WT-TP53 DLBCL WT-TP53 GCB-DLBCL
|
|
|
- Tracy Wheeler
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTAL TABLES AND FIGURES Supplemental Table S1. Summary of gene expression profiling analysis results listing counts of significant differentially expressed transcripts between defined two groups (A) DLBCL FDR DLBCL WT-TP53 DLBCL MUT-TP53 DLBCL (B) GCB-DLBCL FDR GCB-DLBCL WT-TP53 GCB-DLBCL MUT-TP53 GCB-DLBCL (C) ABC-DLBCL FDR WT-TP53 ABC-DLBCL WT-p53 ABC-DLBCL MUT-TP53 ABC-DLBCL
2 (D) WT-TP53 FDR In WT-p53 + vs WT-p53 subsets, In MUT-p53 subset, In MUT-p53 + subset, (E) WT-TP53 FDR WT-p53 + vs WT-p53 In p63 subset, WT-p53 + vs WT-p53 In p63 + subset, WT-p53 + vs WT-p (F) MUT-TP53 In p63 + subset, MUT-p53 + FDR MUT-p53 + vs WT-p53 In p63 subset, MUT-p53 + vs MUT-p53 vs MUT-p
3 Abbreviations: DLBCL, diffuse large B-cell lymphoma; FDR, false discovery rate; GCB, germinal center B-cell like; ABC, activated B-cell like; WT, wild-type; MUT, mutated. 3
4 Supplemental Table S2. Significant differentially expressed genes between p63 + and p63 DLBCL with MUT-TP53 (false discover rate < 0.05) # of probes # of genes MUT-TP53 DLBCL FDR < 0.05 Upregulated TP63, PDLIM4, ASMTL, ARSD, MAGED4/MAGED4B, IL4I1, CALR, MYH6/MYH7, TCF15, LOC729234, PREX1, TSPAN4, BAIAP2, MTHFR, PTP4A3, SNCA, GRASP, CMKLR1, ARHGEF2, DOK1, SDC4, COL7A1, PRG2, KCNQ2, TRPC4AP, IL8RB, PPP2CB, FAM26F, CDK6, FBLL1, RAI1, KIAA0427, ITPRIPL2, SOBP, PFDN4, SNX11, IL17RC, GRRP1, FBF1, CBS, RARS2, VPS53, CCL27, ATP2A2, ZMYND10, CCDC149, SLC5A8, ISLR2, OSBPL5, RGN, PARP10, BST1, C14orf56, B3GNT8, DKFZP547L112, PSMD4, FPGS, TFRC, SPDEF, KIAA1652, USP36, SEMA6B, CADM4, C21orf2, CTSD, C1orf183, SSTR3, COL27A1, DIO2, SFTPC, PEAR1, LOC /MUC5AC, TEAD2, AMOT, NOS3, ABHD12, C22orf31, LYPD1, KCP, PPARGC1A, MGC16025, SDK2, AHDC1, PCSK1N, MED16, RNF24, FOXN4, RIN1, BIRC7, LOC390205, LOC389043, PARD3B, NHSL1, PAX2, CYTH3, TWIST2, C8orf58/PDLIM2, KLK12, ELK4, AKT1S1, OR7A17, CEMP1, GGT7, MSLN, LOC145757, GABBR2, TMEM132A, RCN3, TRPV4, S1PR2, RHOV, GPATCH3, CTNS, SPEF1, POU5F1B, TYMP, ADAMTSL1, PCBP3, ANGPTL4, C16orf35, C14orf180, LOC728288, PRRT2, FLT4, TLE6, PRKCA, ARMC8, C16orf42, EPN1, UBTD1, MAP1LC3A, SLC39A14, TUSC5, CHRD, KIF19, C1orf46, C7orf69, WFDC2, TM6SF2, LOC91450, C14orf176, HPGD, C9orf7, LOC , KIF25, DIO3OS, SLC31A1, WDR72, FLJ36208, DPYSL4, KCTD15, TREML4, LOC , CTBP2, ENO3, METTL12, LTBP4, KLK3, NYX, PCDHB6, PCDHA6, NEU4, FBXO31, LOC404266, MARK2, NUDT2, C10orf72, THBD, GLP1R, UCHL5, LOC338667, ZFP36L1, ZPLD1, ADRA1D, IL4, LOC401134, BPESC1, CYP4Z1, PTGER3, CIDEA, PREX2, LIPC Downregulated SETD5, STRBP, ITGB1, ZNF141, ZNF91, MSI2, BACH2, SLMO2, DDX18, CDC2L5, LOC401504, ZNF439, CXCR4, MTMR2, ZNF226, LOC , CFDP1, VPS35, RNF138, SLC25A36, BPTF, ZDHHC20, COX11, PM20D2, IPO5, TMEM97, RBM15, RERE, LYRM7, RBM27, ATM, LOC220930, ATP5C1, BDP1, PIGP, RC3H2, FNTA, LOC /SUZ12/SUZ12P, ARHGAP15, SNHG6, 4
5 Note: The order of gene lists is based on the fold changes. PCNP, RCBTB1, ALS2CR8, EIF2A, NMD3, RBM26, KBTBD2, TAF9B, LUC7L3, SMC5, SMAD2, CEBPG, TTC3, ZCCHC7, SENP5, CCDC75, PSIP1, PRPF4B, PAK2, PPP1R2, FAM13B, PPP2R5C, ZHX2, IAH1, ZNF638, NKTR, CLPX, ALG8, C19orf2, LOC645513, POLR2K, ARL5B, MRPL30, LRCH3, PRKRA, SET, SLC16A4, TPR, TOPBP1, UBR5, HAT1, ZNF460, TARDBP, MAP3K7, LOC641298, ITCH, PRPF39, SNX30, DDX17, PHF10, ELF1, UPF2, YY1, CCDC7, CTDSPL2, C1orf124, CRLF3, DYNC1LI1, MRPS30, LRRC58, FCHSD2, SPEN, KPNA1, SPOPL, ADNP, GKAP1, UNK, SLC35F5, LOC254128, CAMK2D, CCAR1, TTC37, PUM1, ZBTB44, CPSF6, NFYB, ZNF33B, MLLT10, TOP2B, DPY30/MEMO1, GPD1L, ANKHD1/ANKHD1-EIF4EBP3, YWHAB, EBAG9, RAD21, RPL22, TRAPPC2 TRAPPC2P1, TSN, MATR3, AMY2B/RNPC3, STX17, PDCD6IP, PPPDE1, KAT2B, KIAA0564, BTF3L4, LMBRD1, GLUD2, ACTR8, TTC14, RRAGC, NCBP1, ATG3, SSB, FXR1, YWHAZ, FLJ10213, CNBP, PDS5B, RPL23A, SETD2, HERC4, KIAA2026, PAPOLA, CCNL1, MLH1, DCLRE1C, MCCC1, RPL34, C1orf27, ZNF709, VPRBP, ZSCAN29, C17orf80, LOC /LOC /LOC , PPP4R2, GTF2F2, VPS13B, PIGL, TMEM216, LOC400713, CCNL1, AKIRIN1, ZNF253, TAF7, ORC4L 5
