A study of 133 Chinese children with mitochondrial respiratory chain complex I deficiency

Transcription

1 Clin Genet 2015: 87: Printed in Singapore. All rights reserved Short Report 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd CLNCAL GENETCS doi: /cge A study of 133 Chinese children with mitochondrial respiratory chain complex deficiency Ma Y.-Y., Wu T.-F., Liu Y.-P., Wang Q., Li X.-Y., Ding Y., Song J.-Q., Yang Y.-L., Zou L.-P. A study of 133 Chinese children with mitochondrial respiratory chain complex deficiency. Clin Genet 2015: 87: John Wiley & Sons A/S. Published by John Wiley & Sons Ltd, 2014 To investigate the clinical, enzymological and mitochondrial gene profiles of complex deficiency in Chinese, clinical and laboratory data of the patients (79 boys, 54 girls) were retrospectively assessed. Activities of mitochondrial respiratory chain complexes in peripheral leucocytes were spectrophotometrically measured. The entire mitochondrial DNA (mtdna) sequence was analyzed in 62 patients. Restriction fragment length polymorphism and gene sequencing analyses were performed in 15 families. Ninety-one patients had isolated complex deficiency; 42 had combined deficiencies of complex and other complexes. The main clinical presentations were neuromuscular disorders (107 patients) and non-neurological dysfunction (hepatopathy, renal damage and cardiomyopathy; 26 patients). n 32 of 62 patients who underwent mtdna sequencing, 24 mutations were identified in 15 mitochondrial genes. The 12338T>C, 4833A>G and 14502T>C mutations were found in 12.9%, 11.3% and 4.8% patients, respectively. Seven patients had multiple mutations. Three novel mutations were identified. Chinese patients with complex deficiency presented heterogeneous phenotypes and genotypes. Twenty-four mutations were identified in 15 mitochondrial genes in 51.6% patients. mtdna mutations were more common in isolated complex deficiency than in combined complex deficiencies. The 12338T>C, 4833A>G and 14502T>C mutations were common. Conflictofinterest The authors declare no conflict of interest. Y.-Y. Ma a,t.-f.wu b,y.-p.liu b, Q. Wang b,x.-y.li b, Y. Ding b, J.-Q. Song b, Y.-L. Yang b and L.-P. Zou a a Department of Pediatrics, Chinese Liberation Army General Hospital, Beijing, China and b Department of Pediatrics, Peking University First Hospital, Beijing, China Key words: complex deficiency mitochondrial disorders mitochondrial DNA mitochondrial respiratory chain Corresponding authors: Prof. Li-Ping Zou, Department of Pediatrics, Chinese Liberation Army General Hospital, No. 28, Fu-xing Road, Haidian District, Beijing , China. Tel.: ; fax: ; zouliping21@hotmail.com and Prof. Yan-Ling Yang, Department of Pediatrics, Peking University First Hospital, No. 1, Xi-an-men Road, Xicheng District, Beijing , China. Tel.: ; fax: ; amino_acid3003@126.com Received 30 October 2013, revised and accepted for publication 4 February 2014 Mitochondria hold a central position in cellular bioenergetics. The oxidative phosphorylation (OXPHOS) system is composed of five multi-subunit complexes embedded in the inner mitochondrial membrane. Of these complexes, respiratory chain complex is the largest and most complicated. OXPHOS disorders are one of the most common inborn errors of metabolism (1), with an estimated incidence of approximately 1 per 5000 live births. Mitochondrial respiratory chain complex deficiency [Online Mendelian nheritance in Man (OMM) ] is the most common respiratory chain deficiency, accounting for approximately 30% of all cases (2). Complex deficiency was found to involves mutations in a number of nuclear genes (including genes that encode assembly factors and chaperone proteins) and mitochondrial genes ( The diagnosis of mitochondrial diseases in China has mainly depended on gene screening and histopathological studies, due to a lack of clinical assays for respiratory chain enzymes (3), and precise etiological diagnoses have been obtained in few Chinese patients. The pathogenicity correlations of 179

