BACTERIAL ANTAGONISTS FROM USED ROCKWOOL SOILLESS SUBSTRATES SUPPRESS FUSARIUM WILT OF TOMATO

Transcription

1 Journal of Plant Pathology (2009), 91 (1), Edizioni ETS Pisa, BACTERIAL ANTAGONISTS FROM USED ROCKWOOL SOILLESS SUBSTRATES SUPPRESS FUSARIUM WILT OF TOMATO K. Srinivasan, G. Gilardi, A. Garibaldi and M.L. Gullino Centre for Agro-Environmental Innovation (AGROINNOVA), Università degli Studi di Torino, Via L. da Vinci 44, Grugliasco, TO, Italy SUMMARY Five bacterial strains (FC-6B, FC-7B, FC-8B, FC-9B and FC-24B) isolated from used rockwool soilless substrates were identified using 16S ribosomal DNA (16S rdna) sequence analysis as belonging to the Pseudomonas genus. Seven glasshouse trials were conducted in order to evaluate the efficacy of these bacteria strains (Pseudomonas putida FC-6B, Pseudomonas sp. FC-7B, Pseudomonas putida FC-8B, Pseudomonas sp. FC-9B and Pseudomonas sp. FC-24B) together with Achromobacter sp. AM1 and Serratia sp. DM1 obtained from suppressive soil, against Fusarium wilt of tomato. Two commercial bioproducts, Trichoderma harzianum T22 (RootShield) and Pseudomonas chlororaphis MA 342 (Cedomon) were also evaluated. Different treatment strategies including soil application (10 7 and 10 8 cfu ml -1 ) were adopted in different glasshouse trials (Trial I to VI) to test the efficacy of the bacterial strains against Fusarium wilt. Root dipping was used in Trial VII (10 8 and 10 9 cfu ml -1 ). The lowest disease incidence (3.3) was recorded with a single application of P. putida FC-6B at 10 8 cfu ml -1. Similar results were obtained with the same bacteria when the concentration was decreased to 10 7 cfu ml -1 but an increasing number of applications was required. The highest plant biomass (50.3 g/plant) was recorded in the P. putida FC-8B treatment (Trial III). In conclusion, the current study showed the potential biocontrol activity of bacterial strains FC-6B, FC-7B, FC-8B, FC-9B and FC-24B isolated from re-used rockwool soilless substrates against Fusarium wilt disease, and the growth promoting activity of these strains on tomato plants. Key words: Biological control, suppressive soil, Fusarium oxysporum f. sp. lycopersici, Pseudomonas spp. Corresponding author: M.L. Gullino Fax: marialodovica.gullino@unito.it INTRODUCTION Tomato (Solanum lycopersicum) is an important vegetable crop cultivated on around 4 million Ha worldwide (FAO, 2003). In Italy, it is a high-value crop, grown in greenhouses and in the open and subject to significant losses caused by the fungus Fusarium oxysporum f. sp. lycopersici. Typical symptoms of the disease are yellowing and wilting of leaves progressing upward from the base of the stem. Initially, only one side of a leaf midrib, one branch, or one side of a plant is affected. The symptoms soon spread to the rest of the plant and finally kill it. Due to prolonged survival in soil as a saprophyte and as resistant structures, F. oxysporum is difficult to control (Mujeebur and Shahana, 2002; Borrero et al., 2004). Among control strategies available for Fusarium wilt management, soil fumigation and use of resistant cultivars are the most used. Chemical fumigants pose serious hazards to the environment (Gullino et al., 2003), whereas the development of resistant cultivars takes time and new races of the pathogen can develop that overcome resistance. Hence, there is a vital need to develop alternative strategies. Biological control of plant pathogens using antagonistic fungal and bacterial strains is gaining increasing importance. Soil has untapped potential and contains several potential biocontrol agents (BCAs) such as Pseudomonas spp., Trichoderma spp. and non-pathogenic Fusarium spp. that have shown high antagonistic activity against several soil-borne pathogens (Fuchs et al., 1999; Ramamoorthy et al., 2001). So far, several bacterial and fungal antagonistic strains have been shown to reduce the damage caused by different pathogens, including F. oxysporum f. sp. lycopersici (Postma and Rattink, 1992; Alabouvette, 2001; Moretti et al., 2008). Some studies have shown that the combined effect of antagonism and plant growth promotion by BCAs suppresses Fusarium wilt disease in several crops (De Boer et al., 2003; Fahri and Murat, 2007). Recently, more interest has been shown for the various roles played by microorganisms present in soilless crop systems. Garibaldi et al. (2003) reported the application of selected antagonistic strains against Phytophthora cryptogea on gerbera in closed soilless systems.

