A CRISPR/Cas9-mediated gene editing to enhance the expression of the Solanum lycopersicum MYB12 gene and the nutritional value of tomato
|
|
|
- Ashley Morris
- 5 years ago
- Views:
Transcription
1 A CRISPR/Cas9-mediated gene editing to enhance the expression of the Solanum lycopersicum MYB12 gene and the nutritional value of tomato Dr. Aurelia Scarano Napoli, 22 Dicembre 2017
2 Phenylalanine Phenolic acids 4-Coumarate-Coa Stilbenes Naringenin Chalcone Isoflavones Flavanols Proanthocyanidins Naringenin Dihydroflavonols Flavonols Flavones Aurones BENEFITS FOR THE HEALTH Antioxidant activities Anti-inflammatory properties Healthy aging Protection against inflammatory and chronic diseases Anthocyanins
3 In tomato, polyphenols are present only in the skin (1% of the whole fruit) Improvement of polyphenol content with conventional breedings Metabolic engineering is a useful tool to increase the levels of polyphenols in crops, such as tomato
4 Phenolic acids Dihydroquercetin FLS Quercetin Rutin GT F3 H DFR ANS 3GT RT 5GT Cyanidins Phenylalanine PAL 4-Coumarate-Coa CHS Naringenin Chalcone CHI Naringenin F3H Dihydrokaempferol F3 5 H FLS DFR Kaempferol ANS 3GT RT 5GT Pelargonidins AtMYB12 Dihydromyricetin Myricetin DFR ANS 3GT RT 5GT Petunidins AmDelila (bhlh) AmRosea1 (MYB) Over-expression under the fruitspecific E8 promoter
5 Phenylalanine PAL VvStSy WT 4-Coumaroyl-CoA Resveratrol Piceid CHS Naringenin Chalcone CHI Naringenin F3H Dihydroflavonols Stilbenes 35S::StSy Flavonols Anthocyanins
6 ISPA-CNR, Lecce, Italy (Dr. Angelo Santino) and John Innes Centre, Norwich, UK (Prof. Cathie Martin) WT AmDel/Ros1 Anthocyanins AtMYB12 Flavonols AtMYB12/VvStSy Flavonols Stilbenes AtMYB12/AmDel/Ros1 AtMYB12/AmDel/ Ros1/VvStSy Flavonols Anthocyanins Flavonols Anthocyanins Stilbenes
7 Antioxidant capacity in Bronze 7-fold higher than in WT DSS- induced inflammation as a model of IBD (Inflammatory Bowel Disease) Start DSS treatment Diets enriched in flavonols, anthocyanins and stilbenes alleviate the symptoms of gut inflammation Scarano A., Santino A., et al. 2017, Frontiers in Nutr, in revision
8 genome editing technologies The CRISPR/Cas9 system Site-specific mutations on the target gene, using Cas9 endonuclease Cas9 is driven by RNA-guide/s to recognize a target PAM sequence and cut 3 nucleotides upstream
9 chromatids NHEJ (Non-homologous end joining) HR (Homologous recombination) Small deletions or small insertions + donor template Knocked-in sequence of interest
10 insertion of the 35S promoter ANT1 gene Viral sequences Cermak T. Genome Biology 2015
11 Insertion E8 promoter upstream MYB12 gene homologous recombination (via HR) Transient expression assays Stable transformation with Agrobacterium tumefaciens
12 Gene of interest: SlMYB12 (involved in the flavonoid pathway) RNA guide CTATTTATTGGCATTTCTATTGG SlMYB12 promoter SlMYB12 gene LB RB NPTII Cas9 sgrna LIR Homology arm E8 promoter Homology arm RepLIR
13 Transformation with Agrobacterium rhizogenes: 57 transformed/ 60 hairy roots Screening to detect gene targeting events A B E F Flanking genomic region MYB12 promoter (Homology) E8 promoter MYB12 gene (Homology) Flanking genomic region LEFT JUNCTION RIGHT JUNCTION LEFT JUNCTION F6 G6 CRISPR/Cas9 editing - via HR: 1/57: left and right junction RIGHT JUNCTION WT F6 B8 H6 1/57: left junction 2/57: right junction
14 CTATTTATTGGCATTTCTATTGG Off target 1 (strand +): ACTTTTATTGGCATTTCAATTGG Off target 2 (strand -): ATGTTTATTAGCGTTTCTATTGG off-target #1 WT G6 F6 B8 H6 off-target #2 WT G6 F6 B8 H6 WT WT G6 G6 F6 F6 B8 B8 H6 H6
15 CTATTTATTGGCATTTCTATTGG Off target 3 (strand -): TTTTTTATTGGAGTTTCTATGGG Off target 4 (strand +): CTATCTACTGTCATTTCTAAAGG Off target 5 (strand +): GTATTTATTGAGATTTCAATAGG off-target #3 off-target #4 off-target #5 WT G6 F6 B8 H6 WT G6 F6 B8 H6 WT G6 F6 B8 H6 WT WT WT G6 G6 G6 F6 F6 F6 B8 B8 B8 H6 H6 H6
16 1 LB Site guide Site guide RB NPTII 35S:Cas9 sgrna E8 promoter 2 Site guide Site guide LB RB NPTII Rp5Sa:Cas9 sgrna E8 promoter
17 CRISPR/Cas9 editing - via HR: No off-target activities Stable transformation with Agrobacterium tumefaciens CRISPR/Cas9 editing - via NHEJ: Hairy roots expression assays Stable transformation with Agrobacterium tumefaciens