6 Supplemental Table S3. Significant differentially expressed genes between p63 + and p63 patients with WT-p53 ABC-DLBCL (false discovery rate < 0.20) Function categories Upregulated Downregulated Signaling, immune response, inflammation Development, differentiation Cell growth and proliferation, gene expression, metabolism FOXD1 SOX4 KLHDC5, NONO, PCNT, KDM2B, RRM1, PRPS2, PDHA1, FDXR, UTY, RBM10 GPR182, SOX14, TPO, CTAG2, ADORA1, RNASE7, OR5AK4P CCND2, ZNF221, ZNF287 Apoptosis, cell death, DNA damage TP63, MKL1 response Protein folding, protein translocation, CCT3, AGBL5 heat shock Transport, mobility, cell adhesion WDR66, TIMM9, NLGN4Y ATP11A IncRNA and other unknown function DNAJC5B, C6orf59, NEAT1, CLDND1, CCDC141, TMEM106C, WDR41 QRICH2 6
7 SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1. (A-B) In patients with WT-TP53, the mean expression level of p63 was significantly higher than that of WT-p53; in contrast, in patients with MUT-TP53, the mean expression level of p63 was significantly lower than that of MUT-p53. (C) The p63 + DLBCL group showed trends of higher p53 protein compared with the p63 DLBCL group, but the P values was not significant. (D-G) Prognostic analysis for TP63 mrna expression levels in DLBCL patients. Patients were initially divided into 3 groups for survival analysis according to the mean values of TP63 mrna expression: low TP63 mrna (< mean standard deviation), high TP63 mrna (> mean + standard deviation), and intermediate TP63 mrna levels (the remaining cases). Since there were no significant difference in survival outcomes between the low TP63 mrna and intermediate TP63 mrna groups, these two groups were combined together to compare with the high TP63 mrna group. (D-E) TP63 mrna levels did not correlate with survival in GCB-DLBCL significantly. (F-G) High TP63 mrna levels correlated with significantly better progression-free survival (PFS) and a strong trend of better overall survival (OS) in ABC-DLBCL patients. Supplemental Figure S2. Prognostic analysis for p63 expression in the validation DLBCL cohort. (A) With a cutoff value of +, p63 expression was associated with significantly better PFS in overall DLBCL set and subsets with ABC-DLBCL or with International Prognostic Index (IPI) scores >2. (B) With a cutoff value of >5% for p63 +, p63 expression was associated with significantly better PFS in patients with ABC-DLBCL, and a strong trend toward better PFS in patients with IPI scores >2. 7
8 Supplemental Figure S3. Gene expression profiling analysis of p63 expression correlating with TP53 status. (A) Genes significantly differentially expressed between p63 + and p63 patients with GCB-DLBCL and WT-TP53 (false discovery rate < 0.30). (B) Genes significantly differentially expressed between p63 + and p63 ABC-DLBCL patients with no or low (< 20%) levels of wild-type p53 expression (false discovery rate < 0.20). (C) Genes significantly differentially expressed between p63 + and p63 patients with GCB-DLBCL and MUT- TP53 (false discovery rate < 0.20). (D) Genes significantly differentially expressed between p63 + and p63 patients with ABC-DLBCL and MUT-TP53 (false discovery rate < 0.15) 8
9 A B C C Supplemental Fig. S1 D E F G Months Months
10 A B Cutoff for p63 + Cutoff for p63 + :> 5% Supplemental Fig. S2 Months Months Months Months
11 Supplemental Fig. S3 A B WT-TP53/p63 + GCB WT-TP53/p63 GCB WT-p53 /p63 + ABC WT-p53 /p63 ABC C MUT-TP53/p63 + GCB MUT-TP53/p63 GCB D MUT-TP53/p63 + ABC MUT-TP53/p63 ABC
RNA sequencing of cancer reveals novel splicing alterations
RNA sequencing of cancer reveals novel splicing alterations Jeyanthy Eswaran, Anelia Horvath, Sucheta Godbole, Sirigiri Divijendra Reddy, Prakriti Mudvari, Kazufumi Ohshiro, Dinesh Cyanam, Sujit Nair,
Quantitative Real Time PCR (RT-qPCR) Differentiation of human preadipocytes to adipocytes
Quantitative Real Time PCR (RT-qPCR) First strand cdna was synthesized and RT-qPCR was performed using RT2 first strand kits (Cat#330401) and RT2 qpcr Master Mix (SABioscience, Frederick, MD). Experiments
Supplemental Table 1. List of genes and mature shrna sequences identified from the shrna screen in BRCA2-mutant PEO1 cells.