2 148 Suppression of Fusarium wilt of tomato Journal of Plant Pathology (2009), 91 (1), Several researchers reported that indigenous microorganisms were present in soilless systems and proposed the possibility of exploiting beneficial microorganisms in vegetable crops with the scope of reducing fungicide application (Postma et al., 2000, 2001; Koohakan et al., 2004). The effects of autoclaved/non-autoclaved and used/new rockwool on Fusarium oxysporum f. sp. radicis-lycopersici incidence in closed soilless systems showed the key role of resident microflora in used rockwool in suppressing root rot disease of tomato (Minuto et al., 2007). In the present study, strains isolated from used rockwool substrate in closed soilless systems and from suppressive soil have been evaluated against Fusarium wilt of tomato under glasshouse conditions. To determine the effect of these bacteria against Fusarium wilt and on plant growth, it is necessary to define the application strategies and to standardize the concentration of bacteria. Hence, the objectives of the present study were: (i) to evaluate the efficacy of bacterial strains isolated from soilless substrates and suppressive soil against Fusarium wilt on tomato; (ii) to determine methods of application and concentrations of bacteria that effectively control the disease; (iii) to study the plant growth promoting activity of these strains under glasshouse conditions. MATERIALS AND METHODS Bacterial cultures. Five bacteria (FC-6B, FC-7B, FC- 8B, FC-9B and FC-24B) were isolated from the recycled substrates of soilless crops grown at Albenga (northern Italy), suppressive to Fusarium crown rot (Minuto et al., 2007), that showed antagonistic activity against this disease (A. Garibaldi, personal communication). Species of Achromobacter (AM1) and Serratia (DM1) were isolated from Fusarium disease-suppressive soils in Liguria (northern-italy) (Moretti et al., 2008). F. oxysporum f. sp. lycopersici (strain code Panero 6) and bacterial cultures were obtained from the AGROINNOVA culture collection, University of Torino, Italy. Bacterial identification using 16S rdna analysis. The five bacteria isolated from the soilless substrates were identified using 16S ribosomal DNA (16S rdna) sequence analysis. Genomic DNA was extracted using a DNeasy kit (Qiagen, USA). PCR (Biometra, Germany) was carried out with the universal bacterial primers 704F: 5 GTAGCAGTGAAATGCGTAGA 3 and 1495R: 5 CTACGGCTACCTTGTTACGA 3 in a volume of 34 µl consisting of 0.5 µm of each primer, 3 µl of 10x buffer, 1.5 mm MgCl 2, 200 µm dntps, 5 µl DNA preparation and 1 U of Taq polymerase (Invitrogen, USA). We used the following conditions: 95 C for 3 min, followed by 35 amplification cycles of 94 C for 45 sec, 55ºC for 55 sec, 72ºC for 45 sec and then a final extension at 72 C for 10 min. PCR products were resolved on 2% agarose gels run at 50 V, stained with SYBR-safe (Invitrogen, USA) and sequenced at BMR Genomics, DNA Sequencing Service Centre, Padova, Italy. Seedling preparation. Tomato seeds (cv. Cuore di bue) were sown in plug trays (14 trays, 160 plugs/tray) and transplanted after 21days. The medium used was 50% Tecno-2 (peat+ clay+npk+microelements: 2.5 kg m -3 ) and 50% Tiesse-3 (peat+clay+perlite+npk+ microelements: 1 kg m -3 ). Preparation of bacterial suspensions. The bacterial strains were maintained in Luria Bertani (LB) slants (Miller, 1987) throughout. Fresh bacterial suspensions were prepared by inoculating a loopfull of cells onto 25 ml LB medium in 100-ml Erlenmeyer flasks and incubating on a rotary shaker at 600 rpm for 7 h at 20 C. Bacterial concentration, calculated by serial dilutions and checked by optical density (OD 600 ), were adjusted with deionized sterile water by serial dilution to 1x10 7, 1x10 8 and 1x10 9 cfu ml -1 before use. The commercial products, RootShield (T. harzianum T22 at 3x10 6 cfu ml -1 ; Intrachem, Bio Italia) and Cedomon (P. chlororaphis MA 342 at 7.5x10 6 cfu ml -1 ; Bioagri, AB) were applied according to manufacturer s instructions. Talc inoculum of F. oxysporum f. sp. lycopersici. The fungus was grown on liquid casein hydrolysate medium as per Locke and Colhoun (1974) and maintained on a rotary shaker at 200 rpm for 10 days at 28 C. The culture was centrifuged at 8,000 x g for 20 min at 4 C. The pellet was thoroughly mixed with a double volume of dry talc powder (1:2 w/w) and kept