissues of interest. The other sections were deparaffinized, and the tissues of interest, i.e., DSE, DP, and DB (without villous tissue), were macrodissected and dissolved in 190 L lysis buffer and 10 L proteinase K for 18 hours at 60 C. Subsequently, 400 l of solution D were added, and RNA was isolated according to the method of Chomzynski and Sacchi (24). The quantity and quality of RNA were determined by measuring its absorbance in a spectrophotometer (Nanodrop ND-1000; Nanodrop Technologies, Inc., Wilmington, DE), and reverse transcription was performed with 1 g total RNA, random primers, and a cdna synthesis kit. Real-Time Reverse-Transcriptase Polymerase Chain Reaction The expression of messenger RNA (mrna) was quantified according to the Taqman real-time polymerase chain reaction (PCR) method with the use of validated primer and probe (FAM/TAMRA double-labeled) sets for VEGF-A, VEGFR-1 (Flt-1), VEGFR-2 (KDR), PlGF, Ang-1, Ang-2, and TIE-2. Glycerlylaldehyde-3-phosphate dehydrogenase (GAPDH; primers/vic -labeled probe) was used as an endogenous reference gene. Other genes, i.e., -actin, 2-microglobulin, and cyclophilin, were also used as reference genes and showed comparable results (data not shown). 178 Plaisier et al. Vascularization in human first-trimester decidua Vol. 88, No. 1, July 2007

187 Fertility and Sterility FIGURE 2 Cytokeratin expression and vascularization in the three decidual tissues. Differentiation between three decidual tissues was obtained by HPS and anticytokeratin staining (top). Decidual secretory endometrium and DP expressed cytokeratin only in glandular epithelial cells (solid arrows), whereas cytokeratin was also expressed in EVTs of DB (open arrows). The vascularization pattern in human decidual tissues was determined by image analysis of anti-cd34-stained sections (middle and bottom). The CD34 antigen expression in ECs (arrows) of DSE, DP, and DB was compared within subjects. Data were analyzed using repeated-measures ANOVA. Number of vessels per mm 2 (A), vascular surface per area (mm 2 /mm 2 )(B), and luminal surface ( m 2 /vessel) (C) were calculated and expressed as mean SEM. *P.001, P.05. Bar 100 m. 179 Plasier. Vascularization in human first-trimester decidua. Fertil Steril 2007.

188 Reverse transcriptase-pcr (RT-PCR) reactions for target gene and GAPDH pairs were performed in duplicate, expressed in cycle times, and quantified into ng/ L with the use of a standard curve of total RNA. The amount of RNA expression of DSE was set at 100% to compare DSE with DP and DB, and the gene expression of DP was set at 100% to compare DP with DB. Water and negative-rt samples, obtained by the omission of the RT enzyme in the cdna reaction, were used as negative controls. Immunohistochemistry Serial sections were deparaffinized, endogenous peroxidase was quenched with 3% H2O2/methanol, and aspecific binding was reduced by incubation with 5% bovine serum albumin. Antigen retrieval in trypsin was used for the detection of TIE-2, whereas detection of cytokeratin, Ang-2, and Ki67 required boiling in 0.1 M citrate buffer. Primary antibodies were applied overnight at 4 C, followed by incubation with a biotinylated secondary antibody. Antibody binding was visualized with the use of avidin-biotin and streptavidinhorseradish peroxidase conjugates. Sections were counterstained with Mayer s hematoxylin. The specificity of the immunohistochemical reaction was verified by the omission of the first antibody as well as by using normal mouse, goat, or rabbit serum as first antibody. To evaluate the expression in extravillous trophoblast, cytokeratin and target protein staining were performed on serial sections of 3 m. Evaluation of Vascularization Pattern The CD34-stained endometrial sections were used to scan sequential fields. Two to four samples of each type of tissue were analyzed for each study subject, and six fields per sample were scanned at 100 magnification. The number of vessels per mm 2, vascular surface per mm 2 (mm 2 /mm 2 ), and luminal surface ( m 2 /vessel) were determined with the use of image-analysis software (Qwin; Leica Microsystems, Wetzlar, Germany). Evaluation of Immunohistochemical Staining Immunostaining was evaluated by calculating a staining index (SI), i.e., the proportion of stained cells staining intensity. The proportion of stained cells was expressed as 0, 1, 2, or 3, which marks a positive staining signal in 0%, 10%, 10% 50%, or 50%, respectively, of the cells of a particular cell population. The intensity of staining was expressed as 1, 2, or 3 (weak, moderate, or strong staining, respectively). The minimum score was 0, and the maximum score was 9 (25). The average score of two independent observers was used to calculate the mean and total SI. The mean SI represents the protein expression per studied cell type. The total SI represents the total protein expression per tissue, and was calculated as the sum of the mean SI of endothelial cells (ECs), perivascular smooth muscle cells (PSMCs), glandular epithelium (GE), and stromal cells (SCs) in DSE and DP samples. The mean SI of EVT was also included in the total SI of DB samples. Statistical Analysis All parameters were compared between DSE and DP, between DSE and DB, and between DP and DB within subjects. A general linear model for repeated measurements, i.e., repeated-measures analysis of variance (ANOVA), was performed to analyze the double paired data within subjects of early first-trimester decidua, and to compare data between the early and late first-trimester group (SPSS 11.5, SPSS Inc., Chicago, IL). Where appropriate, we used Friedman s test for nonparametric investigations of correlated observations. P.05 was considered significant. RESULTS Vascularization in Early First-Trimester Decidua Intense CD34 staining was observed in all vessels of the three decidual tissues, with no difference in intensity of staining between the tissues. Vessel density was significantly elevated in DSE (116.4 vessels/mm 2 ) compared to DP (41.7 vessels/mm 2, P.001) and DB (31.8 vessels/mm 2, P.0001). Vessel density in DP and DB also differed significantly (P.03, Fig 2A). Because the concentration of SCs differed between tissues (434 cells/mm 2 in DSE, and 208 cells/mm 2 in DB and DP, P.05), vessel density was corrected for the SC count. The corrected vessel density showed a similar pattern. Density was elevated in DSE (0.28 vessels/scs) compared to DP and DB, and elevated in DP (0.20 vessels/scs) compared to DB (0.15 vessels/scs). The vascular surface was significantly smaller in DSE ( mm 2 /mm 2 ) compared to DP ( mm 2 /mm 2 ) and DB ( mm 2 /mm 2, all P.0001, Fig. 2B). The vascular surface in DP differed significantly from that in DB (P.04). The DSE showed a significantly smaller luminal surface compared to DP (208 versus 1,474 m 2 /vessel, P.0001) and DB (3,465 m 2 /vessel, P.001). This parameter was also significantly smaller in DP compared to DB (P.05, Fig 2C). Thus, pregnancy-induced hormones and extravillous trophoblasts correlate with vascularization, because larger but fewer vessels were present in DP compared to DSE, and in DB compared to DP (Figs. 1 and 2). Gene Expression of Angiogenic Factors in Early First-Trimester Decidua The expression of several angiogenic growth factors and their receptors was evaluated at the RNA level (Table 2). All tested genes were expressed by the three decidual tissues. First, the mrna expressions of the angiogenic factors in DSE were compared with those in DP. Only TIE-2 was 180 Plaisier et al. Vascularization in human first-trimester decidua Vol. 88, No. 1, July 2007

189 TABLE 2 Differential gene expression in early first-trimester decidua. Angiogenic factor DSE a DP DSE a DB DP b DB PlGF 100% 82% 21% 100% 1,286% 302% d 100% 3,000% 237% e VEGF-A 100% 85% 12% 100% 96% 14% 100% 134% 36% KDR 100% 105% 16% 100% 74% 15% 100% 76% 14% Flt-1 100% 105% 14% 100% 130% 24% 100% 131% 23% Ang-1 100% 92% 17% 100% 39% 11% d 100% 55% 15% e Ang-2 100% 115% 29% 100% 34% 8% d 100% 36% 6% e TIE-2 100% 51% 11% c 100% 21% 5% d 100% 43% 7% e Note: Gene expression was determined by RT-PCR in DSE, DP, and DB of early first trimester (n 25), and compared within subjects. Repeated-measures ANOVA was performed to analyze the data. a The gene expression of DSE was set at 100% to compare mrna levels in DSE with those in DP and DB. b The gene expression of DP was set at 100% to compare DP with DB. c P.02, DP compared to DSE. d P.02, DB compared to DSE. e P.01, DB compared to DP. Plasier. Vascularization in human first-trimester decidua. Fertil Steril differentially expressed, reflected by a 49% reduction in DP compared to DSE (P.02). The other genes (VEGF-A, PlGF, Flt-1, KDR, Ang-1, and Ang-2) showed comparable levels of mrna in DP and DSE (Table 2). Subsequently, the mrna levels in DSE were compared to those in DB. This comparison showed a 1,286% induction of PlGF, a 61% reduction of Ang-1, a 66% reduction of Ang-2, and a 79% reduction of TIE-2 in DB compared to DSE (Table 2, P.02). The expressions of VEGF, Flt-1, and KDR did not differ significantly. Finally, mrna expressions in DB were compared to those in DP to evaluate the influence of EVT. This comparison demonstrated a similar pattern as in the comparison of DSE to DB, i.e., increased expression of PlGF (3,000%) and reduced expressions of Ang-1 (45%), Ang-2 (64%), and TIE-2 (57%) in DB compared to DP (Table 2, all P.01). The Expression of Angiogenic Factors at the Protein Level of Early First-Trimester Decidua The distribution of angiogenic factors was determined at the protein level in serial sections of DSE, DP, and DB. The studied proteins were detectable in all decidual tissues (Table 3). The protein expressions in DSE were compared to those in DP, which only showed a higher total SI for Flt-1 in DP (Table 3, P.05). In addition, when DSE and DB were compared, higher endothelial and total expressions of both PlGF and its receptor Flt-1 were demonstrated in DB. The total Ang-1 expression was lower in DB (Table 3, P.05). Also, DB was compared to DP, and this showed a similar pattern as in the comparison of DSE and DB, i.e, higher total and endothelial expressions of PlGF and Flt-1 in DB (Table 3, Fig. 3A,C,E, P.05). Moreover, the total Ang-1 expression was less abundant in DB (P.01), which resulted in a higher Ang-2:Ang-1 ratio in DB than in the other tissues (2.6 in DB versus 1.4 in DP and 1.2 in DSE, P.01). The expressions of VEGF-A, KDR, Ang-2, and TIE-2 proteins were comparable in the three tissues. Endothelium showed expression of all angiogenic factors, except for Ang-1 (Fig. 3A,F). Vascular endothelial growth factor-a was hardly detectable in endothelium (Fig. 3A,B). Angiopoietin-2 and KDR were mainly expressed by GE and PSMCs, but also by ECs (Fig. 3A,D,G). Moreover, TIE-2 showed the highest expression in endothelium (Table 3, Fig. 3A,H). All angiogenic factors, except for Ang-1, were also detected in EVTs. Placental growth factor, VEGF, Flt-1, and TIE-2 were moderately expressed, whereas expressions of KDR and Ang-2 were weak (Table 3, Fig. 4). Vascularization and Expression of Angiogenic Factors in Late First-Trimester Decidua The vascularization parameters in late first-trimester decidua showed similarities with vascularization in the early first trimester. The vascular and luminal surfaces were larger, and vessel density was smaller, in DP and DB compared to DSE, and in DB compared to DP (all P.05, Fig. 5A C). Comparison of vascularization patterns at both time points showed that the vessel density was lower in DB and DP of the late first trimester (17.8 versus 31.8 vessels/mm 2 in DB, and 29.2 versus 41.7 vessels/mm 2 in DP, P.05). The luminal surface was larger, although not significantly, in DB and DP of the late first trimester, i.e., 5,447 versus 3,465 Fertility and Sterility 181

190 TABLE 3 Protein expression of angiogenic factors in early first-trimester decidua. Angiogenic factor ECs PSMCs GE SCs EVTs Total SIs VEGF DSE NP 10.6 DP NP 13.1 DB PlGF DSE NP 11.4 DP NP 10.3 DB 0.9 a a KDR DSE NP 13.1 DP NP 11.0 DB Flt-1 DSE NP 10.6 b DP NP 12.6 DB 1.2 a a Ang-1 DSE NP 6.1 DP NP 6.6 DB a Ang-2 DSE NP 7.5 DP NP 9.6 DB TIE-2 DSE NP 13.2 DP NP 15.0 DB Note: Protein expression of angiogenic factors in DSE, DP, and DB was compared within subjects. Friedman s test, a nonparametric test for paired samples, and the Wilcoxon test were used for statistical analysis. NP not present. Staining was expressed as mean SIs per cell type and as total SIs, i.e., the sum of the mean SIs of ECs, PSMCs, GE, stromal cells, and EVTs per decidual tissue. a P.05, DB versus DP and DSE. b P.05, DSE versus DP. Plasier. Vascularization in human first-trimester decidua. Fertil Steril m 2 /vessel in DB, and 1,829 versus 1,474 m 2 /vessel in DP (Fig. 5B). The vascular surface was similar in decidua at the two time points (Fig. 5C). Gene expressions in the early and late first trimester were compared. Vascular endothelial growth factor-a and Ang-2 mrna were both induced in late first-trimester DB and DP as compared to the early first trimester. The induction was 347% (P.08) in DB and 288% (P.01) in DP for VEGF-A, and 257% (P.01) in DB and 171% (P.01) in DP for Ang-2. Genes in DSE showed no differential expression over time. At the protein level, total VEGF, Ang-1, and Ang-2 protein expressions were elevated in DB of the late first trimester compared to the early first trimester (165%, 288%, and 174%, respectively, P.002). Interestingly, VEGF and PlGF proteins were detected in higher amounts in the endothelium of late first-trimester decidua than in the early first trimester (Fig. 5D,E, P.05). Endothelial Flt-1, KDR, Ang-2, and TIE-2 expressions were comparable in the early and late first trimester. DISCUSSION The present study showed differences in patterns of vascularization between DSE, DB, and DP. These vascular changes correlated with differences in gene expression. Furthermore, the analysis of vascularization in early and late first-trimester decidua suggests that decidual vascularization is remodeled 182 Plaisier et al. Vascularization in human first-trimester decidua Vol. 88, No. 1, July 2007

191 FIGURE 3 Protein expression of angiogenic factors in endothelium of early first-trimester decidua. The protein expression of angiogenic factors was determined in DSE, DP, and DB. Friedman s test, a nonparametric test for paired samples, and the Wilcoxon test were used for statistical analysis. (A) Protein expression of each angiogenic factor in endothelium was expressed as the mean staining index SEM. (B H) Examples of these expressions. (B) Endothelial VEGF expression was not detectable in DB. (C) Placental growth factor was expressed in epithelium (open arrow) and endothelium (solid arrow) of DB. (D) Endothelial KDR expression (solid arrow) and stromal KDR expression (open arrow) in DB. (E) Endothelial Flt-1 expression in DB (arrow). (F) Angiopoitein-1 in DB was detected in epithelium (open arrow), but not in SCs and ECs (solid arrow). (G) Endothelial Ang-2 expression in DB (arrow). (H) Endothelial TIE-2 expression in DB (arrow). Bar 100 m (except F, 50 m); *en, P.05. Plasier. Vascularization in human first-trimester decidua. Fertil Steril as gestation progresses, to accommodate the increasing needs of the implanting embryo. Maternal vascular adaptation to implantation and its regulation have been discussed, but were only studied thoroughly with regard to arterial remodeling and villous vascularization (21, 22). The present study focused on decidual vascular adaptation to implantation and its regulation. The comparison of three decidual tissues (DSE, DB, and DP) within subjects provided the opportunity to separate the influence of the EVT from the changes that occur independent of trophoblast invasion (Fig. 1). Furthermore, all methods were performed on serial paraffin sections, which allowed the study of vascularization, RNA, and protein expression in the same tissue. Changes in vascularization pattern, i.e., the increase of vascular and luminal surfaces and the decrease of vessel density, were detected between the three decidual tissues DSE, DP, and DB. The enlargement of the vascular surface per area in DB and DP was reported previously, and likely is functionally related to the increased blood flow during pregnancy (22, 26). The increase in luminal diameter may represent an additional modulatory effect, although the possibility that this was because of vasodilatation cannot be excluded. Increased luminal diameter in DP and DB could Fertility and Sterility 183

192 FIGURE 4 Protein expression of angiogenic factors in EVTs of early first-trimester decidua. The protein expression of angiogenic factors in EVTs in DB was studied in serial sections stained against cytokeratin and the target protein. (A) Protein expression in EVT was expressed as mean SI SEM. (B) Cytokeratin (arrows) in EVT. (C) Serial PlGF expression (arrows) in EVT. Bar 50 m. Plasier. Vascularization in human first-trimester decidua. Fertil Steril also be induced by relatively low oxygen levels, but whether oxygen levels in DP, DB, and DSE differ is not known (27). The vessel density in DSE (116 vessels/mm 2 ) is lower than the vessel density reported in cycling secretory endometrium, i.e., 186 vessels/mm 2 as reported by Rogers et al. (28), and 195 vessels/mm 2 as reported by Plaisier et al. (29). Perhaps vascularization in DSE is already affected by hormones, although the decidual morphology is not yet present. The decreased vessel density in DP and DB compared to DSE and DB compared to DP suggests a fusion or degeneration of vascular structures. Vailhe et al. reported a nonsignificant decreased vessel density in DB compared to DP, but did not study DSE (2). The vessel density reported in their study, ranging between vessels/mm 2, is comparable to that in our findings. Overall, the vascular differences between decidual tissues might indicate a regulatory role in decidual vascularization for both pregnancy-induced hormones and the EVT. Both steroidal hormones and EVT are able to modulate vascularization directly or indirectly via angiogenic factors such as VEGF-A, PlGF, angiopoietins, and hcg (30 39). Therefore, we studied whether changes in vascularization in decidual tissues correlated with a differential expression of angiogenic factors. First, gene and protein expressions in DSE and DP were compared to evaluate changes occurring independently of trophoblast invasion. Although TIE-2 mrna was the only differentially expressed mrna, its protein expression was not significantly different between DSE and DP. This suggests that TIE-2 protein expression is not influenced by pregnancy-induced hormones, which is in agreement with the finding that TIE-2 protein expression is not regulated during the menstrual cycle (40). The presence of endothelial TIE-2 in all decidual tissues suggests that TIE-2 plays a rather general role in decidual vascularization. The differential expression of the studied angiogenic factors did not provide a satisfactory explanation for the vascular differences between DSE and DP. Perhaps steroidal hormones act through other angiogenic factors or exert direct effects on decidual endothelium. Subsequently, the expressions of angiogenic factors in DB were compared to those in DSE and DP. The mrna expressions of Ang-1, Ang-2, and TIE-2 were significantly lower in 184 Plaisier et al. Vascularization in human first-trimester decidua Vol. 88, No. 1, July 2007

193 FIGURE 5 Vascularization pattern and endothelial protein expression in early versus late first-trimester decidua. The vascularization pattern in human early and late first-trimester decidual tissues was determined by image analysis of anti-cd34-stained sections. Data were analyzed by means of repeated-measures ANOVA. Number of vessels per mm 2 (A), vascular surface per area (mm 2 /mm 2 )(B), and luminal surface ( m 2 /vessel) (C) were expressed as mean SEM. Expression of VEGF was not detectable in early first-trimester endothelium of DB (arrow, D), whereas expression was present in late first-trimester endothelium of DB (arrow, E). *P.04. Bar 50 m. Plasier. Vascularization in human first-trimester decidua. Fertil Steril DB compared to both DSE and DP, and therefore appear to be regulated by the EVT. The decreased TIE-2 expression might result from the decreased levels of Ang-1 and/or Ang-2, because mice lacking Ang-1 have reduced levels of TIE-2 mrna (41). At the protein level, the Ang-2:Ang-1 ratio was significantly elevated in DB compared to DP and DSE, suggesting that vessel destabilization is favored over vessel maturation in DB. The high amount of Ang-2, together with the abundant VEGF expression, may lead to more angiogenesis in DB, which is in concordance with the increased vascular surface in DB (19). Interestingly, all three decidual tissues showed Ang-2: Ang-1 ratios in favor of Ang-2. Embryonic implantation normally occurs under hypoxic conditions, and oxygen levels in decidua are relatively low in the first trimester, ranging between mmhg (42). Hypoxia enhances Ang-2 transcription and destabilizes Ang-1, which may result in the increased Ang-2:Ang-1 ratio (43). Although implantation appears to favor Ang-2, a small amount of Ang-1 must be essential for implantation, because disruption of the Ang-1 gene in mice results in embryonic lethality (41). Another striking observation was the abundant induction of PlGF mrna and proteins in DB compared to DSE and DP. The increased PlGF protein expression was not only due to PlGF production by EVT, because all studied cell types, except PSMCs, showed increased PlGF protein expression in DB. Furthermore, uterine natural-killer cells are known for their PlGF production, and probably contribute to the production of angiogenic factors in decidua as well. Interestingly, PlGF and its receptor, Flt-1, were mainly expressed in the endothelium of DB. Placental growth factor, together with Flt-1, is able to potently induce angiogenesis, resulting in mature and stable vessels (13, 14, 44 46). The induction of PlGF and Flt-1 mrnas and proteins in the DB suggests that both factors play a specific role in regulating angiogenesis at the site of implantation, and this may at least partly account for the vascular changes noted in the DB. The mrnas and proteins of VEGF were abundantly, but not differentially, expressed in all decidual tissues, and KDR, Flt-1, and VEGF proteins were expressed in the endothelium in DB and DP. These findings suggest a general role for VEGF in angiogenesis in human decidual tissues. As gestation progresses, vascular adaptation continues, which manifested itself in the present study by decreased vessel density in DB and DP. The mrna of VEGF and Fertility and Sterility 185

194 Ang-2, and the expressions of VEGF, Ang-1, and Ang-2 proteins, were increased in late first-trimester DB. These increased levels of angiogenic factors suggest increased angiogenic activity at the implantation site as gestation progresses. This was further supported by the increased endothelial expression of PlGF and VEGF proteins in late first-trimester decidua. Together, the decreased vessel density and increased angiogenic activity might be associated with vessel maturity and the quality rather than quantity of vessels. The vascular adaptation to implantation is clearly important in the development of a healthy pregnancy. We showed that vascular adaptation occurs, possibly under the influence of both pregnancy-induced hormones and the EVT, by enhancing the vascular surface, reducing vessel density, and regulating the expression of angiogenic factors. Vascular endothelial growth factor-a, via KDR, probably plays a general role in supporting decidual vascularization, whereas the angiopoietins, via TIE-2, and PlGF, via Flt-1, appear to be key regulators of the vascular adaptive process, and may partly account for the vascular changes at the site of embryonic implantation in the DB. Angiogenesis is strictly regulated during pregnancy, and the success of pregnancy appears to depend partly on delicately balanced vascularization. It is hoped that studying vascularization during mammalian implantation will lead to new understandings of currently inexplicable events associated with pregnancy, such as preeclampsia and missed abortions. REFERENCES 1. Zygmunt M, Herr F, Munstedt K, Lang U, Liang OD. Angiogenesis and vasculogenesis in pregnancy. Eur J Obstet Gynecol Reprod Biol 2003; 110(Suppl):S Vailhe B, Dietl J, Kapp M, Toth B, Arck P. Increased blood vessel density in decidua parietalis is associated with spontaneous human first trimester abortion. Hum Reprod 1999;14: Vuorela P, Carpen O, Tulppala M, Halmesmaki E. VEGF, its receptors and the tie receptors in recurrent miscarriage. Mol Hum Reprod 2000; 6: Goodger AM, Rogers PA. Uterine endothelial cell proliferation before and after embryo implantation in rats. J Reprod Fertil 1993;99: O Shea JD, Kleinfeld RG, Morrow HA. Ultrastructure of decidualization in the pseudopregnant rat. Am J Anat 1983;166: Pijnenborg R, Bland JM, Robertson WB, Brosens I. Uteroplacental arterial changes related to interstitial trophoblast migration in early human pregnancy. Placenta 1983;4: Burton GJ, Jauniaux E, Watson AL. Maternal arterial connections to the placental intervillous space during the first trimester of human pregnancy: the Boyd Collection revisited. Am J Obstet Gynecol 1999;181: Carmeliet P. Angiogenesis in health and disease. Nat Med 2003;9: Ferrara N. Vascular endothelial growth factor and the regulation of angiogenesis. Recent Prog Horm Res 2000;55: Plaisier M, Kapiteijn K, Koolwijk P, Fijten C, Hanemaaijer R, Grimbergen JM, et al. Involvement of membrane-type matrix metalloproteinases (MT-MMPs) in capillary tube formation by human endometrial microvascular endothelial cells: role of MT3-MMP. J Clin Endocrinol Metab 2004;89: Smith SK. Angiogenesis and implantation. Hum Reprod 2000;15(Suppl 6): Das SK, Chakraborty I, Wang J, Dey SK, Hoffman LH. Expression of vascular endothelial growth factor (VEGF) and VEGF-receptor messenger ribonucleic acids in the peri-implantation rabbit uterus. Biol Reprod 1997;56: Carmeliet P, Moons L, Luttun A, Vincenti V, Compernolle V, De Mol M, et al. Synergism between vascular endothelial growth factor and placental growth factor contributes to angiogenesis and plasma extravasation in pathological conditions. Nat Med 2001;7: Luttun A, Tjwa M, Moons L, Wu Y, Angelillo-Scherrer A, Liao F, et al. Revascularization of ischemic tissues by PlGF treatment, and inhibition of tumor angiogenesis, arthritis and atherosclerosis by anti-flt1. Nat Med 2002;8: Sherer DM, Abulafia O. Angiogenesis during implantation, and placental and early embryonic development. Placenta 2001;22: Geva E, Jaffe RB. Role of angiopoietins in reproductive tract angiogenesis. Obstet Gynecol Surv 2000;55: Suri C, Mcclain J, Thurston G, Mcdonald DM, Zhou H, Oldmixon EH, et al. Increased vascularization in mice overexpressing angiopoietin-1. Science 1998;282: Maisonpierre PC, Suri C, Jones PF, Bartunkova S, Wiegand SJ, Radziejewski C, et al. Angiopoietin-2, a natural antagonist for TIE2 that disrupts in vivo angiogenesis. Science 1997;277: Asahara T, Chen D, Takahashi T, Fujikawa K, Kearney M, Magner M, et al. TIE2 receptor ligands, angiopoietin-1 and angiopoietin-2, modulate VEGF-induced postnatal neovascularization. Circ Res 1998;83: Davis S, Aldrich TH, Jones PF, Acheson A, Compton DL, Jain V, et al. Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretiontrap expression cloning. Cell 1996;87: Craven CM, Morgan T, Ward K. Decidual spiral artery remodelling begins before cellular interaction with cytotrophoblasts. Placenta 1998; 19: Kam EP, Gardner L, Loke YW, King A. The role of trophoblast in the physiological change in decidual spiral arteries. Hum Reprod 1999;14: Specht K, Richter T, Muller U, Walch A, Werner M, Hofler H. Quantitativegeneexpressionanalysisinmicrodissectedarchivalformalinfixed and paraffin-embedded tumor tissue. Am J Pathol 2001;158: Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162: Nap AW, Dunselman GA, De Goeij AF, Evers JL, Groothuis PG. Inhibiting MMP activity prevents the development of endometriosis in the chicken chorioallantoic membrane model. Hum Reprod 2004;19: Gibbons GH, Dzau VJ. The emerging concept of vascular remodeling. N Engl J Med 1994;330: Charnock-Jones DS. Soluble Flt-1 and the angiopoietins in the development and regulation of placental vasculature. J Anat 2002;200: Rogers PA, Au CL, Affandi B. Endometrial microvascular density during the normal menstrual cycle and following exposure to long-term levonorgestrel. Hum Reprod 1993;8: Plaisier M, Koolwijk P, Hanemaaijer R, Verwey A, Weiden RM, Risse KJ, et al. Membrane-type matrix metalloproteinases and vascularization in human endometrium during the menstrual cycle. Mol Hum Reprod 2006;12: Hyder SM, Stancel GM. Regulation of angiogenic growth factors in the female reproductive tract by estrogens and progestins. Mol Endocrinol 1999;13: Licht P, Von Wolff M, Berkholz A, Wildt L. Evidence for cycledependent expression of full-length human chorionic gonadotropin/ luteinizing hormone receptor mrna in human endometrium and decidua. Fertil Steril 2003;79(Suppl 1): Plaisier et al. Vascularization in human first-trimester decidua Vol. 88, No. 1, July 2007

195 32. Toth P, Li X, Rao CV, Lincoln SR, Sanfilippo JS, Spinnato JA, et al. Expression of functional human chorionic gonadotropin/human luteinizing hormone receptor gene in human uterine arteries. J Clin Endocrinol Metab 1994;79: Wulff C, Wilson H, Largue P, Duncan WC, Armstrong DG, Fraser HM. Angiogenesis in the human corpus luteum: localization and changes in angiopoietins, TIE-2, and vascular endothelial growth factor messenger ribonucleic acid. J Clin Endocrinol Metab 2000;85: Toth P, Lukacs H, Gimes G, Sebestyen A, Pasztor N, Paulin F, et al. Clinical importance of vascular LH/hCG receptors a review. Reprod Biol 2001;1: Zygmunt M, Herr F, Keller-Schoenwetter S, Kunzi-Rapp K, Munstedt K, Rao CV, et al. Characterization of human chorionic gonadotropin as a novel angiogenic factor. J Clin Endocrinol Metab 2002;87: Krikun G, Sakkas D, Schatz F, Buchwalder L, Hylton D, Tang C, et al. Endometrial angiopoietin expression and modulation by thrombin and steroid hormones: a mechanism for abnormal angiogenesis following long-term progestin-only contraception. Am J Pathol 2004;164: Greb RR, Heikinheimo O, Williams RF, Hodgen GD, Goodman AL. Vascular endothelial growth factor in primate endometrium is regulated by oestrogen-receptor and progesterone-receptor ligands in vivo. Hum Reprod 1997;12: Hyder SM, Stancel GM. Regulation of VEGF in the reproductive tract by sex-steroid hormones. Histol Histopathol 2000;15: Simoncini T, Mannella P, Fornari L, Caruso A, Varone G, Genazzani AR. In vitro effects of progesterone and progestins on vascular cells. Steroids 2003;68: Krikun G, Schatz F, Finlay T, Kadner S, Mesia A, Gerrets R, et al. Expression of angiopoietin-2 by human endometrial endothelial cells: regulation by hypoxia and inflammation. Biochem Biophys Res Commun 2000;275: Suri C, Jones PF, Patan S, Bartunkova S, Maisonpierre PC, Davis S, et al. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 1996;87: Jauniaux E, Watson AL, Hempstock J, Bao YP, Skepper JN, Burton GJ. Onset of maternal arterial blood flow and placental oxidative stress. A possible factor in human early pregnancy failure. Am J Pathol 2000; 157: Zhang EG, Smith SK, Baker PN, Charnock-Jones DS. The regulation and localization of angiopoietin-1, -2, and their receptor TIE2 in normal and pathologic human placentae. Mol Med 2001;7: Khaliq A, Li XF, Shams M, Sisi P, Acevedo CA, Whittle MJ, et al. Localisation Of placenta growth factor (PlGF) in human term placenta. Growth Factors 1996;13: Arroyo J, Torry RJ, Torry DS. Differential regulation of placenta growth factor (PlGF)-mediated signal transduction in human primary term trophoblast and endothelial cells. Placenta 2004;25: Torry DS, Ahn H, Barnes EL, Torry RJ. Placenta growth factor: potential role in pregnancy. Am J Reprod Immunol 1999;41: Fertility and Sterility 187

196 Remote organ injury induced by myocardial ischemia and reperfusion on reproductive organs, and protective effect of melatonin in male rats Engin Sahna, Ph.D., a Gaffari Türk, D.V.M., Ph.D., b Ahmet Atessahin, Ph.D., c Seval Yılmaz, Ph.D., d and Ercument Olmez, M.D. e a Department of Pharmacology, Faculty of Medicine, b Department of Reproduction, Artificial Insemination, and Andrology, Faculty of Veterinary Medicine, c Department of Pharmacology and Toxicology, Faculty of Veterinary Medicine, and d Department of Biochemistry, Faculty of Veterinary Medicine, University of Fırat, Elazığ; and e Department of Pharmacology, Faculty of Medicine, Celal Bayar University, Manisa, Turkey Objective: Myocardial ischemia and reperfusion (MI-R) leads to remote organ injury associated with oxidative stress. Melatonin is a well-known antioxidant and free-radical scavenger. This study was conducted to examine whether MI-R causes damage in the testes and sperm quality, and to investigate the possible protective effect of exogenous melatonin on these parameters in an in vivo rat model. Design: Experimental study. Setting: Experimental Research Center, Fırat University Medical School, Elazığ, Turkey. Patient(s): Eight-week-old male Wistar rats (n 18). Intervention(s): To produce MI-R, a branch of the descending left coronary artery was occluded for 30 minutes, followed by 120-minute reperfusion. Melatonin (10 mg/kg) or vehicle was given 10 minutes before ischemia via the jugular vein. Main Outcome Measure(s): Reproductive organ weights and epididymal sperm concentration, sperm motility, abnormal sperm rate, and testicular-tissue malondialdehyde (MDA) and glutathione (GSH) levels were examined after reperfusion. Result(s): MI-R significantly decreased epididymal sperm motility, and increased the testes-tissue level of MDA, compared to the control group. Administration of melatonin reversed the harmful effects of MI-R significantly. However, MI-R did not change sperm concentration, GSH levels, and reproductive organ weights. Conclusion(s): These findings indicate that MI-R leads to damage of testis tissue and sperm motility, and melatonin protects against MI-R-induced reproductive-organ injury. These results may also encourage the use of antioxidants to reduce remote organ injury in the testis after MI-R. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Melatonin, myocardial ischemia and reperfusion, oxidative stress, sperm characteristics, remote organ Cardiovascular disease is a leading cause of death worldwide, and remains one of the major killers in modern society. It can be initiated by multiple factors, including ischemiaand-reperfusion (I-R) injury (1). Myocardial ischemia and reperfusion (MI-R) represents a clinically relevant problem associated with thrombolysis, angioplasty, and coronary bypass surgery (2). Several studies showed that MI-R leads to remote organ injury (3, 4), and that oxygen-based reactants may play a central role in this injury (5). Myocardial ischemia and reperfusion cause severe damage, as indicated by free radicals and loss of membrane phospholipids (6, 7). Reactive oxygen species (ROS) are free radicals such as the hydroxyl radical (OH ) and the superoxide anion (O 2 ), Received June 7, 2006; revised November 9, 2006; accepted November 20, This work was performed at the Experimental Research Center, Fırat University Medical School, Elazığ, Turkey. Reprint requests: Gaffari Türk, Ph.D., Department of Reproduction and Artificial Insemination, Faculty of Veterinary Medicine, University of Firat, 23119, Elazığ, Turkey (FAX: ; gaffariturk@ hotmail.com). or molecules such as hydrogen peroxide (H 2 O 2 ). The production of ROS is a normal physiological event in various organs, including the testis. However, the overproduction of ROS stimulates DNA fragmentation and can be detrimental to sperm function, associated with peroxidative damage to the mitochondria and plasma membrane. In addition, spermatozoa are especially susceptible to peroxidative damage because of a high concentration of polyunsaturated fatty acids and low antioxidant capacity (8, 9). Melatonin has been gaining acceptance as potent radical scavenger and antioxidant (10, 11). It was shown to inhibit MI-R-induced oxidative changes and reduce I-R-induced arrhythmias, mortality, and infarct size (11 13). On the other hand, the efficacy of melatonin on the oxidative changes in testis tissue and sperm characteristic due to MI-R has not been well-documented. In this study, we aimed to investigate the effect of MI-R on remote organ injury in testis tissue, and the possible protective effects of the exogenous administration of melatonin after MI-R in an in vivo rat model. We evaluated 188 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

197 morphological changes in reproductive organs and sperm characteristics such as epididymal sperm concentration, motility, and abnormal sperm rate, in addition to levels of malondialdehyde (MDA), a stable metabolite of the free radical-mediated lipid peroxidation cascade which is widely used as a marker of oxidative stress, and glutathione (GSH), an important endogenous antioxidant whose levels are influenced by oxidative stress. MATERIALS AND METHODS Experimental Groups Eighteen healthy, adult, male Wistar rats (weighing g, 8 weeks old) were kept under standard laboratory conditions (12 hours light:12 hours dark, and 21 C 2 C). Experiments were performed between 9 AM 5 PM. This study was performed in accordance with the guidelines for animal research from the National Institutes of Health (Bethesda, Maryland), and was approved by our Local Committee on Animal Research. The rats were divided into three groups of six rats each. The control group received isotonic saline; the MI-R group received melatonin vehicle; and the MI-R-plus-melatonin group received a single dose of melatonin. Melatonin (Sigma Chemical Co., St. Louis, MO) was dissolved in ethanol and further diluted in saline to give a final concentration of 1%, and at a dose of 10 mg/kg was administered by IV injection 10 minutes before ischemia. Ischemia and Reperfusion Procedure Rats were anesthetized with intraperitoneal urethane ( g/kg, Fluka Chemical, Buchs, Switzerland). The jugular vein and trachea were cannulated for drug administration and artificial respiration, respectively. Blood pressure and electrocardiography were monitored during I-R; the results are not described here because these parameters were used only to verify MI-R. The chest was opened by a left thoracotomy, followed by sectioning the fourth and fifth ribs, about 2 mm to the left of the sternum. Positive-pressure artificial respiration was started immediately with room air, using a volume of 1.5 ml/100 g body weight at a heart rate of 60 beats/minute to maintain normal partial pressures of CO 2 (pco 2 ) and O 2 (po 2 ), and ph parameters. After the pericardium was incised, the heart was exteriorized by gentle pressure on the right side of the rib cage. A 6/0 silk suture attached to a 10-mm micropoint reverse-cutting needle was quickly placed under the left main coronary artery. The heart was then carefully replaced in the chest, and the animal was allowed to recover for 20 minutes. A small plastic snare was threaded through the ligature and placed in contact with the heart. The artery was then occluded by applying tension to the ligature, and reperfusion was achieved by releasing the tension. The artery was occluded for 30 minutes, and then reperfused for 120 minutes (13). The jugular vein was cannulated for drug administration. As soon as reperfusion was completed, the animal was euthanized by cervical dislocation. The testes, epididymides, seminal vesicles, and prostate were removed and cleared of adhering connective tissue. Measurement of testis weight, length, and thickness was performed, and epididymal, seminal-vesicle, and prostatic weight were evaluated along with epididymal sperm concentration, sperm motility, and sperm morphology. Testis samples were stored at 20 C until biochemical assays. Epididymal Sperm Concentration, Motility, and Abnormal Sperm Rate Spermatozoa in the right epididymis were counted by a modified method of Yokoi et al. (14). Briefly, the epididymis was minced with anatomical scissors in 5 ml of physiological saline, placed in a rocker for 10 minutes, and allowed to incubate at room temperature for 2 minutes. After incubation, the supernatant fluid was diluted 1:100 with a solution containing 5 g sodium bicarbonate, 1 ml formalin (35%), and 25 mg eosin per 100 ml of distilled water. Total sperm number was determined by use of a hemocytometer. Approximately 10 L of the diluted sperm suspension were transferred to each counting chamber of the hemocytometer, and allowed to stand for 5 minutes. The cells that settled during this time were counted with the use of a light microscope at 200 magnification. Progressive motility was evaluated by an method described by Sönmez et al. (15). The fluid obtained from the left cauda epididymis with a pipette was diluted to 0.5 ml with Tris buffer solution. A slide was placed in a light microscope with a heated stage, an aliquot of this solution was placed on the slide, and the percentage of motility was evaluated visually at a magnification of 400. Motility estimates were performed in three different fields from each sample. The mean of the three estimates was used as the final motility score. Samples for evaluation of motility were kept at 35 C. Slides were prepared with Indian ink for determination of the percentage of morphologically abnormal spermatozoa. In total, 300 sperm cells were counted on each slide under a light microscope at 400 magnification (16). Biochemical Assays Testes tissue was homogenized in a Teflon-glass homogenizer with a buffer containing 1.5% potassium chloride, to obtain 1:10 (w/v) whole homogenate. Concentrations of MDA, as an index of lipid peroxidation (LPO), were measured in the homogenate. Then homogenates were centrifuged at 18,000 g (4 C) for 30 minutes to determine reduced GSH levels. Concentrations of MDA were assayed according to a modified method of Ohkawa et al. (17), based on their reaction to thiobarbituric acid, and were expressed as nmol/ml. Tissue GSH concentrations were measured by a kinetic assay by means of a dithionitrobenzoic acidrecycling method described by Ellman (18), and were expressed as mol/ml. Fertility and Sterility 189