Guillemette_Supplemental Table 1 Gene Mature Sequence Gene Mature Sequence ATTCATAGGATGTCAGCAG LOC157193 TATGCGTAAGTAATAAATTGCT TTAGTTCTGTCTTGGAGG LOC152225 CGCATATATGTTCTGACTT ALDH2 CACTTCAGTGTATGCCT
devseek (Sequence(Analysis(Panel(for(Neurodevelopmental(Disorders
ACSL4 Mental/retardation,/XBlinked/63 XLBR ADSL Adenylosuccinase/Deficiency AR AFF2 Mental/retardation,/XBlinked,/FRAXE/type XLBR ALG6 Congenital/disorder/of/glycosylation/type/Ic AR ANK3 Mental/retardation,/autosomal/recessive/37
Supplementary Figures. Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated. for each lesion type.
Supplementary Figures Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated for each lesion type. a b Supplementary Figure 2. Non-negative matrix factorization-derived
A genome-wide association study identifies vitiligo
A genome-wide association study identifies vitiligo susceptibility loci at MHC and 6q27 Supplementary Materials Index Supplementary Figure 1 The principal components analysis (PCA) of 2,546 GWAS samples
Is genomic grading killing histological grading?
Is genomic grading killing histological grading? Christos Sotiriou MD PhD Fonds National de Recherche Scientifique (FNRS) Université Libre de Bruxelles (ULB) Institut Jules Bordet Histological Grade and
Supplementary Table 1. Information on the 174 single nucleotide variants identified by whole-exome sequencing
Supplementary Table 1. Information on the 174 single nucleotide s identified by whole-exome sequencing Chr Position Type AF exomes Database 1 10163148 A/G UBE4B missense 0.000326 1534 2 98 1 4.44 Damaging
POT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia
POT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia Andrew J. Ramsay, Víctor Quesada, Miguel Foronda, Laura Conde, Alejandra Martínez-Trillos, Neus Villamor, David Rodríguez, Agnieszka
Pushing%PET%Imaging%to%the% Cellular%Level:%Development%of%a% Radioluminescence%Microscope%
Stanford University School of Medicine Department of Radiation Oncology Division of Radiation Physics Pushing%PET%Imaging%to%the% Cellular%Level:%Development%of%a% Radioluminescence%Microscope%! Guillem!Pratx,!PhD!
Appendix table of content: Appendix Table S1. Appendix Table S2. Appendix Figure S1. Appendix Figure S2. Appendix Methods.
Appendix table of content: Appendix Table S Appendix Table S Appendix Figure S Appendix Figure S Appendix Methods Appendix Legends Appendix Methods mir--3p putative targets in silico analysis: Predictions
Supplementary Material. Table S1. Summary of mapping results
Supplementary Material Table S1. Summary of mapping results Sample Total reads Mapped (%) HNE0-1 99687516 80786083 (81.0%) HNE0-2 94318720 77047792 (81.7%) HNE0-3 104033900 84348102 (81.1%) HNE15-1 94426598
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature12912 Figure S1. Distribution of mutation rates and spectra across 4,742 tumor-normal (TN) pairs from 21 tumor types, as in Figure 1 from Lawrence et al. Nature
Supplementary information: Forstner, Hofmann et al.