18 Dr Angelo Santino Prof Cathie Martin, Dr Eugenio Butelli Dr Fabio D Orso Thank you!
Supplementary Figures
Supplementary Figures Supplementary Figure 1. AtMYB12 antibody detects both Arabidopsis and tomato MYB12 protein. (a) AtMYB12 antibody detects both SlMYB12 and AtMYB12 in tomato fruit. Both WT and AtMYB12
High Resolution LC-MS Data Output and Analysis
High Resolution LC-MS Data Output and Analysis Software for comparing full-scan datasets MetAlign method Software for comparing full-scan datasets MetAlign method Base line correction and peak pickingnew
Citation for published version (APA): Schijlen, E. G. W. M. (2007). Genetic engineering of flavonoid biosynthesis in tomato
UvA-DARE (Digital Academic Repository) Genetic engineering of flavonoid biosynthesis in tomato Schijlen, E.G.W.M. Link to publication Citation for published version (APA): Schijlen, E. G. W. M. (2007).
TUM. Biocompounds II Concentration of Flavonols and Anthocyanidins in apple skin: Relation between Multiplex and HPLC values. Prof. Dr.
TUM Biocompounds II Concentration of Flavonols and Anthocyanidins in apple skin: Relation between Multiplex and HPLC values Prof. Dr. Treutter Dr. Rühmann Michele Lomonaco Flavonols Are derived from dihydroflavonols
The PLANT PHENOLIC COMPOUNDS Introduction & The Flavonoids
The PLANT PHENOLIC COMPOUNDS Introduction & The Flavonoids The plant phenolic compounds - 8,000 Phenolic structures known - Account for 40% of organic carbon circulating in the biosphere - Evolution of
Biochemical Profiling of Phenolic Compounds in Lentil Seeds
Biochemical Profiling of Phenolic Compounds in Lentil Seeds A Thesis Submitted to the College of Graduate Studies and Research In Partial Fulfillment of the Requirements For the Degree of Doctor of Philosophy
Flavonoids and Inflammation
Flavonoids and Inflammation David Heber MD,PHD Professor of Medicine and Public Health Director, UCLA Center for Human Nutrition David Geffen School of Medicine, UCLA Phytonutrient Classes Carotenoids
Berry press residues as a valuable source of polyphenolics: extraction optimisation and analysis
Berry press residues as a valuable source of polyphenolics: extraction optimisation and analysis Maris Klavins, Agnese Kukela, Linards Klavins, Jorens Kviesis G.Arcimboldo Louvre Application possibilities
Carbon Dioxide induced Changes in Color and Anthocyanin Synthesis of Stored Strawberry Fruit
HORTSCIENCE 34(7):1244 1248. 1999. Carbon Dioxide induced Changes in Color and Anthocyanin Synthesis of Stored Strawberry Fruit Deirdre M. Holcroft 1 and Adel A. Kader 2 Department of Pomology, University
Flavonoids and their contribution to health: a look at the scientific support
Flavonoids and their contribution to health: a look at the scientific support Frank Hu, MD, PhD Professor of Nutrition and Epidemiology Harvard School of Public Health Professor of Medicine Harvard Medical
Flavonoids and their free radical reactions
The Virtual Free Radical School Flavonoids and their free radical reactions Wolf Bors, Christa Michel, Kurt Stettmaier Inst. Strahlenbiol., GSF Research Center D-85764 Neuherberg, Germany ph.: (+49-89)
Roles of Flavonoid Compounds in Determining the Shelf Life of Tomato Fruit
Roles of Flavonoid Compounds in Determining the Shelf Life of Tomato Fruit Yang Zhang A thesis submitted to the University of East Anglia for the degree of Doctor of Philosophy John Innes Centre Norwich
Engineering tomato as a space biofactory fortified in anti-oxidants content and in free radical scavenging activity
Engineering tomato as a space biofactory fortified in anti-oxidants content and in free radical scavenging activity Roma, 18/05/2018 SILVIA MASSA, PhD Plant Biotechnologies ENEA Biotechnology Laboratory
Effects Partial Solar Radiation on the Grapevine
Effects Partial Solar Radiation on the Grapevine Johann Martinez-Luscher, Christopher Chen, Luca Brillante, Monica Cooper and S. Kaan Kurtural* Department of Viticulture and Enology Flavonoids in grape
Molecular and metabolic analyses in developing olive fruit in relation to different water regimes
Molecular and metabolic analyses in developing olive fruit in relation to different water regimes F. Martinelli, L. Sebastiani and P. Tonutti BioLabs, Scuola Superiore Sant Anna Piazza Martiri della Libertà
Fruits and Vegetables Why More Matters