198 FIGURE 1 Sperm motility rates in control, MI-R plus vehicle, and MI-R plus melatonin groups. (A and B): The difference between the columns bearing different lower-case letters is statistically significant (P.01). FIGURE 2 Epididymal sperm concentrations in control, MI-R plus vehicle, and MI-R plus melatonin groups. No difference was found among the groups. Sahna. Melatonin ischemia-and-reperfusion sperm interaction. Fertil Steril Sahna. Melatonin ischemia-and-reperfusion sperm interaction. Fertil Steril Statistical Analyses Data are presented as mean standard error of the mean (SEM). P.05 was considered statistically significant. Data were analyzed by one-way analysis of variance and post hoc Duncan s test. We used the SPSS-PC program (version 10; SPSS, Inc., Chicago, IL) to determine differences among all groups. RESULTS Organ Weights and Dimensions The values of testis weights and dimensions, and epididymis and accessory-gland weights in the control, MI-R, and MI-R plus melatonin groups were examined. However, no statistically significant differences were found among any groups relative to these parameters (data not shown). Testicular-Tissue Levels of MDA and GSH The levels of MDA and GSH in testis tissue are given in Table 1. The MI-R was accompanied by a statistically significant (P.05) increase in MDA level, whereas administration of melatonin significantly (P.05) reduced this value. The level of GSH was not significantly affected by applications of MI-R plus vehicle and MI-R plus melatonin. DISCUSSION The present study shows that MI-R leads to lipid peroxidation in testicular tissue and a decrease in sperm motility. FIGURE 3 Abnormal sperm rates in control, MI-R plus vehicle, and MI-R plus melatonin groups. No difference was observed among all groups in sperm head, sperm tail, and entire sperm abnormalities. Sperm Characteristics The sperm-motility percentages of all groups of rats are shown in Figure 1. Sperm motility in the MI-R plus vehicle group was significantly (P.01) lower than in the control group (35.5% 3.8% versus 65.0% 2.3%, respectively). However, reduced sperm motility obtained in MI-R plus vehicle group returned to its control group value in MI-R plus melatonin application group. Epididymal sperm concentration and abnormal sperm rates are shown in Figures 2 and 3, respectively. The observations of decrease in sperm concentration and increase in all abnormal sperm rates (i.e., head, tail, and total) in MI-R plus vehicle group were not statistically significant. Sahna. Melatonin ischemia-and-reperfusion sperm interaction. Fertil Steril Sahna et al. Melatonin ischemia-and-reperfusion sperm interaction Vol. 88, No. 1, July 2007

199 TABLE 1 Testis-tissue levels of MDA and GSH in control, MI/R plus vehicle, and MI/R plus melatonin groups. MDA GSH Group (nmol/ml) ( mol/ml) Control MI-R plus vehicle a MI-R plus melatonin b Note: Data are expressed as mean SEM. a Significantly different from control group (P.05). b Significantly different from MI-R plus vehicle group (P.05). Sahna. Melatonin ischemia-and-reperfusion sperm interaction. Fertil Steril Administration of melatonin to rats with MI-R attenuated lipid peroxidation, and repaired sperm motility. The damage of sperm is the result of an improper balance between generation of ROS and scavenging activities. The scavenging potential in epididymal fluid is normally maintained by adequate levels of enzymatic and nonenzymatic (GSH) antioxidant mechanisms. The balance of this system is essential to eliminate ROS in the epididymis. The reduction in activities of antioxidant enzymes and the increase in ROS lead to damage in the membrane of spermatozoa (19). Peroxidative damage induced by ROS is one of the major causes of defective sperm function. The sperm plasma membrane contains a high amount of polyunsaturated fatty acids, and so it is particularly susceptible to peroxidative damage. Lipid peroxidation destroys the structure of the lipid matrix in the membranes of spermatozoa, and it is associated with a loss of motility and defective sperm (20, 21). In the present study, we found that MI-R negatively affected sperm motility, but not sperm concentration and abnormal sperm rate. This decrease in sperm motility may be explained by the lipid peroxidation mechanism that we have described. Spermatogenesis occurs in an orderly fashion, with the spermatocytes (primary and secondary) being derived from the spermatogonia via mitotic division. Through meiotic division, the spermatids are formed from secondary spermatocytes; they contain a haploid number of chromosomes. During spermiogenesis, the mature spermatozoa are formed, and releases to the tubular lumen (22). As the period of application of MI-R in the present trial (3 hours) was limited, and the duration of spermatogenesis in the rat is approximately days (23), any significant effect of I-R on spermatogenesis, sperm concentration, and abnormal sperm rates would not be observed. It was recently reported that reperfusion of ischemic myocardium leads to an increase of oxidative stress (11, 13). At the onset of reperfusion, the mitochondrial respiratory rate markedly increases, and greater quantities of free radicals are generated. When these radicals exceed the capacity of the cellular intrinsic free-radical scavenging systems, toxic effects begin to damage the cells. The reactions caused by excessive radicals lead to lipid peroxidation of membranes (24, 25). The beneficial effects of melatonin on MI-R-injury were demonstrated previously (12, 13). Recent studies pertaining to the efficacy of melatonin on remote organ injury demonstrated that melatonin was protective in renal (26) and cardiac (5) I-R injury. Eşrefoğlu et al. (5) showed that MI-R led to morphological testis damage and increased blood MDA and nitric oxide levels. To our knowledge, we are the first to demonstrate that MI-R causes an increase in levels of testistissue MDA and a decrease of sperm motility. In addition to this, the protective effect of melatonin on oxidative changes in testis tissue and sperm characteristics after MI-R was documented. Gwayi and Bernard (27) reported that melatonin receptors were identified in the epididymis, and low-affinity melatoninbinding sites were described in spermatozoa. For this reason, it is possible that melatonin influences sperm motility when sperm transit through the epididymis. In this study, we observed that melatonin positively ameliorated MI-R-induced damage on MDA level and sperm motility. These observations were most probably attributed to the potent free-radical scavenging ability of melatonin. Melatonin was demonstrated to scavenge OH, O 2, singlet oxygen, the peroxyl radical, and the peroxynitrite anion. In addition, the antioxidant actions of melatonin probably derive from its stimulatory effect on superoxide dismutase, glutathione peroxidase, glutathione reductase, and glucose- 6-phosphate dehydrogenase, and its inhibitory action on nitric oxide synthase (4). Melatonin is an amphilic molecule (28, 29), which allows it to pass all biological barriers easily, and quickly penetrate into cells of the ischemic region and all subcellular compartments, where it scavenges damaging radicals. This is a clear advantage of melatonin over other antioxidants, which penetrate cells more slowly. Glutathione is the major cellular sulfydryl which serves as both nucleophile and an effective reductant by interacting with numerous electrophilic and oxidizing compounds. It is important in the regulation of the cellular redox state, and a decline in its cellular level was considered indicative of oxidative stress (30). To our knowledge, after MI-R, the level of GSH in testis tissue has not been documented. Also, in this study, the GSH level of testis tissue was not significantly affected by MI-R. In conclusion, these findings indicate that MI-R leads to damage of testis tissue and sperm motility, and melatonin protects against MI-R-induced reproductive-organ injury. These results may also encourage the use of antioxidants to reduce remote organ injury in the testis after MI-R. Fertility and Sterility 191

200 REFERENCES 1. Gill C, Mestril R, Samali A. Losing heart: the role of apoptosis in heart disease a novel therapeutic target? FASEB J 2002;16: Dhalla NS, Elmoselhi AB, Hata T, Makino N. Status of myocardial antioxidants in ischemia-reperfusion injury. Cardiovasc Res 2000;47: Kim WG, Lee BH, Seo JW. Light and electron microscopic analyses for ischemia-reperfusion lung injury in an ovine cardiopulmonary bypass model. Perfusion 2001;16: Meldrum DR, Donnahoo KK. Role of TNF in mediating renal insufficiency following cardiac surgery: evidence of a postbypass cardiorenal syndrome. J Surg Res 1999;85: Eşrefoğlu M, Gül M, Parlakpınar H, Acet A. Effects of melatonin and caffeic acid phenethyl ester on testicular injury induced by myocardial ischemia/reperfusion in rats. Fundam Clin Pharmacol 2005;19: Maxwell SR, Lip GY. Reperfusion injury: a review of the pathophysiology, clinical manifestations and therapeutic options. Int J Cardiol 1997;58: Dobsak P, Siegelova J, Eicher JC, Jancik J, Svacinova H, Vasku J, et al. Melatonin protects against ischemia-reperfusion injury and inhibits apoptosis in isolated working rat heart. Pathophysiology 2003;9: Köksal İT, Usta M, Orhan İ, Abbasoğlu S, Kadıoğlu A. Potential role of reactive oxygen species on testicular pathology associated with infertility. Asian J Androl 2003;5: Vernet P, Aitken RJ, Drevet JR. Antioxidant strategies in the epididymis. Mol Cell Endocrinol 2004;216: Reiter RJ, Guerrero JM, Garcia JJ, Acuna-Castroviejo D. Reactive oxygen intermediates, molecular damage, and aging. Relation to melatonin. Ann NY Acad Sci 1998;854: Reiter RJ, Tan DX. Melatonin: a novel protective agent against oxidative injury of the ischemic/reperfused heart. Cardiovasc Res 2003;58: Şahna E, Ölmez E, Acet A. Effects of physiological and pharmacological concentrations of melatonin on ischemia-reperfusion arrhythmias in rats: can the incidence of sudden cardiac death be reduced? J Pineal Res 2002;32: Şahna E, Parlakpınar H, Türköz Y, Acet A. Protective effects of melatonin on myocardial ischemia/reperfusion induced infarct size and oxidative changes. Physiol Res 2005;54: Yokoi K, Uthus EO, Nielsen FH. Nickel deficiency diminishes sperm quantity and movement in rats. Biol Trace Elem Res 2003;93: Sönmez M, Türk G, Yüce A. The effect of ascorbic acid supplementation on sperm quality, lipid peroxidation and testosterone levels of male Wistar rats. Theriogenology 2005;63: Ateşşahin A, Karahan İ, Türk G, Gür S, Yılmaz S, Çeribaşı AO. Protective role of lycopene on cisplatin-induced changes in sperm characteristics, testicular damage and lipid peroxidation in rats. Reprod Toxicol 2006;21: Ohkawa H, Ohishi N, Yagi K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 1979;95: Ellman G. Tissue sulphydryl groups. Arch Biochem Biophys 1959;82: Sikka SC. Oxidative stress and role of antioxidants in normal and abnormal sperm function. Front Biosci 1996;1: Sharma RK, Agarwal A. Role of reactive oxygen species in male infertility. Urology 1996;48: Thiele JJ, Friesleben HJ, Fuchs J, Ochsendorf FR. Ascorbic acid and urate in human seminal plasma: determination and interrelationships with chemiluminescence in washed semen. Hum Reprod 1995;10: Brunstein GD. Testes. In: Greenspan FS, ed. Basic and clinical endocrinology. Connecticut: Appleton & Lange, 1991: Bennett JP, Vickery BH. Rats and mice. In: Hafez ESE, ed. Reproduction and breeding techniques for laboratory animals. Philadelphia: Lea and Febiger, 1970: Kaneko S, Okumura K, Numaguchi Y, Matsui H, Murase K, Mokuno S, et al. Melatonin scavenges hydroxyl radical and protects isolated rat hearts from ischemic reperfusion injury. Life Sci 2000;67: Ravingerova T, Slezak J, Tribulova N, Dzurba A, Uhrik B, Ziegelhoffer A. Free oxygen radicals contribute to high incidence of reperfusioninduced arrhythmias in isolated rat heart. Life Sci 1999;65: Kaçmaz A, User EY, Şehirli AO, Tilki M, Özkan S, Şener G. Protective effect of melatonin against ischemia/reperfusion-induced oxidative remote organ injury in the rat. Surg Today 2005;35: Gwayi N, Bernard RTF. The effects of melatonin on sperm motility in vitro in Wistar rats. Andrologia 2002;34: Shida CS, Castrucci AM, Lamy-Freund MT. High melatonin solubility in aqueous medium. J Pineal Res 1994;16: Costa EJ, Shida CS, Biaggi MH, Ito AS, Lamy-Freund MT. How melatonin interacts with lipid bilayers: a study by fluorescence and ESR spectroscopies. FEBS Lett 1997;416: Yu TY, Anderson D. Reactive oxygen species-induced DNA damage and its modification: a chemical investigation. Mutat Res 1997;379: Sahna et al. Melatonin ischemia-and-reperfusion sperm interaction Vol. 88, No. 1, July 2007

201 Effect of leptin on prolactin and insulin-like growth factor-i secretion by cultured rat endometrial stromal cells Kamani H. Tennekoon,Ph.D. a,b Thampoe Eswaramohan,B.Sc. a,b and Eric H. Karunanayake, Ph.D. b a Department of Physiology, b Institute of Biochemistry, Molecular Biology and Biotechnology, University of Colombo, Colombo, Sri Lanka Objective: To study the possible effect of leptin on PRL and insulin-like growth factor (IGF)-I secretion from rat endometrial stromal cells. Design: The effect of recombinant murine leptin on the secretion of PRL and IGF-I by cultured rat endometrial cells was investigated. Setting: Academic institutions. Animal(s): Laboratory bred virgin female rats aged 3 4 months. Intervention(s): Endometrial stromal cell (ESC) cultures in the fourth passage stimulated with 1 1,000 ng/ml of leptin for 24 hours and with 1 ng/ml leptin for hours. Main Outcome Measure(s): Measurement of PRL and IGF-I levels in the conditioned media by enzyme immunoassay. Result(s): Endometrial stromal cells grown in vitro secreted both PRL and IGF-I into the medium and the concentrations significantly increased with passage of time even in the absence of leptin. The increase in PRL was seen mainly at 72 hours and in IGF-I at 24 and 72 hours. Presence of leptin in the culture medium (1 1,000 ng/ml) further enhanced PRL secretion in a dose-dependent manner and this effect was seen with all leptin doses used. Leptin also increased PRL secretion in a time-dependent manner and the increase was seen at 24, 48, and 72 hours. Leptin did not significantly affect IGF-I secretion either in a dose- or a time-dependent manner. Conclusion(s): Biological effects of leptin on the rat endometrium include dose- and time-dependent stimulatory effects on stromal cell PRL secretion. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Leptin, prolactin, endometrial stromal cells Leptin, the first adipocyte hormone to be characterized, is now well known to exert diverse effects on reproduction (1 4). Genetically leptin-deficient and leptin receptor-deficient humans and rodents have reproductive impairment (5 7). Exogenous leptin reverses sterility in genetically leptin-deficient mice (5), advances sexual maturation in normal mice (8), and restores menstrual cycles in women with hypothalamic amenorrhea (9). Leptin acts through its cognate receptor Ob-R and several isoforms of the receptor exist (10). The long form, Ob-Rb, is expressed mostly in the hypothalamus and is thought to mediate the effects on food intake through the JAK-STAT pathway. Most of the peripheral tissues express the short isoforms as well. These are thought to act through other Received April 27, 2006; revised and accepted November 27, Supported by the National Research Council, Sri Lanka (grant no.: 00-07), WHO Rockefeller Career Development Fellowship, and Swedish Agency for Research Corporation with Developing Countries Grant for Molecular Biology and Biotechnology. Parts of this work was presented at the Fertility 2005, United Kingdom and at Sri Lanka Association for the Advancement of Science, Annual Academic Sessions, Reprint requests: Kamani H. Tennekoon, Ph.D., Department of Physiology, Faculty of Medicine, University of Colombo, Kynsey Road, Colombo 8, Sri Lanka (FAX: ; khtennekoon@ med.cmb.ac.lk). pathways such as the MAPkinase pathway. Leptin receptors have been identified at different sites of the reproductive system, including the anterior pituitary, gonads, endometrium, and placenta. Endometrial leptin receptors have been identified in women and in several animal species (11 14). Both endometrial epithelial and stromal cells express leptin receptors, thus becoming targets for leptin action. In mice, leptin receptor expression is greater in the stromal cells than in the epithelial cells (14). In women, endometrial leptin receptor expression varies with the stage of the menstrual cycle (15, 16). Highest leptin receptor expression was observed in the early luteal phase by some investigators (15) and in the late luteal phase by others (11, 16). One study reported a cyclic variation in leptin receptors in luminal and glandular epithelium with highest expression in the luminal epithelium (16). They further observed a slight expression in the stromal cells throughout the menstrual cycle. Furthermore, endometrial leptin receptor deficiency is associated with infertility in women (11). Leptin has been shown to stimulate secretion of interleukin-6 and several chemokines by cultured human endometrial stromal cells and by the human endometrial epithelial /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 193

202 cell line HHUA (17). Some investigators have observed a stimulatory effect of leptin on the secretion of leukemia inhibitory factor by human endometrial cells (18), but other researchers have failed to observe a similar effect (17). Leptin up-regulates expression of 3-integrin, a marker of endometrial receptivity, in human endometrial epithelial cell cultures (19). Leptin and its receptors are expressed in the embryo, indicating a role for leptin in the embryo maternal dialogue during implantation. Several investigators have shown that leptin is required for preimplantation embryo development (20, 21), whereas others have demonstrated a down-regulation of leptin receptors in the uterine implantation sites (14). Immunoreactivity to the long form of the leptin receptor has been observed in human implantation sites with positive signals in the cytotrophoblast and in the epithelial and stromal cells of the maternal decidua (16). In the mouse, trophoblast invasion was stimulated by leptin in vitro (22). Prolactin is a secretory protein of endometrial stromal cells. PRL receptors are found in glandular epithelial cells, implicating a paracrine role for PRL in the endometrium (23). The chemical structure and immunogenecity of endometrial PRL is identical to that of anterior pituitary PRL (24). However, PRL of endometrial origin is transcribed from an alternative promoter resulting in a longer mrna transcript (25). Factors that regulate endometrial PRL secretion differ from that regulating pituitary PRL secretion, and include substances such as cyclic AMP, relaxin, insulin-like growth factor (IGF)-I, and P (23). The pattern of endometrial PRL secretion with higher levels in mid and late secretory phases, the concomitant increase in PRL receptor expression in the endometrial glands, and the known immunomodulatory and angiogenic actions of PRL suggests that PRL plays a significant role in implantation (26). Furthermore, PRL and PRL receptordeficient mice are sterile (27, 28) and PRL expression is impaired in women with recurrent miscarriages or unexplained infertility (29). Insulin-like growth factor-i is expressed in the mid and late proliferative, and early secretory endometrium. Insulinlike growth factor-i immunoreactivity is localized to endometrial epithelial and stromal cells, as well as to the myometrium (30). Type I IGF receptor, which mediates most of the IGF-I action, is localized to the same cells indicating an autocrine and a paracrine role for IGF-I in the uterus. Insulin-like growth factor-i is thought to mediate mitogenic effects of estrogen (E) and both E and P stimulate uterine IGF-I synthesis (31, 32). Furthermore, exogenous IGF-I stimulated PRL secretion and inhibited IGF-binding protein-1 (IGFBP-1) secretion from cultured endometrial stromal cells (33). The IGFBP-1, in turn, has been shown to down-regulate mitogenic effects of IGF-I on endometrial stromal cells (34). Insulin-like growth factor-i has also been shown to stimulate proliferation and migration of mouse ectoplacental cone cells, suggesting a role in placental development (35). In view of the endometrium being a target tissue for leptin, and known and postulated effects of PRL and IGF-I in the endometrium, we investigated possible effect of leptin on PRL and IGF-I secretion by cultured rat endometrial stromal cells in the present study. MATERIALS AND METHODS Isolation and Culture of Rat Endometrial Stromal Cells Primary endometrial stromal cell cultures were established using 3- to 4-month-old, virgin female Sprague Dawley rats from the Animal House at the Faculty of Medicine, University of Colombo. The study was approved by the Institutional Review Board (IRB). Rats were housed under standard conditions (12 hours light and 12 hours dark with ad libitum access to food and water). Stromal cells were prepared according to previously reported methods (36) with some modifications. Vaginal smears were examined microscopically to identify rats in the metestrus stage. Rats in the metestrus stage were killed by injecting pentathiol sodium. Uteri collected, trimmed of fat, and washed in Hanks balanced salt solution (HBSS) to remove blood. Uteri were then minced into small fragments of approximately 1 mm 3 in HBSS and digested with collagenase type I (0.42% w/v) for 30 minutes at 37 C with intermittent agitation. The supernatant was filtered through 100 m filters to remove tissue debris and glandular parts and centrifuged at 800 x g for 5 minutes at 10 C. The cell pellet was suspended in Dulbecco s modified Eagle medium (D-MEM/F-12) supplemented with fetal calf serum (FCS) (10% v/v) and antibiotic antimycotic (1% v/v). An aliquot of the cell suspension was used for counting cells in a hemocytometer (Thoma, Hamburg, Germany) and for determination of viability by trypan blue exclusion. Once the viability was ensured to be 90% or more, cells were seeded onto 24-well culture plates (Nunc, Rochester, NY) at a density of 300,000 cells per well. These were incubated in FCS and antibiotic antimycotic supplemented DMEM/F-12 at 37 C with 5% CO 2 and grown until confluence. Conditioned medium was aspirated and replaced with fresh medium 24 hours later and every 48 hours thereafter. Representative cells were stained for vimentin and cytokeratin to ensure that the monolayers comprised of 98% or more stromal cells. Antibiotic antimycotic ( ), Collagenase Type I ( ), DMEM/F-12 ( ), FCS ( ), and HBSS ( ) were from Invitrogen Corporation, Grand Island, NY. Vimentin (N1521, clone V9) and cytokeratin (N1590, clone AE1/AE3) primary antibodies, secondary antibody (biotinylated link antibody and alkaline phosphatase labeled streptavidin; K 610, DAKO LSAP2 kit), substrate-chromogen (fast red substrate; K 0597), and Tennekoon et al. Effect of leptin on endometrial secretion of prolactin Vol. 88, No. 1, July 2007

203 m filters (CN 09430) were from DAKO Corporation (Carpinteira, CA). Monolayers were treated with 0.25% cold trypsin (Trypsin 1 x Sigma Aldrich, St Louis, MO) in phosphate-buffered saline (ph 7.4) for 30 seconds and incubated for 30 minutes at 37 C with intermittent agitation. Cells were then harvested, pelleted by centrifuging at 500 x g for 5 minutes at 20 C, and reseeded at a density of 25,000 cells per well in 24-well culture plates and grown to confluence. Cell cultures in the fourth passage were used for leptin stimulation. Leptin Stimulation DMEM/F-12 supplemented with heat-inactivated FCS (10% v/v) and antibiotic antimycotic (1% v/v) was used to treat the cultures for 5 days before leptin was added. Recombinant murine leptin (cat. no: 8582, Linco Research Inc., St. Charles, MO) was added at concentrations of 1 1,000 ng/ml to the medium to examine the effect of leptin dose. By the fourth passage, adequate wells were available from the same primary culture; thus all leptin doses were tested within the same experiment. Medium supplemented with heat-inactivated FCS and antibiotic antimycotic was used as control. Conditioned medium was collected after 24 hours. Leptin stimulation at a dose of 1 ng/ml was continued for 72 hours to examine the effect of time of administration. Conditioned medium was aspirated every 24 hours and replaced with fresh medium containing 1 ng/ml leptin. Conditioned media were concentrated 10 times and stored at 80 C until PRL and IGF-I levels were determined by enzyme immunoassay. Each experiment used cells generated from two animals from the same litter. Experiments were repeated three times using separate primary cell cultures generated from litters of different animals. Detection of PRL and IGF-I in the Conditioned Media of ESC by ELISA Prolactin and IGF-I levels in the conditioned media were measured by enzyme immunoassays purchased from Cayman Chemicals (A05101, rat specific; Ann Arbor, MI) and Diagnostic Systems Laboratories, Webster, TX (DSL , rat and mouse specific), respectively. Sensitivity of the assays was 0.5 ng/ml for rat PRL and 30 ng/ml for rat IGF-I. Three similarly treated samples were available within each experiment for each dose or time point tested and all three samples were assayed in duplicate. The DMEM/F-12 supplemented with heat-inactivated FCS and antibiotic antimycotic was also concentrated 10 times and assayed for PRL and IGF-I. Prolactin was not detected in the concentrated medium and IGF-I level was less than 50 ng/ml. Statistical Analyses Data were analyzed using Prism 2.01 (GraphPad Prism, San Diego, CA). Geometric mean SEM was used to describe data. Repeated measures analysis of variance (ANOVA) with Dunnett s post test for multiple comparisons was used on log transformed data to detect the effect of leptin and duration of treatment. Dunnett s post test, which compares all groups to a control group, was selected rather than Bonferroni multiple comparison, which allows comparison between all groups, as multiple testing is known to reduce power of results. Parametric repeated measures ANOVA on log transformed data was selected rather than a nonparametric ANOVA on raw data as the latter is a very conservative test. RESULTS Monolayer cell cultures comprised of spindle-shaped cells and these were more than 98% vimentin positive and cytokeratin negative, confirming the stromal origin of the cells (data not shown). Prolactin secretion 24 hours after leptin treatment at 1, 10, 100, and 1,000 ng/ml is shown in Figure 1A. When analyzed using repeated measures ANOVA, PRL levels in the conditioned media collected just before leptin was added (0 hours) were not significantly different between the culture wells used for leptin stimulation and as the control. Leptin treatment caused a significant increase in PRL secretion in a dose-dependent manner (repeated measures ANOVA: P.0001) from the cultured stromal cells. When each leptin dose was compared with the control using Dunnett s multiple comparison, all does of leptin used in this experiment significantly increased PRL secretion at 24 hours (P.01). Prolactin secretion at 24, 48, and 72 hours after treatment of cell cultures with a leptin dose of 1 ng/ml is shown in Figure 1B. Prolactin secretion increased with passage of time even in the absence of leptin stimulation (repeated measures ANOVA: P.05) and the increase was significant when the cultures had grown for 72 hours (Dunnett s multiple comparison: P.01). Exposure of these cells to 1 ng/ml leptin significantly increased PRL secretion at all three time points tested (repeated measures ANOVA: P.0001; Dunnett s multiple comparison: P.01). The IGF-I levels in the conditioned media from control and leptin treated wells are shown in Figure 2. The IGF-I was detected in the conditioned media even before leptin stimulation. The variation in IGF-I levels between culture wells grown under the same conditions was much more than the variation in PRL levels. When cells were grown in culture for 24 hours with 1 1,000 ng/ml leptin, IGF-I secretion continued at a somewhat higher rate. However, IGF-I levels were not significantly different between culture wells treated with leptin and the control wells before or 24 hours after stimulation with leptin. In the absence of leptin stimulation, IGF-I secretion by endometrial stromal cells increased when cells were cultured for 72 hours, the increase being contributed by cultures at 24 Fertility and Sterility 195

204 FIGURE 1 Effect of leptin on PRL secretion by cultured rat endometrial stromal cells (A) in response to treatment with different doses of leptin for 24 hours, (B) in response to 1 ng/ml leptin for different lengths of time. Leptin significantly increased PRL secretion in a dose- and a timedependent manner (repeated measures ANOVA on log transformed data, P.0001). Prolactin secretion also increased with duration of culture even in the absence of leptin stimulation (repeated measures ANOVA on log transformed data. P.05). Dunnett s post-test was used to compare each dose or time point with the control (i.e., medium only or time 0 hours). *P.05, **P.01. hours, but not at 24 hours. The IGF-I levels were lower at 24 hours after leptin treatment, although this was not statistically significant. In view of the wide variation of basal levels of IGF-I, changes in IGF-I level after treatment with leptin or with passage of time were expressed as a percentage change from basal levels and reanalyzed. The results obtained were sim- FIGURE 2 Effect of leptin on insulin-like growth factor-i (IGF- I) secretion by cultured rat endometrial stromal cells (A) in response to treatment with different doses of leptin for 24 hours, (B) in response to 1 ng/ml leptin for different lengths of time. Leptin did not significantly affect IGF-I secretion, but the IGF-I levels increased with duration of culture (repeated measures ANOVA on log transformed data, P.05). Dunnett s post-test was used to compare each time point with the control (i.e., time 0 hours). *P.05. Tennekoon. Effect of leptin on endometrial secretion of prolactin. Fertil Steril and 72 hours (repeated measures ANOVA: P.05; Dunnett s post test: P.05). When cells were cultured for 72 hours in the presence of 1 ng/ml leptin, IGF-I levels remained similar between control and treated cells at 48 and 72 Tennekoon. Effect of leptin on endometrial secretion of prolactin. Fertil Steril Tennekoon et al. Effect of leptin on endometrial secretion of prolactin Vol. 88, No. 1, July 2007

205 ilar to results obtained when absolute levels were compared (data not shown). DISCUSSION We have shown that cultured rat endometrial stromal cells secrete PRL, and this increases with duration of culture. Prolactin secretion is further augmented by exogenous leptin in a dose- and time-dependent manner. Our findings contrast with those of Tanaka et al. (37) who did not observe any effect of leptin on PRL secretion by unstimulated cultured human endometrial stromal cells. In fact, they reported an inhibition of PRL secretion when cells were co-stimulated with leptin and 8-Br.cAMP, a decidualizing agent, and lack of an effect when already decidualized cells were treated with leptin. The differences between present observations and those reported previously (37), may result from differences in the species used or in experimental methodology. Observations of Watanobe et al. (38) on increased pituitary PRL secretion in response to chronic but not acute administration of leptin in the rat suggest a species difference as well as methodologic differences when time after administration is considered. They found that 5 hours after leptin administration, pituitary PRL secretion was not affected, but leptin increased PRL secretion 3 days after administration. In our study, even the lowest dose of leptin (1 ng/ml) was effective at 24 hours, in stimulating PRL secretion from rat endometrial stromal cells. Tanaka et al. (37), who observed an inhibitory or no effect of leptin administration on PRL secretion by human endometrial cells, do not report the timing of their sampling for PRL estimation. Further studies using similar protocols are warranted to exclude methodologic differences to clarify whether rat and human endometrial stromal cells respond differently to leptin. Both leptin and PRL act on cell membrane receptors belonging to the class I cytokine receptor superfamily, thus using similar signal transduction mechanisms. Furthermore, both of these hormones also activate SOCS, suppressors of cytokine signaling (39, 40). Leptin has been shown to increase secretion of several other cytokines and chemokines in endometrial cells (13, 17, 18). These include up-regulation of the interleukin-1 system comprising of interleukin-1, interleukin-1 receptor, and interleukin-1 receptor antagonist and stimulation of leukemia inhibitory factor secretion (13, 18). It has also been suggested that leptin substitutes for several functions of interleukin-1 in the endometrium (41). Although some investigators (18) reported an increase in leukemia inhibitory factor secretion in response to leptin, others failed to find an increase in leukemia inhibitory factor in response to leptin despite using a very high dose (17). Thus, discordance between our observations and that of Tanaka et al. (37) using two different species is not unexpected. Prolactin synthesis in the endometrium uses an alternative promoter (25). Thus, most of the agents that usually stimulate anterior pituitary PRL secretion are without effect on the endometrium. Present observation, taken together with observation of Watanobe et al. (38) indicates that leptin stimulates PRL secretion from both the anterior pituitary and the endometrium in the rat. A reciprocal effect of PRL on leptin secretion has also been observed in the rat. Prolactin has been shown to enhance leptin secretion from white adipose tissue in the rat (42). Furthermore, the nocturnal surge of PRL parallels that of leptin in the rat; exogenous PRL increases leptin; and dopamine (D 2 ) receptor agonist, bromoergocryptine (bromocryptine) reduces leptin secretion (43). However, possible effect of PRL on leptin secretion by the rat endometrium or expression of the leptin receptor has not been investigated to our knowledge. None of the previous investigators appear to have examined the effect of leptin on IGF-I secretion by the endometrial stromal cells of any species. The IGF-I is known to stimulate PRL secretion from endometrial stromal cells (33). Our present study on the rat endometrial stromal cells did not show any significant effect of leptin on IGF-I secretion. However, the duration of culture had a significant effect on IGF-I secretion. Thus, the effect of leptin on PRL secretion by endometrial stromal cells seen in the present study is unlikely to be mediated secondary to an effect on IGF-I. Similar to our observations, other investigators have shown that leptin has no effect on IGF-I or IGF-I receptor expression in the neuroepithelioma cell line SK-N-MC (44). In contrast, leptin administration reduced IGF-I secretion by cultured human granulosa cells (GC) (45) and increased IGF-I expression in iliac crest osteoblasts (46). Furthermore, IGF-I increased leptin expression in the breast cancer cell line MCF-7 (47). Thus, interactions between leptin and IGF-I appears to vary depending on the cell type. Leptin is now known to exert effects not only at different levels of the hypothalamic pituitary ovarian axis but also on other reproductive tissues such as the endometrium and placenta (3, 48). Obesity and reproductive failure associated with genetic leptin or leptin receptor deficiency (6, 7), and the reversal of reproductive impairment by exogenous leptin (5, 9) indicate that normal reproductive function requires optimal levels of leptin (3, 48). Increased leptin levels are also associated with reproductive defects (49). In the human, except in rare instances of genetic leptin or leptin receptor deficiency, obesity is associated with higher leptin secretion by adipocytes and a leptin resistance in the hypothalamus (50, 51). Whether a leptin resistance in the reproductive system contributes to the reproductive impairment in obesity has not been ascertained. Our previous studies showed that early resumption of men- Fertility and Sterility 197

206 struation in lactating women with higher body mass indices is not mediated by leptin (52). The present study demonstrates that undecidualized rat endometrial stromal cells grown in vitro secrete both PRL and IGF-I and the secretion increases with passage of time, presumably as the cells multiply. Leptin administration further enhances PRL secretion but not IGF-I secretion, in a dose- and time-dependent manner. Thus, leptin appears to be a stimulus for endometrial PRL secretion. However, its biological importance amid other physiological stimuli of endometrial PRL secretion remains to be seen. REFERENCES 1. Barash IA, Cheung CC, Weigle DS, Ren H, Kabigting EB, Kuijper JL, et al. Leptin is a metabolic signal to the reproductive system. Endocrinology 1996;137: Cunningham MJ, Clifton DK, Steiner RA. Leptin s action on the reproductive axis: perspectives and mechanisms. Biol Reprod 1999;60: Moschos S, Chan JL, Mantzoros CS. Leptin and reproduction: a review. Fertil Steril 2002;77: Henson MC, Castracane VD. Leptin in pregnancy: an update. Biol Reprod 2006;74: Chehab FF, Lim ME, Lu R. Correction of the sterility defect in homozygous obese female mice by treatment with human recombinant leptin. Nat Genet 1996;12: Clement K, Vaisse C, Lahlou Z, Cabrol S, Pelloux V, Cassuto D, et al. A mutation in the human leptin receptor gene causing obesity and pituitary dysfunction. Nature 1998;392: Strobel A, Issad T, Camoin L, Ozata M, Strosberg AD. A leptin missense mutation associated with hypogonadism and morbid obesity. Nat Genet 1998;18: Ahima RS, Dushay J, Flier SN, Prabakaran D, Flier JS. Leptin accelerates the onset of puberty in normal female mice. J Clin Invest 1997;99: Welt CK, Chang JL, Bullen J, Murphy R, Smith P, DePaoli AM, et al. Recombinant leptin in women with hypothalamic amenorrhea. N Engl J Med 2004;351: Tartaglia LA. The leptin receptor. J Biol Chem 1997;272: Alfer J, Muller-Schottle F, Classen-Linke I, von Rango U, Happel L, Beier-Helwig K, et al. The endometrium as a novel target for leptin; differences in fertility and subfertility. Mol Hum Reprod 2000;6: Gonzalez RR, Caballero-Campo P, Jasper M, Mercader A, Devoto L, Pellicer A, et al. Leptin and leptin receptor are expressed in the human endometrium and endometrial leptin secretion is regulated by the human blastocyst. J Clin Endocrinol Metab 2000;85: Gonzalez RR, Leavis PC. A peptide derived from the human leptin molecule is a potent inhibitor of the leptin receptor function in rabbit endometrial cells. Endocrine 2003;21: Yoon S-J, Cha K-Y, Lee K-A. Leptin receptors are down-regulated in uterine implantation sites compared to interimplantation sites. Mol Cell Endocrinol 2005;232: Kitawaki J, Koshiba H, Ishihara H, Kusuki I, Tsukamoto K, Honjo H. Expression of leptin receptor in the human endometrium and fluctuation during the menstrual cycle. J Clin Endocrinol Metab 2000;85: Cervero A, Horcajadas JA, Martin J, Pellicer A, Simon C. The leptin system during human endometrial receptivity and preimplantation development. J Clin Endocrinol Metab 2004;89: Fukuda J, Nasu K, Sun B, Shang S, Kawano Y, Miyakawa I. Effects of leptin on the production of cytokines by cultured human endometrial stromal and epithelial cells. Fertil Steril 2003;80: Gonzalez RR, Rueda BR, Ramos MP, Little RD, Glasser S, Leavis PC. Leptin-induced increase in leukemia inhibitory factor and its receptor by human endometrium is partially mediated by interleukin 1 receptor signaling. Endocrinology 2004;145: Gonzalez RR, Leavis PC. Leptin upregulated 3-integrin expression and interleukin-1b upregulates leptin and leptin receptor expression in human endometrial epithelial cell cultures. Endocrine 2001;16: Kawamura K, Sato N, Fukuda J, Kodama H, Kumagal J, Tanikawa H, et al. Leptin promotes development of mouse preimplantation embryos in vitro. Endocrinology 2002;143: Craig J, Zhu H, Dyce PW, Wen L, Li J. Leptin enhances porcine preimplantation embryo development in vitro. Mol Cell Endocrinol 2005;229: Schulz L, Widmaier EP. The effect of leptin on mouse trophoblast cell invasion. Biol Reprod 2004;71: Jabbour HN, Critchley HOD. Potential roles of decidual prolactin in early pregnancy. Reproduction 2001;121: Tomita K, McCoshen JA, Fernandez CS, Tyson JE. Immunological and biological characterisation of human decidual prolactin. Am J Obstet Gyne 1982;142: Telgmann R, Gellersen B. Marker genes of decidualization: activation of decidual prolactin gene. Hum Reprod 1998;4: Jones RL, Critchley HOD, Brooks J, Jabbour HN, McNeilly AS. Localization and temporal expression of prolactin receptor in human endometrium. J Clin Endocrinol Metab 1998;83: Horseman ND, Zhao W, Montecino-Rodrriguez E, Tanaka M, Nakashima K, Engle SJ, et al. Defective mammopoiesis but normal hematopoiesis in mice with a targeted disruption of the prolactin gene. EMBO J 1997;16: Ormandy CJ, Camus A, Barra J, Damotte D, Lucas B, Buteau H, et al. Null mutation of the prolactin receptor gene produces multiple reproductive defects in the mouse. Genes & Dev 1997;11: Garzia E, Borgato S, Cozzi V, Doi P, Bulfamante G, Persani L, et al. Lack of expression of endometrial prolactin in early implantation failure: a pilot study. Hum Reprod 2004;19: Tang XM, Rossi MJ, Masterson BJ, Chegini N. Insulin-like growth factor-i (IGF-I), IGF-I receptors and IGF binding proteins 1 4 in human uterine tissues: tissue localization and IGF-I action in endometrial stromal and myometrial smooth muscle cells in vitro. Biol Reprod 1994;50: Giudice LC, Irwin JC. Roles of the insulin-like growth factor family in nonpregnant human endometrium and at the decidual trophoblast interface. Semin Reprod Endocrinol 1999;17: Kapur S, Tamada H, Dey SK, Andrews GK. Expression of insulin-like growth factor-i (IGF-I) and its receptor in the pre-implantation mouse uterus, and cell specific regulation of IGF-I gene expression by estradiol and progesterone. Biol Reprod 1992;46: Irwin CJ, des las Fuentes L, Duspin BA. Giudice LC, Insulin-like growth factor regulation of human endometrial stromal cell function: coordinate effects on insulin-like growth factor binding protein 1, cell proliferation and prolactin secretion. Regul Pept 1993;48: Frost RA, Mazella J, Tseng L. Insulin-like growth factor binding protein-1 inhibits mitogenic effects of insulin-like growth factors and progestins in human endometrial stromal cells. Biol Reprod 1993;49: Kanai-Azuma M, Kanai Y, Kurohmaru M, Sakai S, Hayashi Y. Insulinlike growth factor (IGF)-I stimulates proliferation and migration of mouse ectoplacental cone cells, while IGF-II transforms them into trophoblastic giant cells in vitro. Biol Reprod 1993;48: Classen-Linke I, Kusche M, Knauthe R, Beier HM. Establishment of a human endometrial cell culture system and characterization of its polarized hormone responsive epithelial cells. Cell Tissue Res 1997; 287: Tanaka T, Utsunomiya T, Bai T, Nakajima S, Umesaki N. Leptin inhibits decidualization and enhance cell viability of normal human endometrial stromal cells. Int J Mol Med 2003;12: Watanobe H, Schioth HB, Suda T. Stimulation of prolactin by chronic but not acute administration of leptin in the rat. Brain Research 2000; 887: Tennekoon et al. Effect of leptin on endometrial secretion of prolactin Vol. 88, No. 1, July 2007