2 Ma et al. these DNA mutations and complex deficiency remain unknown, greatly limiting the clinical applications of gene analysis as a diagnostic tool for mitochondrial respiratory chain disease. Although a few mutations in the genes encoding the subunits of respiratory chain complex have been described, little is known about the clinical, enzymological and genetic features of complex deficiency in Chinese patients. This study aimed to investigate the clinical, enzymological and mitochondrial gene profiles of 133 Chinese children with complex deficiency. Materials and methods Patients n the last 4 years, 133 patients with complex deficiency were recruited. The patients were residents of 19 provinces or cities in mainland China. The male: female ratio was 1.47 (79:54). Prior to tests for mitochondrial disorders, typical aminoacidopathies, organic acidurias and mitochondrial β-oxidation defects were excluded by analyses of blood amino acids, acylcarnitines and urinary organic acids. The parents of all patients were informed about the research, and they consented to participate. This study was approved by the hospital ethics committee. Assays for mitochondrial respiratory chain complexes V The assays for mitochondrial respiratory chain complexes were performed in peripheral leukocytes using spectrophotometry. The activity of each complex is expressed both as a rate (nmol/min/mg of mitochondrial protein) and as a ratio of the rate of citrate synthase, as previously described (4). Mitochondrial gene sequence and haplogroup classification The entire sequence of the mitochondrial genomes of 62 patients was analyzed by polymerase chain reaction (PCR) into eight overlapping fragments. Primer sequences were shown in Table 1. The sequence results were then compared with the revised Cambridge reference sequence ( GenBank D: NC_ Patients with point mutations, as well as their parents, underwent PCR-restriction fragment length polymorphism analysis. Restriction fragment length polymorphism analysis and gene sequencing were used to confirm and quantify mitochondrial DNA (mtdna) mutations. The haplogroups of mtdna were determined using phylogenetic analysis. Classification details have been described previously by Fan and Yao (5). Statistical analysis All data were analyzed using the spss 13.0 software, and p < 0.05 was considered statistically significant. Data are expressed as the mean ± standard deviation (SD) for normal distributions and as median and interquartile range for non-normal distributions. The Student s t-test for independent groups was used to compare means, and the χ 2 test was used to compare proportions between groups. Results Clinical features The 133 study patients had a wide variety of clinical symptoms and signs (Table 2). Symptom onset occurred in the first year of life in 85 patients (63.9%) and before 3 years of age in 102 patients (76.7%). Parents of the all patients were healthy and non-consanguineous. Twentytwo patients (16.5%) had a positive family history, and their affected siblings died of neuromuscular disorders or multi-organ failure without definitive etiological diagnosis. Fourteen mothers (10.5%) of the patients had a history of an unexplained abnormality during pregnancy, such as spontaneous abortion, suspended embryo growth and fetal distress. The neuromuscular system was the most frequently involved, and 107 patients (80.5%) had central nervous system damage and skeletal muscle disorders (Table 2). Cranial magnetic resonance imaging revealed symmetrical bilateral lesions of the basal ganglia, thalamus, cerebellum and brainstem in 27 patients (20.3%), supporting the diagnosis of Leigh syndrome (3, 6). Twentysix patients (19.5%) developed movement disorders after a respiratory or intestinal infection, or an operation. Three patients presented with encephalopathy within 24 h after vaccination. Twenty-six patients (19.5%) presented with nonneurological disorders (Table 2). Twenty-two (16.5%) had hepatopathies with progressive liver dysfunction or intrahepatic cholestasis; 17 (12.8%) had kidney diseases, such as tubular damage and renal failure, and eight (6%) showed cardiomyopathy with heart failure, cardiomegaly and arrhythmia. n 104 patients (78.2%), the plasma lactic acid level was increased ( vs mmol/l in normal controls), and 76 patients (57.1%) had elevated plasma pyruvate levels ( μmol/l vs normal range of μmol/l; Table 2). Skeletal muscle biopsy was performed in five patients; ragged-red fibers were absent, but lipid accumulation was common. Activities of mitochondrial respiratory chain complexes in peripheral blood leukocytes solated complex deficiency was found in 91 patients (68.4%; Table 3). The activity of complex in peripheral blood leukocytes decreased to nmol/min/mg mitochondrial protein or 18 56% of the activity in normal controls (44.0 ± 5.4 nmol/min/mg mitochondrial protein). The ratio of the rate of complex to that of citrate synthase decreased to 16 23% (normal controls, 48% ± 11%). Combined deficiencies of complex and other complexes were found in 42 patients (31.6%; Table 3). 180

3 A study of respiratory complex deficiency Table 1. PCR primers used for entire mtdna amplification Fragments Primer sequences (5 3 ) Production (bp) 1 F:gattcctgcctcatcctatt R: ttctcgtcttgctgtgttat F:gcaatcaaccctcaactatc R: agtaagtatgttcgcctgta F:tgggaagatttataggtagagg R: ggaatgctggagattgtaatg F:ctcaccactacaatcttccta R: gctaatacaatgccagtcag F:ggaacaggttgaacagtcta R: tgatgcgagtaatacggatg F:gcacgacaacacataatgac R: aggcagaatagtaatgaggatg F:ctcgtagtaacagccattct R: aggttatgtgattaggagtagg F:tctattactctcatcgctacc R: tgtgggctatttaggcttta 2979 mtdna, mitochondrial DNA; PCR, polymerase chain reaction. Table 2. Clinical features of patients with respiratory chain complex deficiency solated complex deficiency (n = 91) Combined complex and other complex deficiencies (n = 42) Total (n = 133) Clinical features No % No % No % Gender Male Female Age at onset Neonatal period (0 1 months) nfancy (1 month 1 years) years Abnormal family history Abnormal pregnancy of mother Low birth weight General symptoms Neonatal asphyxia Poor feeding Swallowing difficulty Vomiting Failure to thrive Preceding infection or operation Hyperlactacidemia High pyruvate level Neurological symptoms Psychomotor retardation Motor retardation Motor regression Weakness Epilepsy Abnormal eye movements Hypotonia Ataxia Leigh syndrome Leukoencephalopathy MELAS Liver diseases Kidney diseases Cardiomyopathy MELAS: mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes. The activity of complex in these patients decreased to nmol/min/mg mitochondrial protein, which was 26 48% of the control value. The ratio of the rate of complex to that of citrate synthase decreased to 20 24% (Fig. 1). Analysis of entire mitochondrial gene sequence and haplogroups The entire mtdna was analyzed in 62 of 133 patients, and 24 mutations in 15 mitochondrial genes were 181

4 Ma et al. Table 3. Deficient complexes in the 133 patients with respiratory chain complex deficiency Number With mtdna mutations Without mtdna mutation Deficient complexes Cases % Cases % Cases % p value solated complex deficiency * Combined complex defects Complexes and Complexes and V Complexes and V Total mtdna, mitochondrial DNA. *The patients with mtdna mutation is more in isolated complex deficiency than that in combined complex defects (P < 0.05). Core pedigree analysis Gene analysis was performed in 15 families. Five mtdna mutations (3397A>G, 4833A>G, 12338T>C, 14502T>C and 3243T>C) were detected in the patients and their mothers from six families (Table 3). Fig. 1. Activity of complex and its ratio with the rate of citrate synthase in patients with respiratory chain complex deficiency. The left part of this figure shows the activity of respiratory chain complex, and the right part shows the ratio of this activity to that of citrate synthase. The light gray bar, black bar and dark gray bar represent the values for isolated complex deficiency (91 patients), combined deficiencies of complex and other complexes (42 patients) and normal controls, respectively. Significant differences were observed between isolated complex deficiencies and normal controls, and between combined deficiencies and normal controls (p < 0.05; marked by an asterisk). identified in 32 patients (51.6%). Missense mutations were the most common. Of these 24 mutations, 21 have been reported previously (Table 4). None of the three novel mutations were found in the 110 normal controls. Seven patients had multiple (two or three) mutations (Table 5). All mtdna sequences of 62 patients were classified into the haplogroup H2a2a. Correlative study of complex deficiency and mtdna mutations Among the patients in whom the entire mtdna was sequenced, mtdna mutations were identified in 26 (60.5%) of 43 patients with isolated complex deficiency and 6 (31.5%) of 19 patients with combined deficiencies of complex and other complexes. The prevalence of mtdna mutations was significantly higher in patients with isolated complex deficiency than in patients with combined complex deficiencies (p < 0.05). Discussion Respiratory chain complex deficiency is the most common OXPHOS disorder. Von Kleist-Retzow et al. reported that respiratory chain complex deficiency and combined complexes and V deficiency accounted for 33% and 28% of patients with respiratory chain defects, respectively (7). However, little enzymological information about mitochondrial respiratory chain complex deficiency has been obtained in Chinese patients. This study was the first to investigate the clinical, enzymological and mitochondrial gene profiles in 133 Chinese children with complex deficiency. solated complex deficiency was the predominant biochemical defect in this study (91 patients, 68.4%). A wide variety of clinical and laboratory characteristics were present in our study. Neuromuscular disorders, which frequently manifested as psychomotor retardation, regression and weakness, were common (107 patients, 80.5%). Leigh syndrome was the most common clinical syndrome in our study, which is consistent with the finding of Swalwell et al. (8). n addition, non-neurological manifestations such as liver diseases, kidney diseases and cardiomyopathy were observed in 26 (19.5%) patients. This is in agreement with Skladal et al. who reported that mitochondrial diseases can also be associated with cardiomyopathy, liver failure and kidney diseases, and not only encephalopathy and skeletal muscle diseases (9). These aware clinicians again that non-neuromuscular symptoms might indicate a mitochondrial disorder. Of the 24 mutations detected in 15 mitochondrial genes of 32 patients, 13 mutations involved genes encoding complex subunits (ND1 to ND6), four affected mitochondrial trna genes and four mutations were found in the 12S rrna and 16S rrna genes. The 12338T>C mutation of the ND5 gene was found in eight patients. The 12338T>C mutation has previously been reported in Chinese families with Leber hereditary optic neuropathy (LHON) (10). Our 182

5 Table 4. mtdna mutations in patients with respiratory chain complex deficiency A study of respiratory complex deficiency Mutation Gene Translation product Case number Pedigree Complex defect 3397A>G ND1 M-V A>G ND1 Y-C 1 and 3713T>C a ND1 V-A 1 and V 3644T>C ND1 V-A 1 and V 3497C>T ND1 A-V 1 and V 4833A>G ND2 T-A T>C ND3 S-P T>C ND4 -T G>A a ND4 Asn-Asp T>C ND5 M-T T>C ND6 -V T>C ND6 M-V G>A ND6 A-V G>A CYB G-S G>A COX D-N 1 and V 8609C>T a ATP6 P-L 1 and V 735A>G 12S rrna 12S rrna 1 960insC 12S rrna 12S rrna C>T 16S rrna 16S rrna 1 and V 2755A>C 16S rrna 16S rrna A>G trna-glu trna-glu 1 606A>G trna-phe trna-phe T>C trna-arg trna-arg 1 and V 3243A>G trna-leu trna-leu 1 1 mtdna, mitochondrial DNA. a The novel mutation is shown. Table 5. Seven patients with multiple mtdna mutations Patient Gender Age (years) Age at onset (years) Mutation Gene Complex defect P 11 Male T>C ND T>C ND5 P 15 Female A>G ND G>A CYB P 20 Male A>G ND G>A CYB 11253T>C ND4 P 21 Male A>G ND2 2755A>C 16S rrna P 30 Male A>G trna-phe 12338T>C ND5 P 49 Male G>A COX 3713T>C ND1 P 61 Male C>T ND1 8609C>T ATP6 V andv mtdna, mitochondrial DNA. results indicated that the 12338T>C, 4833A>G and 14502T>C mutations might be common genotypes of complex deficiency in the Chinese population. These homoplasmic mutations were identified in the maternal lineage of patients with complex deficiency and not in 178 Chinese individuals without this deficiency (normal controls) (10). The 4833A>G mutation in the ND2 gene results in substitution in tyrosine with hydrophobic alanine in a highly conserved region. The 14502T>C mutation in the ND6 gene has previously only been reported in Chinese families with LHON (11). This mutation replaces the highly conserved isoleucine at residue position 58 in the ND6 subunit with valine (11). nterestingly, Chinese children with mitochondrial disease are prone to be classified into the haplogroup H2a2a. Methods should be used to explore further the etiology (12). Assays of the activities of OXPHOS enzymes in peripheral leukocytes are a reliable and applicable method for the diagnosis of mitochondrial diseases in 183

6 Ma et al. children. Although some genetic information may be lost when blood samples are used for the diagnosis of mitochondrial diseases, 91% of patients with deficient enzyme activity in lymphocytes exhibited deficient activity in the muscles (13). Thus, in the case of OXPHOS, enzyme activity in the peripheral leukocytes is largely representative of that in the muscle tissue. Molecular, genetic and enzymological analysis can be informative with peripheral leukocytes. nterestingly, a few of patients with isolated enzyme deficiency had multiple mtdna mutations, and a few of patients with one mtdna mutation presented with combined enzyme deficiency. Multiple mutations in a single patient may present as an isolated or a combined complex deficiency, possibly because of the replication, repair and transcription of mtdna or nuclear DNA. The underlying mechanism warrants further investigation. Respiratory chain complex deficiencies are genetically, biochemically and clinically heterogeneous diseases. An assay of respiratory chain enzyme activity might identify the enzymatic causes of these diseases, but direct gene analysis also plays a crucial role in their diagnosis. Acknowledgements This work was supported by China Postdoctoral Science Foundation (2013M532107), the 12th Five-year Plan National Key Technology R & D Program form the Ministry of Science and Technology (2012BA09B04) and Beijing Nature Science Foundation (No ). 2. Distelmaier F, Koopman WJ, van den Heuvel LP et al. Mitochondrial complex deficiency: from organelle dysfunction to clinical disease. Brain 2009: 132: Yang YL, Sun F, Zhang Y et al. Clinical and laboratory survey of 65 Chinese patients with Leigh syndrome. Chin Med J (Engl) 2006: 119: Ma YY, Zhang XL, Wu TF et al. Analysis of the mitochondrial complex -V enzyme activities of peripheral leukocytes in oxidative phosphorylation disorders. J Child Neurol 2011: 26: Fan L, Yao YG. An update to MitoTool: using a new scoring system for faster mtdna haplogroup determination. Mitochondrion 2013: 13: Rahman S, Blok RB, Dahl HH et al. Leigh syndrome: clinical features and biochemical and DNA abnormalities. Ann Neurol 1996: 39: von Kleist-Retzow JC, Cormier-Daire V, de Lonlay P, et al. A high rate (20%-30%) of parental consanguinity in cytochrome-oxidase deficiency. Am J Hum Genet. 1998: 63: Swalwell H, Kirby DM, Blakely EL et al. Respiratory chain complex deficiency caused by mitochondrial DNA mutations. Eur J Hum Genet 2011: 19: Skladal D, Sudmeier C, Konstantopoulou V et al. The clinical spectrum of mitochondrial disease in 75 pediatric patients. Clin Pediatr (Phila) 2003: 42: Liu XL, Zhou X, Zhou J et al. Leber s hereditary optic neuropathy is associated with the T12338C mutation in mitochondrial ND5 gene in six Han Chinese families. Ophthalmology 2011: 118: Zhao F, Guan M, Zhou X et al. Leber s hereditary optic neuropathy is associated with mitochondrial ND6 T14502C mutation. Biochem Biophys Res Commun 2009: 389: McFarland R, Swalwell H, Blakely EL et al. The m.5650g>a mitochondrial trnaala mutation is pathogenic and causes a phenotype of pure myopathy. Neuromuscul Disord 2008: 18: Chretien D, Rustin P, Bourgeron T et al. Reference charts for respiratory chain activities in human tissues. Clin Chim Acta 1994: 228: Reference 1. Thorburn DR. Mitochondrial disorders: prevalence, myths and advances. J nherit Metab Dis 2004: 27: