Mumps disease outbreak in Davangere district of Karnataka, India

Transcription

1 [Downloaded free from on Friday, June 12, 2015, IP: ] Indian Journal of Medical Microbiology, (2015) 33(3): Original Article Mumps disease outbreak in Davangere district of Karnataka, India *CG Raut, DP Sinha, H Jayaprakash, H Hanumiah, MJ Manjunatha Abstract Background: Mumps is a vaccine-preventable disease that usually occurs as a parotitis, but it can also lead to several life- threatening complications, including pancreatitis, meningitis and encephalitis. Objective: To determine and diagnosis of mumps disease, which is communicable disease usually affects childrens. Although it is seen worldwide, but outbreaks not common in India. Materials and Methods: Thirty one suspected mumps cases, who presented to the unimmunized population of Chikkahallivana village in Davangere district of Karnataka, India in January 2014, with clinical evidence of fever, cervical lymphadenitis and ear pain, manifest with self-limited uni-or bilateral parotitis. A total of 31 cases consisting of 31 blood and 31 throat swabs were tested for diagnosis of mumps disease. Results: Of the 31 suspected cases, laboratory results showed 18 positive for mumps IgM antibodies and 7 cases showed presence of mumps virus RNA by RT-PCR using MV specific nested primers. From 31 cases, 5 were positive with both the methods. Conclusion: We confirmed the cases by serological as well as a sensitive RT-nested PCR-based method and sequencing results for the molecular identification of mumps infection. Sequencing results of the SH gene identified outbreak strain as genotype C, which was consistent with other outbreaks in India. Key words: IgM and RT-PCR, mumps disease, unimmunized Introduction Mumps disease is caused by Mumps virus (MV), which belongs to the genus Rubulavirus of the subfamily Paramyxovirinae in the family Paramyxoviridae. MV is antigenically monotypic and spreads by respiratory droplets. Mumps is a vaccine preventable disease that is endemic in most parts of the world. [1] Mumps disease outbreak occurred in an unvaccinated population of Chikkahallivana village in Davangere district of Karnataka, India in January Most of the affected unimmunized population belonged to a worker community who opted out of scheduled vaccination. The disease was managed using provincial mumps control guidelines, including programmes for enhanced surveillance and public awareness, in the specific geographic affected region. After the outbreak resolved, we utilized clinical and laboratory *Corresponding author ( < cgraut@gmail.com>) National Institute of Virology (CGR, DPS, HJ, HH, MJM), Bangalore Unit, Bangalore Near NIMHANS, Karnataka , India Received: Accepted: Quick Response Code: Access this article online Website: PMID: *** DOI: / data to investigate the period of mumps virus detection, the onset of parotitis and to diagnose laboratory findings with mumps status. Following natural infection, 10% of infected individuals remain asymptomatic: 40 50% develops a nonspecific respiratory prodrome and ear pain, and the remaining 30 40% manifest with self limited uni or bilateral parotitis and cervical lymphadenitis. However, the virus can cause severe complication including meningitis, deafness, pancreatitis and orchitis. [2] The epidemic curve is presented in Figure 1, with the beginning of the outbreak in the second week of January, the peak in the last week of January, and the last cases in the first date of February. Mumps vaccination has been incorporated into the regular immunization schedule of many countries, usually along with measles and rubella vaccines in a triple formulation. These vaccines have enabled the WHO to establish global strategies for the advanced control of measles and rubella leading to an elimination target in some regions. However, in contrast to rubella and measles, secondary vaccine failure occurs frequently in the case of mumps and circulation of MV within highly vaccinated populations has been frequently reported. [3 8] Twelve different genotypes of MV based on genetic variation in the SH gene are currently recognized by the WHO. [2,9,10] MV shows a distinct geographic distribution where more than one genotype may circulate simultaneously in