for 10 days at 25 C. The number of chlamydospores per gram of talc was assessed by serial plating on potato dextrose agar (PDA) containing 25 mg l -1 streptomycin sulphate. Glasshouse trials. Seven glasshouse trials were performed from December 2007 to June 2008 with different methods of application of bacteria, i.e. trials I to VI with soil application, trial VII with root dipping. The applications of bacteria, pathogen and incubation of soil mixture after application of bacteria and pathogen are shown in Table 1. Preparation of soil mix containing bacteria and pathogen inoculum. Bacterial strains at two different concentrations (10 7 and 10 8 cfu ml -1 ) and commercial bioproducts at recommended concentrations were prepared and applied in individual soil bags containing 17.5 l of soil. F. oxysporum f. sp. lycopersici (5x10 4 chlamydospores ml -1 of soil) was then inoculated in the bags. Bacteria and pathogen were mixed thoroughly, allowed to multiply for different times and applied to different trials as shown in Table 1. The soil mix in one

3 Journal of Plant Pathology (2009), 91 (1), Srinivasan et al. 149 Table 1. Soil-mix trials: Application of the bacteria and the pathogen, and incubation period before planting. Trial No. Application of bacteria (day) Application of pathogen (day) I 0-7 II III 0 and IV V VI 0 and VII Trials I to VI: soil application Trial VII: root dipping method Soil mix incubation period (days) bag was placed in five pots (3.5 l each). The seedlings were then transplanted into the pots (3 plants/pot for a total of 15 plants in each treatment) arranged in a complete randomized block design at C and relative humidity between 50 and 70%. Root dipping of bacterial strains. F. oxysporum f. sp. lycopersici (5x10 4 chlamydospores ml -1 of soil) was mixed with soil (17.5 l bag) and the contents of each bag was distributed to five pots (3.5 l each). Seedlings were carefully removed 21 days after sowing and their roots dipped in 100 ml of bacterial suspension (10 8 and 10 9 cfu ml -1 ) for 10 min and planted in the pots. P. chlororaphis MA 342 was applied at 7.5x10 6 cfu ml -1. The granular formulation of T. harzianum T22 (3x10 6 cfu ml -1 ) was directly applied to soil (17.5 l bag). There were five replications for each treatment and each treatment had 15 plants (3 plants/pot) in a complete randomized block design. Appropriate inoculated and uninoculated controls were maintained for each trial. Assessment of Fusarium wilt incidence. Every week, each plant in each treatment was assessed for disease development noting the number of infected plants and severity of symptoms. Completely wilted plants were removed. Final disease incidence was evaluated 4 weeks after transplanting. Disease incidence () was assessed on a scale 0 to 100: 0, no infection; 25 initial symptoms of leaf chlorosis, one or two leaves yellow; 50, severe leaf chlorosis and initial wilting during the hottest hours of the day; 75, severe wilting, incipient symptoms of leaf chlorosis and inhibition of growth; 100, leaves totally yellow, wilting of plants followed by death. At the end of each trial, stem sections of wilted plants were cut and placed on Komada s medium (Komada, 1975) to confirm the presence of the wilt pathogen. Measurement of plant growth parameters. At the end of each trial, plant height and total fresh biomass were measured in order to evaluate the plant growth promoting activity of bacterial strains. Statistical analysis. All experiments were repeated once. The mean value of each treatment is given. The data on disease index, plant height and biomass was statistically analyzed (ANOVA). The significance between individual treatments was evaluated with Duncan s multiple range test at (P<0.05) using SPSS Software. RESULTS Identification of bacterial strains. PCR-amplified 16S rdna of the bacterial strains was sequenced and blasted with the NCBI database. The sequence data of all the bacterial strains isolated from soilless substrates showed that the strains belonged to the genus Pseudomonas. The sequences were deposited in NCBI, USA with the following Accession Nos: EU836170, Pseudomonas putida FC-6B; EU836173, Pseudomonas sp. FC-7B; EU836174, Pseudomonas putida FC-8B; EU836171, Pseudomonas sp. FC-9B; and EU836172, Pseudomonas sp. FC-24B. Testing plant growth promoting activity of bacterial strains. Trial I was conducted to study the plant growth promoting activity of the bacterial strains and commercial bioproducts. All treatments significantly improved plant height ( cm) and total biomass ( g) compared to untreated plants (38.4 cm plant height; 27.9 g total biomass). Interestingly, plants treated with Serratia sp. (10 8 cfu ml -1 ) showed the greatest plant height (61.3 cm) whereas the highest total biomass (35.1 g) was recorded in the Pseudomonas sp. FC-9B (10 8 cfu ml -1 ) treatment. This trial also showed that the bacterial strains used did not inhibit tomato plant growth nor were they phytotoxic (Table 2, trial I).

