Phytochemistry 70 (2009) Contents lists available at ScienceDirect. Phytochemistry. journal homepage:

Transcription

1 Phytochemistry 70 (2009) Contents lists available at ScienceDirect Phytochemistry journal homepage: Gene expression changes related to the production of phenolic compounds in potato tubers grown under drought stress Christelle M. André a,b, Roland Schafleitner c, Sylvain Legay a, Isabelle Lefèvre a, Carlos A. Alvarado Aliaga c, Giannina Nomberto c, Lucien Hoffmann a, Jean-François Hausman a, Yvan Larondelle b, Danièle Evers a, * a Department Environment and Agro-Biotechnologies, Centre de Recherche Public-Gabriel Lippmann, Rue du Brill, 41, L-4422 Belvaux, Luxembourg b Institut des Sciences de la Vie, Université Catholique de Louvain, Croix du Sud 2/8, B-1348 Louvain-La-Neuve, Belgium c Germplasm Enhancement and Crop Improvement Division, International Potato Center, Avenida La Molina 1895, Apartado 1558, La Molina, Lima 12, Peru article info abstract Article history: Received 19 December 2008 Received in revised form 6 July 2009 Available online 5 August 2009 Keywords: Potato Andean tuber Solanum tuberosum Antioxidant Polyphenols Chlorogenic acid Gene expression Real-time RT-PCR PAL Phenylpropanoid Drought Genotype Polyphenols represent a large family of plant secondary metabolites implicated in the prevention of various diseases such as cancers and cardiovascular diseases. The potato is a significant source of polyphenols in the human diet. In this study, we examined the expression of thirteen genes involved in the biosynthesis of polyphenols in potato tubers using real-time RT-PCR. A selection of five field grown native Andean cultivars, presenting contrasting polyphenol profiles, was used. Moreover, we investigated the expression of the genes after a drought exposure. We concluded that the diverse polyphenolic profiles are correlated to variations in gene expression profiles. The drought-induced variations of the gene expression was highly cultivar-specific. In the three anthocyanin-containing cultivars, gene expression was coordinated and reflected at the metabolite level supporting a hypothesis that regulation of gene expression plays an essential role in the potato polyphenol production. We proposed that the altered sucrose flux induced by the drought stress is partly responsible for the changes in gene expression. This study provides information on key polyphenol biosynthetic and regulatory genes, which could be useful in the development of potato varieties with enhanced health and nutritional benefits. Ó 2009 Elsevier Ltd. All rights reserved. 1. Introduction Abbreviations: CIP, International Potato Center; ROS, reactive oxygen species; EF1-a, elongation factor 1-a; PAL, phenylalanine ammonia-lyase; C4H, cinnamic acid 4-hydroxylase; 4CL, 4-coumaroyl:CoA-ligase; HCT, hydroxycinnamoylcoenzyme A shikimate/quinate hydroxycinnamoyl transferase; C3H, p-coumarate 3-hydroxylase; HQT, hydroxycinnamoylcoenzyme A quinate hydroxycinnamoyl transferase; CHS, chalcone synthase; CHI, chalcone isomerase; F3H, flavanone 3-hydroxylase; F3 0 H, flavonoid 3 0 hydroxylase; F H, flavonoid hydroxylase; FLS, flavonol synthase; DFR, dihydroflavonol 4-reductase; ANS, anthocyanidin synthase; AN1, anthocyanin 1; AN2, anthocyanin 2. * Corresponding author. Tel.: ; fax: address: evers@lippmann.lu (D. Evers). The staple crop potato (Solanum tuberosum L.) is recognized as a source of health-promoting antioxidants for human diet (Lachman et al., 2000; Brown, 2005; Andre et al., 2007a). Potato tubers contain significant amounts of polyphenols, mainly chlorogenic acid, as well as anthocyanins such as petanin in purple cultivars. Flavonols such as rutin and kaempferol-3-rutinoside also occur in potato, though to a lesser extent (Andre et al., 2007b). Polyphenol compounds have received increasing interest due to their prospective beneficial effects on human health, with roles in the prevention of diseases such as cardiovascular diseases, cancers, neurodegenerative diseases, osteoporosis, or diabetes (Arts and Hollman, 2005; Stevenson and Hurst, 2007). Chlorogenic acid has been shown to inhibit the oxidation of human low-density lipoproteins (LDL) (Meyer et al., 1998), which is recognized as an early event in the pathogenesis of atherosclerosis (Pryor, 2000). Furthermore, chlorogenic acid has been reported to decrease the incidence of cancers in animal models (Kasai et al., 2000) and to inhibit the proliferation of human cancer cells (Feng et al., 2005). The consumption of the anthocyanin petanin through purple potato flakes has also recently been shown to improve the antioxidant status in the serum and liver of cholesterol-fed rats possibly through the enhancement of the expression of some hepatic antioxidant enzymes (Han et al., 2007). Polyphenol compounds are produced in plants through the phenylpropanoid pathway and represent a large family of low molecular weight plant secondary metabolites. The phenylpropanoid metabolism transforms phenylalanine, the branch point substrate between primary and secondary metabolism, into a variety of molecules, including lignins, phenolic acids such as benzoic /$ - see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi: /j.phytochem

2 1108 C.M. André et al. / Phytochemistry 70 (2009) and hydroxycinnamic acids, flavonoids such as flavonols and anthocyanins, stilbenes, and lignans (Boudet, 2007). Phenylpropanoids are constitutively produced in plant specific tissues and cell types, acting as phytoalexins, UV sunscreens, pigments, signaling molecules, and major structural components. Synthesis of polyphenol compounds is also induced in response to biotic and abiotic stimuli such as UV-B radiation, drought, chilling, ozone, heavy metals, attack by pathogens, wounding, or nutrient deficiency (Dixon and Paiva, 1995; Grace, 2005). Polyphenols may act as antioxidants to protect the plant against oxidative stress (Grace, 2005). Routes to the major classes of polyphenol compounds involve (i) the core phenylpropanoid pathway from phenylalanine to an activated (hydroxy) cinnamic acid derivative via the actions of phenylalanine-ammonia-lyase (PAL), cinnamate 4-hydroxylase (C4H, a cytochrome P450) and 4-coumarate-CoA ligase (4CL) (Fig. 1), as well as specific branch pathways for the formation of (ii) simple esters and lignins, (iii) flavonoids, and (iv) stilbenes. The biosynthetic pathway for generating chlorogenic acid (ester of caffeic and quinic acid) is still unclear as three routes may lead to its production (Fig. 1). In Solanaceous species, recent findings have shown that the accumulation of chlorogenic acid involves the enzyme hydroxycinnamoylcoenzyme A quinate hydroxycinnamoyl transferase (HQT) (Niggeweg et al., 2004). Gene-silencing showed that HQT is required for chlorogenic acid synthesis since a reduction of 98% of chlorogenic acid was observed in transformed tomato plants (Niggeweg et al., 2004). However, it is not known whether HQT synthesizes chlorogenic acid directly from caffeoyl CoA (route B, Fig. 1), or if HQT produces p-coumaroyl quinate from p-coumaroyl CoA and quinic acid, which is then converted by p- coumarate 3-hydroxylase (C3H) to chlorogenic acid (route A, Fig. 1). Recently, the enzymes hydroxycinnamoylcoenzyme A shikimate hydroxycinnamoyl transferase (HCT) (Hoffmann et al., 2003) and