Fruits and Vegetables Why More Matters Francene Steinberg, PhD, RD Professor and Chair Department of Nutrition University of California, Davis September 22, 2012 Obesity & Nutrition in a Changing World
PHENOLIC COMPOUNDS IN FOOD
PHENOLIC COMPOUNDS IN FOOD Veronika Abram, Nataša Poklar Ulrih Ljubljana, 2012 Chair of Biochemistry and Chemistry of Foods, Department of Food Science and Technology, Biotechnical Faculty, University
BOT 6516 Plant Metabolism
BOT 6516 Plant Metabolism Lecture 22 Natural Products Slide sets available at: http://hort.ifas.ufl.edu/teach/guyweb/bot6516/index.html Some Big Ideas and Aspirations for Plant Natural Products Why is
C 6 C 3 unit. Figure 2: Volatile oils simple C6 C3 metabolite
Phenylpropenses Are the simplest of shikimic-acid-derived biosynthetic subunit. These secondary metabolites are consist of purely of an aromatic ring (C6), with an unsaturated 3-carbon chain (C3), attached
Final Report for Tufts Institute of the Environment Graduate Fellowship
Final Report for Tufts Institute of the Environment Graduate Fellowship TITLE: Using Jasmonates to Enhance Long-Term Sequestration of Atmospheric Carbon. Benjamin A. Babst, Ph. D. Department of Biology,
ILSI Europe Satellite Workshop on Nutrition for the Ageing Brain: Towards Evidence for an Optimal Diet July 2014, Milan, Italy
ILSI Europe Satellite Workshop on Nutrition for the Ageing Brain: Towards Evidence for an Optimal Diet 03-04 July 2014, Milan, Italy Flavonoids as modulators of APP Processing: A Dietary intervention for
Increasing antioxidant levels in tomatoes through modi cation of the avonoid biosynthetic pathway
Journal of Experimental Botany, Vol. 53, No. 377, Fruit Development and Ripening Special Issue, pp. 2099±2106, October 2002 DOI: 10.1093/jxb/erf026 Increasing antioxidant levels in tomatoes through modi
Staying on Trend: The Powerful Flavonoid Consumers Need Navindra P. Seeram, Ph.D. Bioactive Botanical Research Laboratory
FLRIDA DEPARTMENT F CITRUS Staying on Trend: The Powerful Flavonoid Consumers Need Navindra P. Seeram, Ph.D. Bioactive Botanical Research Laboratory 1 utline 1. Introduction Florida Department of Citrus
Plant Cell Biology; Identification and manipulation of plant quality traits
Plant Cell Biology; Identification and manipulation of plant quality traits Phil Morris, Mark Robbins, Joe Gallagher and Ana Winters Mechanisms of protein protection in forages 30 Determining the constraints
This student paper was written as an assignment in the graduate course
77:222 Spring 2003 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2003) offered
Plants for the future: the development of functional foods for nutrition, health and well-being
Department of Food and Nutritional Sciences Plants for the future: the development of functional foods for nutrition, health and well-being Carol Wagstaff 23 May 2011 University of Reading 2011 www.reading.ac.uk
Flavonoid Metabolism
270S-SO-/2 Flavonoid Metabolism Author Helen A. Stafford, Ph.D. Professor Biology Department Reed College Portland, Oregon CRC Press, Inc. Boca Raton, Florida TABLE OF CONTENTS Chapter 1 General Aspects
Secondary metabolites derived from mixed biosynthetic origin (The flavonoids). SCH 511 Dr. Solomon Derese
Secondary metabolites derived from mixed biosynthetic origin (The flavonoids). 22 The flavonoids comprise a large group of secondary metabolites which are derived from sub-units supplied by the acetate
Ovarian cancer risk and nonisoflavone flavonoids intake: A systematic review of epidemiological studies
Systematic Review Ovarian cancer risk and nonisoflavone flavonoids intake: A systematic review of epidemiological studies Vida Mohammadi 1, Sirous Dehghani 1, Bagher Larijani 2, Leila Azadbakht 1,3,4 1
Toshihiro OHKURA, Michiyo ONISHI, Makoto AONO, Takurou TAKECHI
2 11 28 Toshihiro HKURA, Michiyo NISHI, Makoto AN, Takurou TAKECHI An analytical method using liquid chromathography tandem mass spectrometry (LC/MS/MS) equipped with electrospray ionization (ESI) was
Phytochemistry 70 (2009) Contents lists available at ScienceDirect. Phytochemistry. journal homepage:
Phytochemistry 70 (2009) 1107 1116 Contents lists available at ScienceDirect Phytochemistry journal homepage: www.elsevier.com/locate/phytochem Gene expression changes related to the production of phenolic
NIH Public Access Author Manuscript Curr Anal Chem. Author manuscript; available in PMC 2009 November 26.