4 Table 2. Effect of bacterial strains isolated from soilless substrates and suppressive soil against Fusarium wilt on tomato. Treatment Dosage (CFU/ ml of soil) * Trial I Trial II Trial III Trial IV (0-100) (0-100) (0-100) Achromobacter sp. AM1 1x ± 2.2 e 30.0± 3.2 ab 16.7 ± 7.6 abc 31.9 ± 3.0 a 29.9 ± 13.0 c 5.0± 2.7 abc 40.5 ± 2.9a 37.0 ± 6.8 bcd 38.3± 9.7 d 33.3 ± 1.8 ab 21.9 ±4.3 abc 1x ±1.5 abcd 31.3 ± 0.9 ab 18.3 ± 7.1 abc 30.0 ± 2.6 a 26.4 ± 4.6 c 20.0± 7.8 bcde 45.6 ± 1.5 a 27.6 ± 2.8 ghi 26.7 ±8.3 bcd 30.9 ± 1.9 b 24.3 ± 1.6 ab Serratia sp. DM1 1x ± 3.2 cde 31.2 ± 1.7 ab 26.7 ± 7.9 bcd 36.1 ± 3.0 a 32.5 ± 7.7 bc 20.0 ± 2.7 bcde 35.7 ± 4.3 a 41.6 ± 1.4 b 36.7 ± 8.0 cd 29.3 ± 1.3 b 23.9 ± 14.3 ab 1x ± 2.6 a 31.9 ± 3.7 ab 26.7 ± 6.7 bcd 32.6 ± 1.6 a 28.1 ± 2.1 c 23.3 ± 7.9 cde 34.5 ± 3.6 a 28.4 ± 1.3 fgh 31.7 ± 11.0 bcd 32.5 ± 2.1 ab 23.6 ± 2.9 ab P. putida FC-6B 1x ± 2.4 e 29.6 ± 0.7 b 15.0 ± 6.4 abc 32.4 ± 1.7 a 26.9 ± 3.9 c 3.3 ± 3.3 ab 44.1 ± 2.5 a 40.7 ± 1.9 bc 20.0 ± 6.5 abcd 32.6 ± 1.0 ab 24.4 ±0.7 a 1x ± 1.5 a 32.4 ± 2.3 ab 3.3 ± 3.3 ab 35.9 ± 2.3 a 39.6 ± 5.0 ab 20.0 ± 6.5 bcde 38.0 ± 3.9 a 34.2 ± 12.1 cdefg 20.0 ± 7.0 abcd 29.7 ±1.1 b 25.8 ± 1.5 a Pseudomonas sp. FC-7B 1x ± 2.2 de 30.1 ± 3.0 ab 10.0 ± 7.2 abc 30.3 ± 3.3 a 30.6 ± 13.0 c 13.3 ± 3.3 abcde 38.1 ± 3.0 a 41.7 ± 1.5 b 21.7 ± 5.4 abcd 31.1 ± 0.9 b 24.3 ±1.7 ab 1x ±2.1 abc 32.7 ± 3.7 ab 31.7 ± 7.9 cd 31.2 ± 2.7 a 27.6 ± 3.1 c 16.7 ± 5.3 abcde 40.3 ± 1.3 a 34.6 ± 1.5 cdef 15.0 ± 5.3 abcd 31.3 ±1.7 b 21.6 ± 3.9 abc P. putida FC-8B 1x ± 1.2 cde 32.1 ± 3.1 ab 11.7 ± 4.8 abc 32.8 ± 1.6 a 30.3 ± 4.8 c 3.3 ± 2.3 ab 40.6 ± 1.2 a 50.3 ± 10.6 a 6.7 ± 3.0 ab 33.0 ± 1.0 ab 28.8 ± 14.4 a 1x ± 1.7 ab 33.1 ±5.5 ab 50.0 ± 9.8 de 20.5 ± 3.6 b 23.8 ± 14.0 c 30.0 ± 8.2 e 46.6 ± 2.3 a 28.7 ± 6.5 efgh 16.7 ±5.8 abcd 28.2 ± 1.3 b 24.0 ±9.3 ab Pseudomonas sp. FC-9B 1x ± 0.7 bcde 32.0 ± 1.6 ab 10.0 ± 4.1 abc 32.2 ± 2.0 a 31.8 ± 7.9 bc 8.3 ± 3.1 abcd 38.8 ± 3.5 a 40.4 ± 4.2 bc 25.0 ± 8.8 abcd 32.7 ± 1.7ab 26.5 ± 4.8 a 1x ± 2.5 ab 35.1 ± 2.6 a 25.0 ± 6.9 abc 29.9 ± 2.2 a 29.3 ± 8.3 c 13.3 ± 5.4 abcde 43.0 ± 1.5 a 30.7 ± 3.0 defg 26.7± 8.3 bcd 33.7 ± 2.1 ab 23.9 ± 15.2 ab Pseudomonas sp. FC- 1x ± 3.4 e 31.2 ± 4.0 ab 16.7 ± 7.6 abc 35.9 ± 3.1 a 44.4 ± 8.1 a 6.7 ± 6.7 abc 42.8 ± 3.5 a 34.8 ±1.1 cdef 25.0 ± 7.7 abcd 31.3 ±1.5 b 15.3 ±6.0 c 24B 1x ± 1.4 abcd 31.7 ± 2.6 ab 33.3 ± 9.7 cd 28.9 ± 3.6 a 29.2 ± 12.0 c 26.7 ± 7.5 de 37.4 ± 2.9 a 30.4 ± 4.3 defg 23.3 ± 7.9 abcd 31.6 ± 1.5 b 21.4 ±1.5 abc Cedomon - P. 7.5x ± 2.4 e 30.0 ± 0.9 ab 28.3 ± 7.3 bcd 31.0 ± 2.3 a 28.4 ± 6.4 c 3.3 ± 2.3 ab 43.0 ± 1.6 a 35.2 ±18 bcde 11.7 ±5.9 abc 32.3 ±2.3 ab 24.0 ± 11.5 ab chlororaphis Rootshield - T. 3x ± 3.2 e 29.3 ± 0.3 b 20.0 ± 8.2 abc 31.7 ± 3.0 a 31.1 ± 5.2 bc 16.7 ± 4.0 abcde 34.6 ± 3.0 a 35.9 ± 2.3 bcd 28.3 ±9.4 bcd 32.4 ± 2.3 ab 23.3 ± 4.4 ab harzianum Inoculated control ± 6.3 e 19.3 ± 2.5 b 24.8 ± 9.9 c 56.7 ± 6.7 f 22.3 ±1.9 b 21.9 ± 13.3 i 61.7 ± 6.8 e 20.9 ± 1.6 c 16.5 ± 7.4 bc Non-inoculated control ± 2.0 e 27.9 ± 1.0 b 0.0 a 30.7 ± 1.1 a 32.3 ± 1.8 bc 0.0 a 37.9 ± 1.8 a 23.8 ± 9.9 hi 0.0 ±a 37.5 ± 1.0 a 26.8 ± 3.1 a Values followed by different letters within a column differ significantly (Duncan test p<0.05) : Disease Index * This trial (I) was not inoculated with F. oxysporum f. sp. lycopersici. 150 Suppression of Fusarium wilt of tomato Journal of Plant Pathology (2009), 91 (1),