2 [Downloaded free from on Friday, June 12, 2015, IP: ] July-September 2015 Raut, et al.: Mumps outbreak in Davangere district of Karnataka, India 379 A study subject was considered to have mumps if presented with one of the symptoms criteria and any of the minor criteria. [17] Figure 1: Number of cases of mumps reported during the period from 2 nd week in January 2014 till the first week of February, 2014 Only the clinical definition of mumps was considered as the index case was already evaluated by experts. [17] The household was a sampling unit and the villagers were extensively covered by house to house visits made by the teams. With regard to the uni or bilateral parotitis or fever cases in the household in the last 3 weeks, if any such case was found, extensive information was collected, for that, study subject enquiries about mumps cases were made from the mothers or responsible persons. Information was collected regarding age, gender, Table-1 history of mumps in the last 3 weeks. a region. [3] The magnitude and epidemiology of mumps infection in India are poorly understood. There are few literatures available in PubMed related to mumps virus circulation in India. [11 14] However, detailed investigations on sporadic cases or outbreak (s) of mumps are necessary to understand the circulation of wild type viruses in the context of the global epidemiology of mumps. [15,16] This study describes diagnostic tests performed for lab confirmation of mumps cases from a village Chikkahallivana of Karnataka state, India. Materials and Methods Study area Chikkahallivana is a small village in Davangare district, Karnataka. The district headquarters of Davangare is located at National Highway 4 (Chennai to Mumbai National Highway), Chikkahallivana village is 40 kms away from the district of Davangare and has an estimated population of 364 being rural. The village dwelling setting has two lanes namely, Lane 1 and Lane 2. Study design A cross sectional survey was carried out by three members from the National Institute of Virology, Bangalore Unit with technical support from state Government district medical officer and it was decided that any identified case will be provided necessary treatment at the earliest possible time. Sampling The Chikkahallivana village was covered under this study. The contact was made with the village members to seek their cooperation for the investigation. A total village was surveyed by an investigating team in village who reported having mumps cases. The standard case definition was used for diagnosis of mumps. A disease symptoms criteria was used to clinically identify the mumps cases. Samples were collected from a total of 31 patients. Distribution of the samples was 31 blood and 31 throat swabs. Throat swabs were collected in virus transport medium. All the samples were carried on cold chain to the laboratory for diagnosis, according to WHO guidelines for specimen collection of mumps virus detection. [18] Serological test The blood samples were processed to have the best quality serum and further tested for Mumps IgM antibodies. The test was done with standard positive control using IgM ELISA kit (Calbiotech, CA) as per the protocol. The kit is used for qualitative detection and quantitative determination of specific IgM antibodies to Mumps virus in human serum. Molecular diagnosis Total RNA was extracted from 140 µl of throat swab and blood samples using a QIAmp viral RNA kit (Qiagen, Valencia, CA) according to the manufacturer s protocol. RNA was eluted in 50 µl of nuclease free water. For the conventional PCR gel based platform, a minimum of one standard positive control RNA and one negative control along with samples of target RNA included. We used diagnostic RNA virus based nested reverse transcriptase PCR (RT PCR) to detect mumps virus from clinical samples. [19] A precautions were considered to prevent cross contamination. First round of RT PCR was done using a standard primer pairs (PRV1 forward primer 5 CGCGTGGTCTACGGGGACACGGA 3 and PRV1 reverse primer 5 ATGACGCC GATGTACTTCTTCTT 3 ) to amplify a 600 bp fragment in the SH gene which included the 456 bp amplicon recommended for genotyping. [19] PCR conditions for RT-PCR were reverse transcription step at 42 C for 45 min; followed by 94 C for 2 min for pre denaturation and denaturation at 94 C for 1 min, annealing at 47 C for 1 min and extension 68 C for 2 min, and an extension at 72 C for 7 min for 35 cycles.

3 [Downloaded free from on Friday, June 12, 2015, IP: ] 380 Indian Journal of Medical Microbiology vol. 33, No. 3 Sr. No. Specimen ID Table 1: Mumps sample distribution and results of IgM and RT-PCR Date of Date of specimen Age Sex onset collection (yr) Sample Type IgM results (only serum) RT-PCR results (only TS) 1 OV Blood, TS F Positive Negative 2 OV Blood, TS M Positive Positive 3 OV Blood, TS M Positive Positive 4 OV Blood, TS F Positive Positive 5 OV Blood, TS F Negative Positive 6 OV Blood, TS M Positive Negative 7 OV Blood, TS M Negative Negative 8 OV Blood, TS M Positive Negative 9 OV Blood, TS M Negative Negative 10 OV Blood, TS M Negative Negative 11 OV Blood, TS M Negative Negative 12 OV Blood, TS F Negative Positive 13 OV Blood, TS F Positive Positive 14 OV Blood, TS F Positive Negative 15 OV Blood, TS F Negative Negative 16 OV Blood, TS F Negative Negative 17 OV Blood, TS F Positive Negative 18 OV Blood, TS F Positive Negative 19 OV Blood, TS F Negative Negative 20 OV Blood, TS F Positive Negative 21 OV Blood, TS F Negative Negative 22 OV Blood, TS M Negative Negative 23 OV Blood, TS F Positive Negative 24 OV Blood, TS M