NIH Public Access Author Manuscript Published in final edited form as: Curr Anal Chem. 2008 April 1; 4(2): 75 101. doi:10.2174/157341108784587795. Recent Advances in Anthocyanin Analysis and Characterization
Qualitative and quantitative determination of phenolic antioxidant compounds in red wine and fruit juice with the Agilent 1290 Infinity 2D-LC Solution
Qualitative and quantitative determination of phenolic antioxidant compounds in red wine and fruit juice with the Agilent 1290 Infinity 2D-LC Solution Application Note Food Testing Author Edgar Naegele
The Bioavailability of Dietary Flavonoids & Related Phenolic Compounds. Dietary phenolics. Feeding Studies. Stomach. Tissues. bile.
The Bioavailability of Dietary Flavonoids & Related Phenolic Compounds Dietary phenolics Stomach Tissues Possible Routes for Consumed Dietary Phenolics in Humans bile General circulation Small intestine
Phytonutrients 101. Part 1: 11/28/2011. Fruit & Vegetable Consumption
Phytonutrients 101 Part 1 Presented by: Yvette La Garde, Director of Education Phytonutrients 101 Part 1: Basics of phytonutrients Phytonutrient families Benefits of taking phytonutrients Studies supporting
Functional Foods and Nutraceuticals. Kempherol, Quercetin, and resveratrol. Dr. K. Bhaskarachary. Description of Module
Component I (A) Role Name Affiliation Principal Investigator Dr. Sheela Ramachandran Avinashilingam Institute for Home Science and Higher Education for Women, Coimbatore. Co-Principal Investigators Dr.
Impact of biochemical pre-studies on specific metabolic engineering strategies of flavonoid biosynthesis in plant tissues
Biochemical Engineering Journal 14 (2003) 227 235 Review Impact of biochemical pre-studies on specific metabolic engineering strategies of flavonoid biosynthesis in plant tissues Stefan Martens a,, Jürgen
Phenolics in Food and Natural Health Products: An Overview
Chapter 1 Phenolics in Food and Natural Health Products: An Overview Downloaded via 148.251.232.83 on November 2, 2018 at 10:51:33 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to
Integrative Transcript and Metabolite Analysis of Nutritionally Enhanced DE-ETIOLATED1 Downregulated Tomato Fruit W
This article is a Plant Cell Advance Online Publication. The date of its first appearance online is the official date of publication. The article has been edited and the authors have corrected proofs,
The effect of nitrogen and phosphorus deficiency on flavonol accumulation in plant tissues
Blackwell Science, LtdOxford, UK PCEPlant, Cell and Environment0016-8025Blackwell Science Ltd 2001 24 768 Flavonol accumulation in N- and P-deficient plant tissues A. J. Stewart et al. Original ArticleBEES
Plant Model Systems Used
rom Plant Systems Biology to Renewable uels H H H + H H H H H H H H H H H H H H H H Erich Grotewold Center for Applied Plant Sciences (CAPS) & Department of Molecular Genetics, N H H N 206 Rightmire Hall,
Separation of Polyphenols by Comprehensive 2D-LC and Molecular Formula Determination by Coupling to Accurate Mass Measurement
Separation of Polyphenols by Comprehensive 2D-LC and Molecular Formula Determination by Coupling to Accurate Mass Measurement Application Note Food Testing & Agriculture Author Edgar Naegele Agilent Technologies,
Latest evidence for the cardiovascular health benefits of polyphenols. Prof Kevin D Croft University of Western Australia
Latest evidence for the cardiovascular health benefits of polyphenols Prof Kevin D Croft University of Western Australia New England J Medicine 369(10), 954, 2013 Outline Population cohort studies How
MOL2NET, 2016, 2, 1
MOL2NET, 2016, 2, http://sciforum.net/conference/mol2net-02 1 SciForum MOL2NET Title of the paper Ikram Akhatou, Ángeles Fernández-Recamales *, Ana Sayago, Raúl González-Domínguez and Rafael Beltrán Department
Research. Summary. Introduction
Research Identification and characterization of MYB-bHLH-WD40 regulatory complexes controlling proanthocyanidin biosynthesis in strawberry (Fragaria 9 ananassa) fruits Jan G. Schaart 1 *, Christian Dubos
Why Are Peanuts Good For Me?