Supplementary information: Forstner, Hofmann et al., Genome-wide analysis implicates micrornas and their target genes in the development of bipolar disorder Table of contents Supplementary Figure 1: Regional
Supplementary Figure 1. Microarray data mining and validation
Supplementary Figure 1. Microarray data mining and validation Microarray (>47,000 probes) Raw data Background subtraction NanoString (124 genes) Set cut-off and threshold values Raw data Normalized to
Epigenetic Regulation by Chromatin Activation Mark H3K4me3 in Primate Progenitor
Epigenetic Regulation by Chromatin Activation Mark H3K4me3 in Primate Progenitor Cells within Adult Neurogenic Niche Richard S. Sandstrom 1, Michael R. Foret 2, Douglas A. Grow 2,3, Eric Haugen 1, Christopher
Sample Metrics. Allele Frequency (%) Read Depth Ploidy. Gene CDS Effect Protein Effect. LN Metastasis Tumor Purity Computational Pathology 80% 60%
Supplemental Table 1: Estimated tumor purity, allele frequency, and independent read depth for all gene mutations classified as either potentially pathogenic or VUS in the metatastic and primary tumor
Supplementary Materials
Supplementary Materials Supplemental figure 1. Absolute cell count of naïve/memory compartment of CD4 and CD8 T cells in early years Absolute cell number of naïve (CD45RA+CCR7+), Stem cell memory T cell
Analysis of gene expression in blood before diagnosis of ovarian cancer
Analysis of gene expression in blood before diagnosis of ovarian cancer Different statistical methods Note no. Authors SAMBA/10/16 Marit Holden and Lars Holden Date March 2016 Norsk Regnesentral Norsk
103.5 Membrane metalloendopeptidase TGA GGG GTC ACG ATT TTA GG ATG ATG GTG AGG AGC AGG AC
Supplementary Table SA Primers used for real-time RT-PCR gene regulation and their confirmation Gene Name Accession no Size Region Forward Primer Reverse Primer Efficiency% AKT v-akt oncogene homolog NM_00563
Supplement Results, Figures and Tables
Supplement Results, Figures and Tables Results PET imaging The SUV was significantly higher in tumours of the parental HSC-3 cell line than tumours of the EV and the MMP-8 overexpressing cell lines (Figure
WERNER_FIBRO_DN LEI_MYB_REGULATED_GENES BRCA1_OVEREXP_DN SUBCLASSES_DIFF P21_P53_MIDDLE_DN
Supplemental Table S1. Full List of Up-Regulated Conserved Biological Modules Between Zebrafish Liver Tumor with Human Liver, Lung, Gastric, and Prostate Tumors LvCMs (ZF liver cancer vs. human liver cancers
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature11986 relative IL-6 expression Viable intracellular Bp per well 18 16 1 1 5 5 3 1 6 +DG 8 8 8 Control DG Time (h) hours B. pertussis IL-6 (pg/ml) 15 Control DG
Subject ID: Date Test Started: Specimen Type: Peripheral Blood Date of Report: Date Specimen Obtained:
TEST PERFORMED Whole exome sequencing (WES) with Focused Diagnostic Panel(s): Neuropathy, Leukodystrophy, Myopathy See below for a complete list of genes analyzed. RESULTS 1 sequence variant with potential
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10860 Supplementary Discussion It remains unclear why H3K9 demethylation appeared to be more sensitive to suppression than at least some other histone methylation marks as a result of
Table S1. CDE Sequences and Globin Reporter mrna Half-Lives in NIH3T3 Cells, Related to Figures 1 and 2 Construct Sequence t1/2 ± SD (hrs)
Table S1. CDE Sequences and Globin Reporter mrna Half-Lives in NIH3T3 Cells, Related to Figures 1 and 2 Construct Sequence t 1/2 ± SD (hrs) n TNF -CDE 37 -V2 AGATCCTTCAGACAGACATGTTTTCTGTGAAAACGGAGCTGAGCTAGATCT
Supplementary Information
1 Supplementary Information Human TSC2 Null Fibroblast-Like Cells Induce Hair Follicle Neogenesis and Hamartoma Morphogenesis Shaowei Li 1, Rajesh L. Thangapazham 1, Ji-an Wang 1, Sangeetha Rajesh 1, Tzu-Cheg
IPATIMUP Translational Research Unit Matching IPATIMUP s Expertise with Company s Research/Clinical Strategy
IPATIMUP Translational Research Unit Matching IPATIMUP s Expertise with Company s Research/Clinical Strategy Innovative Projects Questions & Needs André Albergaria INDUSTRY Pharma R&D Clinical Research
Supplemental Figures/Tables. Methylation forward GTCGGGGCGTATTTAGTTC. Methylation reverse AACGACGTAAACGAAAATATCG
Supplemental Figures/Tables Supplementary Tables Table S1. Primer sequences MSP Primers SPARC2 Unmethylation forward TTTTTTAGATTGTTTGGAGAGTG Unmethylation reverse AACTAACAACATAAACAAAAATATC Methylation
Strategy for Integrating Molecular Landscapes in Human Insulinomas
Supplementary Figure 1 Strategy for Integrating Molecular Landscapes in Human Insulinomas 1 Supplementary Figure 2. Gene dendrogam and module colors 0.8 Height 0.9 1.00 module' The Complete Insulinoma
Aggressive B-cell lymphomas and gene expression profiling towards individualized therapy?