Positive Negative 25 OV Blood, TS F Positive Negative 26 OV Blood, TS F Negative Negative 27 OV Blood, TS F Positive Positive 28 OV Blood, TS F Negative Negative 29 OV Blood, TS F Positive Negative 30 OV Blood, TS F Positive Negative 31 OV Blood, TS F Positive Negative Thermocycling was done in a PCR system (Applied Biosystems, Foster City, CA) without an oil overlay. The second PCR round was performed including 1 µl of undiluted first PCR product as template in a reaction containing 10 mm Tris HCl (ph 8.3), 50 mm KCl, 200 µm each dntp, 2.5 mm MgCl 2, 2.5 units of Taq polymerase (Qiagen, Germany), 10 pmol each of internal control primers PRV2 (5 GGGACACGGACTCGGTCTTC 3 ) and PRV2 (5 CCGGAAGG TCTTCTCGCACTC 3 ) and 10 pmol each of forward and reverse primers. Nested PCR assays were subjected to an initial cycle of 94 C for 2 min and 30 cycles of 94 C for 1 min, 50 C for 1 min and 72 C for 1 min, followed by final incubation at 72 C for 5 min. After amplification, 10 µl portion of each product was analyzed by agarose gel electrophoresis utilizing 2.0% agarose gel (Sigma Aldrich) and gels were stained with ethidium bromide at 5 µg/ml and visualized by Gel documentation system (Bio Rad, USA) using the software Quantity One version to determine the band size. A 1 kb DNA ladder (Invitrogen, Life Technologies) was used as a molecular ladder. Nucleotide sequencing for genotyping and phylogenetic analysis The positive mumps viruses of second round PCR products of representative samples were sequenced by dideoxy terminator sequencing method and comparison of the nucleotide sequence was performed using the NCBI BLAST programme with the GenBank database. Mumps SH gene sequence obtained in this study confirmed with both strands and aligned with WHO reference SH gene sequence [10] using software ClustalW version The viral DNA sequence was also deposited in Genbank (

4 [Downloaded free from on Friday, June 12, 2015, IP: ] July-September 2015 Raut, et al.: Mumps outbreak in Davangere district of Karnataka, India 381 Results Serological investigation of the clinical samples showed 18 children (58%) positive for mumps IgM antibodies, from the total 31 samples subjected to serological analysis. In majority, children below the age of 10 years were found positive for mumps IgM antibodies. Total of six children were found positive between the age of 1 6 years, 11 children between the age of 7 13 years and one positive case of 30 age. Out of total 18 children, five boys and 13 girls were found positive for the mumps IgM antibodies Table 1. The results revealed girls were predominantly affected with the mumps disease as compare to boys [Figure 2]. Molecular assay results Mumps virus was detected from throat swab, using nested RT PCR and PCR product size were 448bp with primers targeting the SH genes [Figure 3]. Out of 31 cases, 7 (22%) were confirmed by RT PCR. All acute phase specimens are positive by RT PCR. The age group involved was 1 15 yrs. It included two boys and five girls positive with RT PCR results. Genotyping results Sequence information revealed that the sequence from infected mumps virus share 99% homology with Mumps virus strain MuVi/Chennai.IND/45.12 small hydrophobic protein (SH) gene, complete cds having Genbank accession no. KC from Chennai. Sequencing of the SH gene identified outbreak strain as genotype C, was named as MuVi/Davangare. IND and deposited in Genbank (Acc. No. KJ468460, KJ468461) which was consistent with other outbreaks in India. [11 13] The phylogeny obtained by analysis of representative strains of all genotypes and our sample sequences allowed quick and easy differentiation of the corresponding genotype [Figure 4]. Phylogenetic tree of mumps virus genotypes based on the 316 nucleotides of the entire small hydrophobic gene: Our isolated virus sequences were matched with WHO reference strains. Neighbour joining methods of MEGA 5 programme were used. [20] The parameter employed was Kimura 2 parameter model and the robustness of the internal branches was determined by 1000 bootstrap replications. The horizontal length of the bar denotes percentage difference between sequences (see scale at bottom) and the bootstrap numbers (%) are given at each node. The clustering pattern clearly divides two groups, each representing a genotype group included in this study. The bootstra P values ranges from for genotype A, F, J and for C, E, D, K, M, H, L, I, B, N and G representing of diversity in accession of these mumps strain. The sequence identity of C genotypes with the WHO reference genotype C was ranged from 39 to 99. MuVi/Davangare isolate is close to MuVi/Chennai stain. Furthermore, articles reporting sets of data show temporal changes in the dominant genotype, as well as co circulation of genotypes in the same or in neighbouring states. According to our findings, these different lineages showed within genotype C that the virus responsible for an outbreaks in South India was similar as earlier reported in India. [11 13] Discussion The use of vaccine in developed countries successfully reduced mumps virus infection, though outbreaks are often reported. Due to absence of effective vaccination programmes, mumps is still a major health problem in several developing countries. Mumps disease burden in India is still not completely understood. Few published reports indicate more occurrence of the disease in children of the age group 5 9 years. [4,5] In the present study it was shown that mumps virus exhibited a positive laboratory result is defined as either: IgM positive or virus detection by RT PCR. Suspected mumps cases were confirmed by systematic laboratory testing which included IgM test, RT PCR and sequencing analysis. A positive IgM test result indicates current infection or reinfection. The detection of mumps virus by RT-PCR Figure 2: Mumps samples age and sex- wise distribution in Chikkahallivana village Figure 3: Detection of SH gene by Nested PCR. Lane M: DNA Ladder (1 kb); Lane 1 to 7: Positive Samples; Lane 8: Negative Control; Lane 9: Positive Control

5 [Downloaded free from on Friday, June 12, 2015, IP: ] 382 Indian Journal of Medical Microbiology vol. 33, No. 3 Figure 4: Phylogenetic relationships of the SH sequences of the reference strains and NIV BU sequenced strain for mumps genotyping method confirms the outbreak due to mumps virus and sequencing analysis further revealed circulation of 'C' genotype as reported earlier in South India. Acknowledgement We are thankful to Dr D. T. Mourya, director NIV for providing constant support and valuable suggestions during progression of this study. References 1. Hatchette TF, Mahony JB, Chong S, LeBlanc JJ. Difficulty with mumps diagnosis: What is the contribution of mumps mimickers? J Clin Virol 2009;46: Jin L, Rima B, Brown D, Orvell C, Tecle T, Afzal M, et al. Featherstone D. Proposal for genetic characterization of wild type mumps strains: Preliminary standardization of the nomenclature. Arch Virol 2005;150: Echevarria JE, Castellanos A, Sanz JC, Perez C, Palacios G, Martinez de, et al. Circulation of mumps virus genotypes in Spain from 1996 to J Clin Microbiol 2010;48: Geeta MG, Kumar PK. Mumps need for urgent action. Indian Pediatr 2004;41: Ghatage ST, Kakade GM. An outbreak of mumps meningoencephalitis in Sangli district. Indian Pediatr 2007;44: Guidelines for the prevention and control of mumps outbreaks in Canada. Available from: aspc.gc.ca/publicat/ ccdr rmtc/10pdf/36s1 eng [Last accessed on 2014 May 20]. 7. Dayan GH, Quinlisk MP, Parker AA, Barskey AE, Harris ML, Schwartz JM, et al. Recent resurgence of mumps in the United States. N Engl J Med 2008;358: Inou Y, Nakayama T, Yoshida N, Uejima H, Yuri K, Kamada M, et al. Molecular epidemiology of mumps virus in Japan and proposal of two new genotypes. J Med Virol 2004;73: Johansson B, Tecle T, Orvell C. Proposed criteria for classification of new genotypes of mumps virus. Scand J Infect Dis 2002;34: Palacios G, Jabado O, Cisterna D, de Ory F, Renwick N, Echevarría JE, et al. Molecular identification of mumps virus genotypes from clinical samples: Standardized method of analysis. J Clin Microbiol 2005;43: Vaidya SR, Chowdhury DT, Kumbhar NS, Tomar R, Kamble MB, Kazi MI. Circulation of two mumps virus genotypes in an unimmunized population in India. J Med Virol 2013;85: Jeevan M, Sambantham S, Thangam M. Characterization of mumps virus genotype C among patients with mumps in India. Indian J Med Microbiol 2013;31: John TJ. An outbreak of mumps in Thiruvanthapuram district. Indian Pediatr 2004;41: Vandana KE, Arunkumar G, Bairy I. Role of laboratory in rapid diagnosis of atypical mumps. Braz J Infect Dis 2010;14: Ruijs WL, Hautvast JL, Akkermans RP, Hulscher ME, Velden KV. Role of schools in the spread of mumps among unvaccinated children: A retrospective cohort study. BMC Infect Dis 2011;11: Peltola H, Kulkarni PS, Kapre SV, Paunio M, Jadhav SS, Dhere RM. Mumps outbreaks in Canada and the United States: Time for new thinking on mumps vaccines. Clin Infect Dis 2007;45: Muhlemann K. The molecular epidemiology of mumps virus. Infect Genet Evol 2004;4: Centers for Disease Control and Prevention. Atlanta, GA: US Department of Health and Human Services, CDC; Mumps. Materials and methods for specimen collection, storage, and shipment Available from: lab/specimen collect.html [Last accessed on 2014 May 20]. 19. Royuela E, Castellanos A, Sanchez Herrero C, Sanz JC, Ory FD, Echevarria JE. Mumps virus diagnosis and genotyping using a novel single RT PCR. J Clin Virol 2011;52: Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance and maximum parsimony method. Mol Biol Evol 2011;28: How to cite this article: Raut CG, Sinha DP, Jayaprakash H, Hanumiah H, Manjunatha MJ. Mumps disease outbreak in Davangere district of Karnataka, India. Indian J Med Microbiol 2015;33: Source of Support: Nil, Conflict of Interest: None declared