Why Are Peanuts Good For Me? Anna V.A. Resurreccion Professor Department of Food Science and Technology University of Georgia Griffin Campus Nutrition Long before energy bars There were energy capsules.
Plant Secondary Metabolites
Plant Secondary Metabolites Occurrence, Structure and Role in the Human Diet Edited by Alan Crozier Professor of Plant Biochemistry and Human Nutrition Institute of Biomedical and Life Sciences University
6 CHAPTER-6 TOTAL PHENOLIC AND FLAVONOID CONTENT DETERMINATION
6 CHAPTER-6 TOTAL PHENOLIC AND FLAVONOID CONTENT DETERMINATION 6.1 PHENOLIC COMPOUNDS Phenolic compounds are a group of chemical compounds that are widely distributed in nature. They are simple compounds
Agenda. Wood Chemistry. Stilbenes Biological Significance. Stilbenes. PSE 406/Chem E 470. Stilbenes. Flavonoids
Agenda PSE 06/Chem E 70 Lecture 1,, and Condensed Tannins PSE 06: Lecture 1 1 PSE 06: Lecture 1 Biological Significance Phenolic extractive found in the heartwood of softwoods» Particularly prevalent in
Linlin Liu 1, Yingying Li 1, Guangbiao She 1, Xianchen Zhang 1, Brian Jordan 2, Qi Chen 1, Jian Zhao 1* and Xiaochun Wan 1*
Liu et al. BMC Plant Biology (2018) 18:233 https://doi.org/10.1186/s12870-018-1440-0 RESEARCH Open Access Metabolite profiling and transcriptomic analyses reveal an essential role of UVR8- mediated signal
Measuring exposure to the polyphenol metabolome in observational epidemiologic studies: current tools and applications and their limits 1 3
Narrative Review Measuring exposure to the polyphenol metabolome in observational epidemiologic studies: current tools and applications and their limits 1 3 Raul Zamora-Ros, Marina Touillaud, Joseph A
Bivalent RNA Interference to Increase Isoflavone Biosynthesis in Soybean (Glycine max)
163 Vol.57, n.2: pp. 163-170, March-April 2014 ISSN 1516-8913 Printed in Brazil BRAZILIAN ARCHIVES OF BIOLOGY AND TECHNOLOGY A N I N T E R N A T I O N A L J O U R N A L Bivalent RNA Interference to Increase
The impact of conventional and organic agricultural approaches on blackcurrant polyphenol content and diversity. Sean Conner
The impact of conventional and organic agricultural approaches on blackcurrant polyphenol content and diversity Sean Conner Extraction Protocol 3 ml 60:40 water/acetonitrile 1% acetic acid 0.1 mg/ml morin
Loras College. Michael T. Wallerich Erin Dahlke Ph.D.