5 Table 2. Continued Treatment Dosage (CFU/ml of soil) Trial V Trial VI Trial VII** Dosage Treatment (CFU/ml (0-100) (0-100) of soil) (0-100) Achromobactersp. 1x ± 10.2 b 31.2 ± 4.3 def 18.7 ± 8.4 cdefgh 15.0 ± 8.4ab 40.4 ± 3.2 abc 18.5 ± 6.9 abc Achromobacter sp. 1x ± 9.3 de 27.2 ± 4.1 abcd 19.4 ± 16.0 ab 1x ± 8.0 ab 46.1 ± 4.7 abcd 24.4 ± 16.3 abcdef 11.7 ± 7.3 ab 47.3 ±3.1 ab 22.3 ± 5.0 ab 1x ± 9.4 bcd 23.7 ±3.5 abcd 20.0 ± 12.6 ab Serratia sp. DM1 1x ±5.9 ab 48.3 ± 4.0 abc 28.4 ± 12.5 abc 10.0 ± 6.8 ab 41.3 ±2.1 abc 18.4 ±5.6 abc Serratia sp.dm1 1x ± 9.8 de 17.2 ±3.9 cd 10.2 ± 14.3 b 1x ± 9.0 ab 45.9 ±4.5 abcd 22.2 ±9.1 bcdefg 10.0 ±7.2 ab 46.7 ±3.0 ab 22.5 ±6.2 ab 1x ±13.1 bcd 20.9 ±3.4 bcd 14.6 ±14.1 ab P. putida FC-6B 1x ± 7.1 ab 34.2 ±3.6 cde 19.2 ±7.7 cdefgh 11.7 ± 8.0 ab 39.8 ±4.4 abc 18.9 ±10.3 abc P. putida FC-6B 1x ±7.9 de 22.9 ±3.3 abcd 15.5 ± 9.1 ab 1x ± 2.7 a 59.1 ± 1.9 a 33.7 ±8.0 a 13.3 ±8.0 ab 44.7 ±3.7 ab 17.8 ±6.9 abc 1x ±10.0 bcd 24.9 ±2.8 abcd 20.0 ± 10.4 ab Pseudomonas sp. 1x ±9.3 ab 32.9 ±4.1 cdef 16.5 ± 7.7 efgh 11.7 ±5.9 ab 30.7 ±3.0 c 14.1 ±7.3 cd Pseudomonas sp. FC-7B 1x ±10.0 de 23.7 ±3.8 abcd 16.7 ±11.4 ab FC-7B 1x ±10.5 ab 41.5 ± 5.7 bcde 21.9 ±9.4 bcdefg 8.3± 6.8 ab 36.9 ±4.5 abc 19.3 ±7.9 abc 1x ±8.0 bcd 23.3 ± 3.4 abcd 16.9 ±14.6 ab P. putida FC-8B 1x ± 4.1 ab 39.5 ±3.1 bcde 21.1 ±9.9 bcdefg 23.3± 9.0 b 29.9 ±3.0 c 16.1 ±3.8 bc P. putida FC-8B 1x ± 8.4 bcd 27.8 ±4.3 abcd 23.3 ±14.3 ab 1x ± 8.3 ab 39.1 ±4.4 bcde 18.2 ±9.7 defgh 21.7 ±9.4 b 36.3±4.1 bc 16.9 ± 8.1 bc 1x ±9.7 bcd 28.9 ±3.6 abc 24.3 ±17.4 ab Pseudomonas sp. 1x ±7.6 ab 34.6 ±4.1 cde 17.0 ±8.7 efgh 10.0 ±5.9 ab 41.2 ±3.6 abc 21.4 ±8.8 abc Pseudomonas sp. FC-9B 1x ±8.9 cde 23.5 ±4.3 abcd 19.9 ± 15.4ab FC-9B 1x ±3.8 a 51.9 ±3.3 ab 27.4 ±7.6 abcd 10.0 ±5.9 ab 48.9 ±2.9 a 24.7 ± 4.9 a 1x ±5.6 ab 33.9 ±3.0 ab 28.3 ±12.5 a Pseudomonas sp. 1x ± 9.0 ab 30.2 ±3.5 ef 15.1 ±9.3 fgh 16.7 ± 9.3 ab 36.7 ± 3.0 abc 16.4 ±5.0 bc Pseudomonas sp. FC- 1x ±10.5 bcd 33.5 ±4.2 ab 28.2 ± 11.8 a FC-24B 24B 1x ±5.3 ab 51.1 ±2.7 ab 25.7 ±4.2 abcde 11.7 ±6.4 ab 41.5 ±4.2 abc 20.3 ± 5.8 abc 1x ±8.8 abc 29.5 ±3.5 abc 26.6 ± 12.6 a Cedomon - P. 7.5x ± 3.0 a 53.0 ± 2.4 ab 29.5 ±6.9 ab 16.7 ±9.0 ab 40.5 ±4.4 abc 20.0 ±8.9 abc Cedomon - P. 7.5x ±9.1de 19.8 ±2.6 cd 11.5 ±3.2 b chlororaphis chlororaphis Rootshield - T. 3x ± 9.3 ab 26.9 ±3.5 ef 14.1 ±7.4 gh 11.7 ± 5.4 ab 44.5 ±1.7 ab 18.9 ±4.4 abc Rootshield - T. 3x ±5.0 ab 29.7 ± 2.4 abc 23.2 ±12.6 ab harzianum harzianum Inoculated control ± 10.0 c 18.4 ± 4.1 f 10.6 ±10.0 h 63.3 ±10.0 c 19.6 ±3.3 d 8.5 ± 2.9 d Inoculated control ±5.7 e 15.5 ±2.5 d 11.1 ±9.5 b Non-inoculated control ±a 35.7 ± 1.1 cde 19.0 ±5.0 cdefgh 0.0 a 46.8 ±0.9 ab 21.1 ± 4.5 abc Non-inoculated control ±a 35.6 ± 3.1 a 27.7 ± 18.2 a Values followed by different letters within a column differ significantly (Duncan test p<0.05) ** Bacterial antagonists were applied by root dipping in this trial (Trial VII), whereas in the other trials they were added to the soil Journal of Plant Pathology (2009), 91 (1), Srinivasan et al. 151

6 152 Suppression of Fusarium wilt of tomato Journal of Plant Pathology (2009), 91 (1), Effect against Fusarium wilt of soil application of bacterial strains. In trial II, a soil mix containing bacteria and inoculum of F. oxysporum f. sp. lycopersici gave the lowest disease incidence (ranging from 3.3 to 50.0) compared with the untreated control (58.3). Among different bacterial strains, P. putida FC-6B at 10 8 cfu ml -1 significantly reduced the disease incidence to 3.3. The highest plant biomass (44.4 g) was observed with the application of Pseudomonas sp. FC-24B at 10 7 cfu ml -1 while the untreated control weighed only 24.8 g (Table 2, trial II). In trial III, all treatments showed gave significant disease incidence reduction (3.3 to 23.3), and increased plant height (34.5 to 46.6 cm) and total biomass (27.6 to 50.3 g) compared with the untreated control (disease incidence 56.7; plant height 22.3 cm; total biomass: 21.9 g). The lowest disease incidence (3.3) was recorded with two applications of P. putida FC-6B and FC-8B at 10 7 cfu ml -1 and P. chlororaphis MA 342 at 7.5x10 6 cfu ml -1. P. putida FC-8B (10 7 cfu ml -1 ) treatment greatly increased the total biomass (50.3 g) compared with all other treatments. However, the plant height did not show any significant difference between bacterial treatments (Table 2, trial III). The results of trials II and III showed that two applications of bacterial strains, as in trial III, more effectively reduced the Fusarium wilt and increased the plant growth when compared to a single application. Bacterial strains, applied 7 days before pathogen inoculation, significantly reduced disease incidence (ranging from 6.7 to 38.3) compared with the untreated control (61.7). Among the different bacteria tested, P. putida FC-8B at 10 7 cfu ml -1 significantly reduced the disease incidence to 6.7. While there was a significant difference between bacteria-treated and untreated plants in terms of plant height and biomass, no significant differences were observed between different bacterial treatments (Table 2, trial IV). In trial V, all the bacterial treatments and commercial bioproducts induced a lower disease incidence, ranging from 5.0 to 31.7, while the untreated control showed the highest disease incidence of Application of P. putida FC-6B, Pseudomonas sp. FC-9B at 10 8 cfu ml -1 and P. chlororaphis MA 342 at 7.5x10 6 cfu ml -1 effectively reduced the disease incidence (5.0 to 6.7) when compared with other treatments (Table 2, trial V). In trial VI, the highest disease reduction was recorded in all bacterial treatments (disease incidence ranging from 8.3 to 23.3) where the untreated control recorded the highest incidence of In this trial, two applications of Pseudomonas sp. FC-7B at 10 8 cfu ml -1 significantly reduced the disease incidence to 8.3 when compared with other treatments, including the untreated control (Table 2, trial VI). Application of bacteria by root dipping significantly reduced disease incidence (ranging from 20.0 to 55.0) compared with the untreated control ( 68.3). Among different treatments, Pseudomonas sp. FC-9B (10 9 cfu ml -1 ) and soil application of T. harzianum T22 (3x10 6 cfu ml -1 ) gave the lowest disease incidence of Furthermore, the same bacterial strain (FC-9B; 10 9 cfu ml -1 ) significantly increased plant height (33.9 cm) and biomass (28.3 g) (Table 2, trial VII). Overall analysis of all trials showed that two applications of bacteria (at 0 and 7 days) with pathogen inoculation on day 0 effectively reduced the disease when compared with other methods of application. In all trials, the highest plant growth parameters were found in all the bacterial treatments compared with untreated controls. Soil application of the bacteria more effectively reduced Fusarium wilt when compared to root dipping with antagonists. Furthermore, all trials indicated that the bacterial strains isolated from the soilless substrates have potential biocontrol activity against Fusarium wilt on tomato similar to that of the disease-suppressive soil isolates and commercial products tested. SCUSSION Biological control is one of several strategies with the potential to reduce the severity of many plant diseases. Biocontrol strains can also promote plant growth and therefore increase the economic return. So far, several biocontrol agents including P. fluorescens, P. putida, T. harzianum and B. subtilis have been exploited in the management of soil-borne diseases (Ongena et al., 1999; Fahri and Murat, 2007; Jayaraj et al., 2007). Recently, Garibaldi et al. (2003) reported the efficacy of some selected antagonists including Trichoderma spp. and Fusarium spp. against Phytophthora cryptogea on gerbera in closed soilless systems. This indicated the existence and survival of several beneficial microorganisms in a soilless crop system. Thus, in the current study, the bacterial strains isolated from the recycled soilless substrates and suppressive soils were tested against Fusarium wilt on tomato. All the bacteria increased plant growth and did not exhibit any inhibitory effect on tomato plants. The bacteria effectively reduced Fusarium wilt incidence on tomato under glasshouse conditions. All strains isolated from used rockwool soilless substrates (Minuto et al., 2007) were identified as members of the genus Pseudomonas. Recently, Koohakan et al. (2004) reported high population densities of fluorescent pseudomonads in soilless crop systems. The treatments used in the present study performed well but with different degrees of disease control. Comparing soil incorporation and root dip application methods, soil application significantly reduced disease incidence and improved plant growth to a greater degree than root dipping. In addition, both co- and pre-treatment with antagonists effectively reduced wilt incidence. This suggests that antagonists could compete for nutrients with the pathogen and/or inhibit chlamydospore germination and thereby reduce disease. Sapro-

7 Journal of Plant Pathology (2009), 91 (1), Srinivasan et al. 153 phytic competition for nutrients, parasitic competition for infection sites and induced resistance in host cells have been described in the biological control of Fusarium wilt diseases by several authors (De Boer et al., 2003; Haas and Defago, 2005; Nel et al., 2006). The lowest disease incidence was recorded with a single application of P. putida FC-6B (10 8 cfu ml -1 ) in trial II and two applications of P. putida FC-6B and FC- 8B (10 7 cfu ml -1 ) and P. chlororaphis MA 342 (7.5x10 6 cfu ml -1 ) in trial III. This suggests that either an increased number of bacterial cells or the frequency of application could reduce the pathogen more effectively compared with a lower number of bacterial cells and less frequent application. The biocontrol potential of P. putida has been reported by several authors (De Boer et al., 2003; Bora et al., 2004; Akkopru and Demir, 2005). The results of the current study support earlier findings on biological control in tomato and other crops in the field (Larkin et al., 1996; Mujeebur and Shahana, 2002; Gilardi et al., 2007; Moretti et al., 2008). Furthermore, bacterial treatment, especially with P. putida FC-6B and FC-8B, significantly increased plant growth when compared with untreated and healthy controls. This improved plant growth may be attributed to the production of plant growth promoting substances. In fact, it has been reported that biocontrol agents having both antagonistic and plant growth promoting activity could be more effective in controlling plant diseases (Akkopru and Demir, 2005; Borrero et al., 2006). Likewise, it has been suggested that plant growth promotion could be associated with the secretion of auxins, gibberellins and cytokinins by bacterial antagonists (Ramamoorthy et al., 2001; Siddiqui, 2004) and suppression of deleterious microorganisms in the rhizosphere (Gamliel and Katan, 1993; Sabuquillo et al., 2006). In conclusion, all bacteria isolated from soilless substrates proved their biocontrol potential, showing significant disease control and plant growth promotion on tomato. In particular, P. putida FC-6B and FC-8B and Pseudomonas sp. FC-9B were superior in disease control and plant growth promotion under glasshouse conditions. Thus, P. putida FC-6B and FC-8B and Pseudomonas sp. FC-9B are being developed as biocontrol agents. Further work is in progress with these strains to elucidate the specific mechanisms of action against Fusarium wilt on tomato. In addition, the present findings improve our ability to develop bacterial mixtures with these strains for possible improved control of Fusarium wilt of tomato in the future. AKNOWLEDGEMENTS This research was supported by the Italian Ministry of University and Research (MIUR), the Indian Ministry of Science and Technology and by the Programma regionale di ricerca, sperimentazione e dimostrazione : Difesa ecocompatibile di pomodoro (cv. Cuore di bue) e lattuga allevate in fuorisuolo in Piemonte. REFERENCES Akkopru A., Demir S., Biological control of Fusarium wilt in tomato caused by Fusarium oxysporum f. sp. lycopersici by AMF Glomus intraradices and some rhizobacteria. Journal of Phytopathology 153: Alabouvette C., Fusarium wilt suppressive soils: an example of disease-suppressive soils. Australasian Plant Pathology 28: Bora T., Ozaktan H., Gore E., Aslan E., Biological control of Fusarium oxysporum f. sp. melonis by wettable powder formulations of the two strains of Pseudomonas putida. Journal of Phytopathology 152: Borrero C., Trillas M.I., Ordovas J., Tello J.C., Aviles M., Predictive factors for the suppression of Fusarium wilt of tomato in plant growth media. Phytopathology 94: Borrero C., Ordovas J., Trillas M.I., Aviles M., Tomato Fusarium wilt suppressiveness. The relationship between the organic plant growth media and their microbial communities as characterised by Biolog. Soil Biology and Biochemistry 38: De Boer M., Bom P., Kindt F., Keurentjes J.J.B., van der Sluis I., van Loon L.C., Bakker P.A.H.M., Control of Fusarium wilt of radish by combining Pseudomonas putida strains that have different disease suppressive mechanisms. Phytopathology 93: Fahri Y., Murat D., Control of Fusarium wilt of tomato by combination of Fluorescent Pseudomonas, nonpathogen Fusarium and Trichoderma hazianum T22 in greenhouse conditions. Plant Pathology Journal 6: FAO, World Agriculture Information Center Database. Rome, Italy. 13 February ( Fao.org/waicent/portal/ statistics_en.asp). Fuchs J.G., Moenne-Loccoz Y., Defago G., Ability of nonpathogenic Fusarium oxysporum Fo47 to protect tomato against Fusarium wilt. Biological Control 14: Gamliel A., Katan J., Suppression of major and minor pathogens by fluorescent Pseudomonads in solarised and non-solarised soil. Phytopathology 83: Garibaldi A., Minuto A., Grasso V., Gullino M.L., Application of selected antagonistic strains against Phytophthora cryptogea on gerbera in closed soilless systems with disinfection by slow sand filtration. Crop Protection 22: Gilardi G., Garibaldi A., Gullino, M.L., Effect of antagonistic Fusarium spp. and of different commercial biofungicide formulations on Fusarium wilt of lettuce. Phytoparasitica 35: Gullino M.L., Camponogara A., Gasparrini G., Rizzo V., Clini C., Garibaldi A., Replacing methyl bromide for soil disinfestation: the Italian experience and the implications for other countries. Plant Disease 87:

8 154 Suppression of Fusarium wilt of tomato Journal of Plant Pathology (2009), 91 (1), Hass D., Defago G., Biological control of soil-borne pathogens by fluorescent Pseudomonads. Nature Review of Microbiology 3: Jayaraj J., Parthasarathi T., Radhakrishnan N.V., Characterization of a Pseudomonas fluorescens strain from tomato rhizosphere and its use for integrated management of tomato damping-off. BioControl 52: Komada H., Development of a selective medium for quantitative isolation of Fusarium oxysporum from natural soil. Review of Plant Protection Research 8: Koohakan P., Ikeda H., Jeanaksorn T., Tojo M., Kusakari S., Okada K., Sato S., Evaluation of the indigenous microorganisms in soilless culture: occurrence and quantitative characteristics in the different growing systems. Scientia Horticulturae 101: Larkin R.P., Hopkins D.L., Martin F.N., Suppression of Fusarium wilt of watermelon by non-pathogenic Fusarium oxysporum and other microorganisms recovered from a disease suppressive soil. Phytopathology 86: Locke T., Colhoun J., Contribution to a method of testing oil palm seedlings for resistance to Fusarium oxysporum f. sp. elaeidis Toovey. Journal of Phytopathology 79: Miller H., Practical aspects of preparing phage and plasmid DNA: growth, maintenance, and storage of bacteria and bacteriophage. Methods in Enzymology 152: Minuto A., Clematis F., Gullino M.L., Garibaldi A., Induced suppressiveness to Fusarium oxysporum f. sp. radicis lycopersici in rockwool substrate used in closed soilless systems. Phytoparasitica 35: Moretti M., Gilardi G., Gullino M.L., Garibaldi A., Biological control potential of Achromobacter xylosoxydans for suppressing Fusarium wilt of tomato. International Journal of Botany 4: Mujeebur R.K., Shahana M.K., Effects of root-dip treatment with certain phosphate solubilizing microorganisms on the fusarial wilt of tomato. BioResource Technology 85: Nel B., Steinberg C., Labuschagne N., Vilioen A., The potential of non-pathogenic Fusarium oxysporum and other biological control organisms for suppressing Fusarium wilt of banana. Plant Pathology 55: Ongena M., Daay F., Jacques P., Thonart P., Benhamou N., Paulitz T.C., Cornelis P., Koedam N.M., Belanger R.R., Protection of cucumber against Pythium root rot by fluorescent Pseudomonads: Predominant role of induced resistance over siderophores and antibiosis. Plant Pathology 48: Postma J., Rattink H., Biological control of Fusarium wilt of carnation with a nonpathogenic isolate of Fusarium oxysporum. Canadian Journal of Botany 70: Postma J., Willemsen-de Klein M.J.E.I.M., van Elsas J.D., Effect of the indigenous microflora on the development of root and crown rot caused by Pythium aphanidermatum in cucumber grown on rockwool. Phytopathology 90: Postma J., Willemsen-de Klein M.J.E.I.M., Rattink H., van Os E.A., Disease suppressive soilless culture systems; characterization of its microflora. Acta Horticulturae 554: Ramamoorthy V., Raguchander T., Samiyappan R., Induction of systemic resistance by plant growth promoting rhizobacteria in crop plants against pests and diseases. Crop Protection 20: Sabuquillo P., De Cal A., Melgarejo P., Biocontrol of tomato wilt by Penicillium oxalicum formulations in different crop conditions. Biological Control 37: Siddiqui Z.A., Effects of plant growth promoting bacteria and composted organic fertilizers on the reproduction of Meloidogyne incognita and tomato growth. BioResource Technology 95: Received September 11, 2008 Accepted November 3, 2008