207 39. Bjorbaek C, El-Haschimi?, Frantz JD, Flier JS. The role of SOCS-3 in leptin signaling and leptin resistance. J Biol Chem 1999;276: Ling C, Billig H. PRL receptor-mediated effects in female mouse adipocytes: PRL induces suppressors of cytokine signaling expression and suppresses insulin-induced leptin production in adipocytes in vitro. Endocrinology 2001;142: Gonzalez RR, Devoto L, Campana A, Bischoff P. Effects of leptin, interleukin-1 a, interleukin-6 and transforming growth factor on markers of trophoblast invasive phenotype: integrins and metalloproteinases. Endocrine 2001;15: Gualillo O, Lago F, Garcia M, Menendez C, Senaris R, Casanueva FF, et al. Prolactin stimulates leptin secretion by rat white adipose tissue. Endocrinology 1999;140: Mastronardi CA, Walczewska A, Yu WH, Karanth S, Parlow AF, McCann SM. The possible role of prolactin in the circadian rhythm of leptin secretion in male rats. Proc Soc Exp Biol Med 2000;224: Kiess W, Klammt J, Haze J, Blum WF, Berthold A, Seidel B, et al. Evidence against a direct effect of leptin on insulin-like growth factor-i (IGF-I), IGFBP-2 and IGF-I receptor expression in human SK-N-MC neuroepithelioma cells. Regul Pept 2005;130: Sirotkin AV, Mlyneck M, Kotwica J, Makarevich AV, Florkorikova I, Hetenyi L. Leptin directly controls secretory activity of human ovarian granulose cells: possible inter-relationship with the IGF/IGFBP system. Horm Res 2005;64: Gordeladze JO, Drevon CA, Syversen U, Reseland JE. Leptin stimulates human osteoblastic cell proliferation, de novo collagen synthesis, and mineralization: impact on differentiation markers, apoptosis and osteoclastic signaling. J Cell Biochem 2002;85: Garofalo C, Koda M, Cascio S, Sulkowska M, Kanczuga-Koda L, Golaszewska J, et al. Increased expression of leptin and the leptin receptor as a marker of breast cancer progression: possible role of obesity related stimuli. Clin Cancer Res 2006;12: Budak E, Sanchez MF, Bellver J, Cervero A, Simon C, Pellicer A. Interactions of the hormones leptin, ghrelin, adiponectin, resistin and PYY3-36 with the reproductive system. Fertil Steril 2006; 85: Mantzoros CS, Cramer DW, Liberman RF, Barbieri RL. Predictive value of serum and follicular fluid leptin concentrations during assisted reproductive cycles in normal women and women with the polycystic ovarian syndrome. Hum Reprod 2000;15: Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, et al. Serum immunoreactive-leptin concentrations in normal weight and obese humans. N Engl J Med 1996;334: Caro JF, Sinha MK, Kolaczynski JW, Zhang PL, Considine RV. Leptin the tale of an obesity gene. Diabetes 1996;45: Tennekoon KH, Wasalathanthri S, Jeevathayaparan S, Karunanayake EH. Serum leptin and lactational amenorrhea in well-nourished and undernourished lactating women. Fertil Steril 2005;83: Fertility and Sterility 199

208 Deranged expression of follistatin and follistatin-like protein in women with ovarian endometriosis Paulo B. Torres, M.D., a Pasquale Florio, M.D., Ph.D., a Marcia C. Ferreira, M.D., b Michela Torricelli, M.D., a Fernando M. Reis, M.D., Ph.D., b and Felice Petraglia, M.D. a a Section of Obstetrics and Gynecology, Department of Pediatrics, Obstetrics, and Reproductive Medicine, University of Siena, Siena, Italy; and b Department of Obstetrics and Gynecology, and Department of Physiology, University of Minas Gerais, Belo Horizonte, Brazil Objective: To evaluate the messenger RNA (mrna) expression and peptide localization of follistatin and follistatin-like protein (FLRG) in ovarian endometriosis, compared to healthy human endometrium. Design: Samples of ovarian endometriotic and healthy endometrial tissues were processed by semiquantitative reverse transcript ase-polymerase chain reaction and immunohistochemistry. Setting: Academic health centers in Siena, Italy, and Belo Horizonte, Brazil. Patient(s): Women with endometrioma who underwent laparoscopic excision of ovarian endometriotic cysts (n 16), and healthy, nonpregnant women (n 18, control group). Main Outcome Measure(s): Immunostaining and relative quantification of follistatin and FLRG mrna in ovarian endometriosis and eutopic endometrium. Result(s): Both ovarian endometriosis and healthy endometrium expressed and localized follistatin and FLRG. In endometriotic glands, follistatin immunostaining was homogeneously distributed throughout the cytoplasm of the epithelial cells, contrasting with normal eutopic endometrium, where follistatin expression was focal, irregular, and confined to the basal side of the glands. Follistatin-like protein was immunolocalized in the nuclei of both glandular epithelial cells and stromal cells, with less intense staining in endometriotic samples. The relative intensity of follistatin and FLRG immunostaining was significantly higher and lower, respectively, in endometriosis than in controls. The expression of follistatin mrna was higher, while that of FLRG mrna was lower, in ovarian endometriosis than in healthy eutopic endometrium. Conclusion(s): Ovarian endometriotic lesions show a deranged expression of FLRG and follistatin, which are activin A-binding proteins. This may result in an altered effect of activin A on angiogenesis and/or endometrial differentiation. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Key Words: Follistatin, FLRG, endometriosis, endometrium, activin A, angiogenesis Activin A is a dimeric protein, composed of two A subunits, that belongs to the transforming growth factor- superfamily, a group of structurally similar but functionally diverse growth factors involved in cellular proliferation, differentiation, and apoptosis (1). Human endometrium is an important source of activin A, because stromal and epithelial cells express activin A messenger RNA (mrna) and protein (2 9), and activin A expression and secretion increase during the menstrual cycle, reaching their highest levels in the secretory phase (4, 6, 8). Moreover, the human endometrium is a target for activin A, because the addition of activin A to cultured human endometrial stromal cells promotes the process of decidualization (10, 11). Received May 17, 2006; revised October 31, 2006; accepted November 16, Supported by grants from the Italian Ministry of University and Scientific Research, Rome, Italy, and the University of Siena, Siena, Italy. Presented in part at the World Meeting on Gynecological Pelvic Pain and Endometriosis, Milan, Italy, May 10 14, Reprint requests: Felice Petraglia, M.D., Section of Obstetrics and Gynecology, Department of Pediatrics, Obstetrics, and Reproductive Medicine, University of Siena, Le Scotte Viale Bracci, Siena, Italy (FAX: ; petraglia@unisi.it). The actions of activin A are primarily modulated by follistatin and follistatin-like protein (FLRG), which are activin-binding proteins that neutralize the biological effects of activin A (1). They are expressed by the human endometrium without significant variations throughout the menstrual cycle (8, 12), with increased expression early in pregnancy (7, 12 14). In addition, follistatin was shown to counteract activin A in stromal-cell decidualization (10, 11). Endometriosis is a gynecological condition in women of reproductive age, which primarily produces infertility and pain, and is defined as the presence of viable endometrial glands and stroma outside the uterine cavity, mainly on the pelvic peritoneum, but also in the ovaries and rectovaginal septum, and more rarely in other sites. Endometriomas are invaginations of ovarian surface epithelium that contain endometrial tissue, and are commonly referred to as ovarian cysts lined by endometrial tissue (15). The expression of activin A mrna was found to be reduced in ovarian endometriotic cells compared with healthy endometrium (5), and because activin A also inhibits angiogenesis (16) and modulates immune and inflammatory responses (17, 18), it was proposed that it may have an 200 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

209 impact on the pathogenesis of the disease (5, 9). The present study aimed to evaluate the expression and localization of follistatin and FLRG in ovarian endometriosis. MATERIALS AND METHODS Two groups of women were included in the study: group A, women with endometrioma who underwent laparoscopic excision of ovarian endometriotic cysts (n 16); and group B, healthy nonpregnant women (n 18, control group). Patients with endometrioma had an age range of years, and a cyst diameter measured by ultrasound in the range of mm; all were classified as having stage III or IV endometriosis according to the revised American Fertility Society classification of endometriosis (19). The diagnosis was confirmed by laparoscopic and histological examination of the endometriotic lesions. The control group had an age range of years, and consisted of women with regular menstrual cycles who underwent hysteroscopy for the evaluation of uterine-cavity morphology or laparoscopic tubal sterilization. Specimens were collected during the proliferative phase, initially determined from the number of days since the last menstrual period, and confirmed by ultrasound (20) and by the histological criteria of Noyes et al. (21). Subjects who had received steroid treatment during the past 6 months, and with pituitary, thyroid, or adrenal disorders, were excluded from the study. Informed consent was obtained from the women before their inclusion in the study, for which local institutional review board approval was granted. Representative samples of all ovarian endometriomas were cut from the cyst wall lined by endometriotic tissue. These endometriosis samples and endometrial specimens from controls were in part fixed by immersion in 10% buffered formalin for immunohistochemistry, and in part were immediately submerged in an RNA stabilization reagent (RNAlater; Qiagen, Milan, Italy) for extraction of total RNA and subsequent qualitative and semiquantitative reverse transcriptase-polymerase chain reaction (RT- PCR). Semiquantitative RT-PCR Differences in mrna expression between the control and study groups were estimated by semiquantitative RT- PCR, with the use of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as housekeeping gene. Samples were disrupted and homogenized with the use of Mixer Mill MM 300 (Qiagen), and total RNA was extracted with the RNeasy Protect Mini Kit and treated with RNase-free DNase according to the manufacturer s instructions (Qiagen). Total RNA was quantified by ultraviolet absorption at 260 nm. The reverse-transcription reaction was performed with a Thermoscript RT-PCR system (Invitrogen, Milan, Italy). First-strand cdna was synthesized with the use of 1 g total RNA. After denaturation, template RNA, oligo d(t) primers, and 10 mmol/l of dntp were mixed for 5 minutes at 65 C. Fifteen units of reverse transcriptase were added in the presence of complementary DNA (cdna) synthesis buffer (250 mmol/l Tris acetate, ph 8.4, 375 mmol/l potassium acetate, and 40 mmol/l stabilizer), 40 U RNase inhibitor, 0.1 mol/l dithiothreitol, and diethyl pyrocarbonate-treated water to make a volume of 20 L. The mixture was incubated at 50 C for 45 minutes, heated to 85 C for 5 minutes to stop the reaction, and stored at 20 C. Two microliters of the product were used for the PCR reaction. The PCR was performed under the following conditions: 20 mmol/l Tris-HCl (ph 8.4), 50 mmol/l KCl, 1.5 mmol/l MgCl 2, 25 mmol/l of each dntp, 1 U recombinant Taq DNA polymerase, and 0.4 mol/l (final concentration) primers (Invitrogen) in a 50- L total volume. The specific primers used to amplify cdna fragments corresponding to follistatin (Genebank accession no. J03771), common to both splice variants, were: 5=TGCCACCTGAGAAAGGC- TAC=3 (sense) and 5=ACAGACAGGCTCATCCGGC- TACT 3 (antisense) (included intron size, 904 base pairs (bp); expected size, 201 bp). The FLRG was amplified using primers of the sequence 5=ACCTGAGCGTCATGTACCG=3 (sense) and 5=TGTGGCACGAGGAGATGTAG=3 (antisense) (included intron size, 792 base pairs [bp]; expected size, 198 bp). The GAPDH primers were 5=GAAGGT- GAAGGTCGGAGTCA=3 (sense) and 5=CTGA- GAACGGGAAGCTTGTC=3 (antisense) (expected size, 300 bp). Computer analysis, performed to compare the synthesized oligomers with the human sequences in the gene database of the National Center for Biotechnology, using the BLAST program (22), revealed no significant homology to other genes or pseudogenes. The PCR for follistatin consisted of 30 thermal cycles of 94 C for 30 seconds, 50 C for 1 minute, and 72 C for 20 seconds. The PCR for FLRG consisted of 32 thermal cycles of 94 C for 30 seconds, 55 C for 30 seconds, and 72 C for 30 seconds, followed by a final step of 10 minutes at 72 C. The GAPDH amplification was carried out for 30 seconds at 94 C, 30 seconds at 52 C, and 30 seconds at 72 C for 28 cycles, followed by a final step of 10 minutes at 72 C. The number of PCR cycles was established after testing a range of cycles to ensure that the amount of DNA product remained in the logarithmic range of the amplification curve, so that reliable semiquantified comparisons could be made. Each sample had a negative control in which the reverse transcriptase was omitted in the reaction mixture so as to rule out genomic DNA contamination. A negative control without RNA was also used. Amplification products (15 L) were visualized on a 2% agarose gel stained with 4% ethidium bromide, and photographed under ultraviolet light. The expected bands were Fertility and Sterility 201

210 analyzed by densitometry analysis performed with Image J software (National Institutes of Health, Bethesda, MD), and the relative amounts of follistatin and FLRG mrnas were calculated as follistatin:gapdh and FLRG:GAPDH mrna ratios. Immunohistochemistry Formalin-fixed, paraffin-embedded specimens were cut into 4- m sections and stained by immunohistochemistry with the use of the avidin-biotin-peroxidase method. All samples and controls were processed together. After exposure to 1% H 2 O 2 in methanol to block endogenous peroxidase, sections were treated with normal goat serum (Oncogene Research Products, San Diego, CA) for 30 minutes to suppress nonspecific binding. For follistatin localization, rabbit anti-follistatin antiserum was diluted 1:500 in phosphate-buffered saline (PBS) containing 1% bovine serum albumin and applied on the slides for 12 hours at 4 C, as previously described (23). Rabbit anti-follistatin antiserum is a specific polyclonal antibody raised against recombinant human follistatin of 288 amino acids (FS-288). The specific polyclonal rabbit anti-flrg antibody was used as previously described (12,13,23). Sections were then treated with biotinylated goat antirabbit IgG (Oncogene Research Products) for 30 minutes at room temperature, washed in PBS, and incubated with the avidin-biotin-peroxidase complex (Oncogene Research Products) for 30 minutes. Peroxidase activity was visualized by exposing the sections for 3 minutes to 1 mg/ml 3,3=diaminobenzidine tetrahydrochloride (Sigma Chemical Co., St. Louis, MO) in PBS containing 0.3% H 2 O 2. Sections were then counterstained with hematoxylin. In the negative controls, the primary antibody was replaced by normal rabbit IgG (Oncogene Research Products) or normal rabbit serum at an equivalent dilution. Assessment of Staining The individual intensity of immunostaining of tissue sections was scored under light microscopy as follows: 0 for no staining, 1 for weak staining, 2 for moderate staining, 3 for strong staining, and 4 for strong and widespread staining. Epithelial and stromal tissues were analyzed and scored by two independent observers, blind to each patient s group. Interobserver agreement was 80%, and discordant cases were resolved by discussion with a third examiner. Statistical Analysis After assessment by the Kolmogorov-Smirnov test, normally distributed data were expressed as means SE, and differences between groups were evaluated by unpaired t-test. Otherwise, results were expressed as medians and analyzed by the Mann-Whitney U test. Significance was assumed when P.05. FIGURE 1 Representative RT-PCR bands of GAPDH (300 bp), follistatin (201 bp), and FLRG (198 bp) in human endometrium (Control) and ovarian endometriosis. m, size marker; nc, negative control. Charts represent mean SE of ratios between follistatin and GAPDH mrnas, and FLRG and GAPDH mrnas. *P.01, **P.001, versus control endometrium (t-test). Torres. Activin-binding proteins in endometriosis. Fertil Steril Torres et al. Activin-binding proteins in endometriosis Vol. 88, No. 1, July 2007

211 RESULTS Follistatin mrna Expression The RT-PCR generated a single fragment 201 bp long, corresponding in size to the predicted follistatin mrna fragment (201 bp) (Fig. 1). No amplified fragments caused by DNA contamination were detected in any of the experiments. When evaluated by semiquantitative RT-PCR, the expression of follistatin (expressed as the follistatin:gapdh mrna ratio) was significantly higher (P.001) in ovarian endometriosis than in eutopic endometrium (Fig. 1). FIGURE 2 Immunohistochemical localization of follistatin (A D) and FLRG (E H) in human endometrium (A,E,F) and endometriosis (B,C,G). Brown areas correspond to follistatin or FLRG expression in the epithelium (white arrowheads) and stroma (black arrows). Negative controls are also shown (D,H). Scale bar 50 m. Follistatin Peptide Localization Ovarian endometriosis expressed follistatin immunostaining in both the glandular epithelium and the stroma (Fig. 2B,C). In endometriotic glands, follistatin was homogeneously distributed throughout the cytoplasm of epithelial cells, in contrast with normal eutopic endometrium, where follistatin expression was focal, irregular, and confined to the basal side of the glands (Fig. 2A). In the stroma of endometriotic specimens, similar to normal eutopic endometrium, follistatin immunostaining was scattered and less intense compared to the epithelial compartment. The relative intensity of glandular follistatin immunostaining was significantly higher (P.01) in endometriosis than in controls (Fig. 3A). FLRG mrna Expression As shown in Figure 1, the predicted band corresponding in size to the FLRG (198 bp) product was obtained. No amplified fragments caused by DNA contamination were detected in any of the experiments. When evaluated by semiquantitative RT-PCR, the expression of FLRG mrna (expressed as FLRG:GAPDH mrna ratio) was significantly lower in ovarian endometriotic tissue than in healthy endometrium (P.01, Fig. 1). FLRG Peptide Localization In normal eutopic endometrium, FLRG was localized in the nuclei of both glandular epithelial cells and stromal cells (Fig. 2E,F), with a similar intensity and regularity of expression in both tissue compartments. On the other hand, in ovarian endometriotic tissue, FLRG expression was markedly less intense than in healthy eutopic endometrium, and showed weaker staining in the glands and stroma (Fig. 2G). The relative intensity of FLRG immunostaining was significantly lower (P.01) in endometriosis than in controls (Fig. 3B). Torres. Activin-binding proteins in endometriosis. Fertil Steril DISCUSSION The present study showed that ovarian endometriotic implants express and localize follistatin and FLRG, supporting the concept that endometriotic cells, more than healthy human endometrium (6, 8, 12, 13, 23), have the capacity to synthesize activin A-related proteins. Although these proteins are defined as activin-binding (1), they showed opposite changes in endometriosis: the mrna expression and the intensity of staining of follistatin were significantly higher, while those of FLRG were lower, in endometriosis than in healthy endometrium. This is not surprising, considering that follistatin and FLRG also show different tissue-expression profiles: FLRG is highly expressed in the placenta, testis, skin, and cardiovascular tissue, while follistatin expression is considerably higher in the pituitary and ovary (24). Even in the same biological process (e.g., wound healing), follistatin and FLRG distribution Fertility and Sterility 203

212 FIGURE 3 Scores of follistatin (A) and FLRG (B) immunostaining in human endometrium and ovarian endometriosis, expressed as medians and quartiles. *P.01 versus controls (Mann-Whitney U test). activin A-binding proteins, point to a derangement of the activin A pathway in endometriosis. Indeed, follistatin and FLRG regulate the interaction of activin A with its receptors, and hence its biological availability (1). Thus, activin A induces endometrial decidualization, while the addition of follistatin prevents such an effect (10, 11). The findings that [1] activin A inhibits, while follistatin induces, angiogenesis (16); [2] activin receptors are expressed by endothelial cells (26) and endometrial blood vessels (6); and [3] FLRG is expressed by vessel walls of the human endometrium (12, 13, 23) together underscore the putative role played by activin A in endometrial angiogenesis. Indeed, endometriotic cells require a viable blood supply to develop, and increased angiogenic activity is involved in the pathogenesis of the disease (15). The increased expression of follistatin in endometriotic implants may reduce the tissue availability of free activin A, thereby favoring local angiogenesis. The reduced expression of FLRG in endometriotic cells does not fit in with this hypothesis, but other mechanisms of action may be suggested. Indeed, FLRG is able to modulate fibronectin-mediated cell-cell or cell-matrix adhesions in hematopoietic cells (27), and because fibronectin is a potential regulator of endometriosis implant attachment in the peritoneal cavity (28 30), a synergistic effect of FLRG and fibronectin in the pathogenesis of endometriosis may be suggested. Torres. Activin-binding proteins in endometriosis. Fertil Steril within the wound differs, because distinct factors regulate their respective expressions (25). The differences that we observed in follistatin expression between endometriosis and normal endometrium appear to be of greater magnitude at the mrna rather than the protein level, although only semiquantitative methods were employed. Actually, part of the follistatin produced in the cell is secreted, and is not kept bound to the membrane or in the cytoplasm. Thus, immunohistochemistry may not detect the whole amount of protein being produced in the tissue, while RT-PCR seems to indicate that the follistatin gene has been transcribed at a higher level in endometriosis. Previous findings of reduced expression of activin A mrna in cells isolated from endometriotic cysts (5), together with the present data on the different expression of In conclusion, we showed that follistatin and FLRG are differently expressed in ovarian endometriosis and normal endometrium in the proliferative phase. These differences may account for a local distinct pattern of activin A modulation, which in turn may have important effects in the pathophysiology of endometriosis. The possible roles of follistatin and FLRG in the pathogenesis of endometriosis warrant further investigation, to determine whether their effects are mediated by the local activin pathway or through distinct actions upon the attachment, persistence, and progression of ectopic tissue. Acknowledgments: The authors thank R. Rimokh, M.D., and V. Maguer- Satta, M.D. (INSERM U590, Centre Léon Bérard, Lyon, France), for providing FLRG antibody; Wylie W. Vale, M.D. (Clayton Foundation Laboratories for Peptide Biology, Salk Institute, La Jolla, CA), for providing follistatin antibody; and A.F. Camargos, M.D., and M.M. Carneiro, M.D. (Department of Obstetrics and Gynecology, and Department of Physiology, University of Minas Gerais, Belo Horizonte, Brazil), and L. Galleri, M.D., M. Mazzini, M.D., and J.A. Talarico, M.D. (Department of Pediatrics, Obstetrics, and Reproductive Medicine, University of Siena, Siena, Italy), for their unconditional help in the development of this study. REFERENCES 1. Harrison CA, Gray PC, Vale WW, Robertson DM. Antagonists of activin signaling: mechanisms and potential biological applications. Trends Endocrinol Metab 2005;16: Petraglia F, Florio P, Luisi S, Gallo R, Gadducci A, Vigano P, et al. Expression and secretion of inhibin and activin in normal and neoplastic uterine tissues. High levels of serum activin A in women with 204 Torres et al. Activin-binding proteins in endometriosis Vol. 88, No. 1, July 2007

213 endometrial and cervical carcinoma. J Clin Endocrinol Metab 1998;83: Otani T, Minami S, Kokawa K, Shikone T, Yamoto M, Nakano R. Immunohistochemical localization of activin A in human endometrial tissues during the menstrual cycle and in early pregnancy. Obstet Gynecol 1998;91: Jones RL, Salamonsen LA, Critchley HO, Rogers PA, Affandi B, Findlay JK. Inhibin and activin subunits are differentially expressed in endometrial cells and leukocytes during the menstrual cycle, in early pregnancy and in women using progestin-only contraception. Mol Hum Reprod 2000;6: Reis FM, Di Blasio AM, Florio P, Ambrosini G, Di Loreto C, Petraglia F. Evidence for local production of inhibin A and activin A in patients with ovarian endometriosis. Fertil Steril 2001;75: Jones RL, Salamonsen LA, Zhao YC, Ethier JF, Drummond AE, Findlay JK. Expression of activin receptors, follistatin and betaglycan by human endometrial stromal cells; consistent with a role for activins during decidualization. Mol Hum Reprod 2002;8: Jones RL, Salamonsen LA, Findlay JK. Potential roles for endometrial inhibins, activins and follistatin during human embryo implantation and early pregnancy. Trends Endocrinol Metab 2002;13: Florio P, Severi FM, Luisi S, Ciarmela P, Calonaci G, Cobellis L, et al. Endometrial expression and secretion of activin A, but not follistatin, increase in the secretory phase of the menstrual cycle. J Soc Gynecol Invest 2003;10: Florio P, Rossi M, Sigurdardottir M, Ciarmela P, Luisi S, Viganò P, et al. Paracrine regulation of endometrial function: interaction between progesterone and corticotropin-releasing factor (CRF) and activin A. Steroids 2003;68: Jones RL, Salamonsen LA, Findlay JK. Activin A promotes human endometrial stromal cell decidualization in vitro. J Clin Endocrinol Metab 2002;87: Tierney EP, Giudice LC. Role of activin A as a mediator of in vitro endometrial stromal cell decidualization via the cyclic adenosine monophosphate pathway. Fertil Steril 2004;81: Florio P, Ciarmela P, Toti P, Maguer-Satta V, Rimokh R, Buonocore G, et al. Human endometrium and decidua express follistatin-related gene (FLRG) mrna and peptide. Mol Cell Endocrinol 2004;218: Ciarmela P, Florio P, Toti P, Franchini A, Maguer-Satta V, Ginanneschi C, et al. Human placenta and fetal membranes express follistatin-related gene mrna and protein. J Endocrinol Invest 2003;26: Petraglia F, Gallinelli A, Grande A, Florio P, Ferrari S, Genazzani AR, et al. Local production and action of follistatin in human placenta. J Clin Endocrinol Metab 1994;78: Giudice LC, Kao LC. Endometriosis. Lancet 2004;364: Kozian DH, Ziche M, Augustin HG. The activin-binding protein follistatin regulates autocrine endothelial cell activity and induces angiogenesis. Lab Invest 1997;76: Petraglia F, Sacerdote P, Cossarizza A, Angioni S, Genazzani AD, Franceschi C, et al. Inhibin and activin modulate human monocyte chemotaxis and human lymphocyte interferon-gamma production. J Clin Endocrinol Metab 1991;72: Jones KL, de Kretser DM, Patella S, Phillips DJ. Activin A and follistatin in systemic inflammation. Mol Cell Endocrinol 2004;225: The American Fertility Society. Revised American Fertility Society classification of endometriosis: Fertil Steril 1985;43: Severi FM, Bocchi C, Florio P, Cobellis L, Ignacchiti E, Petraglia F. Transvaginal ultrasonography in women receiving emergency contraception. Fertil Steril 2003;79: Noyes RW, Hertig AT, Rock J. Dating the endometrial biopsy. Fertil Steril 1950;1: Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25: Ciarmela P, Florio P, Sigurdardottir M, Toti P, Maguer-Satta V, Rimokh R, et al. Follistatin-related gene expression, but not follistatin expression, is decreased in human endometrial adenocarcinoma. Eur J Endocrinol 2004;151: Tortoriello DV, Sidis Y, Holtzman DA, Holmes WE, Schneyer AL. Human follistatin-related protein: a structural homologue of follistatin with nuclear localization. Endocrinology 2001;142: Wankell M, Kaesler S, Zhang YQ, Florence C, Werner S, Duan R. The activin binding proteins follistatin and follistatin-related protein are differentially regulated in vitro and during cutaneous wound repair. J Endocrinol 2001;171: McCarthy SA, Bicknell R. Activin-A binds to a heterotrimeric receptor complex on the vascular endothelial cell surface. Evidence for a type 3 activin receptor. J Biol Chem 1994;269: Maguer-Satta V, Forissier S, Bartholin L, Martel S, Jeanpierre S, Bachelard E, et al. A novel role for fibronectin type I domain in the regulation of human hematopoietic cell adhesiveness through binding to follistatin domains of FLRG and follistatin. Exp Cell Res 2006;312: Beliard A, Donnez J, Nisolle M, Foidart JM. Localization of laminin, fibronectin, E-cadherin, and integrins in endometrium and endometriosis. Fertil Steril 1997;67: Garcia-Velasco JA, Arici A. Interleukin-8 stimulates the adhesion of endometrial stromal cells to fibronectin. Fertil Steril 1999;72: Kauma S, Clark MR, White C, Halme J. Production of fibronectin by peritoneal macrophages and concentration of fibronectin in peritoneal fluid from patients with or without endometriosis. Obstet Gynecol 1988;72:13 8. Fertility and Sterility 205

214 TECHNIQUES AND INSTRUMENTATION Intelligent, impedance-regulated, pulsed coagulation in a porcine renal artery model Christian Wallwiener, Cand. Med., a Markus Wallwiener, Cand. Med., a Eva Neunhoeffer, M.D., a Michael Menger, M.D., b Keith Isaacson, M.D., c and Wolfgang Zubke, M.D. a a Department of Obstetrics and Gynecology, University of T ubingen, T ubingen, Germany; b Institute for Clinical and Experimental Surgery, University of Saarland, Homburg, Germany; and c Director of Minimally Invasive Gynecologic Surgery and Infertility, Newton Wellesley Hospital, Harvard Medical School, Boston, Massachusetts Objective: To compare the efficacy of conventional pulsed coagulation (CPC) and newly developed intelligent, impedance-regulated, pulsed coagulation (IPC) in the sealing of porcine renal arteries. Design: Prospective, randomized experimental study. Setting: Isolated porcine artery model in an academic research environment. Animal(s): Female Swabian Hall pigs. Intervention(s): Renal arteries were harvested from Swabian pigs, flushed with saline, and sealed with bipolar open forceps by using high-frequency modulations of CPC (CPC-I: 800-ms pulse, 30-ms pause; CPC-II: 800-ms pulse, 300-ms pause) or IPC (self-regulation of the current flow to tissue impedance during thermal alteration). Additional vessels underwent multiple CPC. Burst pressure and seal failure were measured by increasing the pressure in the sealed arteries with saline infusion until rupture of the seal or the vessel wall. Main Outcome Measure(s): Mean burst pressure, number of instant and secondary seal failures, and relation of burst pressure to vessel diameter. Result(s): Mean burst pressure after IPC ( mm Hg) was statistically significantly higher than that after CPC (CPC-I: mm Hg; CPC-II: mm Hg). Only 5.0% of the vessel seals after IPC, but 34.0% and 39.5% after CPC-I and CPC-II, showed instant or secondary seal failures, which also was a statistically significant difference. Seal quality after multiple CPC was comparable to that observed after the single IPC application (burst pressure, [MCPC-I] mm Hg and mm Hg [MCPC-II]; seal failure rate, 0). Conclusion(s): In an isolated porcine renal artery model, self-regulating modulation of energy-based vessel coagulation achieved superior thermal fusion of vascular tissue than did CPC. This promising novel technique should be analyzed further to determine its in vivo efficacy in long-term studies. (Fertil Steril Ò 2007;88: Ó2007 by American Society for Reproductive Medicine.) Key Words: Vessel sealing, bipolar coagulation, burst pressure, burst strength Increasing numbers of minimally invasive laparoscopic procedures are being introduced into gynecological surgery (1, 2). Laparoscopic myectomy shortens hospitalization, accelerates recovery, lowers expenses, reduces pain, lessens blood loss, and decreases the extent of adhesions (3). In the laparoscopic management of ovarian remnants, electrocoagulation Received June 22, 2006; revised and accepted November 8, Supported by the German Ministry of Education and Research (BMBF) (Berlin, Germany) within the project Minimal invasive Technologie und Therapieverfahren (grant 16SV 1352) and by a research grant from ERBE Elektromedizin GmbH (T ubingen, Germany). Presented as a poster at the 33rd Annual Meeting of the American Association of Gynecological Laparoscopists in San Francisco, California, November 10 13, In addition, a summary of the findings was presented at the 14th Annual Congress of the International Society for Gynecological Endoscopy, London, United Kingdom, April 2 6, Reprint requests: Christian Wallwiener, Cand. Med., Department of Obstetrics and Gynecology, University of T ubingen, Calwerstrasse 4, T ubingen, Germany (FAX: ; cwallwiener@gmx.net). with bipolar forceps for ablation of tissue was less traumatic and decreased the number of recurrences, conversions to laparotomy, and postoperative complications (4). Nonetheless, an unacceptably high number of complications can occur with more complex laparoscopic interventions (5, 6). Vessel sealing during laparoscopic procedures with electrosurgical methods using bipolar current has been widely introduced over the past decade (1, 7 10). Bipolar, sealinginduced hemostasis can withstand high intraluminal pressures (10 14) and therefore offers an alternative to suturing, resulting in reduced blood loss (15, 16). The seals are intrinsic to the vessel wall structure, are not adhesiogenic, and cannot be dislodged like some clips used for hemostasis (10, 17). The quality of vessel sealing, however, is often suboptimal (2, 9, 11). Manipulation to disengage the sealing instrument can weaken the seal (9). Excessive heat increases charring and stickiness of the sealed tissue, resulting in tissue necrosis and hemorrhagic complications (18). Thermal spread to 206 Fertility and Sterility â Vol. 88, No. 1, July /07/$32.00 Copyright ª2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

215 adjacent tissues can induce bowel injury, one of the most hazardous complications (2, 19, 20). Conventional pulsed bipolar coagulation (CPC) has been shown to lead to adequate vessel sealing (3, 4, 8, 10, 11). The methods used so far, however, have been based on a pulse frequency not regulated by impedance but dependent on a preset relationship between pulse and pause duration. As tissue impedance increases because of thermal alteration, the current during the pulse decreases considerably and, after a certain point, even decreases to such an extent that the resulting heat energy, as dictated by Joule s Law, is too low to maintain the optimum tissue temperature needed for coagulation. During CPC, as tissue impedance continues to increase to higher levels, the fraction of the pulse during which current flow is not sufficient also lengthens. We developed a new modulation of CPC in which, unlike CPC, an electrical feedback mechanism based on the degree of denaturation and desiccation of tissue regulates the duration of pulses and of pulse-pause sequences. As soon as current flow decreases to a defined level as a response to the increasing impedance, the pause and the next pulse are initiated automatically, thus avoiding longer fractions of pulses during which the current is too low to ensure the optimum tissue temperature. This dynamic time sequencing not only shortens the process as a whole, it also ensures a higher overall current. We termed this new modulation intelligent, impedance-regulated, pulsed coagulation (IPC). The aim of the present study was to establish whether the safety and reliability of vessel sealing with IPC is superior to that of CPC. MATERIALS AND METHODS The study was approved by the Research Programs Council of the University of T ubingen and the European Academy of the European Society of Gynecological Endoscopy. The authors advised ERBE Elektromedizin GmbH, T ubingen, Germany, on the development of the new technique, without any financial gain. Study Design One hundred thirty-two renal arteries were harvested from female Swabian Hall pigs (weight range, kg). The specimens were dissected and the diameters determined. The vessels were thoroughly flushed with normal saline to remove all blood. They were then stretched across a titanium adapter and secured with purse-string sutures to a pressure application device. Figure 1 shows the experimental setup. Three different modulations of electrothermal energy were applied to test their efficacy in vascular coagulation. The vessels were randomly assigned to a specific coagulation mode. Two were CPC modes with a tissue-independent pulse frequency: pulse duration of 800 ms, with a pause lasting 30 ms (CPC-I group; n ¼ 50) or 300 ms (CPC-II group, n ¼ 43). The third modulation (IPC group; n ¼ 20) was designed to be intelligent and to regulate itself in a single coagulation procedure in response to the changing tissue impedance during thermal alteration (Fig. 2). In line with clinical practice, some additional vessels underwent multiple coagulation (three times) with CPC-I and CPC-II (MCPC-I and MCPC- II). The investigation therefore included five groups of vessels. Vessel sealing was performed by using bipolar open forceps (ERBE BiClamp) and a pulsed high-frequency generator (ERBE VIO 300 D). Coagulation with the two-jawed clamp was triggered via a pedal, and visual and audio signals indicated that the process was completed. The pedal then was released. The system generator and the surgical instrument used in the experiment are already in extensive use in laparoscopic surgery. The forceps pressure was standardized by a sprung handle. During the heating process, all relevant information on current, voltage, and impedance was recorded digitally. The completed seal was visually inspected for discoloring, flatness, and translucency. After sealing, the burst pressure was determined as a measure of seal quality by a different operator, who did not know which mode had been used to seal the vessel. Saline was infused to gradually increase the perfusion pressure by 20 mm Hg/s under constant pressure monitoring, until either the seal or the vessel wall burst. The pressure at which this occurred was defined as the burst pressure in millimeters of mercury. Vessels with seals that did not resist a pressure of 80 mm Hg were considered instant seal failures, and those that did not resist pressures of %200 mm Hg were considered secondary seal failures. Vessels with seals that resisted a pressure of 200 mm Hg were considered successful seals. Statistical Analysis Data are given as mean SEM. After demonstrating normal distribution and homogeneity of variance across groups, differences between groups (burst pressure) were calculated by one-way analysis of variance, followed by an appropriate post hoc test, including the correction of the alpha error to compensate for multiple comparisons. Fisher s exact test was used for the analysis of differences in rates and proportions (seal failures). Overall statistical significance was set at P<.05. The Statistical Package for Social Sciences (SPSS, version 11.5 for Windows; SPSS Inc., Chicago, IL) was used for statistical analysis. RESULTS Application of Single CPC vs. Single IPC In the first part of the study, single CPC-I (n ¼ 50) and single CPC-II (n ¼ 43) were compared with single IPC (n ¼ 20). The mean vessel diameter did not differ between the three groups (P>.05; Table 1). The mean burst pressure achieved after IPC ( mm Hg) was significantly higher (P<.001) than that measured after CPC-I ( mm Hg) and CPC-II ( ). The pressures achieved Fertility and Sterility â 207