Aggressive B-cell lymphomas and gene expression profiling towards individualized therapy? Andreas Rosenwald Institute of Pathology, University of Würzburg, Germany Barcelona, June 18, 2010 NEW WHO CLASSIFICATION
RelA NF κb subunit activation as a therapeutic target in diffuse large B cell lymphoma
www.aging us.com AGING 2016, Vol. 8, No. 12 Research Paper RelA NF κb subunit activation as a therapeutic target in diffuse large B cell lymphoma Mingzhi Zhang 1,2*, Zijun Y. Xu Monette 2*, Ling Li 1*,
Supplementary Figure S1: Validation of amplicons using fluorescence in situ
Supplementary Material Supplementary Figure S1: Validation of amplicons using fluorescence in situ hybridisation with probes for 19q13.2 (A, B), 20q13.13 (C, D) and 20q13.31-q13.32 (E, F). Ovarian clear
Defined lymphoma entities in the current WHO classification
Defined lymphoma entities in the current WHO classification Luca Mazzucchelli Istituto cantonale di patologia, Locarno Bellinzona, January 29-31, 2016 Evolution of lymphoma classification Rappaport Lukes
Characterization of Micro RNA Signature in Peripheral Blood of Schizophrenia Patients using µparaflo TM mirna Microarray Assay
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 5 Number 7 (2016) pp. 503-512 Journal homepage: http://www.ijcmas.com Original Research Article http://dx.doi.org/10.20546/ijcmas.2016.507.055
Plasma-Seq conducted with blood from male individuals without cancer.
Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer
SI Table. SI Table 3. SI Table 4. SI Table 5A. SI Table 5B. SI Table 5C. SI Table 6A. SI Table 6B. SI Table 6C
SI Table SI Table 1 SI Table 2 SI Table 3 SI Table 4 SI Table 5A SI Table 5B SI Table 5C SI Table 6A SI Table 6B SI Table 6C Title List of primers used to clone HCV genes and gene fragments HCV genotype
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/2/9/e1600220/dc1 Supplementary Materials for Portraying breast cancers with long noncoding RNAs Olivier Van Grembergen, Martin Bizet, Eric J. de Bony, Emilie Calonne,
Supplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits.
Supplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits. All With Fst in the With long With SNP(s) at the 5' top 5% bracket haplotypes regulatory region
Table 1A. Genes enriched as over-expressed in DPM treatment group
Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597
Long non-coding RNAs in B-cell malignancies: a comprehensive overview
/, 2017, Vol. 8, (No. 36), pp: 60605-60623 Long non-coding RNAs in B-cell malignancies: a comprehensive overview Lucia Nobili 1,*, Domenica Ronchetti 1,*, Elisa Taiana 1 and Antonino Neri 1 1 Department
Targeted Genes and Methodology Details for Epilepsy/Seizure Genetic Panels
Targeted s and Methodology Details for Epilepsy/Seizure tic Panels Reference transcripts based on build GRCh37 (hg19) interrogated by Epilepsy/Seizure tic Panels Epilepsy Expanded Panel Epilepsy Expanded
Supplementary Table 1. mirna modulated in D HF and ND HF patients. Table shows in a linear scale the same values of Fig. 2.
Supplementary Table 1. mirna modulated in D HF and ND HF patients. Table shows in a linear scale the same values of Fig. 2. mir D HF VS CTR ND HF VS CTR D HF VS ND HF FOLD CHANGE p FOLD CHANGE p FOLD CHANGE
Functionally Recurrent Rearrangements of the MAST Kinase and Notch Gene Families in Breast Cancer
Functionally Recurrent Rearrangements of the MAST Kinase and Notch Gene Families in Breast Cancer Dan R. Robinson, Shanker Kalyana-Sundaram, Yi-Mi Wu, Sunita Shankar, Xuhong Cao, Bushra Ateeq, Irfan A.
Integrative Radiation Biology
Dr. Kristian Unger Integrative Biology Group Research Unit of Radiation Cytogenetics Department of Radiation Sciences Helmholtz-Zentrum München 1 Key Questions Molecular mechanisms of radiation-induced
Editorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease
Cronicon OPEN ACCESS EC DIABETES AND METABOLIC RESEARCH Editorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease Amr TM Saeb* University Diabetes Center, College
Aggressive B-cell Lymphomas Updated WHO classification Elias Campo
Aggressive B-cell Lymphomas Updated WHO classification Elias Campo Hospital Clinic, University of Barcelona Diffuse Large B-cell Lymphoma A Heterogeneous Category Subtypes with differing: Histology and
New network topology approaches reveal differential correlation patterns in breast cancer
Bockmayr et al. BMC Systems Biology 2013, 7:78 RESECH TICLE Open Access New network topology approaches reveal differential correlation patterns in breast cancer Michael Bockmayr 1, Frederick Klauschen
Supplemental Table 1: Enriched GO categories per cluster
Supplemental Table 1: Enriched GO categories per cluster Cluster Enriched with #genes Raw p-value Corrected p-value Frequency in set (%) Cluster 1 immune response - GO:0006955 32 2.36E-14 0.001 13.5 Cluster
Supplemental Table 1. 3 types of signals that are involved in T cell activation
Supplemental Table 1. 3 types of signals that are involved in T cell activation Syn-T cells Allo-T cells CD3/28- T cells First signal MHC-TCR-CD3 pathway Not engaged MHC-alloantigen- TCR-CD3 Engaged CD3-Engaged
Nature Biotechnology: doi: /nbt # m
Supplementary Figure 1. Cell seeding in microwells. Cells were stained with SYBR green and visualized under a microscope. Arrows point to single cells (green). Each image is a different position within
ChromoFic, Chromosome SNP Microarray 750K, High Resolution
SPECIMEN Peripheral blood ChromoFic, Chromosome SNP Microarray 750K, High Resolution CLINICAL INDICATION Failure to thrive, dysmorphism, triangular face, long philtrum, congenital heart disease, increased
Mirsynergy: detect synergistic mirna regulatory modules by overlapping neighbourhood expansion
Mirsynergy: detect synergistic mirna regulatory modules by overlapping neighbourhood expansion Yue Li yueli@cs.toronto.edu October 0, 2018 1 Introduction MicroRNAs (mirnas) are 22 nucleotide small noncoding
Double hit lymphoma Clinical perspectives
Double hit lymphoma Clinical perspectives Peter Johnson Some definitions, for clarity Double-hit lymphoma (5% of DLBL) Rearranged MYC (8q24) by FISH Plus either rearranged BCL2 (18q21) or BCL6 (3q27) Double-expression
Patricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope
Patricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope National Medical Center Disclosures I have no disclosures
Copyright Warning & Restrictions
Copyright Warning & Restrictions The copyright law of the United States (Title 17, United States Code) governs the making of photocopies or other reproductions of copyrighted material. Under certain conditions
Xiaodan Wu 1, Xiaoru Sun 2, Chengshui Chen 2*, Chunxue Bai 3 and Xiangdong Wang 2,3*
Wu et al. Critical Care (2014) 18:508 DOI 10.1186/s13054-014-0508-y RESEARCH Open Access Dynamic gene expressions of peripheral blood mononuclear cells in patients with acute exacerbation of chronic obstructive
Table SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK
Supplemental legends Table SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK Table SП. List of genes in cluster 1 identified using two-dimensional hierarchical clustering analysis Table SШ.
Rôles de l'ubiquitine et des ubiquitine-likes dans les mécanismes de résistance aux traitements anticancéreux. Philippe Soubeyran Cell stress team
Rôles de l'ubiquitine et des ubiquitine-likes dans les mécanismes de résistance aux traitements anticancéreux. Philippe Soubeyran Cell stress team Le cancer du pancréas 10 e 4 e iquitine et ls dans le
SUPPLEMENTAL FILES Microarray Genome-wide expression profiling of CD123+BDCA4+ pdcs
SUPPLEMENTAL FILES Microarray Genome-wide expression profiling of CD123 + BDCA4 + pdcs Genome-wide transcriptome data were collected from sorted CD123 + BDCA4 + pdc of 6 pss patients (3 IFNpos and 3 IFNneg)
Nature Neuroscience: doi: /nn.4295
Supplementary Figure 1 Gene expression profiling of EGFRvIII-expressing human brain tumor stem cells (BTSCs) and mouse astrocytes (a) The protein lysates of human BTSCs were analyzed by immunoblotting
Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
Supplemental Data for Toischer et al., Cardiomyocyte proliferation prevents failure in
Supplemental Data, Page 1 Supplemental Data for Toischer et al., Cardiomyocyte proliferation prevents failure in pressure but not volume overload. Contents: Page 3: Supplemental Figure 1 - Echocardiographic
SUPPLEMENTARY INFORMATION
doi:10.1038/nature13898 Supplementary Information Table 1 Kras mutation status of carcinogen-induced mouse lung adenomas Tumour Treatment Strain Grade Genotype Kras status (WES)* Kras status (Sanger) 32T1
What Do We Know About Individual Variability and Its
What Do We Know About Individual Variability and Its Contribution to Disease? Nathaniel Rothman, MD, MPH, MHS Occupational and Environmental Epidemiology Branch, Division of Cancer Epidemiology and Genetics,
Supplementary information. Dual targeting of ANGPT1 and TGFBR2 genes by mir-204 controls
Supplementary information Dual targeting of ANGPT1 and TGFBR2 genes by mir-204 controls angiogenesis in breast cancer Ali Flores-Pérez, Laurence A. Marchat, Sergio Rodríguez-Cuevas, Verónica Bautista-Piña,
Autism Spectrum Disorder and Itellectual Disability (ASD-ID) Comprehensive Panel Gene List Genes: A2M - ATRX A2M ADAR ALG13 ARHGEF6 A2ML1 ADAT3 ALG2
Genes: A2M - ATRX A2M ADAR ALG13 ARHGEF6 A2ML1 ADAT3 ALG2 ARHGEF9 AAAS ADCY1 ALG3 ARID1A AARS ADCY3 ALG6 ARID1B AARS2 ADCY5 ALMS1 ARID2 AASS ADD3 ALOX12B ARL13B ABAT ADGRG1 ALOXE3 ARL6 ABCA1 ADGRV1 ALS2
Table 3. Genes bound by NF-κB in U937 cells
Table 3. Genes bound by NF-κB in U937 cells ABHD8 ACTR3 AF093680 AF15Q14 AIM2 ALAS1 AP1S2 APBB1IP APG-1 AQP9 ARF3 ARHGAP4 ARHGEF2 ARL1 ARL6IP5 ARTS-1 ASGR2 ASH1 ATF6 ATP5G1 BAT3 BAZ1B BCL2A1 BCL6 BF BNIP1
Aggressive B-Cell Lymphomas
Aggressive B-cell Lymphomas Aggressive B-Cell Lymphomas Stephen Hamilton Dutoit Institute of Pathology Aarhus Kommunehospital B-lymphoblastic lymphoma Diffuse large cell lymphoma, NOS T-cell / histiocyte-rich;
CilioPathy panel. 3-Jul-2018 (102 genen) Centrum voor Medische Genetica Gent. versie. OMIM gene ID
versie 3-Jul-2018 (102 genen) CilioPathy panel Centrum voor Medische Genetica Gent Gene OMIM gene ID Associated phenotype, OMIM phenotype ID, phenotype mapping key and inheritance pattern AHI1 608894 Joubert
Autism/ID Xpanded Panel Gene List (~2000)
Autism/ID Xpanded Panel Gene List (~2000) Approximately 84% of the genes are covered >99% at 10X and the average coverage of a gene at 10X for this panel is >98%. A2M A2ML1 AAAS AARS AARS2 AASS ABAT ABCA1
Analyzing the NCI-60 Cancer Cell Lines using Data Obtained from Genome-Wide ChIP-X Experiments. Jayanth (Jay) Krishnan. Mahopac High School
1 Analyzing the NCI-60 Cancer Cell Lines using Data Obtained from Genome-Wide ChIP-X Experiments Jayanth (Jay) Krishnan Mahopac High School January 25, 2010 2 Analyzing the NCI-60 Cancer Cell Lines using
Primer sequence CGGAAAGCGGCGGGGTGTTGGGGGAGGCGAGGAACAACCGAGGGGAAGC TTTCCTGATACCCATCCTACACAGGATGACGACGATAAGTA
Supplemental Table 1. Sequences of the primers used for generation of H1/H6 virus primer mirna H1/6 kan F mirna H1/6 kan R mirna H1/6 zeo F mirna H1/6 zeo R Primer sequence CGGAAAGCGGCGGGGTGTTGGGGGAGGCGAGGAACAACCGAGGGGAAGC
Activating mutations in the NT5C2 nucleotidase gene drive chemotherapy resistance in relapsed ALL Supplementary Figure 1. TP53 , RPL11 and BANP
Activating mutations in the NT5C2 nucleotidase gene drive chemotherapy resistance in relapsed ALL Gannie Tzoneva, Arianne Perez Garcia, Zachary Carpenter, Hossein Khiabanian, Valeria Tosello, Maddalena
Mirsynergy: detect synergistic mirna regulatory modules by overlapping neighbourhood expansion
Mirsynergy: detect synergistic mirna regulatory modules by overlapping neighbourhood expansion Yue Li yueli@cs.toronto.edu October 30, 2017 1 Introduction MicroRNAs (mirnas) are 22 nucleotide small noncoding
University of Groningen. B cell lymphoma Wu, Rui
University of Groningen B cell lymphoma Wu, Rui IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Sup. Fig. 1. Densitometry and IHC analysis. (a) Densitometry analysis showing
# # # # # # # Supplemental Figure a.5# *" b c MNK# MNK#.5# p)eif4e# MNK# *" RelaAve#protein#level#.0# 0.5# 0.0# *" *" *" *" GM084# SUDHL)6# Pfeiffer# HLY)# TMD8# RelaAve#protein#level#.0# 0.5# 0.0# *"
Comprehensive genetic testing for hearing and vision loss
Comprehensive genetic testing for hearing and vision loss Hearing and vision loss can result from both genetic and non-genetic etiologies In general, there is a genetic basis for up to 50% of prelingual
Messenger RNA profile analysis deciphers new Esrrb responsive genes in prostate cancer cells
DOI 10.1186/s12867-015-0049-1 BMC Molecular Biology RESEARCH ARTICLE Messenger RNA profile analysis deciphers new Esrrb responsive genes in prostate cancer cells Yuan Lu 1,2,5, Jilong Li 2,3,4, Jianlin
Somatic intronic microsatellite loci differentiate glioblastoma from lower-grade gliomas
1 Somatic intronic microsatellite loci differentiate glioblastoma from lower-grade gliomas 2 3 FIGURE S1: Sensitivity & Specificity receiver operator characteristics (ROC) of Signature Cancer-Associated
Logistic regression analysis for the identification of the metastasis-associated signaling pathways of osteosarcoma
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 41: 1233-1244, 2018 Logistic regression analysis for the identification of the metastasis-associated signaling pathways of osteosarcoma Yang Liu 1, Wei Sun 2,
Influence of genetic ancestry and socioeconomic status on type 2 diabetes in the diverse Colombian populations of Chocó and Antioquia
Supplementary Information For: Influence of genetic ancestry and socioeconomic status on type 2 diabetes in the diverse Colombian populations of Chocó and Antioquia Aroon T. Chande 1,2,3, Jessica Rowell
BCR ABL1 like ALL: molekuliniai mechanizmai ir klinikinė reikšmė. IKAROS delecija: molekulinė biologija, prognostinė reikšmė. ASH 2015 naujienos
BCR ABL1 like ALL: molekuliniai mechanizmai ir klinikinė reikšmė. IKAROS delecija: molekulinė biologija, prognostinė reikšmė. ASH 2015 naujienos Ph like ALL BCR ABL1 like acute lymphoblastic leukemia (ALL)
Regulation of eif4 and p70s6k signaling. Chondroitin and dermatan biosynthesis Interferon signaling
Supplemental Information Table S1: Differentially regulated pathways in cortical versus cerebellar human astrocytes following treatment with PBS or IFN-β Pathway Regulation of eif4 and p70s6k signaling
U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
Identification of 12 novel loci that confer susceptibility to early-onset dyslipidemia
INTERNATIONAL JOURNAL OF MOlecular medicine 43: 57-82, 2019 Identification of 12 novel loci that confer susceptibility to early-onset dyslipidemia YOSHIJI YAMADA 1,2, KIMIHIKO KATO 1,3, MITSUTOSHI OGURI
Novel Insights into Breast Cancer Genetic Variance through RNA Sequencing
Insights into Breast Cancer Genetic Variance through RNA Sequencing SUPPLEMENTARY DATA Anelia Horvath, 1,2* Suresh Babu Pakala, 2* Prakriti Mudvari, 1* Sirigiri Divijendra Natha Reddy, 2 Kazufumi Ohshiro,
CD Marker Antibodies. atlasantibodies.com
CD Marker Antibodies atlasantibodies.com CD Marker Antibodies Product Name Product Number Validated Applications Anti-ACE HPA029298 IHC,WB Anti-ACKR1 HPA016421 IHC Anti-ACKR1 HPA017672 IHC Anti-ADAM17
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
The Center for PERSONALIZED DIAGNOSTICS
The Center for PERSONALIZED DIAGNOSTICS Precision Diagnostics for Personalized Medicine A joint initiative between The Department of Pathology and Laboratory Medicine & The Abramson Cancer Center The (CPD)
Moyamoya disease susceptibility gene RNF213 links inflammatory and angiogenic
Supplementary Information for Moyamoya disease susceptibility gene RNF213 links inflammatory and angiogenic signals in endothelial cells Kazuhiro Ohkubo 1,, Yasunari Sakai 1,*,, Hirosuke Inoue 1, Satoshi
Table S2. Functional annotation of the downregulated, differentially expressed genes of Rasless MEFs.
Table S2. Functional annotation of the downregulated, differentially expressed genes of Rasless MEFs. The GeneCodis (Gene Annotation Co-occurrence Discovery) functional annotation tool (http://genecodis.dacya.ucm.es)
DNA methylation signatures for 2016 WHO classification subtypes of diffuse gliomas
Paul et al. Clinical Epigenetics (2017) 9:32 DOI 10.1186/s13148-017-0331-9 RESEARCH Open Access DNA methylation signatures for 2016 WHO classification subtypes of diffuse gliomas Yashna Paul, Baisakhi
SUPPLEMENTAL TABLE AND FIGURES
SUPPLEMENTAL TABLE AND FIGURES Zhang et al. (29) - Enzymes in the NAD + Salvage Pathway Regulate SIRT1 Activity at Target Gene Promoters This document contains supplemental data (1 table and 6 figures)
Next Generation Sequencing in Haematological Malignancy: A European Perspective. Wolfgang Kern, Munich Leukemia Laboratory
Next Generation Sequencing in Haematological Malignancy: A European Perspective Wolfgang Kern, Munich Leukemia Laboratory Diagnostic Methods Cytomorphology Cytogenetics Immunophenotype Histology FISH Molecular
Treatment Landscape in R/R DLBCL Novel Targets and Strategies. Wyndham H. Wilson, M.D., Ph.D. Senior Investigator
Treatment Landscape in R/R DLBCL Novel Targets and Strategies Wyndham H. Wilson, M.D., Ph.D. Senior Investigator Gene-expression profiling of DLBCL subtypes Roschewski, M. et al. (2013) Nat. Rev. Clin.
Supplemental Information. Integrated Genomic Analysis of the Ubiquitin. Pathway across Cancer Types
Cell Reports, Volume 23 Supplemental Information Integrated Genomic Analysis of the Ubiquitin Pathway across Zhongqi Ge, Jake S. Leighton, Yumeng Wang, Xinxin Peng, Zhongyuan Chen, Hu Chen, Yutong Sun,
Supplementary Table 2b. List of spliced oncogenes and tumor suppressors identified in AML patients compared to normal donors
1 Supplementary Table 2b. List of spliced oncogenes and tumor suppressors identified in AML patients compared to normal donors Gene Symbol Gene Name / Tumor Suppressors AKT1 v-akt murine thymoma viral
Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.
a 33,312 b rep 1 rep 1 # 44,325 rep 2 # 44,055 [0-84] rep 2 [0-84] 1810043G02Rik Pfkl Dnmt3l Icosl rep 1 [0-165] rep 2 [0-165] Rps14 Cd74 Mir5107 Tcof1 rep 1 [0-69] rep 2 [0-68] Id3 E2f2 Asap3 rep 1 [0-141]
Celebrating 20 years of the Database Joint UKCCG and CHO Annual Conference. 22 nd -23 rd March 2012 Newcastle upon Tyne
Celebrating 20 years of the Database Joint UKCCG and CHO Annual Conference 22 nd -23 rd March 2012 Newcastle upon Tyne The following years. FISH and genomics Christine Harrison Chair, UK Cancer Cytogenetics