Loras College Michael T Wallerich Erin Dahlke PhD Flavonoids are a large family of polyphenolic compounds that are synthesized in plants and found in substances such as cocoa, apples, tomatoes, and grapes
Cloning, Expression, and Biochemical Characterization of Recombinant Putative Glucosyltransferases Clone 3 and 8 from Grapefruit (Citrus paradisi)
East Tennessee State University Digital Commons @ East Tennessee State University Electronic Theses and Dissertations 5-2012 Cloning, Expression, and Biochemical Characterization of Recombinant Putative
FFQ Whole diet Individual isoflavones (daidzein, genistein, glycitein, biochanin A and formononetin), enterolignans (enterolactone, enterodiol
Data in brief Table 1: Food composition databases used for phytochemical analysis of case control studies Ref Country (study Populatio Dietary Food items Phytochemical(s) addressed Food composition data
Journal of Integrative Agriculture 2016, 15(0): Available online at ScienceDirect
Journal of Integrative Agriculture 216, 15(): 6345-7 Available online at www.sciencedirect.com ScienceDirect RESEARCH ARTICLE Flavonoid content and expression analysis of flavonoid biosynthetic genes in
Developmental, genetic and environmental factors affect the expression of flavonoid genes, enzymes and metabolites in strawberry fruits*
Plant, Cell and Environment (29) 32, 1117 1131 doi: 1.1111/j.1365-34.29.1994.x Developmental, genetic and environmental factors affect the expression of flavonoid genes, enzymes and metabolites in strawberry
Allelic variation of soybean flower color gene W4 encoding dihydroflavonol 4-reductase 2
Yan et al. BMC Plant Biology 2014, 14:58 RESEARCH ARTICLE Open Access Allelic variation of soybean flower color gene W4 encoding dihydroflavonol 4-reductase 2 Fan Yan 1, Shaokang Di 1, Felipe Rojas Rodas
Transcriptional regulation of flavonoid biosynthesis in nectarine (Prunus persica) by a set of R2R3 MYB transcription factors
Ravaglia et al. BMC Plant Biology 213, 13:68 RESEARCH ARTICLE Open Access Transcriptional regulation of flavonoid biosynthesis in nectarine (Prunus persica) by a set of R2R3 MYB transcription factors Daniela
Characterization of Fruit Development and Ripening of Vaccinium angustifolium Ait. in Relation to Microclimate Conditions.
Characterization of Fruit Development and Ripening of Vaccinium angustifolium Ait. in Relation to Microclimate Conditions by Lara Dawn Gibson Submitted in partial fulfilment of the requirements for the
Institut für Angewandte Botanik, Technische M ikroskopie und Organische Rohstofflehre, Getreidemarkt 9, A-1060 Wien, Österreich
Flavonol Synthase Activity and the Regulation of Flavonol and Anthocyanin Biosynthesis during Flower Development in Dianthus caryophyllus L. (Carnation) K. Stich, T. Eidenberger, F. W urst Institut für
Chapter 1. General Introduction
Chapter 1 General Introduction Flavonoids are a large group of polyphenolic secondary metabolite compounds occurring in plants, a group containing more than 8000 known compounds arising from the great
Immunology, Faculty of Medicine University of Bari, Bari (Italy) Proprietà benefiche di latte, vino e olio extra vergine di oliva
Immunology, Faculty of Medicine University of Bari, Bari (Italy) Proprietà benefiche di latte, vino e olio extra vergine di oliva Professor Emilio Jirillo basketball court (about 400 m 2 ) mucosa-associated
Analysis of Antiviral and Chemoprotective Effects of Strawberry Anthocyanins
University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2013 Analysis of Antiviral and Chemoprotective Effects of Strawberry Anthocyanins Jennifer
Daqiu Zhao, Yao Jiang, Chuanlong Ning, Jiasong Meng, Shasha Lin, Wen Ding and Jun Tao *
Zhao et al. BMC Genomics 2014, 15:689 RESEARCH ARTICLE Open Access Transcriptome sequencing of a chimaera reveals coordinated expression of anthocyanin biosynthetic genes mediating yellow formation in
New insights into the regulation of anthocyanin biosynthesis in fruits
New insights into the regulation of anthocyanin biosynthesis in fruits 1 Laura Jaakola 1, 1 Climate laboratory Department of Arctic and Marine Biology University of Tromsø, NO-0 Norway Norwegian Institute
Supporting Information
Supporting Information Staility of Hydroxycinnamic Acid Derivatives, Flavonol Glycosides and Anthocyanins in Black Currant Juice Leenamaija Mäkilä,*, Oskar Laaksonen, Aino-Liisa Alanne, Maaria Kortesniemi,
David C. Nieman, DrPH, FACSM
David C. Nieman, DrPH, FACSM Director, Human Performance Lab, North Carolina Research Campus, Kannapolis, NC (niemandc@appstate.edu; 828-773-0056) Nutrition Reviews 66(6):310-320, 2008. Cannon Village
Title: The Correlation of Firmness Loss with Flavonoid Gene Expression and Pigment Synthesis in Rabbiteye Blueberries (Vaccinium ashei Reade)
Title: The Correlation of Firmness Loss with Flavonoid Gene Expression and Pigment Synthesis in Rabbiteye Blueberries (Vaccinium ashei Reade) Progress Report Grant Code: SRSFC Project # 2011-16 Name, Mailing
Seed Coat Color in Phaseolus vulgaris L. : Its Chemistry and Associated Health Related Benefits. George L. Hosfield
Seed Coat Color in Phaseolus vulgaris L. : Its Chemistry and Associated Health Related Benefits George L. Hosfield USDA, ARS, MWA, Sugarbeet and Bean Research Unit, Department of Crop and Soil Sciences,
Alimentazione e Salute. Prof. Chiara Tonelli Università degli Studi di Milano Dipartimento di BioScienze
Alimentazione e Salute Prof. Chiara Tonelli Università degli Studi di Milano Dipartimento di BioScienze Life expectancy around the world has steadily increased for nearly 200 years Sanitation, education
A healthy blend of polyphenols from Canadian wild blueberries and french grapes COGNITIVE HEALTH
A healthy blend of polyphenols from Canadian wild blueberries and french grapes COGNITIVE HEALTH Cerebelle TM : promoter of your brain health What is Cerebelle TM? Cerebelle TM is a standardized mixture
molecular function. The right hand y-axis indicates the number of annotated unigenes.