p-coumarate 3-hydroxylase (C3H) (Schoch et al., 2001) were shown to be active in non-chlorogenic acid-accumulating species such as Arabidopsis thaliana and alfalfa (Shadle et al., 2007) where they contribute to lignin biosynthesis. In sweet potato, a caffeoyl glucoside has been proposed as an alternative intermediate to chlorogenic acid synthesis (Villegas and Kojima, 1986) (route C, Fig. 1). The flavonoid pathway is initiated by condensation of p-coumaroyl CoA with three molecules of malonyl-coa (coming from the carbohydrate metabolism) (Fig. 1). Naringenin chalcone is rapidly isomerized by the enzyme chalcone isomerase (CHI) to form naringenin. Flavanone 3-hydroxylase (F3H) may subsequently hydroxylate this compound to produce the dihydroflavonol, dihydrokaempferol, which can be further hydroxylated by flavonoid 3 0 hydroxylase (F3 0 H) to form dihydroquercetin. Hydroxylation at the 3 0 and 5 0 positions of the B-ring of dihydrokaempferol (by the flavonoid hydroxylase, F H) leads to the production of dihydromyrecitin, the substrate of delphinidin-based anthocyanins. Dihydrokaempferol and dihydroquercetin are substrates of flavonol synthase (FLS), which catalyzes the production of the flavonols kaempferol and quercetin, respectively. Alternatively, the dihydroflavonols can be reduced to leucoanthocyanidins via the action of dihydroflavonol 4-reductase (DFR), and further converted to anthocyanidins through the enzyme anthocyanidin synthase (ANS) (Schijlen et al., 2004; Bovy et al., 2007; Boudet, 2007). The wide range of chemical structures among flavonoids is due to terminal modifications, including regio-specific hydroxylation, glycosylation, acylation, methylation, Fig. 1. Schematic overview of the polyphenol biosynthetic pathway, starting with the core phenylpropanoid pathway and leading to flavonoid and chlorogenic acid synthesis. Three possible routes (A, B, and C) have been proposed for chlorogenic acid formation. Genes under investigation in the present study are in blue boxes. Abbreviations: PAL, phenylalanine ammonia-lyase; C4H, cinnamic acid 4-hydroxylase; 4CL, 4-coumaroyl:CoA-ligase; HCT, hydroxycinnamoylcoenzyme A shikimate hydroxycinnamoyl transferase; C3H, p-coumarate 3-hydroxylase; HQT, hydroxycinnamoylcoenzyme A quinate hydroxycinnamoyl transferase; UGCT, UDP glucose:cinnamate glucosyl transferase; HCGQT, hydroxycinnamoyl D-glucose:quinate hydrocinnamoyltransferase; CHS, chalcone synthase; CHI, chalcone isomerase; F3H, flavanone 3-hydroxylase; F3 0 H, flavonoid 3 0 hydroxylase; F H, flavonoid hydroxylase; FLS, flavonol synthase; DFR, dihydroflavonol 4-reductase; ANS, anthocyanidin synthase; AN1, anthocyanin 1 transcription factor; AN2, anthocyanin 2 transcription factor.

3 C.M. André et al. / Phytochemistry 70 (2009) prenylation, and sulfation (Dixon and Paiva, 1995; Winkel-Shirley, 2001). The transcription factors regulating the expression of these structural genes have been well characterized in certain plant species (Bovy et al., 2007; Boudet, 2007). Only few studies have yet reported on their regulation in potato (Dejong et al., 2004, 2006; Zhang et al., 2009). Furthermore, the carbohydrate status of the plant may modulate the expression of several genes including some of the polyphenolic biosynthetic pathway (Koch, 1996). Sucrose-induced anthocyanin accumulation has been observed in many plant species such as Petunia (Weiss, 2000) or A. thaliana (Teng et al., 2005). Sucrose has also been shown to stimulate chlorogenic acid synthesis in tomato leaves (Grace and Logan, 2000). The potato germplasm displays a remarkably high diversity in terms of their polyphenolic content and profile (Andre et al., 2007b). However, little is known on the underlying molecular mechanisms, which could explain these biochemical differences. Furthermore, environmental stress such as drought during the tuber development may influence the polyphenol biosynthetic pathway. Watkinson et al. (2006) showed that the expression of some flavonoid biosynthetic genes was affected in potato tubers under drought exposure. In the present study, five native Andean potato cultivars were selected on the basis of their contrasting polyphenol profile. We have previously reported on the impact of drought on polyphenol contents (Andre et al., 2009). Here, we present data on the expression level of polyphenol biosynthetic and regulatory genes among the five genotypes and determine whether the variations in gene expression correlate with changes in polyphenolic metabolites. 2. Results 2.1. Expression of polyphenol-related genes under control growth conditions The five selected Andean potato cultivars included the yellowskinned and -fleshed cultivars Sipancachi and SS-2613, the purple-skinned and yellow-fleshed Huata Colorada, the partly redfleshed Sullu, and the dark purple-skinned and -fleshed Guincho Negra (Fig. 2). Transcript levels of genes encoding thirteen key structural and regulatory enzymes of the polyphenol biosynthetic pathway were examined both at day 0 and day 15 after harvest (Fig. 3). Gene expression was evaluated based on public available gene sequences using primers designed to target multiple close gene sequences from the same family rather than one specific sequence, as most of the genes exist in several copies. For example, potato contains phenylalanine ammonia-lyase (PAL) genes, commonly divided in two subfamilies PAL-1 and PAL-2. Our primers were designed to detect the level of total PAL transcripts rather than the expression of specific PAL-1 or PAL-2 related genes; a similar approach was used for the other genes. Total chlorogenic acids (the sum of the contents of neo-, crypto-, and chlorogenic acids), total flavonols (the sum of the contents of quercetin- and kaempferol-3-rutinoside), as well as total anthocyanins were determined in 15-day tubers of the five cultivars under investigation. Moreover, precise compositional results, previously described in Andre et al. (2009), are compared with the expression levels of the polyphenol biosynthetic genes (Fig. 3) The core phenylpropanoid pathway Among the genes investigated in the present study, genes encoding PAL and C4H, the two first steps of the phenylpropanoid pathway, were the most strongly expressed (Fig. 3). The relative expression of PAL was much higher in the red- and purple-fleshed cultivars, Sullu and Guincho Negra, respectively, as compared to their yellow-fleshed counterparts, SS-2613, Sipancachi, and Huata Colorada. The expression profile of the C4H gene in 0-day tubers varied to a lesser extent than the PAL gene among the genotypes, with a relative 15-fold increase between Sullu and Sipancachi. After 15 days, PAL gene expression was decreased in Guincho Negra and Sullu and increased in SS-2613, Sipancachi, and Huata Colorada as compared to expression at harvest, mitigating to a large extent the differences between cultivars. After 15 days, the range of the expression level of the C4H gene between cultivars was also less pronounced. No significant relationship was found between the expression patterns of C4H and PAL genes (= 0.46 and 0.05 in 0-day and 15-day tubers, respectively), suggesting that these genes are not regulated in a coordinated manner. The expression of the PAL gene at 0 and 15 day, appeared to be positively linked with total anthocyanins. In addition, total chlorogenic acid content was the highest in the cultivar presenting the highest PAL expression level, Guincho Negra. However, such correlation did not occur in other cultivars. Interestingly, the correlation between total chlorogenic acids and PAL expression level appeared to be stronger when 0-day instead of 15-day expression values were considered. No correspondence was found between total flavonols and the expression of the PAL gene, whatever the sampling time The chlorogenic acid pathway HQT, acting on the primary route of chlorogenic acid synthesis in Solanaceous species, was highly expressed in 0-day tubers of all cultivars under investigation (Fig. 3B). The 0-day expression level of the HCT gene was 7.8-fold higher in Guincho Negra than in Sipancachi while intermediate levels were observed for the other cultivars. The expression pattern was similar for the C3H gene (r C3H HCT = 0.99). After 15 days of storage, the expression pattern of the HQT was similar to that described in 0-day tubers, except for SS-2613, for which transcript levels were higher after 15 days. While the transcript levels of the HCT gene decreased after 15 days in all cultivars except Sipancachi, a drastic increase in C3H was observed in all cultivars. Moreover, 15-day expression profiles of HCT and C3H were not correlated (r C3H HCT = 0.07). Expression pattern of the HQT, HCT, and C3H genes at the time of metabolite sampling was weakly correlated to the total chlorogenic acid content found in tubers. In contrast, a strong and positive relationship was found between total chlorogenic acids and the 0-day expression level of the HCT and C3H genes (Fig. 3B) The flavonoid pathway The 0-day expression level of FLS, the enzyme that catalyzes the formation of flavonols (e.g. quercetin and kaempferol), was below the detection limit in all cultivars. Other flavonoid pathway related genes were expressed to a greater extent in the high anthocyaninproducing cultivars Sullu and Guincho Negra in comparison to the low- or non-producing ones, except for the genes encoding F3 0 H and AN2 (Fig. 3C). Among the three low or non-anthocyanin-producing cultivars, Huata Colorada, purple-skinned, expressed the CHS and F3H genes to a higher extent than the yellow-skinned cultivars SS-2613 and Sipancachi. Genes encoding the first three steps of the flavonoid pathway (CHS, CHI, and F3H) were 596-times, 26- times, and 784-times more expressed in Guincho Negra than in Sipancachi. Moreover, the expression of these three genes was highly correlated (r CHS CHI = 0.96, r CHS F3H = 0.99, r F3H CHI = 0.94). DFR and AN1 (a transcription factor) expression was only detected in the three anthocyanin-containing cultivars and were 40- to 145- fold higher in Sullu and Guincho Negra than in Huata Colorada. In contrast, the AN2 gene was expressed in all cultivars at similar levels, except for SS-2613, where its expression was around 40-times

4 1110 C.M. André et al. / Phytochemistry 70 (2009) Fig. 2. Tubers from the five native Andean potato cultivars under investigation: Sipancachi (A), SS-2613 (B), Huata Colorada (C), Sullu (D), and Guincho Negra (E). lower than in the other clones. Expression profiles of DFR and AN1 genes were highly and positively correlated with each other (r DFR AN1 = 0.998). DFR was also correlated with CHS, CHI, and F3H gene expressions (r DFR > 0.87). Similar expression profiles were observed for the cultivars at 15 day storage and day 0. However, most of the flavonoid pathway genes had higher transcript levels at 15 day storage as compared to day 0 (Fig. 3C), except for the AN1 gene. Interestingly, FLS transcripts were detected after 15 days, while undetectable in 0-day tubers. Total anthocyanin content appeared highly associated to the 0- day and 15-day expression of CHS, CHI, F3H, DFR, and AN1 genes (Fig. 3C). Interestingly, the CHI transcript level at day 15 was elevated in the high flavonol-accumulating yellow cultivar SS The flavonol contents were also correlated with FLS transcript levels in 15-day tubers (Fig. 3C) The polyphenol biosynthetic pathway under drought conditions All genes under investigation responded to some extent to drought but the range of induction or repression of gene expression was highly cultivar-dependent (Fig. 4A). While gene expression variations between control and drought-exposed tubers were also present after 15 days of storage (10 C in the dark), the transcript levels did not vary to the same extent than at day 0 (Fig. 4B). Drought-induced effects on polyphenol contents were investigated in 15-day tubers (Andre et al., 2009) and the major changes are summarized in Table The core phenylpropanoid pathway Core phenylpropanoid biosynthesis genes were mainly repressed in tubers from plants exposed to drought (Fig. 4). PAL was repressed in all cultivars except in Huata Colorada, where it remained unchanged in 0-day tubers and appeared induced after 15 days of storage. C4H was strongly repressed in all genotypes on day 15, while on day 0 it was significantly induced in Sullu and repressed in Sipancachi. In Guincho Negra, Sullu, and SS-2613, a concomitant decrease of the expression of PAL gene and of the polyphenol contents was observed. This correspondence is stronger when the 0-day expression values are considered. In Huata Colorada, the increased expression of the PAL was also corroborated by the increase of polyphenol content, but this observation was more evident with 15-day transcript values The chlorogenic acid pathway Expression changes of genes involved in chlorogenic acid biosynthesis were strongly clone- and time-point dependent. At harvest, HCT and C3H genes were induced in drought-exposed tubers of all cultivars except in Guincho Negra. HQT expression was up-regulated in this cultivar and in Sullu, whereas it was reduced in SS-2613 and Huata Colorada. The elevated expression level of the HCT and C3H genes was still obvious following 15 days of storage in Huata Colorada. The down-regulation of the same genes in Guincho Negra was much less pronounced in 15-day tubers, as compared to 0-day. The expression level of HCT and C3H genes observed in Guincho Negra (decrease) and Huata Colorada (increase) was in agreement with the levels of chlorogenic acid observed upon drought in these cultivars (Table 2) The flavonoid pathway The expression of all flavonoid biosynthetic genes, except F3 0 H and AN2, was repressed upon drought in 0-day tubers of Guincho Negra and Sullu. In comparison, transcript levels of the same genes were up-regulated in Huata Colorada. In Guincho Negra and Sullu, the drought-induced down-regulation of CHS, CHI, and F3H disappeared after 15 days of storage. The AN1 gene was however still down-regulated in these cultivars following storage, while F3 0 H, FLS, and AN2 genes were up-regulated. Up-regulated flavonoid pathway genes in Huata Colorada was still evident following 15 days of storage. The repression of transcripts from the flavonoid biosynthetic pathway in Guincho Negra and Sullu correlated well with their decreased anthocyanin contents (Table 2), whereas no relationship was found for 15-day expression values. The elevated expression levels of flavonoid biosynthetic genes in Huata Colorada, observed both at 0 and 15 day, was also reflected by the increase in total anthocyanin contents caused by drought stress.

5 C.M. André et al. / Phytochemistry 70 (2009) Fig. 3. Constitutive expression levels of polyphenol biosynthetic genes including the core phenylpropanoid pathway (A), the chlorogenic acid pathway (B), and the flavonoid pathway (C) in control 0-day and 15-day tubers of the five native Andean potato cultivars. Regions in black frames are enlarged in B 0 and C 0. Gene expression levels were expressed as normalized relative quantities of transcript (NRQ) and were calculated as described in Section 5. Mean values were obtained from three biological replicates, each assayed in triplicate. Error bars represent standard errors. NRQ are compared with the relative polyphenol level determined in 15-day tubers of the five. Data are expressed in relation to the highest value within each variable. Abbreviations: CGA, total chlorogenic acid; Flavo, total flavonols; Antho, total anthocyanins Effect of drought on soluble carbohydrate contents Sucrose was the predominant soluble carbohydrate found in potato tubers (Table 3), followed by glucose, fructose, xylose, and galactose. In Guincho Negra and Sullu, drought stress drastically reduced the contents of all carbohydrates under investigation. Sipancachi was also affected by drought though to a lesser extent, presenting decreased levels of glucose and fructose only. In contrast, the contents of most carbohydrates were increased following drought exposure in Huata Colorada. 3. Discussion 3.1. Gene expression depends on the cultivar and correlates with polyphenolic profiles By measuring the expression levels of 13 genes related to the polyphenol biosynthetic pathway in five potato genotypes, we demonstrated that the polyphenolic profiles are to some extent correlated to variations in gene expression profiles. The gene expression profiles were quite similar in 0-day and 15-day tubers

6 1112 C.M. André et al. / Phytochemistry 70 (2009) Fig. 4. Drought-induced variations on 0-day (A) and 15-day (B) tubers of the five native Andean potato cultivars. Mean expression ratios (n = 3) are presented on a log 2 scale and were calculated as the ratio between the normalized relative expression of drought-stressed tubers and the one of control tubers (NRQ drought =NRQ control ). Error bars were omitted for more clarity. * Significant variation at the p < 0.05 level. (grown under normal conditions). Notable exceptions were the expression patterns of chlorogenic acid pathway and FLS genes, which were different between the two time points. In 0-day tubers, the expression of PAL gene from the core phenylpropanoid pathway, HCT and C3H genes from the chlorogenic acid pathway, and CHS, CHI, F3H, DFR, and AN1 genes from the flavonoid pathway, were coordinated and strongly correlated with the corresponding polyphenol levels. This observation was still evident in 15-day tubers, except for HCT and C3H. Interestingly, drought-induced changes of the expression of these eight genes in 0-day tubers were also directly related to variations of phenolic contents. The most striking results were Huata Colorada and the red- and purplefleshed Sullu and Guincho Negra tubers, which showed respectively activation and repression of the expression of these eight genes, changes also correlated with the respective metabolite levels. However, such a correlation was not observed after 15 days storage. Such results may be explained by the fact that dormant potato tubers are still metabolically active after harvest, albeit to a reduced extent, so that the metabolism reacts to the potential stressful conditions of harvest, transport, and storage at 10 C. The drought-induced variations are further altered by these conditions The production of polyphenols is partially regulated at the transcription level Constitutive and drought-induced expression profiles of PAL, HCT, C3H, CHS, CHI, F3H, DFR, and AN1 genes were coordinated and correlated with the polyphenol levels. This result suggests that the mechanisms of regulation of the proteins encoded by these eight genes are, at least in part, at the transcriptional level, which was less clear for C4H, HQT, F3 0 H, and AN2. The reasons for this could be either that (i) the proteins encoded by these four genes are controlled by post-transcriptional or post-translational modifications, (ii) other gene family members than the one amplified in this study are involved in the tuber polyphenol production, or (iii) their levels are sufficient to allow the pathway to operate without coordinated regulation. HQT has been shown to be the principal route for accumulation of chlorogenic acid in Solanaceous species (Niggeweg et al., 2004). In addition to its enzymatic role in chlorogenic acid synthesis, HQT was found to be able to catalyze the inverse reaction, hydrolyzing chlorogenic acid to re-form caffeoyl-coa (Niggeweg et al., 2004), stressing the complexity of its regulation and its pivotal role in controlling the levels of chlorogenic acid. Chlorogenic acid can indeed be rapidly mobilized to form downstream phenylpropanoid products such as lignin or suberin. Over-expression of HQT in tomato was found to increase the chlorogenic acid content in the fruit, whereas HQT gene silencing caused a reduction (Niggeweg et al., 2004). In the present study, the chlorogenic acid level was not correlated with the expression level of the HQT gene, whereas it was correlated with HCT and C3H, were correlated with the level of this phenolic acid. However, the expression profile for HQT showed that this gene is highly expressed in all cultivars. Our data thus suggest that the fine regulation of chlorogenic acid production may not be at the transcriptional level. The reversibility of the transferase reaction of HQT might be regulated according to the physiological state of the plant. In contrast to structural genes, AN1 and AN2 are two R2R3-MYB transcription factors involved in the regulation of anthocyanin gene transcription. MYB transcription factors are characterized by a structurally conserved DNA-binding domain consisting of single or multiple imperfect repeats. Many of those associated with the anthocyanin pathway are of the two-repeat (R2R3) class (Allan

7 C.M. André et al. / Phytochemistry 70 (2009) Table 1 Primer sequences of the polyphenol biosynthetic genes and two housekeeping genes (EF1-a and L2) used for real-time RT-PCR, together with the amplification length and the melting temperature (T m ) of the corresponding amplified product. Gene name Accession number Primer sequences Amplicon length Amplicon T m PAL BG Forward: ACGGGTTGCCATCTAATCTGACA Reverse: CGAGCAATAAGAAGCCATCGCAAT C4H BG Forward: CCCAGTTTTTGGAAATTGGCTTCA Reverse: GCCCCATTCTAAGCAAGAGAACATC HCT BQ Forward: TCTCCAACCCCTTTTAACGAACC Reverse: CAACTTGTCCTTCTACCACAGGGAA C3H BQ Forward: TTGGTGGCTACGACATTCCTAAGG Reverse: GGTCTGAACTCCAATGGGTTATTCC HQT BF Forward: CCCAATGGCTGGAAGATTAGCTA Reverse: CATGAATCACTTTCAGCCTCAACAA CHS BG Forward: CACCGTGGAGGAGTATCGTAAGGC Reverse: TGATCAACACAGTTGGAAGGCG CHI BG Forward: GGCAGGCCATTGAAAAGTTCC Reverse: CTAATCGTCAATGATCCAAGCGG F3H BQ Forward: CCAAGGCATGTGTGGATATGGACC Reverse: CCTGGATCAGTATGTCGTTCAGCC F3 0 H BQ Forward: TGCGTATACCCAAACTCATTCCG Reverse: AAAAGCCCAAAGTTGATGTGAAAGG FLS BG Forward: CCTCCTTCCTACAGGGAAGCAAA Reverse: CAAGCCCAAGTGACAAGCTCCTAA DFR BG Forward: TCACAGGAGCAGCTGGATTTATCG Reverse: TCAGGATCACGAACAGTAGCATGG AN1 DN Forward: CCTCAACCTCAGAAATTCAGAAGC Reverse: TCGTTGTTGTCGTTCGATGC AN2 DN Forward: ACAAGATGCCACTTTCCTTCACC Reverse: TGTGCATCGTTGGGAGTTAGG EF1-a AB Forward: ATTGGAAACGGATATGCTCCA Reverse: TCCTTACCTGAACGCCTGTCA L Forward: GGCGAAATGGGTCGTGTTAT Reverse: CATTTCTCTCGCCGAAATCG Table 2 Drought-induced variations on polyphenol contents in 15-day tubers from five native Andean potato cultivars. Adapted from Andre et al. (2009). Polyphenols Sipancachi SS-2613 Huata Colorada Sullu Guincho Negra Total chlorogenic acids ns ns a +62% 41% 54% Quercetin-3-rutinoside ns ns ns ns nd b Kaempferol-3-rutinoside ns 71% +192% 77% nd Total anthocyanins nd nd +58% 65% 32% a b ns = Not significant at the p < 0.05 level. nd = Compound not detected. Table 3 Carbohydrate contents in 15-day tubers from five native Andean cultivars field grown under control (C) or drought stress (D) conditions. Mean values are expressed in nmol/g of dry weight and were averaged from three samples (n = 3), each one corresponding to a different plant. Each sample was assayed in duplicate. Galactose Glucose Sucrose Xylose Fructose Total C D C D C D C D C D C D Sipancachi * 31,172 27, * 44,678 35,708 * SS ,271 31,274 39, ,972 80,697 Huata Colorada * 39,504 49,562 38,931 53,514 * * 28, , ,456 * Sullu * 16, * 23,413 18,343 * * * 47,021 20,364 * Guincho Negra * 28, * 41,297 33,254 * * 21, * 92,465 44,748 * * Significant effect of drought at the p < 0.05 level. et al., 2007). The closely related transcription factors, potato AN1 (AAX53087) and AN2 (AAX53091), were reported in Dejong et al. (2006) (referred to as pan1 and pan2) and share 62% of similarity. Interestingly, expression patterns described in that study were in general agreement with ours: AN1 gene was expressed in the colored tubers while AN2 was expressed irrespective of tuber color. It is noteworthy that these authors identified AN1 transcripts in the skin but not in the flesh of the tuber. These two tissues were not subjected to a separate analysis in the present work and would be important for future research. The expression of AN1 was

8 1114 C.M. André et al. / Phytochemistry 70 (2009) coordinated with the expression of the structural anthocyanin gene DFR and anthocyanin contents. AN2 appeared to be differentially regulated, indicating that either (i) AN2 is regulated posttranscriptionally or (ii) AN2 controls the transcription of other genes in addition to those of the anthocyanin pathway. The latter hypothesis is plausible as R2R3-MYB transcription factors have been shown to exert regulatory effects on different branches of the polyphenol biosynthetic pathway, leading to accumulation of other types of polyphenol compounds (Davies and Schwinn, 2006; Boudet, 2007). It is worth mentioning that Teng et al. (2005) showed that, from two MYB genes involved in the regulation of anthocyanin synthesis in A. thaliana, only one was essential for sucrose induction of the anthocyanin pathway. The implication of sucrose will be discussed in the next section Implication of carbohydrate flux in the regulation of polyphenol production In the context of their role as signaling molecules, it has been shown in A. thaliana that carbohydrates and particularly sucrose strongly activate the R2R3-MYB transcription factor PAP1 (Teng et al., 2005; Solfanelli et al., 2005). PAP1 has high homology with AN1 from potato, with 70% identity at the amino acid level. The DFR gene is also induced by glucose and to a minor extent by fructose, perhaps via activation of PAP1 (Teng et al., 2005). Other polyphenol biosynthetic genes including PAL were also responsive to carbohydrate application but to a much lesser extent (Solfanelli et al., 2005). It has also been speculated that the presence of sucrose is necessary for anthocyanin production during the development of potato tubers (Lewis et al., 1999). It appears therefore that the changes in sucrose content observed in Huata Colorada (increase) and in Guincho Negra and Sullu (decrease) might be related to the up-regulation and the down-regulation of polyphenol biosynthetic genes respectively observed in the these cultivars. The polyphenol biosynthetic pathway is particularly induced in plants in response to drought and oxidative stress (Dixon and Paiva, 1995). The decreased polyphenol levels found in the present study in Guincho Negra and Sullu tubers upon drought stress is not in agreement with this observation. The ROS-induced regulation in the potato tuber might differ from the one in source organs such as leaves, which were the main target of past research. Furthermore, in plants with very high constitutive polyphenol contents, further increase of these defense compounds under stress could have no additional advantage and might be too costly. Guincho Negra and Sullu tubers might preferably maintain the production of starch upon drought, leading to a decreased pool of sucrose in the tuber, which is in agreement with our observations The net content of each polyphenol compound will be controlled by the rate of its biosynthesis and of its degradation The variations of polyphenol contents in tubers exposed to drought could be caused by (i) an increase of chemical and/or enzymatic degradation and/or (ii) by a decrease of biosynthesis due to a lower transcription of the biosynthetic genes or to lower enzymatic activities. Very little is known about the stability and turnover of polyphenols in plants. A rapid turnover of chlorogenic acid in plants has been proposed in potato tubers (Taylor and Zucker, 1966), which is consistent with the possible role of chlorogenic acid as a carbon reservoir for lignification or production of antimicrobial agents (Grace and Logan, 2000). Active degradation of polyphenols including anthocyanins can be achieved during plant development through their oxidation catalyzed by polyphenol oxidases and peroxidases (Vaknin et al., 2005; Pourcel et al., 2007), but appears to be highly species- and tissue-dependent. Following oxidation by ROS, phenolic compounds can be regenerated to their reduced and active form by ascorbate (Yamasaki et al., 1997) or by the catalyzing action of monodehydroascorbate reductase (Sakihama et al., 2000). Oxidized flavonoids and hydroxycinnamic acids may also polymerize to form brown pigments (Pourcel et al., 2007) and lignin or suberin (Takahama and Oniki, 2000), respectively. However, nothing is known about the existence of other likely catabolic products. Although the potential increase of ROS upon drought stress could increase to a certain extent the degradation of the phenolic compounds, the results of this study showed that the biosynthesis of these compounds was also affected, at least in part, at the transcriptional level. 4. Conclusion The expression of PAL, HCT, C3H, CHS, CHI, F3H, DFR, and AN1 is correlated with polyphenol content under normal and under drought stress conditions. This good correspondence between transcript level and metabolite level suggests that these enzymes are coordinately regulated, at least in part, at the transcriptional level and that the control of gene expression plays an essential role in the polyphenol biosynthetic pathway. We speculate that the altered pool of sucrose in potato tubers upon drought may be responsible, at least in anthocyanin-containing tubers, for the changes in gene expression and, in turn, for the variation of polyphenol contents. Taken together, the gene expression data presented here improve our understanding of the polyphenol metabolism in potato tubers. Furthermore, this study provides important information on key polyphenol biosynthetic genes, which could be useful for the production of potato varieties with enhanced health and nutritional benefits. 5. Experimental 5.1. Plant material and sampling for gene expression analysis The selection of five potato cultivars (S. tuberosum L.) from the Andigenum group included (Fig. 2): (i) SS-2613, a high polyphenolranking cultivar with a yellow skin and flesh, (ii) Sipancachi, a low polyphenol-ranking one presenting a yellow skin and flesh, (iii) Guincho Negra, a cultivar with a totally purple flesh and skin, (iv) Huata Colorada, a cultivar with a purple skin and yellow flesh, and (v) Sullu, a cultivar presenting a partly red flesh and skin. These genotypes have been subjected in 2007 to a drought treatment, which has recently been described in Andre et al. (2009). Briefly, potato plants were field grown at the CIP (Centro Internacional de la Papa) experimental station in Huancayo (Peru) and exposed to drought during tuberization for 58 days. Mature tubers were harvested and samples were immediately taken from the middle of tubers (ca. 2 g, with skin) and flash frozen in liquid nitrogen for RNA extraction (RNA from 0-day tubers). Intact tubers were transferred to the lab in Lima for processing and were first allowed to stabilize in the dark at 10 C for 2 weeks. A second set of samples was subsequently taken from tubers and flash frozen for RNA extraction (RNA from 15-day tubers). The remaining parts of the tubers were freeze-dried for biochemical analyses and especially for determination of soluble carbohydrates as well as phenolic content. To study gene expression, three biological repetitions (plants) were used for each genotype in each irrigation conditions and time point (0-day and 15-day). Each biological repetition consisted of a mix of three samples from three different tubers, all derived from the same plant. The polyphenol and carbohydrate contents were also determined from three biological repetitions but only for the 15-day tubers. The polyphenol profiles have already been presented in a previous paper (Andre et al., 2009).

9 C.M. André et al. / Phytochemistry 70 (2009) RNA extraction RNA samples were isolated from tuber tissues using the Trizol reagent (Invitrogen, Carlsbad, CA) according to the recommendations of the supplier. Samples were cleared from Trizol and other interfering substances using the RNeasy cleaning plant mini kit from Qiagen (Leusden, The Netherlands). A DNase treatment (Qiagen) was also applied to remove any residual genomic DNA. RNA integrity and purity was checked with the BioAnalyzer (Agilent, Santa Clara, CA) (only RNA samples with a RIN number >7 were accepted) and RNA concentration was determined spectroscopically by measuring its absorbance at 260 nm. Purified RNA samples were stored at 80 C until analysis Determination of the housekeeping and polyphenol-related genes A genorm analysis (Vandesompele et al., 2002) was performed to identify the most stable housekeeping genes. Based on a previous study performed by our group on potato leaves (Nicot et al., 2005), five housekeeping genes were tested for this analysis: cyclophilin, elongation factor 1-a (EF1-a), 18S rrna, adenine phosphoribosyl transferase (aprt), and cytoplasmic ribosomal protein L2. Sucrose synthase, a gene potentially regulated by drought exposure, was used as gene of interest. Sixteen samples coming from control and from drought-stressed tubers (at both time points) were included in the analysis. EF1-a and L2 appeared to be the most stable genes under drought stress and both were used as housekeeping genes. With few exceptions, all the genes described in Fig. 1 were investigated for their expression level. Among the exceptions, one can find (i) route C of the chlorogenic pathway, due to its unlikely occurence in Solanaceae species, (ii) 4CL, which catalyzes a widely spread reaction of esterification of CoA to the carboxyl group of numerous phenolic acids (formation of lignins), and (iii) F H and ANS, for which no potato specific EST existed Primer design Real-time RT-PCR primers were designed on the basis of publicly available potato tuber EST sequences from the GenBank EST database of NCBI ( Primer design was performed using the software Primer Express (Applied Biosystems, Foster City, CA). Primers were designed according to the following criteria: primer length between 18 and 25 bp, melting temperature (T m ) between 63 C and 67 C, GC content between 40% and 60%, no T at the 3 0 end, and not more than 3 G or C in the 5 last bases at the 3 0 end. The absence of hairpin and dimer formation was also verified. Primer sequences are listed in Table 1. According to the available information on gene sequences, the primer specificity was such that several close gene family members could be targeted Two step real-time RT-PCR analysis Two micrograms of each RNA sample were reverse transcribed to cdna using Multiscribe Reverse Transcriptase and random hexamers (Taqman Reverse Transcription Reagents, Applied Biosystems, Foster City, CA). Real-time PCR was performed using SYBR Green dye chemistry (Mesa Green qpcr MasterMix Plus, Eurogentec, Liège, Belgium). For each sense and anti-sense primer, a concentration of 300 nm was used in the mix, except for C3H and CHI primers where 300 nm and 100 nm were used for forward and reverse primers, respectively. All reactions were run in triplicate (technical repeats) on an ABI 7500 Fast real-time PCR system (Applied Biosystems, Foster City, CA). Thermal cycling conditions were: initial 5 min denaturation at 95 C, followed by 40 cycles (15 s at 95 C 1 min at 60 C), and a dissociation stage (15 s at 95 C, 1 min at 60 C, 15 s at 95 C, with a low temperature ramp rate). For all the genes, the final dissociation curves showed a single peak, confirming the absence of primer dimers, contaminants, or unspecific amplifications. PCR efficiency (E) was used to evaluate the performance of the real-time PCR assay and was determined for each gene using the slope of a linear regression model: E ¼ 10 ð 1nslopeÞ In order to set up the calibration curve, 20 cdna samples from tubers of the five cultivars under drought and well-watered conditions were pooled and then used as the PCR template in a range of ng. PCR efficiencies of the target and housekeeping genes ranged from 85% to 100% and were used to determine the expression levels Processing of data The expression levels were accurately quantified on the basis of the quantification model developed by Vandesompele et al. (2002). This model takes multiple reference genes and gene specific amplification efficiencies into account. Accordingly, for each biological samples, the difference ðdþ in quantification cycle value (Cq) between the target (Cq target, averaged from three technical repeats) and the calibrator (Cq calibrator, a fixed Cq value was used for all samples) was first transformed into relative quantities (RQ) using the exponential function with the efficiency (E) of the PCR reaction as its base: RQ ¼ E DCq with DCq ¼ Cq calibrator Cq target ð1þ ð2þ ð3þ A sample specific normalization factor (NF) was then calculated by taking the geometric mean of the relative quantities (RQ) of the housekeeping genes (p): vffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi uy f f NF ¼ t RQ p ð4þ p¼1 Relative quantities (RQ) of the target genes were then normalized by the normalization factor (NF): NRQ ¼ RQ NF NRQ were further rescaled to the sample with the lowest relative quantity. These normalized relative quantities (NRQ) were first used to compare the constitutive expression levels of polyphenol biosynthetic genes between potato cultivars at 0-day and 15-day. The effect of drought on gene expression for each time points was expressed in expression ratios, following the equation: Ratio drought ¼ NRQ drought NRQ control Standard errors ðdþ on the ratios were propagated using the differential equation of Gauss (or first order approximation) as recommended in Muller et al. (2002), following the equation: sffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 2 Dx DRatio ¼ þ xdy 2 ð7þ y y 2 with x ¼ NRQ drought and y ¼ NRQ control Soluble carbohydrate analysis Extraction and analysis of carbohydrates were performed as described in Guignard et al. (2005). Briefly, approximately 70 mg of powdered freeze-dried potato tuber material were mixed with ð5þ ð6þ

10 1116 C.M. André et al. / Phytochemistry 70 (2009) ml of ethanol 80%. This mixture was homogenized using a Vortex for 30 s and shaken for 30 min at 4 C. After centrifugation at 10,000g for 10 min at 4 C, the supernatant was collected. An additional extraction was done on the residue using the same extraction solvent (0.5 ml). The supernatants were pooled and evaporated to dryness in a SpeedVac concentrator (Heto, Thermo Electron Corporation, Waltham, MA). Carbohydrates were resuspended in 1 ml of water and the suspension was filtered through a 0.45 lm Acrodisc PVDF syringe filter prior to analysis using high performance anion exchange chromatography coupled with pulsed amperometric detection (HPAEC-PAD) as detailed in Guignard et al. (2005) Statistical analyses The significance of differences between mean expression levels was evaluated using a Student t-test. Pearson correlation coefficient was determined on log transformed data to evaluate relationships between the expression levels of the different genes. The SigmaStat software (Systat Software Inc., San Jose, CA) was used for these analyses. Acknowledgments We thank Dr. Andrew Allan from Plant and Food Research (New Zealand) for helpful comments on this manuscript. We are also grateful to Laurent Solinhac from CRP-Gabriel Lippmann (Luxembourg) for technical assistance. This work was partly supported by a BFR grant (CA) from the Luxembourg Ministry of Culture, Higher Education and Research and also by funding from the Luxembourg Ministry of Finance. References Allan, A., Hellens, R., Laing, W., MYB transcription factors that colour our fruit. Trends Plant Sci. 13, Andre, C.M., Ghislain, M., Bertin, P., Oufir, M., Herrera, M.R., Hoffmann, L., Hausman, J.-F., Larondelle, Y., Evers, D., 2007a. Andean potato cultivars (Solanum tuberosum L.) as a source of antioxidant and mineral micronutrients. J. Agric. Food Chem. 55, Andre, C.M., Oufir, M., Guignard, C., Hoffmann, L., Hausman, J.-F., Evers, D., Larondelle, Y., 2007b. Antioxidant profiling of native Andean potato tubers (Solanum tuberosum L.) reveals cultivars with high levels of b-carotene, a-tocopherol, chlorogenic acid, and petanin. J. Agric. Food Chem. 55, Andre, C.M., Schafleitner, R., Guignard, C., Oufir, M., Alvarado, C., Nomberto, G., Hoffmann, L., Hausman, J.-F., Evers, D., Larondelle, Y., Modification of the health-promoting value of potato tubers field grown under drought stress: emphasis on dietary antioxidant and glycoalkaloid contents in 5 native Andean cultivars (Solanum tuberosum L.). J. Agric. Food Chem. 57, Arts, I.C., Hollman, P.C., Polyphenols and disease risk in epidemiologic studies. Am. J. Clin. Nutr. 81, Boudet, A., Evolution and current status of research in phenolic compounds. Phytochemistry 68, Bovy, A., Schijlen, E., Hall, R., Metabolic engineering of flavonoids in tomato (Solanum lycopersicum): the potential for metabolomics. Metabolomics 3, Brown, C.R., Antioxidants in potato. Am. J. Potato Res. 82, Davies, K., Schwinn, K., Molecular biology and biotechnology of flavonoid biosynthesis. In: Andersen, O.M., Markham, K.R. (Eds.), Flavonoid: Chemistry, Biochemistry and Applications. CRC Press/Taylor and Francis Group, New York, pp Dejong, W., Eannetta, N., De Jong, D., Bodis, M., Candidate gene analysis of anthocyanin pigmentation loci in the Solanaceae. Theor. Appl. Genet. 108, Dejong, W., Jung, C., Griffiths, H., Genes that determine plant color and uses thereof. Patent WO 2006/ A2. Dixon, R., Paiva, N., Stress-induced phenylpropanoid metabolism. Plant Cell 7, Feng, R., Lu, Y., Bowman, L.L., Qian, Y., Castranova, V., Ding, M., Inhibition of activator protein-1, NF-jB, and mapks and induction of phase 2 detoxifying enzyme activity by chlorogenic acid. J. Biol. Chem. 280, Grace, S., Phenolics as antioxidants. In: Smirnoff, N. (Ed.), Antioxidants and Reactive Oxygen Species in Plants. Blackwell Publishing Limited, Oxford, UK, pp Grace, S., Logan, B., Energy dissipation and radical scavenging by the plant phenylpropanoid pathway. Philos. Trans. R. Soc. Lond. B: Biol. Sci. 355, Guignard, C., Jouve, L., Bogeat-Triboulot, M., Dreyer, E., Hausman, J.-F., Hoffmann, L., Analysis of carbohydrates in plants by high-performance anion-exchange chromatography coupled with electrospray mass spectrometry. J. Chromatogr. A 1085, Han, K., Matsumoto, A., Shimada, K., Sekikawa, M., Fukushima, M., Effects of anthocyanin-rich purple potato flakes on antioxidant status in f344 rats fed a cholesterol-rich diet. Br. J. Nutr. 98, Hoffmann, L., Maury, S., Martz, F., Geoffroy, P., Legrand, M., Purification, cloning, and properties of an acyltransferase controlling shikimate and quinate ester intermediates in phenylpropanoid metabolism. J. Biol. Chem. 278, Kasai, H., Fukada, S., Yamaizumi, Z., Sugie, S., Mori, H., Action of chlorogenic acid in vegetables and fruits as an inhibitor of 8-hydroxydeoxyguanosine formation in vitro and in a rat carcinogenesis model. Food Chem. Toxicol. 38, Koch, K., Carbohydrate-modulated gene expression in plants. Annu. Rev. Plant Physiol. 47, Lachman, J., Hamouz, K., Orsak, M., Pivec, V., Potato tubers as a significant source of antioxidants in human nutrition. Rost. Vyroba 46, Lewis, C., Walker, J., Lancaster, J., Changes in anthocyanin, flavonoid and phenolic acid concentrations during development and storage of coloured potato (Solanum tuberosum L.) tubers. J. Sci. Food Agric. 79, Meyer, A., Donovan, J., Pearson, D., Waterhouse, A., Frankel, E., Fruit hydroxycinnamic acids inhibit human low-density lipoprotein oxidation in vitro. J. Agric. Food Chem. 46, Muller, P., Janovjak, H., Miserez, A., Dobbie, Z., Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques 32, 2 7. Nicot, N., Hausman, J.-F., Hoffmann, L., Evers, D., Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J. Exp. Bot. 56, Niggeweg, R., Michael, A.J., Martin, C., Engineering plants with increased levels of the antioxidant chlorogenic acid. Nat. Biotechnol. 22, Pourcel, L., Routaboul, J., Cheynier, V., Lepiniec, L., Debeaujon, I., Flavonoid oxidation in plants: from biochemical properties to physiological functions. Trends Plant Sci. 12, Pryor, W.A., Oxidationand artherosclerosis. Free Radic. Biol. Med. 28, Sakihama, Y., Mano, J., Sano, S., Asada, K., Yamasaki, H., Reduction of phenoxyl radical radicals mediated by monodehydroscorbate reductase. Biochem. Biophys. Res. Commun. 279, Schijlen, E., de Vos, C., van Tunen, A., Bovy, A., Modification of flavonoid biosynthesis in crop plants. Phytochemistry 65, Schoch, G., Goepfert, S., Morant, M., Hehn, A., Meyer, D., Ullmann, P., Werck- Reichhart, D., CYP98A3 from Arabidopsis thaliana is a 3 -Hydroxylase of phenolic esters, a missing link in the phenylpropanoid pathway. J. Biol. Chem. 276, Shadle, G., Chen, F., Reddy, M., Jackson, L., Nakashima, J., Dixon, R., Downregulation of hydroxycinnamoyl coa: shikimate hydroxycinnamoyl transferase in transgenic alfalfa affects lignification, development and forage quality. Phytochemistry 68, Solfanelli, C., Poggi, A., Loreti, E., Alpi, A., Perata, P., Sucrose-specific induction of the anthocyanin biosynthetic pathway in Arabidopsis. Plant Physiol. 140, Stevenson, D.E., Hurst, R.D., Polyphenolic phytochemicals-just antioxidants or much more? Cell. Mol. Life Sci. 64, Takahama, U., Oniki, T., Flavonoids and some other phenolics as substrates of peroxidase: physiological significance of the redox reactions. J. Plant Res. 113, Taylor, A., Zucker, M., Turnover and metabolism of chlorogenic acid in Xanthium leaves and potato tubers. Plant Physiol. 41, Teng, S., Keurentjes, J., Bentsink, L., Koornneef, M., Smeekens, S., Sucrosespecific induction of anthocyanin biosynthesis in Arabidopsis requires the MYB75/PAP1 gene. Plant Physiol. 139, Vaknin, H., Bar-Akiva, A., Ovadia, R., Nissim-Levi, A., Forer, I., Weiss, D., Oren-Shamir, M., Active anthocyanin degradation in Brunfelsia calycina (yesterday today tomorrow) flowers. Planta 222, Vandesompele, J., Preter, K.D., Pattyn, F., Poppe, B., Roy, N.V., Paepe, A.D., Speleman, F., Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3. research research Villegas, R., Kojima, M., Purification and characterization of hydroxycinnamoyl D-glucose quinate hydrocinnamoyl transferase in the root of sweet potato Ipomoea batatas. J. Biol. Chem. 261, Watkinson, J., Hendricks, L., Sioson, A., Vasquez-Robinet, C., Stromberg, V., Heath, L., Schuler, M., Bohnert, H., Bonierbale, M., Grene, R., Accessions of Solanum tuberosum ssp. andigena show differences in photosynthetic recovery after drought stress as reflected in gene expression profiles. Plant Sci. 171, Weiss, D., Regulation of flower pigmentation and growth: multiple signaling pathways control anthocyanin synthesis in expanding petals. Physiol. Plant. 110, Winkel-Shirley, B., Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 126, Yamasaki, H., Sakihama, Y., Ikehara, N., Flavonoid-peroxidase reaction as a detoxification mechanism of plant cells against H 2 O 2. Plant Physiol. 11, Zhang, Y., Suk Jung, C., De Jong, W., Genetic analysis of pigmented tuber flesh in potato. Theor. Appl. Genet.. doi: /s