216 FIGURE 1 Coagulation process (a and b) and pressure application device (c and d). Wallwiener. Intelligent pulsed vessel coagulation. Fertil Steril in CPC-I sealed arteries did not differ significantly from those observed in CPC-II sealed arteries (P>.05). In the IPC group, instant seal failures were seen in 5.0% of the vessels studied, and successful sealing was observed in 95.0%. In contrast, CPC-I produced 28.0% instant and 6.0% secondary seal failures, and only 66.0% of the single CPC-I seals were considered successful. Similar results were found for CPC-II, which produced 32.6% instant and 7.0% secondary seal failures, and only 60.5% of the single CPC-II seals were considered successful. Thus, the overall seal failure after IPC was significantly (P<.05) lower than that observed after CPC-I and CPC-II (Table 1). Application of Multiple CPC vs. Single IPC In the second part of the study, multiple CPC was compared with the results of single IPC (n ¼ 20). Multiple CPC consisted of applying the coagulation mode three times in repetition. A total of 19 vessels were subjected to multiple coagulation, 9 of them with CPC-I and 10 of them with CPC-II. The mean vessel diameter did not differ between the three groups (P>.05; Table 2). The mean burst pressures achieved by these modes of coagulation did not differ significantly from that observed after single coagulation with IPC (P>.05; Table 2). In addition, both multiple CPC-I and multiple CPC-II did not produce any instant or secondary seal failures (Table 2). Accordingly, the rate of seal failures of multiple CPC was not different from that observed after single ICP. Relationship Between Burst Strength and Vessel Diameter A clear inverse relationship between burst pressure and vessel diameter was seen. The mean burst pressure of sealed blood vessels with diameters of <4 mm was mm Hg. Renal arteries with larger diameters (R4 mm) showed a significantly (P<.05) lower burst pressure when compared with that measured in the smaller blood vessels (Fig. 3). DISCUSSION The widespread use of heating tissue to achieve coagulation is primarily driven by the availability of and improvement in technologies that perform this efficiently, but not by a detailed understanding of the bio-thermomechanics of the process (21). Improvements in instrumentation and technology have made a significant contribution to the consistent advances in laparoscopic surgery. Every improvement, however, generates new complications, and the introduction of energy-based vessel ligation has been no exception. Thermal fusion is influenced by the amount of heat input over time and the length of time that the heat is applied. In bipolar coagulation, the interaction between impedance and current creates the high temperatures necessary for vessel 208 Wallwiener et al. Intelligent pulsed vessel coagulation Vol. 88, No. 1, July 2007

217 FIGURE 2 Pulse initiation in IPC (upper panel) and CPC (lower panel). In IPC, the pulses are initiated when current flow decreases to a certain level. Pulse initiation is therefore impedance dependent, whereas in CPC, pulse initiation is based on a predetermined relationship between pulse and pause. Wallwiener. Intelligent pulsed vessel coagulation. Fertil Steril coagulation, and the change in tissue impedance indirectly indicates when this temperature has been reached. Pulsed coagulation appears to generate vapor zones with high impedance during the pulse. The current, seeking the path of lowest impedance, generates a high-energy density around these zones, leading to additional thermal effects. During the pause, while the forceps and the tissue are cooling, the vapor condenses and the moisture returns. During subsequent pulses, this process is repeated until uniform coagulation is achieved (7, 8). Denaturation of collagen is enhanced through hydration by decreasing its stability (21); therefore, continuous hydration during pulsed coagulation may very well lead to increased seal quality (7, 8). Vessels can be successfully coagulated with CPC (8, 10, 11), but until now, most pulsed bipolar coagulation methods in current use are based on a predetermined pulse frequency with fixed bursts and pauses. They are dependent on impedance but do not regulate themselves on it. Because of the variability of vascular tissue and vessel size, this may result in overcoagulation or inadequate ligation, which both lead to seal failure. Conventional coagulation can take %12 seconds and, in our study, resulted in seal failures in a high number of cases. We suggest that this is primarily a result of the long fraction of the pulse during which the current decreases and the energy density is reduced. This fraction increases as the coagulation process advances, whereas the pulse and pause intervals remain constant. The result is that the overall current and energy density is too low to ensure the high temperature and rapid increase in temperature that were required for thermal fusion. To overcome this limitation, we developed a new modulation of the alternating current required, aiming to achieve IPC with a dynamic modulation process, in which the duration of pulses and pulse-pause sequences adapts itself to increasing tissue impedance. The adaptive initiation of subsequent pulses leads to a higher energy input per time unit and a more rapid rise in temperature, leaving the tissue to cool only during the pause designed for this very purpose. The present study evaluated the newly developed modulation of our coagulation software in an isolated porcine renal-artery model. We found that single application of our newly TABLE 1 Coagulation of porcine renal arteries by using CPC, compared with IPC. Parameter CPC-I CPC-II ICP Total no. of vessels (n) Mean vessel diameter (mm) Instant seal failures, n (%) 14 (28.0) a 14 (32.6) b 1 (5.0) Secondary seal failures, n (%) 3 (6.0) 3 (7.0) 0 (0.0) Overall seal failures, n (%) 17 (34.0) b 17 (39.6) b 1 (5.0) Successful seals, n (%) 33 (66.0) b 26 (60.5) b 19 (95.0) Mean burst pressure (mm Hg) Note: Data are mean SEM. a P¼.05. b P<.05 vs. ICP. Wallwiener. Intelligent pulsed vessel coagulation. Fertil Steril Fertility and Sterility â 209

218 TABLE 2 Coagulation of porcine renal arteries by using multiple CPC (mcpc), compared with by using IPC. Coagulation mode mcpc-i mcpc-ii ICP Total no. of vessels (n) Mean vessel diameter (mm) Instant seal failures, n (%) 0 (0.0) 0 (0.0) 1 (5.0) Secondary seal failures, n (%) 0 (0.0) 0 (0.0) 0 (0.0) Successful seals, n (%) 9 (100.0) 10 (100.0) 19 (95.0) Mean burst pressure (mm Hg) Note: Data are mean SEM and are not significantly different among the three groups. Wallwiener. Intelligent pulsed vessel coagulation. Fertil Steril developed technique was significantly better than the coagulation methods in conventional use. Nonetheless, these results should be interpreted with caution until the results of in vivo follow-up studies are available. One limitation of our study is that despite randomization, the operator was aware of the coagulation technique in use, thus introducing potential bias. However, most parameters that potentially could be influenced, such as the pressure applied and the duration of the sealing process, were standardized, and the different modes were used according to FIGURE 3 Seal strength (B) given in relation to vessel diameter (A) after conventional or intelligent pulsed coagulation of porcine renal arteries. Data are grouped according to vessel diameter; that is, vessels with diameters <4 mm (group 1, light blue bars), R4 mm and <6 mm (group 2, semiblue bars), and R6 mm (group 3, dark blue bars). Note the inverse relationship, indicating decreasing seal strength with increasing vessel diameters. Data are mean SEM. *P<.05 vs. group 1. # P<.05 vs. group 2. Vessel diameter [mm] A * # * * Gr-1 Gr-2 Gr-3 Gr-1 Gr-2 Gr-3 Wallwiener. Intelligent pulsed vessel coagulation. Fertil Steril B * Seal strength [mmhg] a randomized scheme. Only after preparing the vessel and before the sealing process did the operator change the mode according to the randomized study protocol. Another limitation of our study is the lack of follow-up data inherent in the model chosen. Also, the dissection of the arteries may have caused damage to the vessels tested. However, this appears unlikely, because all due care was taken. Unlike other study groups, we used bloodless coagulation in our experiments. To study the effect of the different current modulations on the vessel wall and the ensuing seal with only a minimum of variables, all blood was flushed from the vessel before testing. We believe that isolated preserved blood would not ideally mimic the clinical situation and that the specific effect of blood perfusion on the process of coagulation can be determined only in vivo. Other reports have shown that arteries with a diameter of >5 mm show a higher rate of seal failures (11). In the present study, analysis of the relationship between vessel size and burst pressure confirmed that the seal quality was better the smaller the vessel, suggesting that the burst pressure decreases reciprocally with an increase in vessel diameter. Our results further show that IPC led to successful seals in 95% of vessels, whereas CPC-I led to only 66%, and CPC- II, only 61%. The number of seal failures in our study was higher than that in other studies, where only 5% 25% of seal failures occurred (8 10). This is probably because we used a very strict definition for failure (burst pressure of <200 mm Hg), because we believe that a rigorous approach is required when testing new technology. Moreover, in this study, vessels with relatively large diameters were studied, and all failures, including technical failures, were included in the analysis, which also would have contributed to the higher number of failures. Multiple CPC in our experimental setting not only took longer but did not lead to a superior sealing quality than was achieved after single coagulation with IPC. It therefore appears that multiple coagulation is not superior to IPC, may cause more lateral thermal damage, and may carry a higher risk of rupture. However, because no prior reports on consecutive coagulation of vessels under experimental 210 Wallwiener et al. Intelligent pulsed vessel coagulation Vol. 88, No. 1, July 2007

219 conditions were found in the literature, and given the small number of vessels in this part of our study, the implications of these results should be viewed with caution. In conclusion, this study in a porcine renal artery model demonstrates that in this specific setting, a new, intelligent, impedance-regulated modulation of energy-based vessel coagulation appears to achieve safer thermal fusion of vascular tissue than do commonly used methods. Unlike CPC, in which the coagulation process is preset by the operator, with IPC, the current flow is regulated by the impedance feedback from the tissue being coagulated. This promising technique requires further investigation in vivo, including long-term analyses. Acknowledgments: The authors thank Ralf Klein, Dipl.-Ing., for technical support and Alistair Reeves, B.A., for editorial assistance. REFERENCES 1. Philosophe R. Avoiding complications of laparoscopic surgery. Fertil Steril 2003;80(Suppl 4): Tulikangas PK, Smith T, Falcone T, Boparai N, Walters MD. Gross and histologic characteristics of laparoscopic injuries with four different energy sources. Fertil Steril 2001;75: Hurst BS, Matthews ML, Marshburn PB. Laparoscopic myomectomy for symptomatic uterine myomas. Fertil Steril 2005;83: Nezhat C, Kearney S, Malik S, Nezhat C, Nezhat F. Laparoscopic management of ovarian remnant. Fertil Steril 2005;83: Harkki-Siren P, Kurki T. A nationwide analysis of laparoscopic complications. Obstet Gynecol 1997;89: Hershlag A, Markovitz J. Is laparoscopy back? Fertil Steril 2005;84: Isaacson K. New developments in radiofrequency technology for laparoscopic surgery. Contemp Ob Gyn 2002;47: Presthus JB, Brooks PG, Kirchhof N. Vessel sealing using a pulsed bipolar system and open forceps. JAm Assoc Gynecol Laparosc 2003;10: Spivak H, Richardson WS, Hunter JG. The use of bipolar cautery, laparosonic coagulating shears, and vascular clips for hemostasis of small and medium-sized vessels. Surg Endosc 1998;12: Kennedy JS, Stranahan PL, Taylor KD, Chandler JG. High-burststrength, feedback-controlled bipolar vessel sealing. Surg Endosc 1998; 12: Pietrow PK, Weizer AZ, L Esperance JO, Auge BK, Silverstein A, Cummings T, et al. PlasmaKinetic bipolar vessel sealing: burst pressures and thermal spread in an animal model. J Endourol 2005;19: Heniford BT, Matthews BD, Sing RF, Backus C, Pratt B, Greene FL. Initial results with an electrothermal bipolar vessel sealer. Surg Endosc 2001;15: Harold KL, Pollinger H, Matthews BD, Kercher KW, Sing RF, Heniford BT. Comparison of ultrasonic energy, bipolar thermal energy, and vascular clips for the hemostasis of small-, medium-, and large-sized arteries. Surg Endosc 2003;17: Novitsky YW, Rosen MJ, Harrell AG, Sing RF, Kercher KW, Heniford BT. Evaluation of the efficacy of the electrosurgical bipolar vessel sealer (LigaSure) devices in sealing lymphatic vessels. Surg Innov 2005;12: Levy B, Emery L. Randomized trial of suture versus electrosurgical bipolar vessel sealing in vaginal hysterectomy. Obstet Gynecol 2003;102: Tamussino K, Afschar P, Reuss J, Perschler M, Ralph G, Winter R. Electrosurgical bipolar vessel sealing for radical abdominal hysterectomy. Gynecol Oncol 2005;96: Katkhouda N, Mavor E, Friedlander MH, Mason RJ, Kiyabu M, Grant SW, et al. Use of fibrin sealant for prosthetic mesh fixation in laparoscopic extraperitoneal inguinal hernia repair. Ann Surg 2001;233: Harrell AG, Kercher KW, Heniford BT. Energy sources in laparoscopy. Semin Laparosc Surg 2004;11: Tulikangas PK, Beesley S, Boparai N, Falcone T. Assessment of laparoscopic injuries by three methods. Fertil Steril 2001;76: El-Banna M, Abdel-Atty M, El-Meteini M, Aly S. Management of laparoscopic-related bowel injuries. Surg Endosc 2000;14: Wright NT, Humphrey JD. Denaturation of collagen via heating: an irreversible rate process. Annu Rev Biomed Eng 2002;4: Fertility and Sterility â 211

220 Medical management of early pregnancy failure in a patient with coronary artery disease David N. Hackney, M.D., Mitchell D. Creinin, M.D., and Hyagriv Simhan, M.D., M.S.C.R. Department of Obstetrics, Gynecology, and Reproductive Sciences, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania Objective: To describe a case of early pregnancy failure in a patient who was not an optimal candidate for suction aspiration because of her body habitus and history of a myocardial infarction that was treated medically with misoprostol. Design: Case report. Setting: Academic tertiary-care hospital. Patient: A 43-year-old woman with morbid obesity, coronary artery disease, previous myocardial infarction, obstructive sleep apnea, and other medical problems who presented with an early pregnancy failure. Intervention: Medical management with 800 g of vaginal misoprostol in an inpatient setting with cardiac monitoring. Main Outcome Measure(s): Ultrasonographic resolution of intrauterine pregnancy, vaginal bleeding, and cardiac events. Result(s): No gestational sac was visualized by ultrasound on the second hospital day, the patient s hemoglobin value at discharge was 12.1 mg/dl, and no adverse cardiac events occurred. Conclusion(s): Medical management with misoprostol on an inpatient basis is a possible alternative to dilation and curettage in patients with complex medical problems and early pregnancy failure. (Fertil Steril 2007;88: 212.e by American Society for Reproductive Medicine.) Key Words: Misoprostol, early pregnancy failure, medical management, obesity, cardiac, myocardial infarction Vacuum aspiration has generally been considered the standard treatment for cases of early pregnancy failure that require intervention. When performed by an experienced operator in a patient of normal weight, vacuum aspiration has an extremely low complication rate, and can often be accomplished with only local anesthesia. However, such procedures are generally performed in young, healthy women. Complications of pregnancy, regardless of outcome, significantly increase in the presence of medical comorbidities. The ability of a woman to handle surgical stress is compromised by conditions such as coronary artery disease (CAD) and obesity. With morbid obesity also comes the physical difficulty of successfully obtaining adequate visualization for instrumentation of the cervix and uterus without the need for general or regional anesthesia. The use of misoprostol for the medical management of early pregnancy failure is an effective alternative to vacuum aspiration (1 6), and an attractive alternative in patients who may be at greater risk for surgical complications. We present the case of a 43-year-old patient with morbid obesity, cardiovascular disease, and other medical comorbidities who Received June 13, 2006; revised and accepted November 1, Reprint requests: David N. Hackney, M.D., Department of Obstetrics, Gynecology, and Reproductive Sciences, Magee-Womens Hospital, University of Pittsburgh School of Medicine, 300 Halket Street, Pittsburgh, Pennsylvania (FAX: ; dhackney@ mail.magee.edu). underwent treatment for early pregnancy failure with the use of vaginal misoprostol during inpatient observation. CASE REPORT A 43-year-old G 2 P 0 Sab 1 woman presented for consultation at 7 weeks and 5 days of estimated gestation because of significant medical conditions. She had weighed in excess of 180 kg prior to undergoing a gastric bypass in Her weight at the time of her visit was 130 kg with a body mass index (BMI) of 55, consistent with morbid obesity. She had undergone two angioplasties for CAD before experiencing a myocardial infarction in Her baseline cardiac function was New York Heart Association class 2 3 (7), based on angina with exertion that limited her activity level to no more than walking at a slow pace. Her last exercise stress test had been performed 4 years earlier, and had been terminated due to shortness of breath at 85% maximum predicted heart rate. However, there were no signs on her electrocardiogram to suggest ischemia. A single-photon emission computed tomography scan had also been performed 4 years earlier, and showed a fixed inferior wall defect in the distribution of the right coronary artery. The ejection fraction was 61%, with mild inferior wall hypokinesis. In addition to her cardiac disease, the patient had obstructive sleep apnea necessitating continuous positive airway pressure, type II diabetes mellitus necessitating insulin, /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 212.e1

221 chronic hypertension, and hypothyroidism. At the time of her initial consultation, the only medication she was taking was her thyroid supplementation. When she had discovered that she was pregnant, she discontinued her cardiac medications, including furosemide and quinapril. Her hemoglobin A1C value was 7.1%. The patient s cervix was difficult to visualize on pelvic examination because of her weight. Transvaginal ultrasonography during that visit confirmed a viable intrauterine pregnancy with an embryonic pole of 1.4 cm, consistent with the estimated gestational age. The patient was counseled at length about the risks involved in continuing the pregnancy with her current medical comorbidities. In particular, she was counseled about the significant risk of death or permanent disability related to her cardiac status and previous myocardial infarction. At the conclusion of our conversation, the patient expressed her desire to continue the pregnancy, and outpatient consultation with cardiology was arranged. An echocardiogram estimated her ejection fraction to be 50% 75%, but was technically limited by the patient s body habitus. She experienced heavy vaginal bleeding 10 days later, before her next scheduled visit with us. She went to her local emergency room, where ultrasonography showed an embryonic demise. The patient was otherwise stable and was followed up in our office the next day, where transvaginal ultrasonography confirmed the presence of a 1.5-cm embryonic pole without cardiac activity. The vaginal bleeding had largely abated at that time. We reviewed management options with her including vacuum aspiration, expectant management, and medical management with vaginal misoprostol. Because of the difficulty that had previously been encountered when examining the patient, we counseled her that it would be difficult to perform a vacuum aspiration with local anesthetics only, and that she would probably require general or regional anesthesia. This would entail significant risk, given her cardiac and pulmonary disease. We were concerned about the safety of outpatient medical or expectant management because of the potential for unmonitored heavy bleeding with severe cardiac disease and limited mobility. We offered her the option of vaginal misoprostol treatment while she was being monitored as an inpatient. She was informed of the risks of medical management, including the potential for heavy bleeding necessitating vacuum aspiration under urgent conditions. The patient felt that medical management was her best option, and she was admitted to a general medical and surgical floor for continuous cardiac monitoring. Her baseline hemoglobin value was 13.8 mg/dl, and intravenous access was secured. The patient had reported some vaginal bleeding since her last visit, and thus transvaginal ultrasonography was repeated to ensure that the pregnancy had not already passed. A 1.3-cm embryonic pole without cardiac activity was again visualized. Misoprostol 800 g was administered vaginally by a physician without a speculum, and the patient was observed overnight with frequent readings of vital signs and pad counts. Our plan was to consider a repeat dose of misoprostol if expulsion was unsuccessful at a planned sonographic evaluation 24 hours later. We ordered ibuprofen 600 mg every 6 hours and acetaminophen 325 mg with oxycodone 5 mg, 1 2 tablets every 4 6 hours as needed, for pain management. Medical management would have been abandoned and surgical intervention performed if: [1] vaginal bleeding occurred that exceeded two soaked pads per hour for 2 consecutive hours, [2] the patient requested that we no longer pursue medical management, [3] pain was encountered that could not be controlled with appropriate analgesics, or [4] a clinical scenario was encountered in which, in the opinion of the physician team, the continuation of the care plan would place the patient at a significant risk. Approximately 6 hours after insertion of the misoprostol, the patient experienced uterine cramping and passed small clots and some tissue. Tachycardia was not encountered, and the patient s pain was well-controlled with two doses of ibuprofen and a single dose of acetaminophen with oxycodone. The following morning, the patient reported a significant decrease in her bleeding and pain. Her hemoglobin value was 12.1 mg/dl, and transvaginal ultrasonography showed an absence of the gestational sac and an endometrial thickness of 1.7 cm. The patient continued to have minimal bleeding and pain over the course of the next few hours, and was discharged home with appropriate instructions. The patient was then returned to the care of her referring gynecologist, and no posthospitalization problems were reported in our follow-up telephone contact. She planned to purse permanent sterilization in the future. DISCUSSION The occurrence of early pregnancy failure in patients with complex medical problems is not uncommon. The likelihood of pregnancy failure and medical comorbidities increases with advancing maternal age. In addition, many medical problems, such as poorly controlled diabetes with high glycosylated hemoglobin values, also predispose patients to pregnancy failure. The ideal management of such patients is commonly a vacuum aspiration under controlled conditions. This procedure allows for a definitive resolution of the pregnancy without the risk of heavy bleeding that can occur in some cases of expectant management. It can also often be accomplished with the use of local anesthetics or minimal sedation. The patient in our case presented the dual challenges of obesity and significant medical comorbidities. The patient s adipose distribution made visualization of the cervix very difficult. We believed that the performance of a vacuum aspiration would likely have required either general or regional anesthesia, which would have further increased her medical risk. 212.e2 Hackney et al. Cardiac patient with early pregnancy failure Vol. 88, No. 1, July 2007

222 Expectant management is often successful in patients with early pregnancy failure, and avoids the surgical and anesthetic risks of vacuum aspiration (8). Rates of success with expectant management are generally lower in cases of anembryonic gestation or embryonic and fetal demise, compared to women with an incomplete abortion, with 50% of patients requiring some intervention (1). In addition, it was our desire for this patient to expel the pregnancy in a more controlled manner in a facility where surgical intervention would be available if needed. Expectant management was not pursued for all of these reasons. If the patient had failed to respond to the administration of misoprostol, however, expectant management or vacuum aspiration would have been necessary. Although not approved by the Food and Drug Administration in the United States, the off-label use of misoprostol was shown in randomized trials to be effective in the management of early pregnancy failure in comparison to vacuum aspiration (2 6). Complete expulsion of products occurred in 84% of patients in a recent study, with only approximately 1% requiring emergent curettage for hemorrhage (6). There was no significant difference in the number of patients experiencing serious complications requiring hospitalization between those undergoing vacuum aspiration and those receiving misoprostol. The risks of medical management with misoprostol were thus felt to be lower than those of vacuum aspiration in our patient. To our knowledge, this is the first reported case of misoprostol being used for early pregnancy failure in a patient with obesity and coronary artery disease. Randomized trials using misoprostol for early pregnancy failure have generally excluded patients who were anemic or had significant medical conditions such as those in our patient (2 6). This case demonstrates that medical management of early pregnancy failure, on a basis of inpatient observation, can be considered in patients who are at increased risk of complications related to vacuum aspiration because of significant medical comorbidities. REFERENCES 1. Graziosi GCM, Mol BW, Ankum WM, Bruinse HW. Management of early pregnancy loss. Int J Gynaecol Obstet 2004;86: Wood SL, Brain PH. Medical management of missed abortion: a randomized clinical trial. Obstet Gynecol 2002;99: Chung TK, Lee DT, Cheung LP, Haines CJ, Chang AM. Spontaneous abortion: a randomized, controlled trial comparing surgical evacuation with conservative management using misoprostol. Fertil Steril 1999;71: Demetroulis C, Saridogan E, Kunde D, Naftalin AA. A prospective randomized trial comparing medical and surgical treatment for early pregnancy failure. Hum Reprod 2001;16: Muffley PE, Stitely ML, Gherman RB. Early intrauterine pregnancy failure: a randomized trial of medical versus surgical treatment. Am J Obstet Gynecol 2002;187: Zhang J, Gilles JM, Barnhart K, Creinin MD, Westhoff C, Frederick MM. A comparison of medical management with misoprostol and surgical management for early pregnancy failure. N Engl J Med 2005;353: Fisher JD. New York Heart Association Classification. Arch Intern Med 1972;129: Wieringa-de Waard M, Vos J, Bonsel GJ, Bindels PJE, Ankum WM. Management of miscarriage: a randomized control trial of expectant management versus surgical evacuation. Hum Reprod 2002;17: Fertility and Sterility 212.e3

223 Segregation of chromosomes in spermatozoa of four Hungarian translocation carriers Anna Kékesi, a Edit Erdei, M.D., Ph.D., b Miklós Török, M.D., Ph.D., a Sándor Drávucz, M.D., Ph.D., a and András Tóth, Ph.D. a a Department of Obstetrics and Gynecology, and b Department of Andrology and Urology, Medical Health Center, Budapest, Hungary Objective: To determine the segregation pattern of the translocated chromosomes in spermatozoa of human males with translocations. Design: Retrospective case control study. Setting: Hospital-based genetic laboratory for reproductive biology. Patient(s): A carrier with Y autosome reciprocal translocation, two with autosome autosome reciprocal translocations, and one with Robertsonian translocation. Intervention(s): Blood sample and sperm sample collection from each translocation carrier. Main Outcome Measure(s): Fluorescence in situ hybridization on lymphocyte slides to characterize each translocation case. Fluorescence in situ hybridization with specific DNA probes for each of the sperm samples to characterize the chromosomes involved in the rearrangement and to evaluate the possible interchromosomal effect for chromosomes 18, X, and Y. Result(s): Each translocation carrier showed a specific mode of segregation pattern of the translocated chromosomes, confirming the dependence on chromosomes involved in the translocation. The highest frequency from alternate segregation was with the carrier of Robertsonian translocation (90.9%), and the lowest was with the carrier of Y autosome translocation (29.7%). No evidence of an interchromosomal effect for chromosomes 18, X, and Y were detected. Conclusion(s): Depending on the rate of the genetically normal and abnormal segregation modes, we can evaluate the chance of having a healthy proband. These results ensure more accurate genetic counseling for patients in assisted reproduction centers. (Fertil Steril 2007;88:212.e by American Society for Reproductive Medicine.) Key Words: Genetics, infertility, FISH, chromosome translocation, sperm Chromosomal abnormalities often lead to infertility. Structural chromosomal disorders are detectable from peripheral blood by karyotyping and metaphase fluorescence in situ hybridization (FISH) and account for 21% of all chromosome abnormalities (1). Robertsonian translocations and balanced reciprocal translocations are the most frequent structural chromosomal abnormalities, with an incidence of 1.23/1,000 (2) and 1/625 (3) newborns, respectively. The translocation carriers exhibit no particular phenotype, but they produce a large number of chromosomally unbalanced gametes. The widespread use of intracytoplasmic sperm injection technology may increase the possibility of transmitting the genetic defects to the offspring by avoiding severe steps of natural selection (4). By using FISH with specific DNA probes, we can determine the chromosomal segregation pattern of the translocated chromosomes in spermatozoa. The segregation pattern Received April 27, 2006; revised October 10, 2006; accepted November 15, Supported by the Hungarian Scientific Research Fund (OTKA, Budapest, Hungary; grant T ). Reprint requests: András Tóth, Ph.D., Department of Obstetrics and Gynecology, Medical Health Center, Budapest, Hungary, H-1135 Szabolcs u. 35, Budapest, Hungary (FAX: ; dr.atoth@gmail.com). is variable, depending on the translocated segments involved. Robertsonian translocation occurs when two acrocentric chromosomes fuse together, resulting in an abnormal, generally dicentric chromosome that has the long arms of the original two. Balanced Robertsonian translocation carriers have only 45 chromosomes. The most common translocations to be found are usually between two autosomes with only one breakpoint in each. One specific and rare category is the Y autosome translocation with the incidence of 1/2,000 (5), which falls into the following three groups. [1] Translocation of the long arm of the Y chromosome to an acrocentric chromosome. There is no loss of euchromatin. This type is frequently familial without clinical significance. [2] Translocation of the Y-euchromatin to an autosome, resulting in 45 chromosomes, including the Y autosome fusion product. These males are mostly infertile. [3] A balanced Y autosome translocation in which the autosome is not an acrocentric. Carriers are frequently mentally retarded and/or infertile. The infertility may be a consequence of abnormal sex vesicle (X Y association) formation disrupting meiosis, which causes spermatogenetic arrest (6). In some cases, infertility can be related to partial or complete loss of the AZF regions within the translocation-derived acentric fragment /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 212.e5

224 The use of FISH allows the investigation of interchromosomal effects with an analysis of thousands of spermatozoa. Some studies suggest that interchromosomal effects do exist (7, 8), but others have been unable to demonstrate them (9, 10). We analyze the segregation pattern of the translocated chromosomes in spermatozoa of four different translocation carriers and evalute the possible interchromosomal effects for chromosomes 18, X, and Y in three of the four patients were also investigated. MATERIALS AND METHODS This study was approved by the Hungarian Scientific Research Fund. Patient History Seminal parameters from translocation carriers are given in Table 1. Patient 1 The first patient was a 38-year-old male with cryptozoospermia ( per microliter). Ten percent of the spermatozoa had decreased mobility, and 90% were immotile. Only 3% of the spermatozoa had normal morphology. The patient was normal at the physical examination, including his reproductive system. Concentrations of FSH, LH, PRL, and T were within normal ranges. Chromosome investigation of peripheral blood revealed a balanced 46,X,t(Y;3)(q12;p21) karyotype. Deoxyribonucleic acid analysis showed no deletions of the AZFa, b, and c regions. Patient 2 The second patient was a 41-year-old male with normal reproductive system. Semen analysis showed normozoospermia (sperm concentration: per microliter). Chromosome investigation revealed a balanced 46,XY,t(1; 17)(p11;q11) karyotype. The patient s wife had bilateral tubular occlusion. After four unsuccessful intracytoplasmic sperm injection treatments, they were referred to our center. Patient 3 The third patient was a 34-year-old male with varicocele. Levels of FSH, LH, PRL, and P levels were within normal ranges. Semen analysis showed oligozoospermia ( per microliter). Chromosome investigation revealed a balanced 45,XY,t(13;14)(q10;q10) karyotype. His wife had left-side tubular occlusion and polycystic ovarian syndrome. Patient 4 The fourth patient was a 25-year-old male. Semen analysis showed normozoospermia (sperm concentration: per microliter). Chromosome investigation revealed a balanced 46,XY,t(4;6)(q31.1;p25) karyotype. He and his wife were referred to genetic counseling because of one spontaneous and two missed abortions at 9 weeks of gestation. Deoxyribonucleic Acid Probes A dual-color FISH was used to characterize the translocations from metaphase spreads of peripheral lymphocytes and to determine the meiotic segregation of the chromosomes involved in the rearrangement in sperm cells. For patient 1, DNA probes were purchased from Oncor (Gaithersburg, MD). Alpha-satellite (DYZ3) classicalsatellite (DYZ1) probe complex specific for chromosome Y (biotin labeled) and alpha-satellite DNA probe (DXZ1, DIG labeled) specific for chromosome X were used. The probes were detected by fluorescein isothiocyanate conjugate (FITC) (chromosome Y) and rhodamine (chromosome X) fluorochromes. For patient 2, alpha-satellite, direct-labeled probe specific for the heterochromatic part of chromosome 1 (1qh, green; Q-Biogene) and telomere-specific, direct-labeled probe for chromosome 17 (Tel17q, red) were used. For patients 3 and 4, DNA probes were purchased from Vysis Inc. For patient 3, a locus-specific probe for chromosome 13q14 region (LSI13, Spectrum Green) and a subtelomeric probe specific for the 14q region (TEL Vysion 14q, Spectrum Orange) were used; for patient 4, telomere-specific probes for chromosome 4 (Tel Vysion 4q, Spectrum Orange) and for chromosome 6 (Tel Vysion 6p, Spectrum Green) were used to identify the different segregation modes. In three patients (patients 2, 3, and 4), the occurrence of interchromosomal effect (ICE) for chromosomes 18, X, and Y also was evaluated. The DNA probes for the chromosomes studied were purchased from Vysis Inc. (CEP18, TABLE 1 Characteristics of the four translocation carriers analyzed. Name Age (y) Density ( 10 6 ml) Volume (ml) Normal motility (%) Normal morphology (%) Clinical diagnosis Karyotype Patient OATS 46,X, t(y;3)(q12;p21) Patient NS 46,XY, t(1;17)(p11;q11) Patient OS 45,XY, t(13;14)(q10;q10) Patient NS 46,XY, t(4;6)(q31.1;p25) Kékesi. Chromosomal analysis of spermatozoa. Fertil Steril e6 Kékesi et al. Chromosomal analysis of spermatozoa Vol. 88, No. 1, July 2007

225 TABLE 2 Segregation analysis results from spermatozoa in the three translocation carriers analyzed. Segregation pattern (%) Patient No. sp. Alternate Adjacent II Adjacent I 3:1 Diploidy Other 2 t(1;17)(p11;q11) 1, t(13;14)(q10;q10) 1, t(4;6)(q31.1;p25) 1, Note: Dashes indicate none. Kékesi. Chromosomal analysis of spermatozoa. Fertil Steril Spectrum Aqua/CEPX, Spectrum Green/CEPY, and Spectrum Orange). Data were statistically analyzed by using a heteroscedastic t-probe. Fluorescence In Situ Hybridization Studies on Lymphocyte Metaphases and on Sperm Cells Fluorescence in situ hybridization analysis on lymphocyte metaphases was performed according to Oncor protocol for patient 1, according to Q-Biogene protocol for patient 2, and according to Vysis protocol for patient 3 and 4. The fresh ejaculate was washed twice with phosphate-buffered saline, and after centrifugation, it was fixed three times with methanol glacial acetic acid (3:1). Before hybridization, the spermatozoa were treated for 5 minutes with a solution of 25 mm dithiothreitol in 1 M Tris, ph 9.5 (11) to decondense the sperm heads. The protocol for probes and sample denaturation, incubation, and detection were performed according to manufacturer s instructions (Oncor, Q-Biogene, and Vysis). Briefly, after sperm-head decondensation, the slides were washed in 2 SSC at 37 C for 8 minutes, then the sperm spreads were denatured in 70% formamide: 2 SSC at 72 C for 4 minutes, whereas the DNA probes were denatured at 73 C for 5 minutes (Oncor, Vysis). According to Q-Biogene protocol, samples were denatured together with DNA probes at 75 C for 10 minutes and were hybridized in a humidified chamber in 37 C for hours. Slides were washed in 0.4 SSC at 73 C for 2 minutes (Vysis), in 0.5 SSC at 65 C for 4 minutes (Q-Biogene), and then in phosphate-buffered detergent (BPD) for 2 minutes and were counterstained with 6-diamino-2-phenylindole (DAPI) solution. According to Oncor protocol, after the washing step, DNA probes were immunodetected by fluorescein isothiocyanate conjugate and rhodamine fluorochromes. Microscopic Analysis and Scoring Criteria Analyses were performed with an epifluorescence microscope equipped with filter sets for DAPI, Spectrum Aqua, Spectrum Green, and Spectrum Orange. Sperm nuclei without fluorescent signal and sperm cells without intact tail were not evaluated. To differentiate split signals, sperm cells were scored as having two signals for a particular probe if the signals were separated from each other by at least one spot diameter. RESULTS Dual-color FISH was performed in all of our patients with hybridization rates of 95%. Segregation analysis results are shown in Table 2. Patient 1 The balanced Y autosome translocation was confirmed by FISH analysis from lymphocytes metaphases. Digoxigeninlabeled probe complex specific for the centromeric and heterochromatic part of chromosome Y revealed the translocation of the heterochromatic region to an autosome (chromosome 3). Because this patient had a very low sperm concentration ( per microliter), only 450 spermatozoa could be analyzed by FISH. The rate of genetically normal and balanced spermatozoa in ejaculate was only 20.2% (3/X): 9.5% of spermatozoa [der(3)/der(y)] resulted from 2:2 alternate segregation during meiosis, 67.3% resulted from adjacent I and II, and 3% resulted from one type of 3:1 segregation [der(3)/der(y)/x] or were diploid [3/X/der(3)/der(Y)]. The methodological approach used did not allow differentiation of the other types of 3:1 segregation from the other segregation modes and differentiation between adjacent I and II segregations. Because this patient has very few sperm, his data are not described in Table 2. Patient 2 Fluorescence in situ hybridization technique on lymphocyte metaphase spreads demonstrated the reciprocal translocation between chromosome 1 and chromosome 17. One thousand five hundred seventy-five sperm heads were scored by using double FISH. The segregation pattern showed that 53.7% of the spermatozoa analyzed originated from 2:2 alternate segregation [1/17 and der(1)/der(17)], 38% resulted from adjacent I [17/der(1) and 1/der(17)], 7% resulted from adjacent II segregation [1/der(1) and 17/der(17)], and 1.3% had diploidy Fertility and Sterility 212.e7

226 [1/17/der(1)/der(17)]. The proportion of alternate and adjacent segregation was close to the theoretical 1:1 (53.7% and 45%, respectively). Patient 3 In lymphocyte FISH, we could demonstrate the Robertsonian translocation t(13;14)(q10;q10). Segregation analysis was ascertained in 1,629 spermatozoa. Most spermatozoa (90.9%) resulted from 2:1 alternate segregation [13/14 and der(13;14)] during meiosis. The proportion of unbalanced spermatozoa resulting from 2:1 adjacent segregations [13, 14, 13/der(13;14) and 14/der(13;14)] were 8.2% of the cells analyzed. Diploidy or 3:0 segregation mode proved to result in 0.7% [13/14/der(13;14)]. Spermatozoa with an unexpected combination of signals were 0.2% (classified as other). Patient 4 Double-FISH analysis with DNA probes specific for chromosome 4q and for chromosome 6p confirmed the result of standard cytogenetic investigation, which showed reciprocal autosomal translocation between chromosomes 4 and 6 (Fig. 1). One thousand fifty spermatozoa of this translocation carrier were scored. Fifty-four percent of the sperm cells resulted from alternate or adjacent II segregations [4/6, der(4)/der(6), 4/der(4), 6/der(6)]. Differentiation between alternate and adjacent II segregation modes was not possible by using these DNA probes. Other spermatozoa were unbalanced and resulted from adjacent I segregation [4/der(6) and 6/der(4); 33.6%] or from 3:1 segregation (12.2%) or were diploid (0.2%; Fig. 2). To evaluate the possible ICE, a total of 4,531 spermatozoa were analyzed from three translocation carriers (patients 2, 3, and 4). These results were compared with those of five normozoospermic control donors. From these donors, we analyzed 9,885 spermatozoa. Table 3 shows the details of the evaluation of chromosomes 18, X, and Y. The frequencies of disomy for chromosome 18 (0.2%, 0.2%, and 0.0, respectively), X (0.06% each), Y (0.2%, 0.4%, and 0.06%), and XY (0.1%, 0.06%, and 0.0) and the diploidy rate (0.06%, 0.3%, and 0.06%) were similar to the rates of spermatozoa of control donors (0.08%, 0.06%, 0.07%, 0.08%, and 0.19%, respectively). The numbers of sperm studied were not high enough to support a statement, but it appears that there were no statistical differences between the patients and control males regarding the aneuploidy and diploidy rates of chromosomes 18, X, and Y (P.1) in sperm. DISCUSSION The aim of this study was to determine the segregation pattern of the translocated chromosomes in sperm cells of four translocation carriers. Segregation studies have been FIGURE 1 Fluorescence in situ hybridization on a lymphocyte metaphase of a translocation carrier with 46,XY,t(4;6)(q31.1;p25). The chromosomes were counterstained with 6-diamino-2-phenylindole. Kékesi. Chromosomal analysis of spermatozoa. Fertil Steril e8 Kékesi et al. Chromosomal analysis of spermatozoa Vol. 88, No. 1, July 2007

227 FIGURE 2 Fluorescence in situ hybridization analysis on spermatozoa of patient 4. (A) 2:2 Alternate [4/6 or der(4)/der(6)] or adjacent II [4/der(4) and 6/der(6)] segregations. (B) 3:1 segregation [6 or der(4)]. (C) Adjacent I segregation [6/der(4)]. (D) Adjacent I segregation [4/der(6)]. (E) 3:1 segregation [4 or der(6)]. Kékesi. Chromosomal analysis of spermatozoa. Fertil Steril performed by FISH for the last decade (12 15) on spermatozoa from those who carry structural chromosomal abnormalities as Robertsonian translocations and reciprocal translocations. The four different types of segregation were found in the translocation carriers we analyzed, where the methodological approach used allowed differentiation between the different types of segregation. In the patient who carried Robertsonian translocation (patient 3), during meiosis (prophase I), the rearranged chromosomes form a trivalent structure (16, 17). When TABLE 3 Results of ICE for chromosomes 18, X, and Y in balanced reciprocal translocation carriers and in control, normozoospermic males analyzed. Patient 18/X, n (%) 18/Y, n (%) Disomy 18, n (%) Disomy X, n (%) Disomy Y, n (%) Disomy XY, n (%) Diploidy, n (%) Total Patient (51.3) 721 (48.0) 3 (0.20) 1 (0.06) 3 (0.20) 2 (0.10) 1 (0.06) 1,502 Patient (48.8) 758 (50.3) 3 (0.20) 1 (0.06) 6 (0.40) 1 (0.06) 5 (0.3) 1,509 Patient (49.5) 763 (50.2) 0 1 (0.06) 1 (0.06) 0 1 (0.06) 1,520 Totals for patients 2,260 (49.9) 2,242 (49.5) 6 (0.13) 3 (0.06) 10 (0.22) 3 (0.05) 7 (0.14) 4,531 Control (47.2) 908 (52.0) 4 (0.20) 2 (0.10) 2 (0.10) 4 (0.20) 2 (0.10) 1,747 Control 2 1,030 (49.4) 1,045 (50.0) 0 2 (0.10) 0 1 (0.05) 11 (0.50) 2,081 Control 3 1,004 (49.4) 1,024 (50.3) 1 (0.05) 0 2 (0.10) 0 1 (0.05) 2,032 Control (47.8) 1,043 (51.6) 3 (0.14) 1 (0.05) 1 (0.05) 3 (0.14) 2 (0.14) 2,021 Control 5 1,018 (50.8) 980 (48.9) 0 1 (0.05) 2 (0.10) 0 3 (0.15) 2,004 Totals for controls 4,844 (49) 5,000 (50.6) 8 (0.08) 6 (0.06) 7 (0.07) 8 (0.08) 19 (0.19) 9,885 Kékesi. Chromosomal analysis of spermatozoa. Fertil Steril Fertility and Sterility 212.e9

228 this trivalent form is in cis-configuration, alternate segregation is promoted during meiosis I, resulting in the production with equal frequencies of a normal gamete, including the acrocentric chromosomes and the balanced gamete with only the translocated chromosomes. The other segregation modes, adjacent I and the rare 3:0, produce unbalanced gametes with abnormal embryos that cause miscarriage or aneuploid offspring. Spermatozoa in seven male carriers of Robertsonian translocation were analyzed by Anton et al. (15). Their results were correlated with ours (alternate segregations, 83% 88.23%; adjacent segregations, 11.11% 14.53%; and 3:0 mode, % compared with our investigations 90.9%, 8.2%, and 0.7%, respectively). Most carriers of Robertsonian translocations have oligozoospermia. This may be a result of the intervention of meiotic checkpoints during meiosis (erratic chromosomes, lack of tension), when the cell may be unable to complete the meiotic process that leads the cell into apoptosis. If the cell is capable of completing the division process, the result may be the production of aneuploid or diploid spermatozoa. Usually, carriers of reciprocal translocations have an increased risk of producing unbalanced gametes as compared with carriers of Robertsonian translocations. The meiotic behavior of reciprocal translocations depends on the chromosomes involved in the rearrangement, the position of the breakpoints, crossovers in the translocated chromosomes, and the morphological characteristics of the rearranged chromosomes. In the first metaphase of meiosis, a close configuration, such as a ring, produces mainly 2:2 segregations, whereas an open configuration, such as a chain, produces 3:1 segregations (18). During meiosis I, the segregation of the quadrivalent that is formed by the translocated chromosomes and their normal homologues produces a variety of balanced and unbalanced gametes. The alternate phenotype is the only segregation mode that yields normal offspring. Unbalanced gametes are produced by adjacent I, adjacent II, and 3:1 segregation. In adjacent I segregation, homologous centromeres move to opposite poles, whereas they move to the same pole in adjacent II and 3:1 segregations. In the two autosomal-translocation carriers (patient 2 and 4), almost equal proportions of normal (alternate segregation) and abnormal (adjacent and 3:1 segregation) sperm cells were analyzed. An excess of unbalanced gametes usually is higher in sex chromosome autosome translocations than in the autosome autosome translocations. This may be a result of the involvement of the sex chromosomes because the translocation may prevent the normal formation of the sex vesicle, which is essential for a normal meiotic process. Pseudoautosomal regions of the Y chromosome (PAR1 and PAR2) are responsible for a correct pairing between the two sex chromosomes. Pseudoautosomal region 1 is at the telomere of Xp/Yp, and PAR2 is at the telomere of Xq/Yq. Our patient 1 had t(y;3)(q12;p21) translocation with breakpoints at Yq12 and 3p21, which means that PAR2 was translocated to der(3). This phenomenon may cause asynapsis within the quadrivalent at the pachytene stage in some cells, which leads to severe oligozoospermia. Pinho et al. (19) analyzed a male with t(y;1)(q12;q12) translocation with an otherwise normal phenotype. In this male, the PAR2 region in Yq was translocated to der(1), causing meiotic I arrest, which led to azoospermia. Hsu (20) described 25 cases, among which 80% of males had azoospermia. Sperm analysis was performed in a male with a reciprocal t(y;16)(q11.21;q24) translocation by Giltay et al. (13). This patient had severe oligoasthenoteratozoospermia. Segregation analysis of morphologically normal spermatozoa showed that 51% originated from alternate segregation. If morphologically abnormal sperm cells were also included, nearly 90% of all the spermatozoa were unbalanced. Thus, selecting morphologically normal sperm cells for intracytoplasmic sperm injection treatments reduces but does not preclude the likelihood of unbalanced spermatozoa. These literature data propose that males with Y autosome translocations produce little or no sperm cells or that they produce a high percentage of unbalanced spermatozoa. In the ICE evaluation, the numbers of investigated sperm were not high, but the data obtained did not appear to provide any evidence of an ICE for chromosomes 18, X, and Y. According to Pellestor et al. (21), ICE in translocation carriers could be restricted to those carriers who have abnormal semenograms. Oliver-Bonet et al. (22) analyzed two reciprocal translocation carriers with normozoospermia and also did not find any evidence for an ICE (chromosomes 6, 18, 21, X, and Y were analyzed). In our study, the two reciprocal translocation carriers analyzed (patient 2 and 4) had normal semen parameters, and patient 3 with Robertsonian translocation had oligozoospermia (other semen parameters, such as sperm cell morphology and motility, were within normal ranges). Interchromosomal effect analysis of spermatozoa with patient 1 was not possible because of the extremely low sperm concentration ( per microliter). Our results confirm the investigations mentioned in the previous paragraph (21, 22), although the Robertsonian translocation carrier had a low sperm concentration that could have been related to aneuploidy and diploidy. We found only a slight increase in the rate of disomy for chromosome Y (0.4%) and in the rate of diploidy (0.3%) for this patient, although we analyzed only three chromosomes (18, X, and Y). Fluorescence in situ hybridization analysis of spermatozoa can be a very useful technique for evaluating the risk of chromosomally abnormal embryos in translocation carriers, although the rate of unbalanced spermatozoa observed is much higher than that detected in studies of human fetuses from translocation carriers (23). This difference is explained by the low viability of most unbalanced conceptions. These 212.e10 Kékesi et al. Chromosomal analysis of spermatozoa Vol. 88, No. 1, July 2007

229 results are very informative in applying assisted reproductive techniques. For those translocation carriers whose partners become pregnant, prenatal or preimplantation diagnosis are offered. REFERENCES 1. Pandyan N, Jequier AM. Mitotic chromosomal anomalies among 1210 infertile men. Hum Reprod 1996;11: Nielsen J, Wohlert M. Chromosome abnormalities found among newborn children: results from 13-year incidence study in Arhus, Denmark. Hum Genet 1991;87: Van Dyke DL, Weiss L, Roberson JR, Babu VR. The frequency and mutation rate of balanced autosomal rearrangements in man estimated from prenatal genetic studies for advanced maternal age. Am J Med Genet 1983;35: Buonadonna AL, Cariola F, Caroppo E, Di Carlo A, Fiorente P, Valenzano MC, et al. Molecular and cytogenetic characterization of an azoospermic male with a de-novo Y;14 translocation and alternate centromere inactivation. Hum Reprod 2002;17: Nielsen J, Rasmussen K. Y/autosomal trasnlocations. Clin Genet 1976; 9: Gardner RJM, Sutherland GR. Chromosome abnormalities and genetic counseling. New York: Oxford University Press, 1989: Burns J, Koduru P, Alonso M, Chaganti R. Analysis of meiotic segregation in a man heterozygous for two reciprocal translocations using the hamster in vitro penetration system. Am J Hum Genet 1986;38: Templado C, Navarro J, Benet J, Genesca A, Perez MM, Egozcue J. Human sperm chromosome studies in a reciprocal translocation, t(2;5). Hum Genet 1988;79: Pellestor F, Sele B, Jalbert H, Jalbert P. Direct segregation analysis of reciprocal translocations: a study of 283 sperm karyotypes from four carriers. Am J Hum Genet 1989;44: Estop A, van Kirk V, Cieply K. Segregation analysis of four translocations, t(2,8), t(3;15), t(5;7) and t(10;12), by sperm chromosome studies and a review of the literature. Cytogenet Cell Genet 1995;70: Martini E, Speel EJM, Geraedts JPM, Ramaekers FCS, Hopman AHN. Application of different in-situ hybridization detection methods for human sperm analysis. Hum Reprod 1995;10: Mercier S, Morel F, Fellman F, Roux C, Bresson JL. Molecular analysis of the chromosomal equipment in spermatozoa of a 46,XY,t(7;8) (q11.21;cen) carrier by using fluorescence in situ hybridization. Hum Genet 1998;102: Giltay JC, Kastrop PMM, Tiemessen CHJ, van Inzen WG, Scheres JMJC, Pearson PL. Sperm analysis in a subfertile male with a Y;16 translocation, using four-color FISH. Cytogenet Cell Genet 1999;84: Oliver-Bonet M, Navarro J, Carrera M, Egozcue J, Benet J. Aneuploid and unbalanced sperm in two translocation carriers: evaluation of the genetic risk. Mol Hum Rep 2002;8: Anton E, Blanco J, Egozcue J, Vidal F. Sperm FISH studies in seven male carriers of Robertsonian translocation t(13;14)(q10;q10). Hum Reprod 2004;11: Vidal F, Templado C, Navarro J, Marina S, Egozcue J. Meiotic and synaptonemal complexes studies in a 14/21 translocation carrier. Int J Androl 1982;5: Luciani JM, Guichaoua MR, Mattei A, Morazzani MR. Pachytene analysis of a man with a 13q;14q translocation and infertility. Cytogenet Cell Genet 1984;38: Escudero T, Abdelhadi I, Sandalinas M. Predictive value of sperm fluorescence in situ hybridization analysis on the outcome of preimplantation genetic diagnosis for translocations. Fertil Steril 2003;79: Pinho MJ, Neves R, Costa P, Ferras C, Sousa M, Alves C, et al. Unique t(y;1)(q12;q12) reciprocal translocation with loss of the heterochromatic region of chromosome 1 in a male with azoospermia due to meiotic arrest: a case report. Hum Reprod 2005;20: Hsu LYF. Phenotype/karyotype correlations of Y chromosome aneuploidy with emphasis on structural aberrations in postnatally diagnosed cases. Am J Med Genet 1994;53: Pellestor F, Imbert I, Andreo B, Lefort G. Study of the occurrence of interchromosomal effect in spermatozoa of chromosomal rearrangement carriers by fluorescence in-situ hybridization and primed in-situ labelling techniques. Hum Reprod 2001;16: Oliver-Bonet M, Navarro J, Codina-Pascual M, Guitart AM, Egozcue J, Benet J. From spermatocytes to sperm: meiotic behaviour of human male reciprocal translocations. Hum Reprod 2004;19: Boue A, Gallano P. Collaborative study of the segregation of inherited chromosome structural rearrangements in 1356 prenatal diagnosis. Prenat Diagn 1984;4: Fertility and Sterility 212.e11

230 Retrograde ejaculation: simpler treatment Rene Leiva, M.D., C.C.F.P. Private Family Practice, Ottawa, Ontario, Canada Objective: To report a case of successful treatment of complete retrograde ejaculation by use of a novel, simple, and noninvasive home-based protocol. Design: Case report. Setting: Private family medicine clinic. Patient(s): A couple with primary infertility due to the male s complete retrograde ejaculation due to childhood s bladder surgery. The woman was healthy with normal menstrual cycles. Intervention(s): After intercourse, the male patient voided a urine semen mixture from a previously alkalinized urine and proceeded to inseminate it intravaginally into his wife. Determination of best time for intercourse was done by use of the ovulation (Billings) method. Result(s): This protocol has been used successfully by this couple to conceive two healthy children. Conclusion(s): To our knowledge, this is the second reported case of successful management of infertility through this protocol. It might be appropriate to try this method first on select patients with retrograde ejaculation. (Fertil Steril 2007;88:212.e by American Society for Reproductive Medicine.) Key Words: Retrograde ejaculation, treatment, ovulation method, Billings method, timing ovulation I report a successful case of treatment of infertility due to retrograde ejaculation. In August 2000, Cleine (1) reported a simpler home-based method to treat cases of retrograde ejaculation. As Cleine has pointed out, the current methods to treat this problem are invasive as well as stressful for patients. It might include urethral catheterization of the bladder with use of assisted reproductive technology (ART) with the use of sperm retrieved from the urine. In addition, some patients might object morally to artificial methods of assisted reproduction. I report the second case of successful treatment of complete retrograde ejaculation by use of this novel, simple, and noninvasive home-based protocol. CASE REPORT Around the same time, a 32-year-old man and his 29-yearold wife approached me at my family medical practice regarding their problem with infertility. Appropriate investigations at one of Montreal s leading infertility clinics had shown that the man suffered from complete retrograde ejaculation due to bladder surgery during childhood. Otherwise, they were both healthy. The woman had regular 28-day menstrual cycles and she was nullipara. Treatment options were offered at the infertility clinic, including IVF, intracytoplasmic sperm injection (ICSI), and artificial insemination using sperm recovered from the bladder urine after masturbation. Due to their moral beliefs, they had decided not to proceed with these options. On an internet search of their own, they found the article mentioned previously (1). They approached me to give them medical advice. Received January 27, 2005; revised and accepted August 27, Reprint requests: Rene Leiva, M.D., Suite 202, 194 Main St., Ottawa, Ont, K1S 1C2, Canada (FAX: ; rene.leiva@mail. mcgill.ca). I provided them with the medical supplies as well as technical explanations. They were told to proceed without direct medical supervision as follows: the man was to drink a sodium bicarbonate solution (7 g in 500 ml of water) 2 hours before intercourse. Just before intercourse he would empty his bladder. Right after ejaculation, he would urinate in a 50-mL sterile cup. The urine semen mixture would consist of about 2 3 ml of a thick gelatinous mass. He then would proceed to draw it into a 10-cc disposable sterile syringe being careful not to contaminate the opening. He would then connect the syringe to the silicon catheter of a regular 14-gauge IV needle. Immediately, he would insert this catheter intravaginally and slowly inseminate. She was to remain in supine position with her pelvis elevated at 45 degrees for the next 2 hours. They used regular pillows to achieve this position. Inseminations occurred during the ovulatory phase as predicted by the ovulation method (also known as Billings method) (2). During each cycle, the husband abstained from ejaculating until the woman felt or saw ovulatory mucus, then they would have once-a-day intercourse until the phase ended as described by the Billings method. Pregnancy ensued during their second menstrual cycle and a healthy baby girl was born at 38 weeks. Two years later, they tried again using the same method and she got pregnant during her first menstrual cycle. A healthy baby boy was born at 40 weeks. DISCUSSION In comparison to Cleine s article, our protocol had some modifications: first, we used smaller catheters, which did not seem to affect the outcome. However, I am not certain whether the modified supine position or the man s absti /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 212.e13

231 nence might have had some effect on the success of the procedure. Second, rather than timing the intercourse using specific days or artificial methods to predict ovulation, the couple decided to use the ovulation method that they knew very well. Current evidence seems to demonstrate its superiority for evaluating the time of ovulation in a natural way (3 5). Finally, the literature suggests that bed rest after intercourse or IUI might increase the chances of conception (6). Current standard practice calls for a more elaborate management of patients with infertility due to retrograde ejaculation. However, as stated already by Cleine, a trial of a less invasive and simpler method is warranted in some special circumstances. Even more, as this case illustrates, many couples might prefer a method that does not entitle a conflict with their moral religious views and still be open to the use of modern medicine. I believe that it is appropriate to follow Cleine s advise and try this method first on select patients with retrograde ejaculation. REFERENCES 1. Cleine JH. Retrograde ejaculation: can sperm retrieval be simpler and noninvasive? Fertil Steril 2000;74: Billings E, Westmore A. The Billings method: using the body s natural signal of fertility to achieve or avoid pregnancy. 5th rev. ed. Melbourne: Anne O Donovan Publishing, Stanford JB, White GL, Hatasaka H. Timing intercourse to achieve pregnancy: current evidence. Obstet Gynecol 2002;100: Bigelow JL, Dunson DB, Stanford JB, Ecochard R, Gnoth C, Colombo B. Mucus observations in the fertile window: a better predictor of conception than timing of intercourse. Hum Reprod 2004;19: Stanford JB, Smith KR, Dunson DB. Vulvar mucus observations and the probability of pregnancy. Obstet Gynecol 2003;101: Saleh A, Tan SL, Biljan MM, Tulandi T. A randomized study of the effect of 10 minutes of bed rest after intrauterine insemination. Fertil Steril 2000;74: e14 Leiva Retrograde ejaculation: simpler treatment Vol. 88, No. 1, July 2007

232 Azoospermia as a new feature of Fabry disease Aline Papaxanthos-Roche, M.D., a Colette Deminière, M.D., b Frédéric Bauduer, M.D., c Claude Hocké, M.D., d Guy Mayer, M.D., a and Didier Lacombe, M.D. e a Laboratoire de Biologie de la Reproduction, Centre Hospitalier Universitaire Maternité Pellegrin, Bordeaux; b Laboratoire de Cytologie et d Anatomie Pathologie, Centre Hospitalier Universitaire Pellegrin, Bordeaux; c Service d Hématologie, Centre Hospitalier Côte Basque, Bayonne; d Service de Gynécologie, Centre Hospitalier Universitaire Saint André, Bordeaux; and e Service de Génétique Médicale, Centre Hospitalier Universitaire Pellegrin, Bordeaux, France Objective: To describe two cases of azoospermia in men with Fabry disease. Design: Case report. Setting: Centre hospitalier universitaire, maternité Pellegrin, Bordeaux, France. Patient(s): Two infertile men with azoospermia and with Fabry disease. Intervention: Testicular biopsies. Main Outcome Measure: Histological and electron microscopy analysis of testicular biopsies. Result(s): Testicular biopsies revealed characteristic aspects of trihexosid ceramid deposits in Leydig cells by optical and electronic microscopic analysis. Using testicular sperm extraction and intracytoplasmic sperm injection, sperm retrieval led to pregnancies and deliveries of healthy children. Conclusion(s): Azoospermia should be considered as a possible complication of Fabry disease. We recommend a routine sperm analysis in the follow-up of young patients with Fabry disease. Azoospermia was still present after 4 years of agalsidase- therapy. Because we do not know the efficacy of agalsidase therapy on the genital involvement in Fabry disease, sperm cryopreservation is recommended. (Fertil Steril 2007;88:212.e by American Society for Reproductive Medicine.) Key Words: Fabry disease, azoospermia, infertility, testicular biopsy, ICSI Fabry disease is an X-linked inherited disorder of lysosomal metabolism due to mutations in the GLA gene encoding -galactosidase A ( -GAL). This enzyme is responsible for degradation of glycolipids inside the lysosomes. The deficiency of catalytic activity leads to accumulation of globotriaosylceramide (Gb3) and related neutral glycosphingolipids in the lysosomes of endothelial, perithelial, and smooth muscle cells of the myocardal and renal systems, to a lesser extent in reticuloendothelial and connective cells of the cornea, and in ganglions and perineural cells of the autonomic nervous system. A majority of hemizygous affected men develop severe multisystemic disease, dominated by renal failure and progressive neurological and cardiac involvement (1 7). The availability of enzyme-replacement therapy (ERT) with human recombinant -GAL offers a specific treatment (8). In the literature, only a few cases of male infertility were reported (9, 10). Infertility in Fabry disease is not welldocumented, and its underlying pathogenesis has not been elucidated. The purpose of this study was to report on two cases of azoospermia in men with Fabry disease, to build a better understanding of the genital involvement in this disease. Received March 9, 2006; revised and accepted November 9, This work was performed at the Centre Hospitalier Universitaire and Université Victor Segalen Bordeaux 2, Bordeaux, France. Reprint requests: Aline Papaxanthos-Roche, M.D., Laboratoire de Biologie de la Reproduction, Centre Hospitalier Universitaire Maternité Pellegrin, Place Amélie Raba Léon, Bordeaux Cedex, France (FAX: (0) ; aline.papaxanthos@chu-bordeaux.fr). MATERIALS AND METHODS Case 1 A 34-year-old man with Fabry disease consulted for a primary infertility. This male patient had a classic Fabry disease history, with acroparesthesia since age 10 years and angiokeratomas. The diagnosis of Fabry disease was done at age 22 years. Alpha-galactosidase activity was absent, and genetic analysis showed a R277X mutation. His family history was positive for Fabry disease. He had mild left-ventricular hypertrophy, and renal involvement with proteinuria (0.9 g/24 hours) and bilateral renal cysts on abdominal imaging (ultrasound examination and computerized tomography scan). The creatinine clearance (69 ml/min) was normal. He had been treated with ERT with biweekly doses of 1.0 mg/kg of recombinant human -galactosidase A (rh- GalA) (agalsidase-, Fabrazyme; Genzyme Europe, Naarden, The Netherlands) since age 34 years, leading to an improvement of his quality of life and left ventricular hypertrophy. No effect was observed in the renal features. Azoospermia was diagnosed in 3 semen analyses with centrifugation pellet screening. Seminal markers (alpha glucosidase, fructose, citric acid, phosphatase acid, and zinc) were in the normal range. Serum FSH and T were normal. An andrological evaluation searching for familial male infertility, a personal history of undescended testis in childhood, orchiepididymitis, or mumps orchitis was negative. Physical examination revealed a testis volume of 25 ml. Genetic investigations showed a 46,XY karyotype and absence of microdeletion in the azoospermia factor (AZF) region of the Y chromosome. Open-excision /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 212.e15

233 testicular biopsies were performed on both testicles under general anesthesia on the day of ovum retrieval. Testicular tissue was shredded roughly, using two microscope glass slides in a petri dish on the warmed stage of a stereomicroscope at 40 magnification until tissue pieces of 1mm 3 or free tubuli pieces a few millimeters in length were obtained (11). The shredded tissue was then checked for the presence of spermatozoa under an inverted microscope ( 400 magnification). A few spermatozoa were found. The biopsies for histopathological evaluation were fixed in routine Bouin s fixative (Coopérative Pharmaceutique Française, Melun, France) and embedded in Paraplast Plus (Gifrer Barbezat, Lyon, France). Histological analysis was performed on hematoxylin and eosin-stained thin sections. Histologic analysis of the left testicular tissue showed hypospermatogenesis; all stages of spermatogenesis were present, but spermatids and spermatozoa were scarce; tubule basement membranes were thickened; and vitreous tables of the interstitial blood vessels were thickened with diminishing of the vascular lumen. The right testis had the same histologic features as the left one; however, more spermatids and spermatozoa were observed. In both testes, the number of Leydig cells was in the normal range, and some of them were increased in size. Their cytoplasm contained microvacuoles, giving a spumous appearance to these cells, which is a characteristic of stored lipid. The patient s wife was 31 years old. Ovarian stimulation was performed using the long protocol, with pituitary suppression followed by ovarian stimulation. Five oocytes were retrieved by vaginal ultrasound-guided follicular puncture. Intracytoplasmic sperm injection (ICSI) was performed on the four mature oocytes. The remaining testicular-tissue extract was cryopreserved. One embryo was obtained and transferred 2 days after oocyte retrieval, leading to the delivery of one healthy female baby weighing 2,080 g, 8 months later. Three years after the birth, the couple consulted again for a second child. The man had been treated with agalsidase- for 3.5 years. He was still azoospermic. A hormonal investigation showed a slight rise in the level of FSH (12.1 mu/ml; normal range, 1 8 mu/ml). Serum levels of LH, inhibin B, PRL, T, and biodisponible T were normal. Seminal markers were normal. Because testicular spermatozoa had been cryopreserved, a new biopsy was not performed. The two attempts at ICSI that resulted in cryopreserved testicular spermatozoa led to one single ET without pregnancy. The third attempt at ICSI, performed on 8 oocytes of the 11 recovered, led to the development of four embryos, the in utero transfer of two embryos, the establishment of a twin pregnancy, and the birth of two children. of proteinuria. His renal function was altered (serum creatinine at 218 mol/l, and uremia at 8.1 mmol/l). He had angiokeratomas and left-ventricular hypertrophy. Activity of -galactosidase was absent on two determinations. The Q57X mutation was identified in the GLA gene. Enzyme-replacement therapy with biweekly doses of 1.0 mg/kg of rh- GalA (agalsidase-, Fabrazyme; Genzyme Corp.) was initiated at age 29 years. Azoospermia was diagnosed in three semen analyses with centrifugation pellet screening. An andrological investigation was negative. A physical examination and genital sonography showed a testicular volume of 20 ml for the right testis, 25 ml for the left testis, and the absence of anatomical abnormalities. However, ultrasonography of the testes revealed their heterogeneous aspect with hypoechogeneous zones. Seminal markers such as -glucosidase, fructose, citric acid, phosphatase acid, and zinc were within normal range. Hormonal investigations (serum level of FSH, LH in a LH-releasing hormone test, inhibin B, and T) were also normal. His karyotype was 46,XY. No microdeletion in the AZF region of the Y chromosome was identified. Testicular biopsies and sperm extraction were performed as described for case 1. A wet preparation showed a few spermatozoa. The histological aspect of the two testes was characterized by maturation arrest of the germinal cells, with numerous spermatocytes and exceptional spermatozoa. Sertoli cells were normal in appearance. The number of Leydig cells was within normal range. When electron microscopy was performed on the cryopreserved biopsies, the Leydig cells had a distorted nucleus. The cytoplasm was full of numerous compact and abnormal inclusions. These osmiophile inclusions had a lamellar aspect with alternating light- and dark-stained bands, and were delimited by a simple membrane. Other inclusions FIGURE 1 Electron microscopy of the testis. Leydig cell with onion bulb-like osmiophile inclusions. Case 2 A 33-year-old man and his wife consulted for primary infertility because of azoospermia. This man had a positive family history of Fabry disease. He suffered from abdominal pain, and hypertension was noted at age 23 years. A renal biopsy was performed at age 25 years after identification Papaxanthos-Roche. Azoospermia in two men with Fabry disease. Fertil Steril e16 Papaxanthos-Roche et al. Azoospermia in two men with Fabry disease Vol. 88, No. 1, July 2007

234 had the appearance of an onion bulb, with concentric lamellas of irregular thickness such as myelin-like bodies (Fig. 1). These inclusions were identical to those described in Fabry disease in the kidney (12). The patient s 29-year-old wife underwent oocyte retrieval under transvaginal ultrasound guidance after ovarian stimulation. The 8 oocytes of the 11 retrieved that had extruded the first polar body underwent ICSI with fresh testicular spermatozoa. Three embryos were obtained and transferred in utero. The remaining testicular tissue was cryopreserved. At 7 weeks after ET, two gestational sacs with fetal heart activity were seen with the use of ultrasound. The antenatal period was uneventful. Two viable healthy babies, one female weighing 2,200 g and one male weighing 2,900 g, were delivered after 35 weeks of gestation. Twenty months after the IVF attempt and 27 months after the beginning of ERT, this man underwent a sperm analysis that confirmed the azoospermia; the hormonal investigation (serum FSH, LH, inhibin B, and T) was still normal. Institutional review board approval was not required, because our IVF unit is licensed by the Ministry of Health of France. Moreover, there were no interventions other than those for standard IVF treatments for azoospermic patients. DISCUSSION We describe two documented cases of azoospermia in patients with Fabry disease who underwent IVF treatment with TESE and ICSI, leading to the birth of five children. In the literature, there is only one reference to infertility in Fabry disease: asthenoteratozoospermia was described in two brothers suffering from Fabry disease (9). Recently, oligozoospermia was described in 4 out of 4 men with Fabry disease (13). Our study is the first to report azoospermia. The fertility of men with Fabry disease remains to be evaluated. The relationship between infertility and Fabry disease can be established on the basis of the histological appearance under light and electron microscopy, with the identification of trihexosid ceramid deposits. In our study, only biopsies of testes were studied, and characteristic aspects of trihexosid ceramid deposits were noted in Leydig cells. This is in agreement with the studies of Nistal et al. (10) and Elleder (5) on autopsy specimens of the testes and epididymis of a 32-year-old man and a 47-year-old man, respectively, with Fabry disease. Nistal et al. (10), using light and electron microscopy, described characteristic ceramide deposits in Leydig cells and in the epithelial lining of both the ductuli efferentes and the ductus of the epididymis, and in the blood vessels, connective tissue cells, and muscle cells of the testicular interstitium, tunica albuginea, and epididymis. Myeloid bodies were absent or scarce in both the seminiferous epithelium and the mediastinum testis. However, the seminiferous tubules were affected, showing reduced diameter and a few degenerated spermatogonia and primary spermatocytes. Elleder (5) found glycolipid storage in Leydig cells and in the epithelial lining of the ductuli efferentes and caput epididymis epithelium, mainly in the basal cells. Leydig cells have the mesenchymal origin (14) as endothelial, fibroblast, and muscle cells that are the target sites of glycosphingolipid deposits in Fabry disease (12). The pathogenesis of infertility in Fabry disease is probably related to the accumulation of neutral glycosphingolipids in the testis and epididymis. Both a testicular and posttesticular origin can be discussed. Sperm transport can be disturbed by the obliteration of intratesticular cannaliculi. Moderate histological alterations of the seminiferous epithelium, the normality of Sertolian function with a normal inhibin B plasma level, the normal range of the FSH plasma level, and the histopathological analysis of the genital tract can corroborate this posttesticular origin. The seminal marker of epididymal function (1,4-glucosidase), originating in the epithelial cells of the corpus and cauda regions, was within normal range in both patients, indicating the absence of total obstruction in these areas and in the male tract below, and pointing to a probable origin of the obstruction in the ductuli efferentes (15 17). This is in agreement with the description by Nistal et al. (10) and Elleder (5) of ceramide deposits in these parts of the genital tract. Alternatively, a testicular origin for azoospermia in Fabry disease, with disrupted production of sperm, may be supported by the localization of glycosphingolipid deposits in Leydig cells and in the blood vessels, connective tissue cells, and muscle cells of the testicular interstitium (5, 10). Seminiferous tubular involvement could be secondary to a hormonal mechanism or vascular alterations. Serum T levels were normal in both patients. However, intratesticular levels of T were not measured. Although advanced uraemia may also impair testicular function, leading to azoospermia (18), this was not the case with our patients. In case 1, the plasma level of FSH rose 3 years after the initial diagnosis of azoospermia. Most men with Fabry disease are fertile. The possible risk of azoospermia is probably higher after years of age, due to the accumulation of Gb3. Enzyme-replacement therapy with agalsidase- does not seem to reverse azoospermia. No data are available regarding agalsidase- therapy. Azoospermia was still present after 4 years of treatment in both cases. The evolution of the histological aspects after ERT could not be evaluated by a second biopsy, because only cryopreserved spermatozoa were available. It remains unclear whether ERT could reduce the risk of azoospermia if introduced before decreased fertility. In conclusion, in light of these two cases, a diagnosis of Fabry disease should be considered in patients with azoospermia. On the other hand, azoospermia should be considered as a possible complication of Fabry disease. We recommend a routine sperm analysis in the follow-up of young patients with Fabry disease. Because we do not know the efficacy of agalsidase therapy on the genital involvement in Fabry disease, sperm cryopreservation should also be Fertility and Sterility 212.e17

235 advised in these patients, to circumvent developing azoospermia in the future. Acknowledgments: The authors thank Jean-Louis Pariente, M.D., for performing the testicular biopsies. REFERENCES 1. Brady RO, Schiffmann R. Clinical features of and recent advances in therapy for Fabry disease. J Am Med Assoc 2000;284: Colombi A, Kostyal A, Bracher R, Gloor F, Mazzi R, Tholen H. Angiokeratoma corporis diffusum: Fabry s disease. Helv Med Acta 1967;34: Desnick RJ, Ioannou YA, Eng CM. -galactosidase A deficiency: Fabry disease. In: Scriver CR, Beaudet AL, Sly WS, Valle D, Kinzler KE, Vogelstein B, eds. The metabolic and molecular bases of inherited disease. New York: McGraw-Hill, 2001: Desnick RJ, Brady R, Barranger J, Collins AJ, Germain DP, Goldman M, et al. Fabry disease, an under-recognized multisystemic disorder: expert recommendations for diagnosis, management, and enzyme replacement therapy. Ann Intern Med 2003;138: Elleder M. Sequelae of storage in Fabry disease pathology and comparison with other lysosomal storage diseases. Acta Paediatr Suppl 2003;443: Eng CM, Resnick-Silverman LA, Niehaus DJ, Astrin KH, Desnick RJ. Nature and frequency of mutations in the alpha-galactosidase A gene that cause Fabry disease. Am J Hum Genet 1993;53: MacDermot KD, Holmes A, Miners AH. Anderson-Fabry disease: clinical manifestations and impact of disease in a cohort of 98 hemizygous males. J Med Genet 2001;38: Wilcox WR, Banikazemi M, Guffon N, Waldek S, Lee P, Linthorst GE, et al. International Fabry Disease Study Group. Long-term safety and efficacy of enzyme replacement therapy for Fabry disease. Am J Hum Genet 2004;75: Torok L, Szekeres L, Reszler M. Angiokeratoma corporis diffusum in 2 brothers. Hautarzt 1980;31: Nistal M, Paniaga R, Picazo ML. Testicular and epididymal involvement in Fabry s disease. J Pathol 1983;141: Verheyen G, De Croo I, Tournaye H, Pletincx I, Devroey P, Van Steirteghem AC. Comparison of four mechanical methods to retrieve spermatozoa from testicular tissue. Hum Reprod 1995;10: Faraggiana T, Churg J, Grishman E, Strauss L, Prado A, Bishop DF, et al. Light- and electron-microscopic histochemistry of Fabry s disease. Am J Pathol 1981;103: Faggiano A, Pisani A, Pivonello R, Filippella M, Gaccione M, Tortora F, et al. Multiple endocrine system involvement in patients with Fabry disease. Presented at the 5th International Symposium on Lysosomal Storage Diseases, Valencia, 2005, April Gondos B. Testicular development. In: Johnson AD, Gomes WR, eds. The testis, volume IV. New York: Academic Press, 1977: Guérin JF, Ben Ali H, Rollet J, Souchier C, Czyba JC. Alpha-glucosidase as a specific epididymal enzyme marker: its validity for the etiologic diagnosis of azoospermia. J Androl 1986;7: Cooper TG, Yeung CH, Nashan D, Nieschlag E. Epididymal markers in male infertility. J Androl 1988;9: Yeung CH, Cooper TG, Senge T. Histochemical localization and quantification of -glucosidase in the epididymis of men and laboratory animals. Biol Reprod 1990;42: Prem AR, Punekar SV, Kalpana M, Kelkar AR, Acharya VN. Male reproductive function in uremia: efficacy of haemodialysis and renal transplantation. Br J Urol 1996;78: e18 Papaxanthos-Roche et al. Azoospermia in two men with Fabry disease Vol. 88, No. 1, July 2007

236 CASE REPORT Oxytocin antagonists may improve infertility treatment Piotr Pierzynski, M.D., Ph.D., a Torsten M. Reinheimer, Ph.D., b and Waldemar Kuczynski, M.D., Ph.D. a a Center for Reproductive Medicine KRIOBANK, Bialystok, Poland; and b Ferring Pharmaceuticals A/S, International PharmaScience Center, Department of Non-Clinical Development, Copenhagen, Denmark Objective: To confirm the improvement of uterine receptivity following administration of oxytocin and vasopressin V 1A antagonist atosiban. Design: Case report. Setting: Private reproductive medicine center. Patient(s): A 42-year-old woman with a history of 15 years infertility and seven failed in vitro fertilization/embryo transfer (IVF-ET) attempts. Intervention(s): Atosiban (mixed vasopressin V 1A /oxytocin antagonist registered for the treatment of imminent premature birth) was administered on the 14th day of endometrial synchronization for oocyte donation. Main Outcome Measure(s): Uterine contractile activity (component of uterine receptivity) and success of treatment of infertility. Result(s): Intense spontaneous uterine contractility was visualized by transvaginal sonography. After 1 hour of intravenous infusion of atosiban, a repeated scan showed a significant decrease in contractile activity (11 vs 7 contractions per 4 minutes, respectively). The ET was performed immediately after, and the infusion of atosiban continued for the next 2 hours. The treatment decreased the uterine contractile activity and resulted in successful embryo implantation and a normal twin diamniotic pregnancy. Conclusion(s): Atosiban may improve uterine receptivity during ET and may increase success rates of advanced infertility treatment procedures. (Fertil Steril Ò 2007;88:213.e Ó2007 by American Society for Reproductive Medicine.) Key Words: Oxytocin antagonists, vasopressin antagonists, IVF-ET, uterine contractility, atosiban, clinical pregnancy The effectiveness of in vitro fertilization embryo transfer (IVF-ET) usually does not exceed 30% per treatment cycle (1), and is further reduced in women older than 36 years (2). Good quality of embryos and optimal intrauterine environment are the basic determinants of success for ET, and the whole IVF-ET procedure. Ideal intrauterine conditions that enable implantation include appropriate endometrial status, sufficient endometrial perfusion and absence of excessive uterine contractions. In particular, increased uterine contractile activity may expel embryos from the uterus (3, 4). Implantation and pregnancy rates are inversely correlated with the frequency of uterine contractions. High uterine contractile activity at ET (five or more contractions per minute) is found in about one-third of patients, and in these women clinical pregnancy rates reach 13% per cycle, in contrast to the 53% of successful pregnancies in women with lower uterine activity (three or less contractions per minute) (5). Moreover, irritation of the uterine cervix by the ET catheter is Received May 2, 2006; revised and accepted September 11, Reprint requests: Piotr Pierzynski M.D., Ph.D., Center for Reproductive Medicine KRIOBANK, Stoleczna 11, Bialystok, Poland (FAX: þ ; piotr.pierzynski@wp.pl). likely to induce additional contractile reflexes and further decrease the chances of successful embryo implantation (6). However, uterine contractile activity, an important component of uterine receptivity, is currently not a subject of specific diagnosis or treatment in ET recipients. Progesterone supplementation, even when acting on uterine receptivity, improving endometrial status, and decreasing uterine contractions, shows no benefit for pregnancy rates after IVF-ET (7). Studies assessing the effectiveness of piroxicam (cyclooxygenase inhibitor) and ritodrine (b 2 -adrenoreceptor agonist) have shown a positive effect on pregnancy rates (8, 9), but these drugs have failed to enter routine clinical use because of safety concerns. Oxytocin antagonists constitute a new class of drugs introduced for the tocolytic treatment of preterm labor. Atosiban (TRACTOCILE; Ferring Pharmaceuticals A/S, Copenhagen, Denmark), a mixed vasopressin V 1A /oxytocin antagonist registered in Europe for the treatment of imminent premature birth, is more uterine selective and has minimal side effects compared with b 2 -adrenoreceptor agonists (10). Inhibition of oxytocin or vasopressin V 1A receptors effectively stops uterine contractility in nonpregnant patients (11). Oxytocin/ vasopressin V 1A receptor blockade may constitute a safe /07/$32.00 Fertility and Sterility â Vol. 88, No. 1, July e19 doi: /j.fertnstert Copyright ª2007 American Society for Reproductive Medicine, Published by Elsevier Inc.

237 and effective treatment for improving uterine receptivity in women undergoing ET, providing a decrease in uterine contractile activity, an increase in endometrial perfusion, and improvement in endometrial status. We report a case of application of atosiban during IVF-ET treatment that decreased contractions of the nonpregnant uterus, supported embryo implantation, and led to successful pregnancy after seven previous negative treatment cycles. This is the first case of successful pregnancy and delivery after atosiban treatment in an IVF-ET patient. MATERIALS AND METHODS In the referred cycle, the patient was treated according to the standard procedures of endometrial synchronization for donated oocyte recipients (12). Increasing doses of estradiol valerate (Progynova; Schering AG, Berlin, Germany) were administered at 2 8 mg/day for 14 days and micronized progesterone (Utrogestan, Laboratories Besins International, Paris, France) at 600 mg/day; IVF with intracytoplasmic sperm injection (ICSI) for two donated oocytes was performed, with embryo culture, ET, and luteal support after ET (Utrogestan, 600 mg per day for 12 weeks). Oocytes used in this cycle had been donated by a healthy, 27-year-old woman with a good response to ovarian stimulation, who had presented to the IVF-ET treatment program for male factor infertility. The patient s previous treatment cycles had involved pituitary desensitization, controlled ovarian hyperstimulation, oocyte collection, IVF-ICSI, embryo culture, and ET for three cycles, then the donated oocyte scheme previously described for four consecutive cycles. In the referred cycle, ET was performed on the 14th day of synchronization using a soft transfer catheter (Labotect GmbH, Goettingen, Germany). A transvaginal sonography scan with 4-minute digital recording of a sagittal transsection of the uterus (SSD 1700 with 7.5 MHz transvaginal convex probe; Aloka Holding, Zug, Switzerland) with a digital camcorder (DCR PC100E, Sony Corporation, Tokyo, Japan) was performed before the start of atosiban infusion and then repeated directly before the ET. Assessment of uterine contractions was performed with digital 4 speed sonography film sequences, using Direct X software (Microsoft, Redmond, WA) that visualized time-compressed vertical displacements of an image segment that covered the endometrial myometrial interface. IVF-ET programs (cycles one to three) with a total number of four transferred embryos (A and B class). Normal appearance of the uterine cavity was hysteroscopically confirmed before the continuation of infertility treatment. Taking into consideration her poor ovarian response to controlled hyperstimulation, further treatment plans employed donated oocytes. In the following 7 months, four consecutive ET cycles (cycles four through seven) that used a total of eight top-quality embryos resulted in negative outcomes. Four otherwise healthy women who had been included within the IVF programs for male factor infertility had donated the oocytes used in these cycles. For the 8th cycle, after obtaining approval of a local ethics committee and receipt of the patient s written informed consent, we decided to administer atosiban. RESULTS One hour before ET, analysis of the digital transvaginal sonography (TVS) recording demonstrated high spontaneous uterine contractile activity (11 contractions within 4 minutes; Fig 1A). Intravenous administration of atosiban started with a bolus dose of 6.75 mg and continued thereafter at an infusion rate of 18 mg/hour. Directly before ET, a marked decrease in uterine contractility with decreased intensity of contractions was demonstrated (seven contractions within 4 minutes; Fig 1B). All of the visualized contractions were of fundocervical FIGURE 1 Ultrasonography of endometrial myometrial interface movements on the sagittal section of the uterine fundus. (Endo: endometrium; Myo: myometrium.) The interface is marked with bright color for better visualization; arrows represent uterine contractions. (A) High spontaneous uterine contractile activity before the treatment (control). (B) Reduced uterine activity during atosiban infusion (directly before embryo transfer). CASE PRESENTATION A 42-year-old, otherwise healthy woman was referred for treatment after a 15-year history of infertility. Following an initial diagnosis of intramural uterine myomata and left simple ovarian cyst, surgical treatment that included laparotomy, myomectomy with reconstruction of the uterus, and left cystectomy was performed with no complications. The patient was unsuccessfully treated in three consecutive Pierzynski. Atosiban in infertility treatment. Fertil Steril e20 Pierzynski et al. Atosiban in infertility treatment Vol. 88, No. 1, July 2007

238 direction, and were of less intensity during the second recording in the presence of atosiban. After performing transfer of two embryos, we reduced the atosiban to 6 mg/hour and continued for 2 hours (total administered dose: 37.5 mg). A positive pregnancy test was obtained 2 weeks after ET. Luteal support then lasted up to the 16th gestational week. Following 8 weeks, sonographic evaluation revealed a normal twin diamniotic pregnancy consistent with the gestational age. At the 29th gestational week, the patient underwent cesarean section due to vaginal bleeding suggestive of placental abruption. The delivered twins, a female and male, presented signs of prematurity and required respiratory support. The boy was operated on for meconium ileus. Both infants were released from the pediatric unit after 6 weeks with normal psychomotor development. DISCUSSION The presented case illustrates that application of atosiban, a mixed vasopressin V 1A and oxytocin receptor antagonist, decreases uterine contractions of the nonpregnant uterus and may promote implantation, specifically by preventing early embryo expulsion. Such an expulsion may result from the contractile reflexes in response to irritation by the ET catheter. In an equine animal model, experimental cervical insertion resembling irritation of the cervix during the ET was shown to induce a rapid and pronounced increase in plasma oxytocin levels (13). Uterine hypercontractility in IVF patients may also be a consequence of stimulation of myometrial expression of oxytocin receptors by supraphysiologic estradiol levels (14) arising from controlled ovarian hyperstimulation, a procedure used in IVF protocols in which exogenous gonadotropins (follicle-stimulating hormone, luteinizing hormone) are administered. Uterine contractions have been shown experimentally to transport methylene blue dye into the vagina in 57% of mock embryo transfers (3). It was demonstrated that only 45% of transferred embryos remained in the uterus 1 hour after the transfer (15), and that 15% of embryos could be found in vagina after the ET (4). The oxytocin receptor system is functionally connected to the production of prostaglandins. It has been demonstrated that oxytocin stimulates release of arachidonic acid and prostaglandin F 2a from decidual cells (16). Administration of oxytocin that stimulated uterine PGF 2a expression was shown to decrease both endometrial blood supply and embryonic survival in cattle (17). Oxytocin receptor blockade, apart from the reduction of uterine contractions, is reported to inhibit the stimulation of uterine production of prostaglandins (18). Additionally, atosiban has been demonstrated to preferentially relax uterine arteries of near-term pregnant rats, decreasing the systolic blood pressure, which in turn may increase uterine perfusion (19). Such multidirectional modes of action of atosiban may be of benefit, providing a specific treatment for the improvement of uterine receptivity following ET. The scheme of administration of atosiban in the referred patient (intravenous bolus of 6.75 mg, 1-hour infusion at 18 mg/hour, followed by 2-hours infusion of 6 mg/hour) is justified by its pharmacokinetics (20) and is being clinically applied in pregnant women experiencing preterm labor (21). Neither prolonged infusion nor sonography scans after ET was possible for ethical reasons (patient discomfort during prolonged infusion and embryotoxicity of ultrasound, respectively). Up until now, treatment of ET recipients with oxytocin antagonists has not been a subject of experimental investigation. Therefore, before commencing the experimental treatment, we decided to exclude the possibility of adverse influences of atosiban on embryos. In a preclinical study that preceded the atosiban administration in the presented case, we did not find any embryotoxic influence on human sperm motility or on rabbit embryonic development (22). A treatment that improves uterine receptivity and increases pregnancy rates should be further investigated. In the referred case, 12 embryos transferred in seven cycles had failed to implant, most likely due to excessive uterine contractions. This case may shed new light on the role of oxytocin and vasopressin V 1A receptors in the uterine receptivity and support advanced infertility treatment. Treatment with atosiban or other vasopressin V 1A /oxytocin antagonists such as barusiban (23) may substantially improve uterine receptivity during ET and support implantation, especially in women with increased uterine motility. Because it is uterine specific, embryo-safe, decreases the PGF 2a formation, and probably increases uterine perfusion, oxytocin/vasopressin V 1A receptor blockade may constitute a new treatment opportunity in ET procedures. REFERENCES 1. Nyboe Andersen A, Gianaroli L, Felberbaum R, de Mouzon J, Nygren K. Assisted reproductive technology in Europe, Results generated from European registers by ESHRE. Hum Reprod 2005;20: Stolwijk A, Wetzels A, Braat D. Cumulative probability of achieving an ongoing pregnancy after in-vitro fertilization and intracytoplasmic sperm injection according to a woman s age, subfertility diagnosis and primary or secondary subfertility. Hum Reprod 2000;15: Mansour R, Aboulghar M, Serour G, Amin Y. Dummy embryo transfer using methylene blue dye. Hum Reprod 1994;9: Poindexter A, Thompson D, Gibbons W. Residual embryos in failed embryo transfer. Fertil Steril 1986;46: Fanchin R, Righini C, Olivennes F, Taylor S, de Ziegler D, Frydman R. Uterine contractions at the time of embryo transfer alter pregnancy rates after in-vitro fertilization. Hum Reprod 1998;13: Lesny P, Killick S, Tetlow R, Robinson J, Maguiness S. Embryo transfer can we learn anything new from the observation of junctional zone contractions? Hum Reprod 1998;13: Fanchin R, Righini C, de Ziegler D, Olivennes F, Ledee N, Frydman R. Effects of vaginal progesterone administration on uterine contractility at the time of embryo transfer. Fertil Steril 2001;75: Tsirigotis M, Pelekanos M, Gilhespie S, Gregorakis S, Pistofidis G. Ritodrine use during the peri-implantation period reduces uterine contractility and improves implantation and pregnancy rates post-implantation. Presented at the 16th annual meeting of the European Society of Human Fertility and Sterility â 213.e21

239 Reproduction and Embryology; June 25 28, 2000; Bologna, Italy: O Moon H, Park S, Lee J, Kim K, Joo B. Treatment with piroxicam before embryo transfer increases the pregnancy rate after in vitro fertilization and embryo transfer. Fertil Steril 2004;82: Worldwide Atosiban vs Beta-agonist Study Group. Effectiveness and safety of the oxytocin antagonist atosiban versus beta-adrenergic agonists in the treatment of preterm labour. Br J Obstet Gynaecol 2001;108: Akerlund M. Involvement of oxytocin and vasopressin in the pathophysiology of preterm labor and primary dysmenorrhea. Prog Brain Res 2002;139: Devroey P, Pados G. Preparation of endometrium for egg donation. Hum Reprod Update 1998;4: Handler J, Konigshofer M, Kindahl H, Schams D, Aurich C. Secretion patterns of oxytocin and PGF2alpha-metabolite in response to cervical dilatation in cyclic mares. Theriogenology 2003;59: Richter ON, Kubler K, Schmolling J, Kupka M, Reinsberg J, Ulrich U, et al. Oxytocin receptor gene expression of estrogen-stimulated human myometrium in extracorporeally perfused non-pregnant uteri. Mol Hum Reprod 2004;10: Menezo L, Anker D, Saint-Baroux J. Conception and realization of artificial dried embryo for training in IVF. Acta Eur Fertil 1985;16: Wilson T, Liggins GC, Whittaker DJ. Oxytocin stimulates the release of arachidonic acid and prostaglandin F2 alpha from human decidual cells. Prostaglandins 1988;35: Lemaster JW, Seals RC, Hopkins FM, Schrick FN. Effects of administration of oxytocin on embryonic survival in progestogen supplemented cattle. Prostaglandins Other Lipid Mediat 1999;57: Serradeil-Le Gal C, Valette G, Foulon L, Germain G, Advenier C, Naline E, et al. SSR126768A (4-chloro-3-[(3R)-(þ)-5-chloro-1-(2,4-di- methoxybenzyl)-3-methyl-2-oxo-2,3-dihydro-1h-indol-3-yl]-n-ethyl-n- (3-pyridylmethyl)-benzamide, hydrochloride): a new selective and orally active oxytocin receptor antagonist for the prevention of preterm labor. J Pharmacol Exp Ther 2004;309: Vedernikov Y, Betancourt A, Shi S, Shi L, Reinheimer T, Garfield R. Oxytocin antagonistic effect of barusiban and atosiban in isolated uterine artery from late pregnant rats. Presentation at the annual scientific meeting of the Society for Gynecologic Investigation; March 2006; Toronto, Canada. 20. Goodwin TM, Millar L, North L, Abrams LS, Weglein RC, Holland ML. The pharmacokinetics of the oxytocin antagonist atosiban in pregnant women with preterm uterine contractions. Am J Obstet Gynecol 1995; 173: European Medicines Agency. Tractocile European Public Assessment Report; Available at: Humans/EPAR/tractocile/tractocile.htm. 22. Pierzynski P, Gajda B, Smorag Z, Rasmussen A, Kuczynski W. Effect of atosiban on rabbit embryo development and human sperm motility. Fertil Steril 2007;87: Pierzynski P, Lemancewicz A, Reinheimer T, Akerlund M, Laudanski T. Inhibitory effect of barusiban and atosiban on oxytocin-induced contractions of myometrium from preterm and term pregnant women. J Soc Gynecol Invest 2004;11: e22 Pierzynski et al. Atosiban in infertility treatment Vol. 88, No. 1, July 2007

240 CORRESPONDENCE Positive expression of the immunoglobulin superfamily protein IZUMO on human sperm of severely infertile male patients Recently, the immunoglobulin superfamily protein IZUMO on the sperm surface was identified as being essential for sperm egg fusion. Although we examined the expression of IZUMO on sperm of 13 male infertile patients with severe oligozoospermia and/or athenozoospermia and 12 infertile patients with fertilization failure in previous conventional IVF to determine whether it is varied in infertility patients, we could not identify any patients with IZUMO negative by immunocytochemistry. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Received July 28, 2006; revised and accepted November 16, Reprint requests: Yukihiro Terada, M.D., Ph.D., Department of Obstetrics and Gynecology, Tohoku University School of Medicine, 1-1 Seiryo-machi, Aoba-ku, Sendai, Miyagi , Japan (FAX: ; Although considerable progress identifying sperm and egg components involved in sperm egg fusion has been made, several issues remain unresolved. In the nearly 2-decade search for sperm surface and egg plasma membrane proteins functioning in this process, most attention has been given to the members of the ADAM (a disintegrin and metalloprotease) family of proteins expressed by sperm and integrins expressed on the egg plasma membrane. However, the phenotypes of those gene knockout mice revealed that they were not essential factors for sperm egg fusion (1 4). Recently, it was demonstrated that IZUMO (5), a novel member of the immunoglobulin superfamily expressed on the sperm inneracrosomal membrane after the acrosome reaction, and CD9 (6 8), a member of the tetraspanin superfamily of integral membrane proteins on the egg surface, may play essential roles in sperm egg fusion. IZUMO-deficient male mice and CD9-deficient female mice exhibited infertility, resulting from a severe impaired sperm egg fusion. The aim of the present study was to determine whether the expression of IZUMO is varied in infertility patients. We examined only acrosome-reacted sperm from male infertile patients with severe oligozoospermia and/or athenozoospermia that clinically indicated intracytoplasmic sperm injection (ICSI) including two cases of frozen sperm. We also examined only acrosome-reacted sperm from infertile patients with fertilization failure including sperm egg fusion failure, which means in this study that the patients had no fertilized egg with two pronuclei even though some eggs in metaphase II were inseminated in previous conventional IVF. In other words, infertile patients with fertilization failure never demonstrated fertilization in previous conventional IVF. As human membrane cofactor protein CD46 (9) is not detectable at the plasma membrane of fresh sperm, but is detectable on the inneracrosomal membrane of sperm after the acrosome reaction as occurred with IZUMO, we regard CD46 positive sperm as sperm after the acrosome reaction. All sample collection and procedures were approved by the Ethics Committee of the Tohoku University School of Medicine and Suzuki Memorial Hospital, and informed consent was obtained from all patients. Ejaculated sperm were obtained from a 32-year-old fertile donor and 13 male infertile patients and 12 infertile patients with fertilization failure. Sperm were frozen in freezing medium, Test Yolk Buffer (Irvine Scientific, Santa Ana, CA), at 80 C, then thawed at normal temperature. Sperm were washed in modified HTF (Irvine Scientific) and 10% serum substitute supplement (Irvine Scientific), then centrifuged at 335 g for 5 minutes. After resuspension, the sperm were allowed to swim up for 60 minutes or/and centrifuged at 84 g for 20 minutes and incubated in a droplet of P1 medium (Irvine Scientific) to induced the acrosome reaction. Incubated sperm were then attached to coverslips, which were rinsed in phosphate buffered serum. Nonspecific antibody binding was blocked by incubation with normal goat serum for 1 hour at 37 C. Sperm were labeled overnight at 4 C with monoclonal antibodies against CD46 (mouse IgG, diluted 1:100; provided by Dr, Seya). IZUMO was detected by incubation with polyclonal antibodies (rabbit IgG, diluted 1:50) overnight at 4 C. Primary antibodies were detected using fluorescein isothiocyanate-conjugated goat antimouse (Zymed, San Francisco, CA) or tetramethyl rhodamine isothiocyanate-conjugated antirabbit (Sigma, St. Louis, MO) antibodies (both IgG diluted 1:40) for 1 hour at 37 C. DNA was detected by labeling with Hoechst dye (Hoechest, Kumamoto, Japan) for 15 minutes at 37 C. Coverslips were examined using a Leica DMLB microscope (Leica Microsystems, 214 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

241 TABLE 1 Male patients with severe infertility. Case Pregnancy career Sperm density ( 10 6 /ml) Sperm motility (%) Result of ICSI No. of counted sperm No. of CD46-positive sperm No. of Izumo-negative and CD46-positive sperm 1 0G0P G0P Infertility G0P Infertility G0P Infertility G0P Pregnancy 475 b G0P 2 76 Infertility 317 b G0P 3 23 Infertility G0P 3 12 Infertility G0P Infertility G0P 7 23 Infertility G0P Infertility G0P Infertility G0P Infertility Note: G gravida; ICSI intracytoplasmic sperm injection; P pregnancy. a The patient has not yet undergone ICSI. b Frozen sperm were studied. Hayasaka. Expression of IZUMO on human sperm. Fertil Steril a Heidelberg, Germany). The numbers of CD46- and/or IZUMO-positive sperm were counted using Micro Analyzer software (Ather, Tokyo, Japan). At first, we examined the sperm obtained from a fertile donor. IZUMO were detected on the inneracrosomal membrane of sperm after the acrosome reaction. We could not identify any spermatozoon in which IZUMO could not be detected on the inneracrosomal membrane in the presence of CD46. We examined the sperm of 13 male infertile patients with oligozoospermia or asthenozoospermia as the clinical indication for ICSI. Their pregnancy career, sperm density, sperm motility, and result of ICSI are shown in Table 1. We also examined the sperm of 12 infertile patients with fertilization failure. Their clinical background seems to be as follows. Nine infertile couples displayed primary infertility, while three infertile couples exhibited secondary infertility. Clinical indication for previous conventional IVF was unknown for five infertile couples, a male factor for six infertile couples, and endometriosis for one infertile couple. As for them, fertilization was confirmed in subsequent ICSI. The average number of inseminated oocytes in previous conventional IVF attempts was 8.92 oocytes per infertile couple (ranging from 2 to 27). The average number of sperm per infertile patient counted in the study was 403 (ranging from 112 to 884). Among those sperm, the average number of CD46-positive sperm per infertile patient was 203 (ranging from 72 to 529). IZUMO was detected on the inner acrosomal membrane of all the examined sperm after the acrosome reaction. Our result suggest that sperm from infertile patients have a fundamental potential to complete sperm egg fusion, even in the case of ICSI. We could not identify any patients with IZUMO negative by immunocytochemistry. Men with dysfunction of IZUMO would only be able to leave a descendant by the use of ICSI, which has been performed in infertility treatments for only the past 15 years. Prior to 15 years ago, they would have been lost from the population because of their infertile phenotype. As this would make such individuals quite rare, our sample size was likely insufficient to identify them. We studied 13 severely infertile male patients who underwent ICSI because of severe oligozoospermia and/or asthenozoospermia. In each patient, IZUMO could be detected in acrosome reacted sperm at the protein level. The function of this protein is thought to fuse with the egg plasma membrane, which remains normal regardless of extreme decreases in either density or motility. This report indicates the difficulty to select the assisted reproductive technology plan for infertile patients by the information from a single factor, for example, sperm motility, IZUMO, and other molecules on the sperm and egg, which participated during the fertilization process. Acknowledgments: The authors acknowledge Dr. Masakuni Suzuki, Dr. Haruo Murakawa, Dr. Koichi Kyono, and Dr. Takashi Murakami for their expert assistance on this study. Fertility and Sterility 215

242 Shinichi Hayasaka, M.D. a Yukihiro Terada, M.D., Ph.D. a Naokazu Inoue, Ph.D. b Masaru Okabe, Ph.D. b Nobuo Yaegashi, M.D., Ph.D. a Kunihiro Okamura, M.D., Ph.D. a a Department of Obstetrics and Gynecology, Tohoku University School of Medicine, Sendai, Miyagi; and b Genome Information Research Center, Osaka University, Osaka, Japan REFERENCES 1. Cho C, Bunch OD, Faure J-E, Goulding HE, Eddy ME, Primakoff P, et al. Fertilization defects in sperm from mice lacking Fertilin. Science 1998;281: Shamsadin R, Adham MI, Nayernia K, Heinlein OAU, Oberwinkler H, Engel W. Male mice deficient for germ-cell Cyritestin are infertile. Biol Reprod 1999;61: Nishimura H, Cho C, Branciforte RD, Myles GD, Primakoff P. Analysis of loss of adhesive function in sperm lacking Cyritestin or Fertilin. Dev Biol 2001;233: Miller B, Georges-Labouesse E, Primakoff P, Myles D. Normal fertilization occurs with eggs lacking the integrin alpha 6 beta 1 and is CD9-dependent. J Cell Biol 2000;149: Inoue N, Ikawa M, Isotani A, Okabe M. The immunoglobulin superfamily protein Izumo is required for sperm to fuse with eggs. Nature 2005;434: Miyado K, Yamada G, Yamada S, Hasuwa H, Nakamura Y, Ryu F, et al. Requirement of CD9 on the egg plasma membrane for fertilization. Science 2000;287: Naour LF, Rubinstein E, Jasmin C, Prenant M, Boucheix C. Severely reduced female fertility in CD9-deficient mice. Science 2000;287: Kaji K, Oda S, Shikano T, Ohnuki T, Uematsu Y, Sakagami J, Tada N, et al. The gamete fusion process is defective in eggs of CD9-deficient mice. Nat Genet 2000;24: Inoue N, Ikawa M, Nakanishi T, Matsumoto M, Nomura M, Seya T, et al. Disruption of mouse CD46 couses an accelerated spontaneous acrosome reaction in sperm. Mol Cell Biol 2003;23: Hayasaka et al. Correspondence Vol. 88, No. 1, July 2007

243 Repeat vasectomy reversal yields high success rates We retrospectively reviewed our experiences with repeat vasectomy reversal and report the patency and natural pregnancy rates. Our data demonstrate that repeat vasectomy reversal is a valid option in patients with a failed initial reversal, although the suitability of repeat reversal should be based on the obstructive interval, the original reversal, the experience of the reversal surgeon, and any female factors, as well as the couple s wishes. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Vasectomy is one of the most common urologic surgeries performed, with nearly 500,000 men undergoing the procedure each year. Vasectomy reversal is performed in nearly 6% of these men, and in the absence of significant female factors it has been shown to be more cost-effective than sperm aspiration and in vitro fertilization (IVF) (1, 2). Previous reports of repeat vasectomy reversals following initial vasectomy reversal failure have demonstrated reasonable success rates (3 8). However, improvements with IVF and intracytoplasmic sperm injection (ICSI) have questioned the utility of vasectomy reversals and repeat reversals. The purpose of our study was to review the success rates for repeat reversals and to determine if the obstructive interval affects the type and outcome of the repeat procedure. Received May 23, 2006; revised November 7; accepted November 17, Reprint requests: Jay Sandlow, M.D., Associate Professor, Department of Urology, Medical College of Wisconsin, 9200 W. Wisconsin Avenue, Milwaukee, WI (FAX: ; jsandlow@ mail.mcw.edu). After obtaining Institutional Review Board approval, we retrospectively analyzed the indications and outcomes of all microsurgical vasectomy reversals performed by four fellowship-trained male infertility specialists. Follow-up was obtained from clinic visits, phone contact, and in some cases written notes from the patient. Semen analysis was obtained between 4 weeks and 3 months after surgery and every 3 months until pregnancy occurred or the patient elected to discontinue follow-up. Patients without a postoperative semen analysis were excluded from patency rate calculations unless they established a pregnancy. Patients who underwent vasovasostomy (VV) with less than 6 months of follow-up or vasoepididymostomy (EV) with less than 12 months of follow-up were excluded from the patency rate analysis unless they had motile sperm in the semen. Patients with less than 12 months of follow-up or no ongoing interest in establishing a conception were excluded from the pregnancy rate analysis unless they had established a pregnancy. These criteria are in accordance with previously published reports regarding vasectomy reversal outcomes (9). Also, patients without a semen analysis, but who actively attempted conception for at least 1 year, were included in the pregnancy rate calculation. All procedures were performed using microsurgical technique: VV was performed with either a formal twolayer anastomosis with 10-0 and 9-0 nylon or modified one-layer anastomosis with 9-0 nylon; EV was performed with the Berger triangulation or Marmar intusussception technique (10, 11). Statistical analysis was performed with computer software (Instat; Graphpad Software, San Diego, CA). Forty-nine men underwent repeat vasectomy reversal. The average obstructive interval for the original reversal was 10.5 years and the average time between the original and the repeat procedure was 2.7 years. The average patient age was 40.8 years, and the average partner age was 32.0 years. Average time of follow-up from second reversal was 9.3 months (range 2 36 months). Pregnancy data was available on 32 couples, with 13 (41%) achieving natural pregnancy. An additional 2 couples conceived via IVF. Two couples had no follow up. The data are presented in Table 1. Nineteen patients out of 49 (34%) required at least a unilateral EV if they had a VV as their first procedure. Patients with at least a unilateral VV had patency and pregnancy rates of 91% and 48%, respectively. Eight out of 19 patients (42%) with obstructive interval 10 years required at least unilateral EV, with 89% patency after their repeat reversal. Eleven out of 28 patients (39%) with obstructive interval 10 years required at least unilateral EV, with 80% patency after their repeat reversal. The requirement for at least a unilateral EV and patency rates did not differ between the two groups (P 1.0 and P.6797, respectively). The pregnancy rate also was not different for those with obstructive intervals less than 10 years versus 10 years or greater, although the number of patients with pregnancy data was small (58% vs. 33%; P.2641). Secondary azoospermia occurred in four (10%) patients; one with a 9-year obstructive interval and three at 10 years. The Vasovasostomy Study Group (3) reported that repeat vasectomy reversal procedures have decreased success rates compared with first-time reversal procedures. Patency rates were 86% and 75% for first and repeat reversals, /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 217

244 TABLE 1 Success rates for repeat vasectomy reversals with obstructive interval <10 vs. 10 years. Obstructive interval Repeat reversal VV VV-EV EV Total Patency rates Natural pregnancy rates 10 yrs /18 (89%) 7/12 (58%) 10 yrs /25 (80%) (P.6797) 7/18 (39%) (P.2641) Total 40/47 (85%) 14/32 (44%) Note: EV vasoepididymostomy; VV vasovasostomy. Hollingsworth. Outcomes of repeat vasectomy reversals. Fertil Steril respectively (P.0004), and pregnancy rates were 52% and 43%, respectively (P.08). Because of this, couples who have failed the first reversal must decide whether to undergo a repeat reversal or consider other options, such as sperm aspiration and IVF/ICSI. Although success rates for IVF have improved, it is still more costly than vasectomy reversals. In addition, it exposes the female partner to hormonal stimulation, surgical procedures, and a greater chance of multiple gestations. Therefore, many couples would still prefer the option of vasectomy reversal. Several studies have examined the success of repeat vasectomy reversal after a failed first attempt. Matthews et al. (4) reported a patency rate of 85% and a pregnancy rate of 31%. Donovan et al. (5) demonstrated patency and pregnancy rates of 78% and 44%, respectively. Pasqualatto et al. (6) reported 67% patency and 25% pregnancy rates after repeat EV. They found that although patency rates were similar regardless of the etiology of the obstruction, pregnancy rates were better in men with congenital obstruction compared with obstruction due to either vasectomy or inflammation. Paick et al. (7) found that obstructive interval, reconstruction type, anastomotic site, patient age, and postoperative semen parameters also did not influence surgical outcome. In the Vasovasostomy Study Group (3), there was a strong relationship between the obstructive interval and the pregnancy rates. In the present series, there was a trend toward a lower pregnancy rate if the obstructive interval was greater than 10 years, although the difference was not statistically significant. Perhaps with larger numbers of patients, these results would have been significant. Patients who were 10 years from their original vasectomy had pregnancy rates of 58%, whereas those with 10 years had a 33% pregnancy rate (P.2641). Hernandez and Sabanegh (8) found that up to 73% of patients required at least a unilateral EV in their repeat procedures compared with 4% in the initial reversal. This study also found patency and pregnancy rates of 88% and 46%, respectively, in patients with at least a unilateral VV. In the present study, only 35% of patients undergoing repeat procedures required at least a unilateral VE, suggesting that there is a good chance of performing a repeat VV, which has a better pregnancy rate. The patency and pregnancy rates in the present series of 91% and 48%, respectively, are similar to those in the Hernandez and Sabanegh report. One of the limitations of our study is the lack of follow-up for some of our patients and for those with incomplete pregnancy data. This highlights the difficulty in obtaining follow-up for some of these patients. Furthermore, there may have been subtle differences in surgical techniques and intraoperative decisions that led to a difference in outcomes from the various surgeons. Finally, it might have been helpful to determine the cause of failure in the original reversals (ischemia, sperm leak, etc.) and see if there is any relationship to the outcome of the repeat reversal. However, this was not something that was noted by any of the surgeons on a regular basis. Nonetheless, we feel that this report adds to the literature and offer these conclusions regarding repeat vasectomy reversals: Patency and pregnancy rates were not statistically different, nor was the need for EV, between patients with 10 years and 10 years obstructive interval; therefore, the time from vasectomy solely cannot be used to counsel couples. Other studies have demonstrated a relationship between the obstructive interval and pregnancy rates. With larger numbers of patients, the difference in pregnancy rates might have achieved statistical significance. In the absence of significant female factor, repeat vasectomy reversal, although it is technically more difficult, yields acceptable pregnancy outcomes, even in longer obstructive intervals. In light of this report, as well as those previously mentioned, many couples who have failed a vasectomy reversal are still excellent candidates for a repeat reversal. However, there may be some couples in whom sperm aspiration with IVF/ICSI is the preferred option. Patients who required EV in their first reversal may have a lower chance of pregnancy than with IVF (6), as may couples with significant female factors, such as tubal disease and ovulatory dysfunction requiring gonadotropin stimulation. Thus, there are situa- 218 Hollingsworth et al. Correspondence Vol. 88, No. 1, July 2007

245 tions where a repeat reversal may not be as good an option as IVF. In summary, repeat vasectomy reversal is a valid option in patients with a failed initial reversal. The suitability of repeat reversal should be based on the obstructive interval, the original reversal, the experience of the reversal surgeon, and any female factors, as well as the couple s wishes. Margarita R. Hollingsworth, M.D. a Jay I. Sandlow, M.D. a Christopher G. Schrepferman, M.D. b Robert E. Brannigan, M.D. c Peter N. Kolettis, M.D. d Departments or Divisions of Urology, a Medical College of Wisconsin, Milwaukee, Wisconsin; b University of Kentucky, Lexington, Kentucky; c Northwestern University, Evanston, Illinois; and d University of Alabama, Birmingham, Alabama REFERENCES 1. Pavlovich CP, Schlegel PN. Fertility options after vasectomy: a cost-effectiveness analysis. Fertil Steril 1997;67: Kolettis PN, Thomas AJ Jr. Vasoepididymostomy for vasectomy reversal: a critical assessment in the era of intracytoplasmic sperm injection. J Urol 1997;158: Belker AM, Thomas AJ Jr, Fuchs EF, Konnak JW, Sharlip ID. Results of 1,469 microsurgical vasectomy reversals by the Vasovasostomy Study Group. J Urol 1991;145: Matthews GJ, McGee KE, Goldstein M. Microsurgical reconstruction following failed vasectomy reversal. J Urol 1997;157: Donovan JF Jr, DiBaise M, Sparks AET, Kessler J, Sandlow JI. Comparison of microscopic epididymal sperm aspiration and intracytoplasmic sperm injection/in-vitro fertilization with repeat microscopic reconstruction following vasectomy: is second attempt vas reversal worth the effort? Hum Reprod 1998;13: Pasqualotto FF, Agarwal A, Srivastava M, Nelson DR, Thomas AJ. Fertility outcomes after repeat vasoepididymostomy. J Urol 1999; 162: Paick JS, Park JY, Par DW, Park K, Son H, Kim SW. Microsurgical vasovasostomy after failed vasovasostomy. J Urol 2003;169: Hernandez J, Sabanegh ES. Repeat vasectomy reversal after initial failure: overall results and predictors for success. J Urol 1999;161: Matthew GJ, Schlegel PN, Goldstein M. Patency following microsurgical vasoepididymostomy and vasovasostomy: temporal considerations. J Urol 1995;154: Berger RE. Triangulation end to side vasoepididymostomy. J Urol 1998;159: Marmar JL. Modified vasoepididymostomy with simultaneous double needle placement, tubulotomy, and tubular invagination. J Urol 2000; 163: Fertility and Sterility 219

246 Differential expression of selected gene products in uterine leiomyomata and adenomyosis Gene products estrogen receptor, progesteron receptor-a, retinoid X receptor, insulin-like growth factor-ii, insulin-like growth factor I receptor, platelet-derived growth factor, epithelial growth factor receptor, and BCL-2 were examined by immunohistochemistry with the aid of a tissue microarray from 46 hysterectomies with adenomyosis and leiomyomata. With appropriate internal controls, there were significant differences in gene expression between adenomyosis and leiomyomata. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Adenomyosis (ADM) is a very common symptomatic disorder characterized by benign, ectopic invasion of the endometrial glands and stroma into the myometrium, with hyperplasia of the surrounding smooth muscle (1). The etiology of adenomyosis is largely unknown. It is speculated that weakness in the uterine smooth muscle, increased uterine pressure, or metaplasia (2) may be contributing factors. Abnormal levels of sex-steroid hormones appear to be associated with adenomyosis. Long-term treatment of mice with ovarian sex-steroid hormones can induce adenomyosis (3,4). Some molecular factors, such as local growth factors, could play a role in its pathogenesis (5). The IGF-II gene is one of three that are significantly down-regulated by selective estrogen receptor modulator (SERM)-induced adenomyosis in mice (2,6). Adenomyosis commonly coexists with uterine leiomyomata (ULM) (more than one third of ULM are accompanied by ADM) (7). Although the pathogenesis of both diseases remains unknown, ADM and ULM have a few common associations: they affect women of reproductive age, and display a similar response to antiestrogen treatments (1). In a previous study, we noted that the average sizes of ULM are smaller in patients with ADM than in those without ADM (7). The levels of expression of ULMassociated genes appear to be lower in ULM with ADM than in ULM without ADM (7). In this study, we further compared the expression of selected gene products between adenomyosis and leiomyomata. The Institutional Review Board for Human Materials (New York University School of Medicine, New York, New York) approved this study. Received May 17, 2006; revised November 3, 2006; accepted November 16, Current address of Mary Levy is the Department of Pathology, Saint Joseph s Hospital and Medical Center, Phoenix, Arizona Reprint requests: Jian-Jun Wei, M.D., Department of Pathology, New York University School of Medicine, Bellevue Hospital, NB4W1, 462 First Avenue, New York, New York (FAX: ; E- mail: weij03@med.nyu.edu). Forty-six patients with both uterine leiomyomata and adenomyosis were selected for this study. All patients underwent hysterectomies during reproductive age (i.e., years), and all sampled endometria were in the proliferating phase (i.e., follicular phase). The sizes of leiomyomata ranged from cm, with a mean size of 5.26 cm (Table 1). Tissue sections of archival, formalin-fixed, paraffin-embedded specimens from endometrium, myometrium, adenomyosis, and leiomyomata were reviewed and selected. Tissue cores from each of four components were arrayed for a tissue microarray (TMA), comprising a total of 184 tissue cores. Matched endometrium and myometrium served as internal controls for ADM and ULM, respectively. Antibodies against BCL-2, epithelial growth factor receptor (EGFR), estrogen receptor (ER ), insulin-like growth factor II (IGF-II), insulin-like growth factor I receptor (IFG1R ), platelet-derived growth factor (PDFR), progesteron receptor (PR-A), and retinoid X receptor (RXR ) were used. The immunohistochemical conditions for these antibodies were previously described (8). Stained TMA slides were scored jointly by two pathologists with the use of a visual semiquantitation method (optical density of the immunoreactivity), depending on the staining characteristics of the antibody. The level of expression of IGF-II mrna was examined by an in situ complementary RNA (crna) hybridization of TMA tissue cores with a Digoxin-labeled IGF-II crna probe (Roche, Inc., Indianapolis, IN). The IGF-II crna probe was generated by the IGF-II forward primer from exon 6 (AAGTCGATGCTGGTGCTTCT) and reverse primer from exon 7 (GGGTCGACACGTCCCTCT). To reduce variations from the tissue preparation among cases, internal matched endometrium (for ADM) and myometrium (for ULM) were used. To evaluate the actual changes of gene expression from ULM and ADM, the net difference of immunoreactivity (scores of ADM minus endometrium, and of ULM minus myometrium) for all markers and in situ hybridization intensities of IGF-II were 220 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

247 TABLE 1 Summary of patients information (A) and differential expression of selected gene products in leiomyomata and adenomyosis compared to matched endometrium and myometrium (B). A. No. of cases Age (y) (mean SEM) ULM size (cm) (mean SEM) B ( ) ( ) ADM Markers ADM-E (mean SEM) ADM-S (mean SEM) ADM (E S) (mean SEM) ULM (mean SEM) P value a BCL EGFR ER IGF-II IGF1R PDGF PR RXR Note: ADM-E adenomyosis epithelium; ADM-S adenomyosis stroma; ADM (E S) adenomyosis epithelium and stroma. a Statistical significance between ADM (E S) and ULM. Levy. Gene expression in leiomyomata and adenomyosis. Fertil Steril scaled. The net difference of the selected gene products in ADM (including stroma and epithelium) and ULM against matched endometrium and myometrium are summarized in Table 1 and Figure 1. Among cases with interpretable results, a reduction of ER was identified in 42% (11/26) of ADM, with a net difference of , while only 13% (6/45) of ULM had a reduced expression of ER, with a net difference of There was a significant difference in ER expression between ADM and ULM (P.001). A minimal change in PR-A expression was seen in ADM compared to the matched endometrium, with a net difference of An increase of PR-A protein was identified in 60% of ULM (25/41), with a net difference of The difference in PR-A expression levels between ULM and ADM was not significant. Most of the ADM (22/28) had a net difference of immunoreactivity for RXR ( ). In contrast, the overall expression of RXR in ULM had a minimal change ( ). However, increased RXR expression was found in 30% (14/46) of ULM, no change in 54% (25/46) and decreased expression in 15% (7/46) (Fig. 1C). The levels of expression of RXR were significantly different between ULM and ADM (P.001). Epithelial growth factor receptor was reduced in about 55% (16/29) of ADM. Overall, there was a minimal change in ADM epithelium ( ), and a slight reduction in ADM stroma ( ), compared to matched endometrium. A net difference of EGFR was detected in 47% (21/46) of ULM, with a mean score of The net difference of EGFR in ADM and the net difference of EGFR in ULM were statistically significant (P.001). Nineteen of 34 ADM (56%) showed a reduction of PDGF in ADM, with a net difference of About 28% (13/46) of ULM had an increase in PDGF compared to matched myometrium, with a net difference of The difference between ADM and ULM was statistically significant (P.001). Immunoreactivity for IGF-II was scored in 34 ADM cases and matched endometrium. More than two thirds of the cases (25/34) showed a reduction of IGF-II in ADM compared to matched endometrium (Fig. 1A,C), with a net difference of in the epithelium, and a net difference of in the stroma. The overall reduction of IGF-II in ADM was In contrast, among 45 ULM with matched myometrium, 33% (15/45) of ULM had an increase in IGF-II, 11% (5/45) had a reduction of IGF-II, and 55% (25/45) had no change in Fertility and Sterility 221

248 FIGURE 1 Differential expression of IGF-II mrna, its protein, and other selected gene products in ADM and ULM. (A) Photomicrographs show immunoreactivity for IGF2-II (A1,A2) and crna in situ hybridization (A3,A4) in matched endometrium (A1,A3) and adenomyosis (A2,A4). The intensity of IGF-II can be appreciated in terms of the darkness of the brown (protein, above) and purple (mrna, below) colors. (B) Histogram shows mean values of net difference of immunoreactivity for selected gene products (indicated below the wide bars) in ADM (black bars) and ULM (gray bars). Small t-bars indicate standard errors. (C) Dendrogram cluster analysis of selected gene products (above) in ADM and ULM (right). The intensity of red and green colors indicates gain and loss of gene products in ULM and ADM, respectively, compared to matched myometrium and endometrium. Black indicates no change. Levy. Gene expression in leiomyomata and adenomyosis. Fertil Steril IGF-II. The mean net difference of IGF-II in ULM was (Table 1). Almost undetectable IGF-II gene products contributed in large part to the reduction of IGF-II in ADM (Fig. 1A1,A2). The IGF-II mrna was further examined by tissue in situ hybridization with a crna probe from IGF-II exon 6 and exon 7. Expression levels of IGF-II mrna were scaled, based on the density of IGF-II granules in tissue cores, with the aid of density photometry (NIH and Scion Image, nih.gov/nih_images). Among 40 cases with tissue available from ADM and endometrium, the mean score of IGF-II was in endometrium, and in ADM (Fig. 1A3,A4). There was a significant down-regulation of IGF-II mrna in ADM compared to matched endometrium (P.001). The findings of IGF-II mrna levels of expression were consistent with the amount of IGF-II protein in ADM. Among 29 cases, 18 (62%) showed a reduction of IGF1R, nine (31%) had no change, and only two (7%) had 222 Levy et al. Gene expression in leiomyomata and adenomyosis Vol. 88, No. 1, July 2007

249 an increase in ADM. The net difference of IGF1R in ADM was present in both epithelium and stroma, with mean values of 0.44 and 1.06, respectively. In contrast, 21 of 45 ULM cases (46%) had an increase in IGF1R, with a net difference of The differential expression of IGF1R between ADM and ULM was highly significant (P.001). An increase in BCL-2 was present in both the epithelial ( ) and stromal ( ) components of ADM (net difference, ). Among 40 cases of ULM with immunoreactivity for BCL-2, 51% revealed an increase in BCL-2, with a net difference of There is no statistical significance of BCL-2 expression between ULM and ADM (P.05). The genes selected for this study are known to be dysregulated in ULM. The comparison of gene-expression patterns between ULM and ADM suggests that they may comprise a useful tool for establishing an understanding of the molecular differences in these two commonly coexisting diseases. As shown in Figure 1 and Table 1, there is a complete difference in gene-expression profiles between these two diseases. The differential expression of IGF-II in ADM and ULM is of great interest. First, there is growing evidence that IGF-II is one of a few autocrine growth factors that are consistently overexpressed in ULM (9). Second, activation of the IGF-signaling pathway can be an important cellular mechanism in the promotion of ULM growth (8,10). Prior to this study, the expression of IGF-II in human ADM had not been tested. In ADM-induced animal models, IGF-II mrna was found to be markedly down-regulated compared to normal endometrium, as observed by a global gene transcription profiling analysis (2, 6). In the present study, we demonstrated that IGF-II is also markedly downregulated in human ADM compared to normal endometrium, both in mrna and protein levels. Insulin-like growth factor II is an imprinting gene, and only the paternal allele is activated in most tissues, including ULM (11). We still do not know the molecular mechanism of how IGF-II is overexpressed in ULM. In human uteri, IGF-II may serve as an important regulator of muscle growth and differentiation. The opposite pattern of expression of IGF-II, as well as other selected genes in ADM, indicates different molecular and pathogenetic mechanisms of ULM and ADM. Because the gene markers selected for this study are paracrine or autocrine growth factors, as well as some mitogenic receptors, the opposite profile of expression of these genes in ADM may provide an unfavorable microenvironment for ULM growth. BCL-2 and PR are the only two gene products which showed slight up-regulation in ADM. Up-regulation of BCL-2 in adenomyosis was also described previously (12). To minimize the effects of sex-steroid hormones on gene expression, only uteri in the follicular phase were selected for this study. It was previously reported that progesteron is responsible for elevating intrauterine pressure, resulting in the dilatation of vessels and aiding in the invasion of the myometrium by endometrial tissue (4). Our study shows that a slight up-regulation of progesteron in ADM may implicate a positive role of PR in the pathogenesis of ADM. Mary Levy, M.D. Khush Mittal, M.D. Luis Chiriboga, Ph.D. Xinmin Zhang, M.D. Herman Yee, M.D., Ph.D. Jian-Jun Wei, M.D. Department of Pathology, New York University School of Medicine, New York, New York REFERENCES 1. Matalliotakis I, Katsikis IK, Panidis DK. Adenomyosis: what is the impact on fertility? Curr Opin Obstet Gynecol 2005;17: Parrott E, Butterworth M, Green A, White IN, Greaves P. Adenomyosis a result of disordered stromal differentiation. Am J Pathol 2001;159: Kawahara R, Matsuda M, Mori T. Increase in the number of integrinbeta1-immunoreactive monocyte-lineage cells in experimentallyinduced adenomyosis in mice. Life Sci 2003;73: Yamamoto T, Noguchi T, Tamura T, Kitawaki J, Okada H. Evidence for estrogen synthesis in adenomyotic tissues. Am J Obstet Gynecol 1993;169: Deffieux X, Fernandez H. Physiopathologic, diagnostic and therapeutic evolution in the management of adenomyosis: review of the literature [in French]. J Gynecol Obstet Biol Reprod (Paris) 2004;33: Eyster KM, Boles AL, Brannian JD, Hansen KA. DNA microarray analysis of gene expression markers of endometriosis. Fertil Steril 2002;77: Wei JJ, Chiriboga L, Mittal K. Expression profile of the tumorigenic factors associated with tumor size and sex steroid hormone status in uterine leiomyomata. Fertil Steril 2005;84: Wei J, Chiriboga L, Mizuguchi M, Yee H, Mittal K. Expression profile of tuberin and some potential tumorigenic factors in 60 patients with uterine leiomyomata. Mod Pathol 2005;18: Arslan AA, Gold LI, Mittal K, Suen T-C, Belitskaya-Levy I, Tang M-S, et al. Gene expression studies provide clues to the pathogenesis of uterine leiomyoma: new evidence and a systematic review. Hum Reprod 2005;20: Kovacs KA, Lengyel F, Kornyei JL, Vertes Z, Szabo I, Sumegi B, et al. Differential expression of Akt/protein kinase B, Bcl-2 and Bax proteins in human leiomyoma and myometrium. J Steroid Biochem Mol Biol 2003;87: Rainho CA, Pontes A, Rogatto SR. Expression and imprinting of insulin-like growth factor II (IGF2) and H19 genes in uterine leiomyomata. Gynecol Oncol 1999;74: Zhang L, Li J, Li M. Expression of bcl-2 protein in adenomyosis [in Chinese]. Zhonghua Fu Chan Ke Za Zhi 2000;35: Fertility and Sterility 223

250 The value of Chlamydia trachomatis specific IgG antibody testing and hysterosalpingography for predicting tubal pathology and occurrence of pregnancy We assessed two diagnostic methods, Chlamydia trachomatis specific IgG and hysterosalpingography (HSG), as a screening test for the likelihood of tubal damage or occurrence of pregnancy before laparoscopy in 178 subfertile women who were randomly assigned to HSG followed by laparoscopy or immediate laparoscopy. The diagnostic accuracy and prognostic value of both C. trachomatis specific IgG antibody testing and HSG are comparable but show poor performance. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Tubal pathology accounts for approximately 14% of the causes of subfertility (1). Therefore, assessment of the tubal status has become a routine part of the fertility work-up. Several diagnostic tests can be used to assess tubal status, of which Chlamydia antibody testing (CAT) and hysterosalpingography (HSG) comprise the first-line approach. These tests are usually followed by the gold standard laparoscopy and dye (2). The CAT and HSG tests provide risk estimates of tubal pathology before laparoscopy, but the diagnosis of tubal pathology can only be made with laparoscopy and dye. The diagnostic accuracy of CAT and HSG compared with laparoscopy and dye is well established (3 7). Most studies have shown that CAT performs just as well or better than HSG. However, the prognostic value of both tests in predicting occurrence of pregnancy is not well known. Idahl et al. (8) showed that there were no differences in achieving pregnancy between C. trachomatis IgG negative or positive women. Moreover, as shown by several studies, the prognostic value of HSG also is low (9 13). The aim of the present study was twofold. First, we assessed the diagnostic accuracy of C. trachomatis specific IgG (CtsIgG) and HSG compared with laparoscopy and dye in a large group of subfertile women. Second, we used both tests as prognostic indicator to assess occurrence of pregnancy. All women in this study participated in a multicenter, randomized controlled trial with or without the performance of HSG to assess the usefulness of HSG as routine investigation in the fertility work-up before laparoscopy and dye. Recruitment strategy, description of subjects, and the main Received June 23, 2006; revised and accepted November 17, Reprint requests: Denise A. M. Perquin, M.D., Department of Obstetrics and Gynecology, Medical Center Leeuwarden, P.O. Box 888, 8901 BR Leeuwarden, The Netherlands (FAX: ; dperquin@knoware.nl). results of this study have been published elsewhere (14). The present part of the trial took place only at the Division of Reproductive Medicine, Department of Gynecology, Leiden University Medical Center. The institutional review board of the hospital approved all stages of the study. As part of the fertility work-up, blood was drawn at the patient s first visit. All spare serum was cryopreserved. For the present study, the spare serum of the participating women was thawed to perform a species-specific peptidebased serologic assay for the presence of IgG antibodies to C. trachomatis (SeroCT; Savyon Diagnostics, Ashdod, Israel). The results of CtsIgG antibody testing were compared with the findings of HSG in the diagnosis of tubal pathology using laparoscopy and dye as the reference standard. The results of both tests were also compared with occurrence of pregnancy within 18 months after randomization as the clinical end point in terms of cumulative pregnancy rate. The diagnosis of clinical ongoing pregnancy was based on positive urine or serum pregnancy test in association with an intact intrauterine gestation sac on ultrasound scans. The HSG was performed with a water-soluble contrast medium (Omnipaque 300, Nycomed Ltd, Birmingham, UK). An HSG was considered abnormal if there was occlusion of one or both tubes or peritubal adhesions without tubal occlusion. Laparoscopy and tubal testing was performed with methylene blue dye. Laparoscopic findings of tubal factor subfertility were defined as extensive periadnexal adhesions and/or distal occlusion of one or both tubes (15). Endometriosis was not included. The SeroCT IgG assay and calculation were performed according to the manufacturer s instructions. The qualitative outcome of the assay (cut-off index) was categorized as negative ( 1.0) or positive ( 1.10). Values in the equivocal zone (optical densities between the values for negativity and positivity) were considered as negative re- 224 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

251 sults in the calculations when a second sample was also borderline or negative. The diagnostic accuracy of CtsIgG and HSG compared with laparoscopy were assessed by calculating sensitivity, specificity, and likelihood ratios. The prognostic value of CtsIgG and HSG in predicting occurrence of pregnancies was assessed with Kaplan-Meier survival analysis and Cox proportional hazard models. P values of.05 were considered to be statistically significant. A total of 178 subfertile women participated in the present study. Sixty-five women underwent both HSG and laparoscopy, 25 women only HSG, and 88 women only laparoscopy. Therefore, the CtsIgG results could be compared with laparoscopy in 153 women, whereas the HSG results could be compared with laparoscopy in 65 women. Out of all 153 women, 9 (6%) showed unilateral occlusion, 14 (9%) showed bilateral occlusion, and 8 (5%) showed peritubal adhesions without tubal occlusion at laparoscopy. In 35 out of 153 women studied (23%), CtsIgG was positive; 14 of these seropositive women (40%) had tubal pathology according to laparoscopy. Out of the 118 CtsIgG-negative women, 17 had tubal pathology (14%). The sensitivity, specificity, positive likelihood ratio, and negative likelihood ratio for CtsIgG in predicting tubal pathology were 45%, 83%, 2.6, and 0.7, respectively. In 65 out of 153 women, an HSG and laparoscopy were performed. A total of 41 women had a normal HSG, and 24 had an abnormal HSG. Fifteen women (23%) showed unilateral occlusion, eight (12%) showed bilateral occlusion, and one (2%) showed peritubal adhesions without tubal occlusion. In 11 out of 24 women with abnormal HSG (46%), tubal pathology was found at laparoscopy. Out of the 41 women with normal HSG, 5 had tubal pathology at laparoscopy (12%). The sensitivity, specificity, positive likelihood ratio, and negative likelihood ratio for HSG were 69%, 73%, 2.6, and 0.4, respectively. For women who achieved pregnancy during the trial period, whether spontaneous or treatment related, there were no statistically significant differences found in cumulative pregnancy rate between CtsIgG-negative and CtsIgG-positive results (hazard ratio 0.73, 95% confidence interval [CI] ; P.25) (Fig. 1A). Pregnancy rates at given times throughout the study were also not significantly different. There was also no significant difference in cumulative pregnancy rate between normal and abnormal findings at HSG (hazard ratio 1.33, 95% CI ; P.35) (Fig. 1B). The main strength of the present study is the prospective design. All women included had a diagnostic laparoscopy for evaluation of tubal status. An allocation concealment was applied with 0% loss to follow-up. The shortcoming of the study is that the diagnostic or prognostic value of CAT and HSG can be determined separately, but the total sample FIGURE 1 Cumulative pregnancy rates between CtsIgG results and HSG findings. Perquin. C. trachomatis-specific IgG and HSG. Fertil Steril size is too small for the combination of diagnostic and prognostic value. We showed that C. trachomatis IgG antibodies have comparable diagnostic accuracy with HSG in detecting tubal pathology. These findings have been shown by other studies that also compared CAT with HSG and used laparoscopy as reference standard (3 7). Those authors measured C. trachomatis IgG antibodies by microimmunofluorescence (MIF) assay, but we used a species-specific (peptide-based) immunoassay (EIA) as predictor of tubal pathology. These new EIA tests are well standardized, less laborious, less expensive, and easier to perform than the MIF test (16). The disadvantage of using CAT is that there is yet no uniformity in assays and Fertility and Sterility 225

252 cut-off levels. In addition, Chlamydia antibody testing cannot predict tubal factor subfertility due to other causes (previous surgery or endometriosis), and the laboratory procedure has its limitations (e.g., cross-reactivity with other Chlamydia species such as C. pneumoniae). The greatest advantage of Chlamydia antibody testing is its simplicity, limited inconvenience, and no complications. We demonstrated that Chlamydia antibody testing and HSG have comparable limited value in predicting pregnancy rates. No significant differences were found in cumulative pregnancy rate between CtsIgG-negative and CtsIgG-positive results. Idahl et al. (8) also showed that there were no differences between C. trachomatis IgG negative or positive women concerning pregnancy rates. There was also no difference in cumulative pregnancy rates between normal and abnormal findings at HSG. This low prognostic value of HSG was also found in other studies (9 12). Only one recent prospective study showed results on the diagnostic and prognostic role of Chlamydia serology compared with HSG and laparoscopy and supported our findings (13). That study did not record the definition of tubal pathology found at HSG or laparoscopy. In conclusion, we assessed two diagnostic methods, CtsIgG and HSG, as a screening test for the likelihood of tubal damage or occurrence of pregnancy in subfertile women before laparoscopy. The diagnostic accuracy of C. trachomatis specific IgG antibody testing is comparable with HSG, but both show poor performance. The prognostic value of occurrence of pregnancy of both tests is also poor. Chlamydia antibody testing as screening test to estimate the risk of tubal pathology before laparoscopy is preferable to HSG owing to its simplicity and limited inconvenience. Denise A. M. Perquin, M.D. a Matthias F. C. Beersma, M.D., Ph.D. b Anton J. M. de Craen, Ph.D. c Frans M. Helmerhorst, M.D., Ph.D. d a Department of Obstetrics and Gynecology, Medical Center Haaglanden, The Hague; b Department of Virology, Erasmus Medical Center, Rotterdam; and c Department of Gerontology and Geriatrics, and d Division of Reproductive Medicine, Department of Gynecology, Leiden University Medical Center, Leiden, The Netherlands REFERENCES 1. Hull MG, Glazener CM, Kelly NJ, Conway DI, Foster PA, Hinton RA, et al. Population study of causes, treatment, and outcome of infertility. Br Med J (Clin Res Ed) 1985;291: Rowe PJ, Comhaire FH, Hargreave TB and Mellows HJ. WHO manual for the standardized investigation and the diagnosis of the infertile couple. Cambridge: Cambridge University Press, 1993:4. 3. Dabekausen YAJM, Evers JLH, Land JA, Stals FS. Chlamydia trachomatis antibody testing is more accurate than hysterosalpingography in predicting tubal factor infertility. Fertil Steril 1994;61: Meikle SF, Zhang X, Marine WM, Calonge BN, Hamman RF, Betz G. Chlamydia trachomatis antibody titers and hysterosalpingography in predicting tubal disease in infertility patients. Fertil Steril 1994; 62: Mol BWJ, Dijkman B, Wertheim P, Lijmer J, van der Veen F, Bossuyt PMM. The accuracy of serum chlamydial antibodies in the diagnosis of tubal pathology: a meta-analysis. Fertil Steril 1997;67: Thomas K, Couglin L, Mannion PT, Haddad NG. The value of Chlamydia trachomatis antibody testing as part of routine infertility investigation. Hum Reprod 2000;15: Veenemans LM, Linden PJ. The value of Chlamydia trachomatis antibody testing in predicting tubal factor infertility. Hum Reprod 2002;17: Idahl A, Boman J, Kumlin U, Olofsson JI. Demonstration of Chlamydia trachomatis IgG antibodies in the male partner of the infertile couple is correlated with a reduced likelihood of achieving pregnancy. Hum Reprod 2004;19: Maas JWM, Evers JLH, ter Riet G, Kessels AGH. Pregnancy rate following normal versus abnormal hysterosalpingography findings: a meta-analysis. Gynecol Obstet Invest 1997;43: Mol BW, Swart P, Bossuyt PM, van der Veen F. Is hysterosalpingography an important tool in predicting fertility outcome? Fertil Steril 1997;67: Mol BW, Collins JA, Burrows EA, van der Veen F, Bossuyt PM. Comparison of hysterosalpingography and laparoscopy in predicting fertility outcome. Hum Reprod 1999;14: Karande VC, Pratt DE, Rabin DS, Gleicher N. The limited value of hysterosalpingography in assessing tubal status and fertility potential. Fertil Steril 1995;63: Keltz MD, Gera PS, Moustakis M. Chlamydia serology screening in infertility patients. Fertil Steril 2006;85: Perquin DAM, Dörr PJ, de Craen AJM, Helmerhorst FM. The routine use of hysterosalpingography prior to laparoscopy in the fertility work-up: a multicenter randomized controlled trial. Hum Reprod 2006;21: Land JA, Evers JLH, Goossens VJ. How to use Chlamydia antibody testing in subfertility patients. Hum Reprod 1998; Verkooyen RP, Peeters MF, Rijsoort-Vos JH, van de Meijden WI, Mouton JW. Sensitivity and specificity of three new commercially available Chlamydia trachomatis tests. Int J STD AIDS 2002;13: Perquin et al. Correspondence Vol. 88, No. 1, July 2007

253 Prospective, randomized trial of metformin and vitamins for the reduction of plasma homocysteine in insulin-resistant polycystic ovary syndrome One hundred and two women with insulin-resistant polycystic ovary syndrome were randomized to treatment with a vitamin B preparation, metformin, or both, in conjunction with standard infertility treatment. Plasma homocysteine levels were significantly reduced by both B vitamins and metformin, but to a greater degree by B vitamins, and higher pregnancy rates were associated with vitamin B treatment. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) The majority of women with polycystic ovary syndrome (PCOS) are insulin-resistant with compensatory hyperinsulinemia, which is linked to elevated homocysteine levels via suppression of cystathione beta-synthase. Homocysteine (Hcy) metabolism is also affected by the bioavailability of folic acid, methyl group donors, and B vitamins (1 4). Elevated Hcy is linked to pregnancy complications and increased pregnancy loss (5). Treatment of infertility in the patient with PCOS now commonly incorporates insulin-reducing measures such as exercise, weight loss, and drugs such as metformin or rosiglitazone, which have improved treatment results in terms of both higher pregnancy rates (PRs) and lower miscarriage rates. Metformin, while improving insulin resistance, was shown in certain clinical situations to increase serum Hcy levels by reducing levels of folic acid and vitamin B12 (6 8). We prospectively examined the effect of B vitamins and/or metformin on plasma Hcy levels in insulin-resistant patients with PCOS wishing to conceive, and we observed the effects on reproductive outcomes. One hundred and two infertile patients diagnosed with insulin-resistant PCOS and who desired pregnancy were recruited for this study over a period of 14 months. Diagnostic criteria for PCOS included at least two of the three Rotterdam criteria (9). Eighteen patients were scheduled for induction of ovulation, and 84 patients for IVF-intracytoplasmic sperm injection (ICSI) because of additional infertility factors. Insulin resistance was determined by a static fasting glucose and insulin measurement, calculating the homeostasis model assessment (HOMA) index (glucose [mmol/l] insulin [miu/l]/22.5) and the logarithmic transformation of the HOMA index (log 10 HOMA). The upper limit of normal was constructed by calculating the mean Received August 1, 2006; revised October 8, 2006; accepted November 16, Laboratory costs were partly supported by Solgar Israel, Ltd., Netanya, Israel. Reprint requests: Morey Schachter, M.D., In Vitro Fertilization and Infertility Unit, Assaf Harofeh Medical Center, Tel Aviv University, Zerifin, Israel (FAX: ; ivfdoc@asaf.health.gov.il). 2 SDs of a normal control group, for each variable, which reflect accepted reference values (10 12). These 102 patients were randomized before treatment, and after giving informed consent, assigned to one of four groups by opening sealed envelopes containing computergenerated random assignation numbers. Group one (control) underwent infertility treatment only. Group two underwent infertility treatment and metformin 1,700 mg per day (two divided doses of 850-mg tablets; Glucomin, Teva, Israel), started simultaneously with gonadotropin injections. Group three underwent infertility treatment and vitamin B treatment, including 50 mg B6, 400 g folic acid, 500 g B12 (as cobalamin), 1 g trimethylglycine (betaine), and 6 mg pyridoxal-5-phosphate per day (Homocysteine Modulators; Solgar, Leonia, New Jersey) started simultaneously with gonadotropin injections. Group four underwent infertility treatment and both metformin (glucomin 1,700 mg/day, as in group 2) and vitamin B treatment (Homocysteine Modulators, as in group 3). The control and metformin patients (groups 1 and 2) were treated with a standard daily dose of 0.4 mg folic acid (folic acid; CTS, Kiryat Gat, Israel). Induction of ovulation was carried out with the use of standard low-dose protocols, starting with 75 IU/day recombinant FSH (Gonal-F; Serono, Geneva, Switzerland) and 5,000 IU hcg (Pregnyl, Organon, the Netherlands). The IVF-ICSI cycles were performed with midluteal triptorelin, 0.1 mg/day (Decapeptyl; Ferring, Ceasarea, Israel) and 150 IU/day (starting dose) of hmg (Menogon, Ferring, Denmark) with hcg, as previously mentioned. All subsequent IVF and ICSI laboratory procedures and ETs were performed as described by Strassburger et al. (13). Only clinical pregnancies (visualized by ultrasound 3 4 weeks after hcg injection) were counted. Ongoing pregnancies were those that progressed beyond 12 gestational weeks. Glucose, insulin, and Hcy were measured from plasma separated and frozen immediately. Homocysteine was measured as total plasma L-homocysteine, determined using a fluorescence polarization immunoassay by IMX analysis /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 227

254 (Axis-Shield; Abbott Diagnostics, Oslo, Norway). All intra-assay coefficients of variation (CVs) were 2.7% 4.7%, and all interassay CVs were 2.2% 6.2%. Fasting plasma glucose, insulin, and Hcy were measured before treatment, and after three cycles of treatment, or after a positive pregnancy test, whenever this was achieved. Overall analysis of all patients (n 102) showed an average age of years, and an average body mass index of kg/m 2. Average fasting insulin was U/ml (normal, 19 U/ml), and the average log HOMA was (normal, 0.59), with no difference found among treatment groups randomized. Average baseline plasma Hcy was mol/l (95th percentile in our infertile patients with normal ovaries was 11 mol/l). Homocysteine levels were significantly correlated to insulin-resistance indices, including fasting insulin, HOMA, and log HOMA (P.001 for all, F , by analysis of variance [ANOVA]). Homocysteine levels were reduced after treatment in all groups, from 7% 32% (Table 1). Differences between treatment groups were found to be statistically significant (P.001, F 5.3, ANOVA), although no one treatment group was found to be significantly better in terms of Hcy reduction than other treatment groups, versus the control group (Table 1). Vitamin treatment, with or without metformin, resulted in a reduction of Hcy of 24.7% ( 4%) versus a reduction of 10.9% ( 6%) for the nonvitamin treatment groups (control and metformin-only) (P.02, F 9.5, ANOVA). No differences were seen in levels of fasting glucose or insulin after treatment. The overall three-cycle cumulative PR for all groups was 69.6% (71/102). There were no statistically significant differences between treatment groups in PRs or ongoing PRs, although the highest PRs and ongoing PRs were seen in the vitamin-only and vitamin-metformin groups (75% 77% and 61% 67%, respectively). Homocysteine levels are positively correlated to oxidative stress in vascular endothelium, activation of platelets (14), impairment of blood flow (15), and stimulation of vascular smooth muscle proliferation (16). Thus, elevated Hcy may impair implantation by interfering with endometrial blood flow and vascular integrity, and was documented to increase the probability of early pregnancy loss (17). Both impaired implantation and increased rates of miscarriage are more frequent in PCOS, even after controlling for ovulatory abnormalities, increased LH, and hyperandrogenism, which might be due in part to elevated Hcy in these patients. Our previous study (18) and that of others (19) found an association between insulin resistance and elevated Hcy in women with PCOS. Several studies examined the effect of both insulin-reducing medications such as metformin or rosiglitazone, and vitamin preparations, on Hcy levels in insulin-resistant patients or patients with or PCOS. Kilicdag et al. (6), Vrbikova et al. (8), and Wulffele et al. (20) reported that treatment of patients with PCOS or Diabetes Mellitus II (DM II) with metformin increased the average level of Hcy by mol/l. These results contrast with those found in this study, which found decreases in Hcy levels of 12% (approximately 2 mol/l) after treatment with metformin for periods of 6 16 weeks. The only difference in these studies was the intake by our control and metformin groups of 0.4 mg/day of folic acid, which could account for some of the difference (6% 12%). Kilicdag et al. (7) conducted another study in 60 patients with PCOS, administering metformin alone, metformin and B-group vitamins, or metformin and folic acid. Their results were a decrease in Hcy in the folic acid and vitamin B supplementation groups of 8.3% and 21%, respectively. Our findings are in agreement with theirs, suggesting that supplementation of B-group vitamins, folic acid, and methyl donors such as trimethylglycine (betaine) could have positive effects on patients with PCOS treated with metformin. The reduction in Hcy levels of 6% in the control group could be the result of the TABLE 1 Changes in homocysteine levels before and after treatment, and cumulative PRs by groups. Group Hcy 1 ( mol/l) Hcy 2 ( mol/l) Hcy Cum PR Ongoing PR All (n 102) % (71/102) 63.3% (45/71) Control (n 23) % (14/23) 50.0% (7/14) Metformin (n 28) % (18/28) 61.0% (11/18) Vitamins (n 24) % (18/24) 61.0% (13/18) Metformin and vitamins (n 27) % (21/27) 67.0% (14/21) Note: Hcy 1 homocysteine levels before treatment. Hcy 2 homocysteine levels after treatment. Hcy reduction in homocysteine levels between first and second measurement. Cum PR cumulative three-cycle PR. Ongoing PR clinical pregnancies progressing beyond 12 gestational weeks. Schachter. Homocysteine reduction modalities in PCOS. Fertil Steril Schachter et al. Correspondence Vol. 88, No. 1, July 2007

255 addition of 0.4 mg folic acid, or the effect of increased E 2 during the treatment cycle, as previously reported by Lox and Prien (21). Part of the reduction in all treatment groups might be attributed to this effect of the increase in E 2. Metformin intake may reduce vitamin B12 levels, which could increase Hcy in treated individuals. On the other hand, reduction in insulin levels by metformin could allow for increased trans-sulfuration of Hcy, and thus reduce Hcy levels. The addition of B vitamins was formulated to tip the balance in favor of a net reductive effect on Hcy. Our results suggest that the combination of B vitamins and metformin would lead to the best results in terms of ongoing pregnancies, because of the reduction of Hcy by all of these supplements, together with the additional teratogenic protection conferred by folate and B12, and the reduction in miscarriage rate for patients with PCOS afforded by metformin (22) and B vitamins (17). Although methyltetrahydrofolate reductase enzyme deficiencies and baseline vitamin deficiencies were not screened for in this patient group before the study was initiated, previous studies (23, 24) did not find significant frequencies of these disorders in patients with PCOS, and thus selection bias is unlikely. We conclude that infertile women with insulin-resistant PCOS have elevated levels of Hcy, and this could be responsible in part for the decreased implantation rates and increased miscarriage rates of patients with PCOS, even with effective induction of ovulation or IVF. The supplementation of B-group vitamins and/or metformin is effective in reducing Hcy; the combination of both could allow for each factor s benefits to be borne out, improving reproductive results. Acknowledgments: The authors are grateful to Solgar (New Jersey) for the donation of Homocysteine Modulators Vegicaps, and to Alex Maor, Ph.D. (Solgar Israel, Ltd.), for his assistance and follow-up of the research work. Morey Schachter, M.D. a Arieh Raziel, M.D. a Devorah Strassburger, Ph.D. a Carmela Rotem, M.Sc. b,c Raphael Ron-El, M.D. a Shevach Friedler, M.D. a a In Vitro Fertilization and Infertility Unit, Assaf Harofeh Medical Center, Tel Aviv University, Zerifin; b Felsenstein Medical Research Center, Rabin Medical Center, Petah Tikva; and c Research and Development, Solgar Israel, Ltd., Netanya, Israel REFERENCES 1. McCarty MF. Insulin secretion as a potential determinant of homocysteine levels. Med Hypotheses 2000;55: House JD, Jacobs RL, Stead LM, Brosnan ME, Brosnan JT. Regulation of homocysteine metabolism. Adv Enzyme Regul 1999;39: Meigs JB, Jacques PF, Selhub J, Singer DE, Nathan DM, Rifai N, et al. Fasting plasma homocysteine levels in the insulin resistance syndrome. Diabetes Care 2001;24: Setola E, Monti LD, Galluccio E, Palloshi A, Fragasso G, Paroni R, et al. Insulin resistance and endothelial function are improved after folate and vitamin B12 therapy in patients with metabolic syndrome: relationship between homocysteine levels and hyperinsulinemia. Eur J Endocrinol 2004;151: Craig LB, Ke RW, Kutteh WH. Increased prevalence of insulin resistance in women with a history of recurrent pregnancy loss. Fertil Steril 2002;78: Kilicdag EB, Bagis T, Zeyneloglu HB, Tarim E, Aslan E, Haydardedeoglu B, et al. Homocysteine levels in women with polycystic ovary syndrome treated with metfrormin versus rosiglitazone: a randomized study. Hum Reprod 2005;20: Kilicdag EB, Bagis T, Tarim E, Aslan E, Erkanli S, Simsek E, et al. Administration of B-group vitamins reduces circulating homocysteine in polycystic ovarian syndrome patients treated with metformin: a randomized trial. Hum Reprod 2005;20: Vrbikova J, Bicikova M, Tallova J, Hill M, Starka L. Homocysteine and steroids levels in metformin treated women with polycystic ovary syndrome. Exp Clin Endocrinol Diabetes 2002;110: Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Workshop Group. Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome. Fertil Steril 2004; 81: Brun JF, Raynaud E, Mercier J. Homeostasis model assessment and related simplified evaluations of insulin sensitivity from fasting insulin and glucose. Diabetes Care 2000;23: Mather KJ, Hunt AE, Steinberg HO, Paeadisi G, Hok G, Katz A, et al. Repeatability characteristics of simple indices of insulin resistance: implications for research applications. J Clin Endocrinol Metab 2001;86: Bonora E, Targher G, Alberiche M, Bonadonna RC, Saggiani F, Zenere M, et al. Homeostasis model assessment closely mirrors the glucose clamp technique in the assessment of insulin sensitivity. Diabetes Care 2000;23: Strassburger D, Friedler S, Raziel A, Schachter M, Kasterstein E, Ron-El R. Very low sperm count affects the result of intracytoplasmic sperm injection. J Assist Reprod Genet 2000;17: Coppola A, Davi G, De-Stefano V, Mancini FP, Cerbone AM, Di- Minno G. Homocysteine, coagulation, platelet function and thrombosis. Semin Thromb Hemost 2000;26: Chambers JC, Ueland PM, Wright M, Dore CJ, Refsum H, Kooner JS. Investigation of relationship between reduced, oxidized, and protein-bound homocysteine and vascular endothelial function in healthy human subjects. Circ Res 2001;89: Van Guldener C, Stehouwer CD. Hyperhomocysteinemia, vascular pathology and endothelial dysfunction. Semin Thromb Hemost 2000; 26: Quere I, Mercier E, Bellet H, Janbon C, Mares P, Gris JC. Vitamin supplementation and pregnancy outcome in women with recurrent early pregnancy loss and hyperhomocysteinemia. Fertil Steril 2001; 75: Schachter M, Raziel A, Friedler S, Strassburger D, Bern O, Ron-El R. Insulin resistance in patients with polycystic ovary syndrome is associated with elevated homocysteine. Hum Reprod 2003;18: Rouzi AA, Ardawi MS. Plasma homocysteine and insulin resistance in women with polycystic ovary syndrome. Fertil Steril 2005;84(Suppl):S Wulffele MG, Kooy A, Lehert P, Bets D, Ogterop JC, Borger van der Burg B, et al. Effects of short-term treatment with metformin on serum concentrations of homocysteine, folate and vitamin B12 in type 2 diabetes mellitus: a randomized placebo controlled trial. J Intern Med 2003;254: Fertility and Sterility 229

256 21. Lox CD, Prien SD. The homocysteine pathway during the first two weeks of pregnancy following IVF-ET. Fertil Steril 2000;74(Suppl):S Jakubowicz DJ, Iuorno MJ, Jakubowicz S, Roberts KA, Nestler JE. Effects of metformin on early pregnancy loss in the polycystic ovary syndrome. J Clin Endocrinol Metab 2002;87: Yarali H, Yildirir A, Aybar F, Kabakci G, Bukulmez O, Akgul E, Ota A. Diastolic dysfunction and increased serum homocysteine concentrations may contribute to increased cardiovascular risk in patients with polycystic ovary syndrome. Fertil Steril 2001;76: Yilmaz M, Bukan N, Ayvaz G, Karakoc A, Toruner F, Cakir N, et al. The effects of rosiglitazone and metformin on oxidative stress and homocysteine levels in lean patients with polycystic ovary syndrome. Hum Reprod 2005;20: Schachter et al. Correspondence Vol. 88, No. 1, July 2007

257 Open-identity donor insemination in the United States: is it on the rise? Information about US donor insemination programs was reviewed to determine whether an increasing number are offering open-identity donation. Results indicate that indeed, numbers are rising and that the ratio of openidentity to anonymous sperm donors in a program increases the longer that the program has offered an openidentity option. (Fertil Steril Ò 2007;88: Ó2007 by American Society for Reproductive Medicine.) An Internet search today suggests that a considerable number of donor insemination (DI) programs now offer open-identity sperm donation. In contrast to traditional anonymous donors, open-identity donors agree to release their identifying information to adult offspring. Internationally, a number of countries recently have legislated that DI programs abolish anonymous donation and instead have open-identity sperm donors only (e.g., the United Kingdom and Norway in 2005 and the Netherlands in 2004; this legislation also applies to other forms of gamete donation). The United States has no legislation concerning gamete donation, but several DI programs now have both anonymous and open-identity donors for recipients to choose from or are entirely open-identity donation. To address whether open-identity donation is on the rise in the United States, we reviewed information about US DI programs to determine the number offering open-identity donation. Among programs in existence for R10 years, we then statistically tested whether the number of open-identity DI programs had increased during this time period. In this study sample, we included US DI programs that recruit their own sperm donors (this included commercial and nonprofit sperm banks, DI programs within fertility centers, and stand-alone DI programs). These programs could also use donors from other programs, but our criterion was that at least some of their donors were recruited on site. In the United States, no licensing body requires that DI providers be registered in a central database. Thus, we used multiple sources to identify programs for study inclusion. Our four main sources included the American Association of Tissue Banks list of accredited DI programs, fertilehope s list of DI programs (fertilehope is a nonprofit organization that helps cancer patients preserve their fertility), and two Websites, spermcenter.com (a commercial Website developed by a DI recipient to allow recipients to compare sperm bank services) and fertilityplus.org (a nonprofit Website developed by patients for patients trying to conceive). By including both commercial and Received June 30, 2006; revised and accepted November 17, Reprint requests: Joanna E. Scheib, Ph.D., Department of Psychology, University of California, Davis, California (FAX: ; jescheib@ucdavis.edu). recipient-driven sources as well as an accreditation organization, we aimed to compile as comprehensive a list of DI programs as possible. We also reviewed lists of DI programs in books oriented toward single women (1) and lesbians (2), but these were redundant with our other sources. The final sample included 31 DI programs. There are many more programs in the United States that were not included because they did not recruit their own donors but instead bought sperm from one or more of the programs in our sample. Several of the programs included in the sample had more than one site. If they had only one catalog for all sites, they were counted as one program, whereas programs with multiple sites and multiple catalogs were counted as more than one program. We obtained the following information for each program: number of donors in the program s catalog; how long the program has existed; and when applicable, the proportion of the donors who were open-identity, the definition of open-identity, and how long the program has offered open-identity donation. This information was obtained from each program s Website; from direct contact with the program by phone; and/or at the American Society for Reproductive Medicine s 2005 annual meeting, from a program s representative. No programs declined to participate in the study. Because this study used information about the programs that was publicly available, institutional review board approval was not required. To test whether an increasing number of programs are offering open-identity donors, we identified programs that had existed for R10 years. Only 3 of the 31 programs did not qualify, leaving a sample size of 28. For a program to have open-identity donors, the donors had to be willing to be identified to offspring at or before the offspring reached age 18 years and/or to have at least one meeting with the offspring. Thus offspring were guaranteed to be able to get additional information about their donors at some point, should they want it. The donors had to agree to this at the time of donation. A few programs had donors who were willing to be asked in the future whether they wanted to reveal their identity, if an adult offspring should request it. However this did not qualify as open-identity donation, because these donors retained the right to refuse identity release /07/$32.00 Fertility and Sterility â Vol. 88, No. 1, July doi: /j.fertnstert Copyright ª2007 American Society for Reproductive Medicine, Published by Elsevier Inc.

258 We compared the number of DI programs with openidentity sperm donors in 1996 to the number in In 1996, 3 (10.7%) of the 28 programs had open-identity donors. In 2006, about three times as many (nine; 32.1%) had open-identity sperm donors. These numbers were significantly different [c 2 (1) ¼ 13.44, P<.001], suggesting that the number of open-identity DI programs is increasing. As countries move toward legislating open-identity only programs, there is usually concern that the numbers of donors will drop and that the availability of DI thus will be threatened (e.g., Daniels et al. [3] and Paul et al. [4]). It is possible, however, that whereas numbers will drop (e.g., Daniels and Lalos [5]), they will increase again as donor recruitment strategies change at the programs (see also Novaes [6]). For example, as programs move from strategies focused on monetary compensation to a focus on the altruistic and helping component of DI, a different set of men will be recruited, from different sources than before (e.g., community volunteer organizations as opposed to college campuses). This change takes time. Thus, we tested whether there was a relationship between the number of years that a program has offered open-identity donation and the proportion of open-identity donors in their catalog. For this analysis, we dropped one program that had started recruiting open-identity donors but did not yet have them in its catalog. Among the eight programs with open-identity donors, age of the program and proportion of open-identity donor in the catalog were strongly related [r(6) ¼.731, P<.05; Fig. 1]. One program was open-identity only (i.e., it had no anonymous donors). If this program was excluded from the analysis, the relationship was even stronger [r(5) ¼.936, P<.01]. These results suggest that in the United States, the number of open-identity DI programs is increasing. In addition, it appears that the ratio of open-identity to anonymous donors at a program increases the longer that a program has offered open-identity donation. This finding may be encouraging to countries that recently have legislated open-identity only gamete-donation programs and are experiencing a shortage of donors. One limitation of this study was that we could not identify a sample of programs that existed in 1996 and that no longer exist. It is possible that open-identity programs existed but failed to thrive. However, we know of no such programs. In the United States, the increase in open-identity programs suggests that the industry is in a time of change, with more and more DI programs recognizing that the option to access a donor s identity is important. It has yet to be empirically tested whether this reflects a change among prospective DI parents attitude toward sharing donor information with their child and wanting options for them. It is FIGURE 1 Relationship between the number of years that a DI program has had open-identity donors and the proportion of open-identity donors in its catalog. Proportion open-identity donors in DI program catalog Number of years open-identity donation available at DI program Scheib. Open-identity sperm donation in the United States. Fertil Steril also unclear whether this is true among heterosexual couples who can be deterred from disclosure by feelings of stigma around male infertility. However, single women and lesbians almost always are open about their use of DI and consequently may want the option of open-identity donation for their children. As their numbers increase among DI users, the demand for open-identity programs also will increase. This is likely to be the primary driving force behind the current increase in open-identity programs that we are experiencing in the United States. Joanna E. Scheib, Ph.D. a,b Rachel A. Cushing, B.A. a a Department of Psychology, University of California, Davis; and b The Sperm Bank of California, Berkeley, California REFERENCES 1. Mattes J. Single mothers by choice. New York: Random House, Toevs K, Brill S. The essential guide to lesbian conception, pregnancy, and birth. Los Angeles, CA: Alyson Books, Daniels K, Blyth E, Crawshaw M, Curson R. Short communication: previous semen donors and their views regarding the sharing of information with offspring. Hum Reprod 2005;20: Paul S, Harbottle S, Stewart JA. Recruitment of sperm donors: the Newcastle-upon-Tyne experience Hum Reprod 2006;21: Daniels K, Lalos O. The Swedish insemination act and the availability of donors. Hum Reprod 1995;10: Novaes SB. Giving, receiving, repaying: gamete donors and donor policies in reproductive medicine. Int J Technol Assess Health Care 1989;5: Scheib and Cushing Correspondence Vol. 88, No. 1, July 2007

259 A Prostaglandin D2 system in the human testis As shown recently, cyclooxygenase 2 (COX2), the inducible key enzyme for the prostaglandin (PG) biosynthetic pathway, is abundantly present in interstitial cells of testes of men suffering from different forms of impaired spermatogenesis and sub- or infertility, but it is absent in human testes with normal spermatogenesis. Although the spectrum of the downstream products of COX2 action in testis, namely PGs, and their effects are not known, our results show that Prostaglandin D2 (PGD2) likely plays a role. We describe (a) PGD2 synthetases, as well as receptors for PGD2 (DP) in testicular interstitial cells of men suffering from spermatogenic damage and infertility, and report that (b) PGD2 is produced by and can affect Leydig cells of an animal model, which expresses testicular COX2 and DP. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Received July 13, 2006; revised and accepted November 16, Supported by the German Research Foundation (DFG) Ma 1080/16-1, and in part by a DAAD-ANTORCHAS exchange program. The first and second authors have contributed equally to this work. Reprint requests: Artur Mayerhofer, Anatomisches Institut am Biederstein, Ludwig-Maximilians-Universität, Biedersteiner Strasse 29, Munich, Germany (FAX: ; Mayerhofer@ lrz.uni-muenchen.de). As shown recently, cyclooxygenase 2 (COX2), the inducible key enzyme for the prostaglandin (PG) biosynthetic pathway, is abundantly present in interstitial cells of testes of men suffering from different forms of impaired spermatogenesis and sub- or infertility, while it is absent in human testes with normal spermatogenesis (1). Although the spectrum of the downstream products of COX2 action in these cases are not known, many different PGs are likely to be produced as a consequence. Provided that further PG synthesizing or modifying enzymes, as well as receptors for PG are present, these PG systems may thus be of unexplored relevance to the cellular events occurring in testes of infertile men with damaged spermatogenesis. Testicular PGs and their actions in the testis are, however, not well examined. In part, this may be explained by the obvious lack of COX expression in testes of most animal species, which normally neither express COX1 nor COX2 (1, 2). Thus, data about receptors for PGs, namely PGE2 and PGF2 in rat Leydig cells (3), or expression of a so-called lipocalin-type PGD2 synthase by adult-type Leydig cells in rodents (4, 5) have not been viewed in context of functional testicular PG systems. Expression of lipocalin-type PGD2 synthase, for example, changes during development, and has been regarded a developmental marker. Yet some older reports in rodents and newer studies in MA10 cells imply a role of COX2 and/or PGs in Leydig cell steroidogenesis (6, 7). More recently, it has been observed that COX2 is expressed in aging rat testis (8, 9) and in human testicular tumors (10). Adult golden hamster Leydig cells also express active COX2 linked to production of PGs (2), including PGF2. This PG inhibits gonadotropin-stimulated testosterone production by altering steroidogenic enzymes, presumably via its FP receptors. This implies a regulatory inhibitory local PGF2 system in testis. Because FP, the receptor activated by PGF2, is also found in human Leydig cells (2), such a system may be functional in testes of men with impaired spermatogenesis and COX2 expression. Interestingly, in the study mentioned (2), PGD2 was the only other PG tested, besides PGF2, which affected the function of Leydig cells. Hamster Leydig cells express DP, the receptor for PGD2 (unpublished observation) and PGD2 stimulated basal testosterone production, but did not alter gonadotropin-stimulated steroid output. In testes of men with impaired spermatogenesis, PGD2 is likely to be produced by two cell types: mast cells and Leydig cells. Significantly more and activated mast cells are found in testes of infertile men (11). They are thought to express the so-called hematopoetic type of PGD2 synthetase, as do mast cells in other organs of the human body (12), while Leydig cells have been shown to express the so-called lipocalin type PGD2 synthetase (4, 5). We hypothesized that this situation may be of special importance in the interstitial testicular compartment of men with impaired spermatogenesis, where COX2 is abundantly expressed (1), and could provide precursor PGs for PGD2 synthetases (1). We reasoned that identification and localization of the receptor for PGD2, namely the G-protein coupled receptor DP, may hint to a role of PGD2 in the testis. The present study therefore attempted to elucidate in human testes expression of lipocalin type and hematopoietic type PGD2 synthetases. We then evaluated expression and localization of DP, the receptor for PGD2. In parallel, we used hamster Leydig cells, which, with regard to COX2 expression, resemble human Leydig cells in states of impaired testicular function and spermatogenesis, to explore whether this PG is formed and is active as a regulatory factor in testis /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 233

260 All methods used have been described previously (1, 2, 11, 13, 14). Human testicular samples (biopsies) were evaluated in this retrospective study. They had been obtained from patients with normal spermatogenesis (including samples from patients with obstructive azoospermia because of prior ligation of the vas deferens or unknown reasons [n 6]) and impaired spermatogenesis (n 8; two Sertoli-cell-only, two germ cell arrest, four mixed atrophy syndrome), and are identical to sample pools described previously (14). Data about the general health status of individual patients were not recorded. All participants had granted written Informed Consent to the use of samples and the study had been approved by the local Ethical Committee. Hamster Leydig cells were isolated as described (2) and enzyme immuno assay for PGD2 (Cayman Chemical, Ann Arbor, MI) were performed following the instructions of the manufacturer. PGD2 (Sigma-Aldrich, Munich, Germany, 2 mm stock solution in 70% ethanol) was used to treat hamster Leydig cells for 3 hours, and testosterone accumulation in the media was measured by RIA, as described (2). A total of four different batches of Leydig cells preparations were studied, consisting of five to six replicates per group. Statistical analysis was done by analysis of variance followed by the Student-Newman-Keuls test. For immunohistochemistry, the ABC method and a commercial anti DP antibody (Sigma-Aldrich; 1:800) were used. For PCR studies, we used commercial cdna (pooled testicular samples; Invitrogen GmbH, Karlsruhe, Germany), cdna obtained from laser microdissected human testicular biopsies (interstitial and tubular areas [13]), as well as deparaffinized testicular sections scratched from glass slides: normal (n 2) and pathologic samples (n 4). These biopsies were also used for immunohistochemistry. Oligonucleotide primers for PCR for lipocalin type PGD2 synthetase (accession number Genbank NM_000954) were 5 -GGT GGA GAC CGA CTA CGA C-3 (sense) and 5 -TGT TCC GTC ATG CAC TTA TCG-3 (antisense), for the hematopoietic type PGD2 synthetase (NM_014485) a sense primer, 5 -TGA CTG GCC TGA AAT CAA ATC AA-3 and antisense primer pair 5 -AGT GTC CAC AAT AGC ATC AAC AT-3 were used. Primers for the DP (NM_ ) were 5 -TGC AAC CTC GGC GCC ATG-3 (sense) and 5 -TCC TGT ACC TAA GAG GTC-3 (antisense). Laser microdissection and treatment of dissected material were peformed as described (1, 14). For laser microdissected material the first set of DP primers was as follows: 5 -TGC AAC CTC GGC GCC ATG-3 (sense) and 5 -TCC TGT ACC TAA GAG GTC-3 (antisense) and nested primers were 5 -CAA CCT CTA TGC GAT GCA-3 (sense) and 5 -CAA GGC TCG GAG GTC TTC-3 (antisense). All PCR products were sequenced to verify their identities (1, 11). PROSTAGLANDIN D2 SYNTHETASES AND DP IN HUMAN TESTES Results of reverse transcriptase-polymerase chain reaction (RT-PCR) studies showed expression of PGD2 synthetases, namely lipocalin type and hemaotopoietic type, in the human testis (Fig. 1A). The latter can be assumed to be present in mast cells (our unpublished immunohistochemical studies), while the lipocalin form, according to published data, is likely to be present in Leydig cells (4, 12). RT-PCR also showed that the DP receptor gene is expressed in human testes (Fig. 1A and B). Laser microdissection followed by RT-PCR indicated its expression in interstitial, but not in the tubular compartment (Fig. 1B). This was corroborated by immunolocalization studies, which showed DP in interstitial cell clusters (Fig. 1C). Together with the documented presence of COX2 in interstitial cells (1), which likely provides precursor PGs for PGD synthesis, these results imply that PGD2 is a product of interstitial cells, both mast cells and Leydig cells of human testes. PGD2 via DP may therefore regulate Leydig cell function in a paracrine/autocrine manner. To explore these possibilities further, additional studies were performed using hamster Leydig cells. PGD2 IS PRODUCED BY AND ACTS ON LEYDIG CELLS Freshly isolated hamster Leydig cells constitutively express both COX2 (2), and as we found, secrete PGD2 (150 fmol/10 6 Leydig per 3 hours). In accordance with previous results (2), treatment of hamster Leydig cells with PGD2 (10 M for 3 hours) resulted in a significant stimulatory effect on basal testosterone production in four experiments (P.05 Student-Neuman-Keuls test; data not shown). To our knowledge, this is the first report describing a PGD2-DP system in human testis. This system appears to be of special relevance to testes of infertile men with deranged spermatogenesis, in which COX2 is also expressed. Thus, COX2 action may initiate a chain of events, which include formation of PGD and its action on Leydig cells. Although reasons for spermatogenic defects in the patients examined in this study are likely heterogeneous and karyotypes and endocrine profiles were not recorded, COX2 and PG synthesis appear to be common in testes of patients with different types and degrees of derangements of spermatogenesis (1), implying a general mechanism. Our results indicate two potential sources for PGD2 in human testes: Leydig cells, as evidenced by expression of lipocalin type PGD2 synthetase, and mast cells, which express hematopoietic type of PGD2 synthetase. As COX2, the key enzyme of PG synthesis, and PGD2 synthetases are concomitantly expressed in interstitial cells of men with impaired spermatogenesis, one must assume that formation 234 Schell et al. Correspondence Vol. 88, No. 1, July 2007

261 FIGURE 1 (A) Results from RT-PCR experiments: both hematopoietic-type (H-PGDS) and lipocalin-type (L-PGDS) PGD2 synthetases are found in human testes, which also contain the corresponding DP receptor. Controls ( ) without testicular input cdna are also shown. PCR products were verified by sequencing. (B) Detection of DP by laser microdissection and RT-PCR: tubular (T) and interstitial (I) tissue of a Sertoli-cell-only patient biopsy before (top) and after (bottom) laser microdissection are shown. Samples obtained were subjected to RNA extraction, RT, and nested PCR. DP was found to be present only in interstitial areas. Detection of tubulin in both samples indicates presence of equal amounts of input cdna. (C) Detection of DP by immunohistochemistry: one representative experiment using a biopsy from a Sertoli-cell-only patient is shown (top and bottom left) and indicates that DP protein is expressed by and restricted to interstitial cells. In the control (co) shown, the primary antibody was replaced by normal serum. DP was also found in interstitial cells of a sample of a testis with normal spermatogenesis (bottom right). Bars: approximately 60 m. of PGD2 in these cases occurs in the interstitial compartment. Production of PGD2 was indeed proven in freshly isolated hamster Leydig cells (2), which also respond to PGD2 by increased testosterone production. In conclusion, the topic of COX2, PGs, and testis is emerging as a field of research, which may be highly relevant to human testicular functions, specifically to men with impaired spermatogenesis and infertility. The currently available data imply that COX2 is present in human testes of men with deranged spermatogenesis, and that at least three PG receptors are expressed in human testes as well, namely FP, PPAR, and DP (1, 2, and present study). Many commonly used drugs interfere with PG formation. Therefore, deeper insights into these testicular systems are urgently required, and may lead to novel therapeutic approaches in male infertility. Christoph Schell a Monica B. Frungieri, Ph.D. a,b Martin Albrecht, Ph.D. a Silvia I. Gonzalez-Calvar, Ph.D. b Frank M. Köhn, M.D. c Ricardo S. Calandra, M.D. b,d Artur Mayerhofer, M.D. a a Anatomisches Institut am Biederstein, Ludwig- Maximilians-Universität, Munich, Germany; b Instituto de Biología y Medicina Experimental, CONICET, Buenos Aires, Argentina; c Andrologicum Munich, Munich, Germany; and d Instituto Multidiscilpinario de Microscopia y Biología Celular, CONICET-CICPBA, La Plata, Argentina Schell. Prostaglandin D system in testis. Fertil Steril REFERENCES 1. Frungieri MB, Weidinger S, Meineke V, Kohn FM, Mayerhofer A. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARgamma: possible relevance to human fibrotic disorders. Proc Natl Acad Sci USA 2002;99: Frungieri MB, Gonzalez-Calvar SI, Parborell F, Albrecht M, Mayerhofer A, Calandra RS. Cyclooxygenase-2 (COX-2) and prostaglandin F2 (PGF2 ) in Syrian Hamster Leydig cells: inhibitory role on LH/hCGstimulated testosterone production. Endocrinology 2006;147: Walch L, Clavarino E, Morris PL. Prostaglandin (PG) FP and EP1 receptors mediate PGF2alpha and PGE2 regulation of interleukin- 1beta expression in Leydig cell progenitors. Endocrinology 2003;144: Baker PJ, O Shaughnessy PJ. Expression of prostaglandin D synthetase during development in the mouse testis. Reproduction 2001; 122: Ahtiainen P, Rulli SB, Shariatmadari R, Pelliniemi LJ, Toppari J, Poutanen M, et al. Fetal but not adult Leydig cells are suspectible to adenoma formation in response to persistently high hcg levels: a study on hcg overexpressing transgenic mice. Oncogene 2005;24: Bartke A, Kupfer D, Dalterio S. Prostaglandins inhibit testosterone secretion by mouse testes in vitro. Steroids 1976;28: Wang X, Dyson MT, Jo Y, Stocco DM. Inhibition of cyclooxygenase-2 activity enhances steroidogenesis and steroidogenic acute regulatory gene expression in MA-10 mouse Leydig cells. Endocrinology 2003; 144: Fertility and Sterility 235

262 8. Wang X, Stocco DM. The decline in testosterone biosynthesis during male aging: a consequence of multiple alterations. Mol Cell Endocrinol 2005;238: Wang X, Shen CL, Dyson MT, Eimerl S, Orly J, Hutson JC, Stocco DM. Cyclooxygenase-2 regulation of the age-related decline in testosterone biosynthesis. Endocrinology 2005;146: Hase T, Yoshimura R, Matsuyama M, Kawahito Y, Wada S, Tsuchida K, et al. Cyclooxygenase-1 and -2 in human testicular tumours. Eur J Cancer 2003;39: Meineke V, Frungieri MB, Jessberger B, Vogt H, Mayerhofer A. Human testicular mast cells contain tryptase: increased mast cell number and altered distribution in the testes of infertile men. Fertil Steril 2000;74: Metcalfe DD, Baram D, Mekori YA. Mast cells. Physiol Rev 1997; 77: Frungieri MB, Calandra RS, Lustig L, Meineke V, Kohn FM, Vogt HJ, et al. Number, distribution pattern, and identification of macrophages in the testes of infertile men. Fertil Steril 2002;78: Albrecht M, Frungieri MB, Gonzalez-Calvar S, Meineke V, Kohn FM, Mayerhofer A. Evidence for a histaminergic system in the human testis. Fertil Steril 2005;83: Schell et al. Correspondence Vol. 88, No. 1, July 2007

263 Comparison of human chorionic gonadotropin and gonadotropin-releasing hormone agonist for final oocyte maturation in oocyte donor cycles In this retrospective study of 74 oocyte-donor IVF cycles, the rates of fertilization, implantation, clinical pregnancy, ongoing pregnancy, and early pregnancy loss were similar after an agonist or hcg trigger. These findings suggest that the agonist trigger is a viable alternative for oocyte donors with significant risk factors for ovarian hyperstimulation syndrome. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Received July 20, 2006; revised October 30, 2006; accepted November 16, Reprint requests: Bruce Shapiro, M.D., Fertility Center of Las Vegas, 8851 West Sahara Avenue, #100, Las Vegas, Nevada (FAX: ; bsshapiro@aol.com). Oocyte donors are preferentially selected for their high oocyte yields, and therefore tend to have many risk factors for ovarian hyperstimulation syndrome (OHSS). These include young age, high concentration of serum E 2, and a large number of follicles (1, 2). Ovarian hyperstimulation syndrome is associated with the use of hcg for final oocyte maturation, and the incidence of OHSS increases with the level of ovulatory hcg serum (1, 2). Alternately, an agonist of GnRH may be used to trigger an LH surge for final oocyte maturation in cycles regulated by a GnRH antagonist. This alternative may prevent severe OHSS, possibly through complete and irreversible luteolysis (3, 4). A recent study found a reduced incidence of moderate-to-severe OHSS when a GnRH agonist was used instead of hcg in patients with polycystic ovary syndrome who were undergoing autologous IVF cycles (0 versus 31%) (5). The incidence of severe OHSS in oocyte donors is lower than in autologous cycles, probably because of the absence of pregnancy in donors (6). Nevertheless, severe OHSS can occur in oocyte donors (7). Dramatically increased rates of early pregnancy loss were reported when a GnRH agonist was used instead of hcg (8, 9), resulting in reduced rates of ongoing pregnancy. These studies did not address donor cycles. A recent summary of existing studies found that the efficacy of agonist triggers in oocyte donors had not yet been investigated (10). The current study compares outcomes following hcg or agonist trigger in oocyte donor cycles. The current study included 50 oocyte donors 38 years of age, and 69 recipients undergoing 74 fresh cycles. Oocyte donors underwent ovarian stimulation with FSH in combination with hmg. A GnRH antagonist, either ganirelix acetate or cetrorelix, was used for pituitary suppression during the donor s ovarian stimulation. Final oocyte maturation was achieved with either IM hcg or 4 mg of SC leuprolide acetate. Doses of hcg varied from 2,500 20,000 IU, depending on the patient s weight and risk factors for OHSS. From March October 2004, there was a gradual protocol transition to the use of GnRH agonist triggers in oocyte donors with high risk factors for OHSS, particularly those with follicles on the day of trigger, while donors with less risk were given hcg. One agonist down-regulated cycle, three cycles that were stimulated with FSH only, and any cycles that were canceled before administration of the trigger were excluded from this study. Otherwise, the study included all donor cycles with ovulatory triggers administered between January 1, 2004 May 5, Oocytes from each retrieval were used by only one recipient. Embryos were cultured to the blastocyst stage before transfer. Luteal support included E 2 (oral, IM, or transdermal) and IM injections of 100 mg P in oil daily. The P supplement was transitioned to vaginal suppositories and oral administration as needed, to maintain a serum level of 15 ng/ml after transfer. Progesterone and E 2 supplements were continued in pregnant patients until placental production of both became evident by measures of serum levels at 8 orweeks of gestational age. Most patients discontinued all supplementation by 10 weeks of gestation. Pregnancy was identified when rising serum hcg levels reached 5 IU/L. Clinical pregnancy was established through detection of an intrauterine gestational sac by transvaginal ultrasound examination at 5 6 weeks of gestation. Ongoing pregnancies were identified by detection of fetal heart motion on ultrasound examination at 9 11 weeks of gestation. Chi-square tests were used to compare nominal variables. Wilcoxon s signed rank test was used to compare numeric variables. We used JMP, version 5.01a (SAS Institute, Cary, NC), for statistical analyses. Institutional review board approval was not obtained for this retrospec /07/$32.00 Fertility and Sterility Vol. 88, No. 1, July 2007 doi: /j.fertnstert Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. 237

264 TABLE 1 Comparison of oocyte donor cycles using agonist or hcg trigger. Agonist hcg Significance Triggers Donor age (yr) a NS Days of stimulation a NS Ampules of gonadotropins a P Follicles, day of trigger a P E2, day of trigger (pg/ml) a P Oocytes recovered a P Fertilization rate (%) a NS Transfers d Recipient age (yr) a NS Embryos transferred a NS Pregnancies b 28 (87.5%) 37 (92.5%) NS Gestational sacs Implantation rate 62.9% 72.5% NS Clinical pregnancies b 26 (81.3%) 34 (85.0%) NS Early pregnancy losses c 6 (21.4%) 6 (16.2%) NS Ongoing pregnancies b 22 (68.8%) 31 (77.5%) NS Note: NS Not significant (P 0.05). a Mean plus or minus one standard deviation. b Per transfer. c Per pregnancy (percent of pregnancies that failed to become ongoing pregnancies). d Two cycles were canceled due to suboptimal endometrial development. Shapiro. hcg vs. GnRH agonist in donor cycles. Fertil Steril tive study because it used existing data and did not reveal patient identities. A comparison of 32 agonist-triggered and 42 hcgtriggered fresh donor cycles is given in Table 1. Agonist triggers were selectively provided to oocyte donors at high risk of OHSS. Consequently, the agonist-triggered cycles were associated with more follicles and greater serum E 2 levels on the day of the trigger, and more recovered oocytes. The fertilization rate, age of recipients, number of transferred embryos, pregnancy rate (PR), clinical pregnancy rate, implantation rate, early pregnancy loss rate, and ongoing PR were similar in both groups. Two hcg-triggered cycles were canceled before transfer due to abnormal responses to the preparation protocol in the intended recipients. Their embryos were cryopreserved. One oocyte donor experienced OHSS, and required transvaginal paracentesis. She was triggered with hcg. Previous studies found increased rates of early pregnancy loss in fresh autologous cycles after an agonist trigger (8, 9). The present study found no significant evidence of an increased rate of early pregnancy loss in donor cycles with the use of an agonist trigger. This suggests that the reported increased rate of early pregnancy loss in autologous cycles after an agonist trigger is due to an endometrial factor, and not an oocyte or embryo factor. Any negative endometrial effect after an agonist trigger in fresh autologous cycles would not be operant in oocyte donor cycles, consistent with the finding of parity between the two groups in the current study. These findings support the hypothesis that GnRH agonist triggers are an effective alternative to hcg triggers in oocyte donors with significant risk factors for OHSS. Bruce S. Shapiro, M.D. a,b Said T. Daneshmand, M.D. a,b Forest C. Garner, M.S. a,b Martha Aguirre, Ph.D. a Richard Ross, M.S. a a Fertility Center of Las Vegas, Las Vegas, Nevada; and b Department of Obstetrics and Gynecology, University of Nevada School of Medicine, Las Vegas, Nevada REFERENCES 1. Practice Committee of the American Society for Reproductive Medicine. Ovarian hyperstimulation syndrome. Fertil Steril 2003;80: Shapiro BS, Daneshmand ST, Garner FC, Aguirre M, Ross R, Morris S. Effects of the ovulatory serum concentration of human chorionic 238 Shapiro et al. Correspondence Vol. 88, No. 1, July 2007

265 gonadotropin on the incidence of ovarian hyperstimulation syndrome and success rates for in vitro fertilization. Fertil Steril 2005;84: Kol S, Itskovitz-Eldor J. Severe OHSS: yes, there is a strategy to prevent it! Hum Reprod 2000;15: Kol S. Luteolysis induced by a gonadotropin releasing hormone agonist is the key to prevention of ovarian hyperstimulation syndrome. Fertil Steril 2004;81: Babayof R, Margalioth EJ, Huleihel M, Amash A, Zylber-Haran E, Gal M, et al. Serum inhibin A, VEGF and TNFalpha levels after triggering oocyte maturation with GnRH agonist compared with HCG in women with polycystic ovaries undergoing IVF treatment: a prospective randomized trial. Hum Reprod 2006;21: Morris RS, Paulson RJ, Sauer MV, Lobo RA. Predictive value of serum oestradiol concentrations and oocyte number in severe ovarian hyperstimulation syndrome. Hum Reprod 1995;10: Halme J, Toma SK, Talbert LM. A case of severe ovarian hyperstimulation in a healthy oocyte donor. Fertil Steril 1995;64: Humaidan P, Bredkjaer HE, Bungum L, Bungum M, Grondahl ML, Westergaard L, et al. GnRH agonist (buserelin) or hcg for ovulation induction in GnRH antagonist IVF/ICSI cycles: a prospective randomized study. Hum Reprod 2005;20: Kolibianakis EM, Schultze-Mosgau A, Schroer A, Van Steirteghem A, Devroey P, Diedrich K, et al. A lower ongoing pregnancy rate can be expected when GnRH agonist is used for triggering final oocyte maturation instead of HCG in patients undergoing IVF with GnRH antagonists. Hum Reprod 2005;20: Griesinger G, Diedrich K, Devroey P, Kolibianakis EM. GnRH agonist for triggering final oocyte maturation in the GnRH antagonist ovarian hyperstimulation protocol: a systematic review and metaanalysis. Hum Reprod Update 2006;12: Fertility and Sterility 239

266 The effect of cinnamon extract on insulin resistance parameters in polycystic ovary syndrome: a pilot study Cinnamon extract has been shown to reduce insulin resistance in in vitro and in vivo studies by increasing phosphatidylinositol 3-kinase activity in the insulin signaling pathway and thus potentiating insulin action. Fifteen women with polycystic ovary syndrome (PCOS) were randomized to daily oral cinnamon and placebo for 8 weeks. Comparisons of post-treatment to baseline insulin sensitivity indices using fasting and 2-hour oral glucose tolerance tests showed significant reductions in insulin resistance in the cinnamon group but not in the placebo group. A larger trial is needed to confirm the findings of this pilot study and to evaluate the effect of cinnamon extract on menstrual cyclicity. (Fertil Steril 2007;88: by American Society for Reproductive Medicine.) Polycystic ovary syndrome (PCOS) is one of the most common endocrinopathies among women of reproductive age, affecting 5% 10% of the population (1). In the absence of other endocrine disorders (congenital adrenal hyperplasia, hyperprolactinemia, thyroid dysfunction, Cushing syndrome, and androgen secreting tumors) the syndrome is defined by the presence of at least two of following symptoms based on the Rotterdam consensus criteria: [1] oligo- or anovulation, [2] clinical or biochemical signs of hyperandrogenism, and [3] the presence of polycystic ovaries on ultrasound (2, 3). Although insulin resistance and the compensatory hyperinsulinemia are not part of any criteria for the diagnosis, the prevalence among women with PCOS is 50% 70% (4) and may be as high as 95% in overweight women (5). Hyperinsulinemia may contribute to the pathogenesis of PCOS by promoting abnormal androgen secretion and disrupting folliculogenesis and menstrual cyclicity (6, 7). However, the use of insulin-sensitizing agents for treating ovulatory dysfunction in PCOS is controversial as a recent prospective, randomized, controlled trial demonstrated a lack of effectiveness from the use of metformin for ovulation induction (8) in contrary to prior studies (9 15). The polyphenol type-a polymers, procyanidin, extracted from cinnamon stimulate autophosphorylation of the insulin receptor and inhibit protein tyrosine phosphatase I. Adipocytes treated with cinnamon extract in in vitro conditions increase the glucose uptake and glycogen synthesis by these two mechanisms (16, 17). In vivo, cinnamon Received July 27, 2006; revised November 1, 2006; accepted November 16, Presented at the ASRM 62nd Annual Meeting, New Orleans, Louisiana, October 21, Reprint requests: Jeff Wang, M.D., Department of Obstetrics & Gynecology, Columbia University, 622 W. 168th Street PH-16, New York, NY (FAX: ; jw781@columbia.edu). extract has been found to mitigate insulin resistance induced by high fructose diets in normal Wistar rats as measured by the euglycemic clamp (18). These findings suggest that cinnamon extract may potentiate insulin action by enhancing the insulin signaling pathways leading to increased phosphatidylinositol 3-kinase activity, which regulates insulin-stimulated glucose uptake and glycogen synthesis (19). In the human, oral cinnamon extract reduced fasting glucose, triglycerides, low-density lipoprotein (LDL), and total cholesterol in patients with type 2 diabetes mellitus in a prospective, randomized, placebo-controlled trial involving 60 subjects with type 2 diabetes mellitus (20). Given these findings, we designed this pilot study to test the hypothesis that oral cinnamon extract would improve insulin sensitivity in women with PCOS. MATERIALS AND METHODS Fifteen women with PCOS (mean body mass index [BMI], kg/m 2 ; mean age, years) were recruited for the study between August 2005 and January 2006 from the Center for Women s Reproductive Care at the Columbia University. All subjects had [1] oligomenorrhea or amenorrhea and [2] polycystic ovaries (PCO) by ultrasonography. Among them, four also had biochemical evidence of hyperandrogenism as defined by elevated serum T levels ( 80 ng/dl). Patients who had diabetes mellitus, hyperprolactinemia, thyroid disorders, and hypertension were excluded. Other exclusion criteria included the use of confounding medications such as oral hypoglycemics, insulin-sensitizing drugs, oral contraceptive agents, and -blockers within 60 days before enrollment. Normative data for indices of insulin sensitivity were derived from 12 normo-ovulatory nonobese women (mean BMI, kg/m 2 ; mean age, years) previously studied (unpublished data). 240 Fertility and Sterility Vol. 88, No. 1, July /07/$32.00 Copyright 2007 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

267 The Institutional Review Board (IRB) of Columbia University approved the study protocol, and all patients gave their signed informed consent. All subjects were evaluated on days 3 7 after a spontaneous or progestogen-induced menstrual bleed. Height and weight were measured in light clothing without shoes and BMI (kg/m 2 ) was calculated. Transvaginal ultrasonography was carried out to measure ovarian volumes and the number of follicles. Fasting bloods were obtained for endocrine and metabolic parameter. The homeostasis model insulin resistance index (HOMA-IR) was calculated using the following formula: fasting glucose (mmol/l) fasting insulin ( U/mL)/22.5 (21). The quantitative insulin sensitivity check index (QUICKI) was calculated according to the following formula: [log fasting glucose (mg/dl) log fasting insulin ( U/mL)] 1 (22). A standard 75-g oral glucose tolerance test (OGTT) was performed after 12 hours of fasting. Venous blood samples for blood glucose and serum insulin were drawn at 0, 30, 60, and 120 minutes. Glucose tolerance status was evaluated using the criteria established by the American Diabetes Association (23). The response of glucose and insulin during the OGTT were analyzed by calculating the areas under the curve (AUC) using the trapezoidal method. The insulin sensitivity index was calculated according to the Matsuda method: 10,000 [fasting glucose (mg/dl) fasting insulin ( U/mL) mean glucose during OGTT (mg/dl) mean insulin during OGTT ( U/mL)] 1/2 (24). After the screening procedure, study subjects were randomly allocated in a 1:1 ratio to a placebo group (one capsule, three times per day) or to a cinnamon extract group (one capsule containing 333 mg of cinnamon extract, three times per day) using computer-generated assignment. Participants and study staff were blinded to the group assignment. Cinnamon capsules were provided by Integrity Nutraceuticals International (Sarasota, FL). All subjects were advised to use nonhormonal contraception during the study. They were also advised not to modify their usual eating or exercise habits throughout the study. At the end of 8 weeks, BMI and fasting blood was obtained for endocrine and metabolic parameters, and OGTT was repeated. Serum levels of FSH, LH, PRL, TSH, total T, E 2, insulin, and sex hormone binding globulin (SHBG) were measured with chemiluminescence assays using Immulite (Diagnostic Products Corporation, Los Angeles, CA). Interassay and intra-assay coefficients of variation for all assays did not exceed 10% with the exception of total T (16% and 13%, respectively) and E 2 (16% and 15%, respectively). All variables between the placebo and cinnamon groups at baseline were compared using the Mann-Whitney U test, as were comparisons with the values in normo-ovulatory women. Wilcoxon signed ranks tests were used to compare all variables between baseline and at 8 weeks of treatment in the placebo and in the cinnamon extract groups. Data analyses were performed using the statistical software package SPSS for Windows (Version 13.0 for Windows; SPSS, Inc., Chicago, IL). RESULTS Mean baseline HOMA-IR and QUICKI in the 15 subjects indicated greater insulin resistance compared to those of the normo-ovulatory nonobese controls (HOMA-IR, vs , P.05 and QUICKI, vs , P.05, respectively). The placebo and the cinnamon group did not differ with respect to age, BMI, FSH, E 2, T, fasting glucose and insulin, QUICKI, HOMA- IR, or insulin sensitivity index at baseline. In the placebo group, one patient was lost to follow-up after randomization, resulting in seven available patients in the final analysis. There were no adverse effects noted during this study. Body mass index did not change significantly during the 8-week treatment period. Total T and E 2 remained unchanged. Fasting glucose decreased significantly from mg/dl ( 7.7%, P.03). However, fasting insulin, HOMA-IR, QUICKI, and the Matsuda insulin resistance index remained unchanged. In the cinnamon group, one patient withdrew from the study for personal reasons after starting the medication, resulting in six available patients in the final analysis. Body mass index, total T, and E 2 remained the same. Fasting glucose decreased significantly from mg/dl ( 16.9%, P.03). The QUICKI increased significantly from (7.7%, P.03) and HOMA-IR decreased from ( 44.5%, P.03), both consistent with improved insulin sensitivity (Fig. 1). These post-treatment insulin resistance indices were not statistically different from those of the normo-ovulatory controls (P.17). Results from the OGTT showed a reduction in mean glucose levels (AUC glucose /120 minutes) from mg/dl per minute to mg/dl per minute ( 20.9%, P.03) and the Matsuda insulin resistance index increased from during the treatment period ( 122.8%, P.05), also consistent with improved insulin sensitivity. DISCUSSION The primary objective of this pilot study was to determine whether oral administration of cinnamon extract would improve insulin sensitivity in women with PCOS. During the 8-week treatment period, oral cinnamon extract resulted in a significant reduction in fasting glucose as well as insulin resistance, as measured by various indices of insulin sensitivity from fasting and OGTT values. These findings are comparable to that of a prior human study in which daily administration of 1,000 mg of oral cinnamon extract reduced fasting glucose levels by 16% Fertility and Sterility 241

268 FIGURE 1 (A) HOMA-IR remained unchanged in the placebo group after 8 weeks of treatment compared to baseline. (B) However, post-treatment HOMA-IR in the cinnamon extract group showed significant reductions compared to pretreatment values (P.03 by Wilcoxon signed ranks test). Lines represent the baseline and post-treatment HOMA-IR values for individual patients. Wang. Cinnamon and insulin resistance in PCOS. Fertil Steril during a 60-day study period in older patients (mean age, 52 6 years) with type 2 diabetes mellitus (20). In this study, fasting glucose was similarly reduced by 17% during the 8-week treatment period in younger and nondiabetic women with PCOS. The mean HOMA-IR in the cinnamon group decreased significantly from a pretreatment value of , which was not statistically different from that of the normo-ovulatory controls presumably without insulin resistance. However, this comparison does not imply a complete normalization of insulin resistance with cinnamon extract, as the use of historic controls may be confounded by unrecognized biases. The OGTT showed a significant 21% reduction in mean glucose and an increase in Matsuda s insulin sensitivity index. There were no reported side effects in either study. The reduction in insulin resistance associated with cinnamon extract appears to be mediated through an increase in glucose utilization, as there were no significant alterations in hyperinsulinemia measured by fasting insulin or mean insulin levels during OGTT. These findings are consistent with prior studies demonstrating that the polyphenol type-a polymers, procyanidin, in cinnamon extracts exert their hypoglycemic effects primarily by potentiating insulin signaling at the postreceptor level, resulting in an increase in PI-3 kinase activity. Activation of this pathway leads to the translocation of GLUT-4 receptors and the attenuation of the tonic inhibition on glycogen synthase, culminating in improved glucose utilization by facilitating intracellular glucose transport and increasing glycogen synthesis, respectively. Cinnamon did not reduce total T levels in this study, but the negative finding may be in part due to the small sample size of the pilot study. The effect of cinnamon on ovulation and menstrual regularity was not assessed objectively as the intent of this pilot study was only to determine the potential impact on insulin sensitivity, and the length of the study was too short for any assessment. In conclusion, oral administration of cinnamon extract for 8 weeks was well tolerated and improved insulin sensitivity in nondiabetic women with PCOS. Although these preliminary findings are interesting and consistent with prior in vivo animal and human studies, the role of cinnamon as an adjunctive therapy in the treatment of PCOS is far from being established. However, we are encouraged in that this small short-term study was able to demonstrate alteration in insulin resistance parameters. Clearly, a large prospective, randomized, placebo-controlled trial involving a greater number of patients and a longer treatment duration would be needed to validate the findings of this pilot study. Jeff G. Wang, M.D. a Richard A. Anderson, Ph.D. b George M. Graham, III, M.D. c Micheline C. Chu, M.D. a 242 Wang et al. Correspondence Vol. 88, No. 1, July 2007