Takemura et al. Supplementary Fig.S1 Supplementary Fig. S1. GO assignment of all unigenes. The unigenes were mapped to three main categories: iological process, cellular component and molecular function.
Hydroxylation of the B-Ring of Flavonoids in the 3'- and 5'-Position with Enzyme Extracts from Flowers of Verbena hybrida
Hydroxylation of the B-Ring of Flavonoids in the 3'- and 5'-Position with Enzyme Extracts from Flowers of Verbena hybrida G. Stotz and G. Forkm ann Institut für Biologie n, Lehrstuhl für Genetik, Universität
Overview. Introduction
Identification of Polyphenolic Compounds in Berries from Different Vaccinium Species using Liquid Chromatography High Resolution Mass Spectrometry (LC-HR-MS) Claudia Ancillotti 1, Massimo del Bubba 1,
Supporting Information
Supporting Information Pang et al. 10.1073/pnas.0805954105 SI Materials and Methods Screening of hairy root lines. Total RNA was extracted from 15 independent TT2-transformed and two empty vector control
Genetic and environmental effects influencing fruit colour and QTL analysis in raspberry
DOI 10.1007/s00122-010-1334-5 ORIGINAL PAPER Genetic and environmental effects influencing fruit colour and QTL analysis in raspberry Susan McCallum Mary Woodhead Christine A. Hackett Angzzas Kassim Alistair
Impact of Phytonutrients on Inflammation
Impact of Phytonutrients on Inflammation Zhaoping Li, M.D., Ph.D. Associate Professor of Medicine Center for Human Nutrition David Geffen School of Medicine, UCLA TIME Feb. 23, 2004 Role of Inflammation
Consumer sensory analysis of high flavonoid transgenic tomatoes
This is the author s final, peer-reviewed manuscript as accepted for publication. The publisher-formatted version may be available through the publisher s web site or your institution s library. Consumer
Flavonoid structures. Other dietary polyphenols with biological activity
Flavonoid structures Polyphenol Bioactivity: Antioxidants? Prof Kevin D Croft University of Western Australia Riemersma RA et al QJM 1; 9:77-8 ther dietary polyphenols with biological activity Phenolic
9/21/2016. Composition and Compositional Changes During Development: Part II. V. Major Components of Fruits and Vegetables.
Composition and Compositional Changes During Development: Part II Dr. Jeffrey K. Brecht Horticultural Sciences Department, Gainesville Dr. Mark A. Ritenour Indian River Research and Education Center, Fort
THE IDENTIFICATION OF PHENOLIC ACIDS BY HPLC METHOD FROM STRAWBERRIES. Abstract
M. Cioroi. Scientifical Researches. Agroalimentary Processes and Technologies, Volume XI, No. 1 (2005), 211-216 THE IDENTIFICATION OF PHENOLIC ACIDS BY HPLC METHOD FROM STRAWBERRIES Maria Cioroi, Department
Identification and Antioxidant Capacity of Anthocyanin Pigment, and Expressional Analysis of Flavonoid Biosynthetic Genes in Colored Rice Strains
Identification and Antioxidant Capacity of Anthocyanin Pigment, and Expressional Analysis of Flavonoid Biosynthetic Genes in Colored Rice Strains Academic Dissertation Xiao Qiong Chen March 2013 Contents
Institute of Food Research
Institute of Food Research Health benefits of dietary polyphenols current evidence for plausible mechanisms Paul Kroon Polyphenols & Health Group Plant Natural Products & Health Programme paul.kroon@ifr.ac.uk
PHENOLIC COMPOUNDS IN TOMATO SUSCEPTIBLE AND RESISTANT TO MELOIDOGYNE INCOGNITA (KOFOID ET WHITE) CHITWOOD. by K. L. BAJAJ and R.
Nematol. medit. (1977), 5: 329-333. Department at Vegetable Crops, Punjab Agricultural University Ludhiana 141004, ndia PHENOLC COMPOUNDS N TOMATO SUSCEPTBLE AND RESSTANT TO MELODOGYNE NCOGNTA (KOFOD ET
Conversion Of Flavone To Isoflavone: A. Effects. Alyce Ruhoff and Erin Speetzen Ph. D.
Conversion Of Flavone To Isoflavone: A Computational ti Study on Substituent t Effects Alyce Ruhoff and Erin Speetzen Ph. D. University of Wisconsin Stevens Point Background: What are Flavonoids? Flavanoids
Using Recombinant Microorganisms for the Synthesis and Modification of Flavonoids and Stilbenes
C H A P T E R 36 Using Recombinant Microorganisms for the Synthesis and Modification of Flavonoids and Stilbenes Eun Ji Joo*, Brady F. Cress and Mattheos A.G. Koffas, *Department of Chemistry and Chemical
Eligibility The NCSF online quizzes are open to any currently certified fitness professional, 18 years or older.
Eligibility The NCSF online quizzes are open to any currently certified fitness professional, 18 years or older. Deadlines Course completion deadlines correspond with the NCSF Certified Professionals certification
High throughput metabolic approaches to identify common functionalities of dietary polyphenols
High throughput metabolic approaches to identify common functionalities of dietary polyphenols Augustin SCALBERT Clermont-Ferrand Antioxidant properties Polyphenols Health No dietary recommendations for
The Effects of Sugar Application on the Concentrations of Anthocyanin and Flavonol of Mahajanaka Mango (Mangifera indica Linn. cv.
Chiang Mai J. Sci. 2010; 37(2) 355 Chiang Mai J. Sci. 2010; 37(2) : 355-362 www.science.cmu.ac.th/journal-science/josci.html Contributed Paper The Effects of Sugar Application on the Concentrations of
AUSTRALIAN FUNCTIONAL NUTRACEUTICAL
Botanical Innovations PURE NATURE AUSTRALIAN FUNCTIONAL NUTRACEUTICAL FLAVOURS, FRAGRANCES & INGREDIENTS Plant Extracts-Naturally Fermented Fruits and Vinegars Cold Pressed Oils-Essential Oils-Phenolic
Isoflavonoid Production by Genetically
Isoflavonoid Production by Genetically 54 Engineered Microorganisms Brady F. Cress, Robert J. Linhardt, and Mattheos A. G. Koffas Contents 1 Metabolic Engineering... 1650 1.1 Background... 1650 1.2 Metabolic
Negative Regulation of Anthocyanin Biosynthesis in Arabidopsis by a mir156-targeted SPL Transcription Factor W OA
This article is a Plant Cell Advance Online Publication. The date of its first appearance online is the official date of publication. The article has been edited and the authors have corrected proofs,
XXIV National Congress Italian Phytopathological Society (SIPaV) BOOK OF ABSTRACTS. Ancona, 5-7 September, 2018
XXIV National Congress Italian Phytopathological Society (SIPaV) BOOK OF ABSTRACTS UNIVERSITÀ POLITECNICA DELLE MARCHE Department of Agricultural Food and Environmental Sciences Edited by Gianfranco Romanazzi,
6/8/2015 FOOD CONSTITUENTS. Determination of phytochemical components with advanced analytical methods Part I. Phenolic and polyphenolic compounds
Qualitative, physicochemical and phytochemical indicators of cherry fruit quality [2-4 June 2015] Determination of phytochemical components with advanced Part I Maria Isabel Gil CEBAS CSIC, Murcia, Spain
Dissertation zur Erlangung des Doktorgrades der Fakultät für Chemie und Pharmazie der Ludwig-Maximilian-Universität München
Dissertation zur Erlangung des Doktorgrades der Fakultät für Chemie und Pharmazie der Ludwig-Maximilian-Universität München Arabidopsis flavonoid glycosylation impacts on phenylpropanoid biosynthesis and
Metabolic Engineering of Anthocyanin Biosynthesis in Escherichia coli
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, July 2005, p. 3617 3623 Vol. 71, No. 7 0099-2240/05/$08.00 0 doi:10.1128/aem.71.7.3617 3623.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved.