IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois

Transcription

1 FERTILITY AND STERILITY VOL. 80, NO. 4, OCTOBER 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A. CASE REPORTS Preimplantation genetic diagnosis for the Kell genotype Yury Verlinsky, Ph.D., a Svetlana Rechitsky, Ph.D., a Seckin Ozen, M.D., a Christina Masciangelo, M.Sc., a Jonathan Ayers, M.D., b and Anver Kuliev, M.D., Ph.D. a IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois Objective: To use preimplantation genetic diagnosis (PGD) to achieve a Kell 1 (K1) allele free pregnancy in couples at risk for producing a child with hemolytic disease of the newborn (HDN) caused by maternofetal incompatibility in sensitized mothers. Design: DNA analysis of biopsied blastomeres from cleavage-stage embryos in IVF-ET with the goal of identifying and transferring back to patients the K1 allele free embryos. Setting: IVF program at the Reproductive Genetics Institute, Chicago, Illinois, and IVF Michigan, Rochester Hills, Michigan. Patient(s): Two at-risk couples with a history of neonatal death caused by HDN due to K1/K2 genotype in a male partner. Intervention(s): Biopsy of single blastomeres and testing for paternal K1 allele in each embryo after standard IVF. Main Outcome Measure(s): DNA analysis of blastomeres indicating whether corresponding embryos were K1 allele free for the purpose of transferring only embryos without the K1 allele. Result(s): Of 36 embryos tested in five cycles from two couples, 18 were predicted to be K1 allele free. Of these, 9 were transferred, resulting in a K1 allele free twin pregnancy and the birth of two healthy children. Conclusion(s): PGD of the K1 genotype resulted in the birth of healthy twins confirmed to be free of the K1 allele. PGD in couples with a heterozygous K1/K2 male partner provides an option for avoiding HDN in sensitized mothers. (Fertil Steril 2003;80: by American Society for Reproductive Medicine.) Key Words: Preimplantation genetic diagnosis, Kell genotype, blastomere biopsy, multiplex PCR, linked marker analysis Received December 2, 2002; revised and accepted March 19, Reprint requests: Anver Kuliev, M.D., Ph.D., Reproductive Genetics Institute, Chicago, 2825 North Halsted, Chicago, Illinois (FAX: ; anverkuliev@ hotmail.com). a Reproductive Genetics Institute. b IVF Michigan /03/$30.00 doi: /s (03) The Kell (K1) system is one of the major antigenic systems in human red blood cells, comparable in importance to RhD, as it may cause maternofetal incompatibility, leading to severe hemolytic disease of the newborn (HDN) in sensitized mothers (1). The K1 allele is present in 9% of the population, in contrast to its highly prevalent allelic variant K2. The gene is located on chromosome 7 (7q33), which consists of 19 exons, with the only C- to-t base substitution in exon 6 in K1 compared with the K2 antigen, which leads to a threonine-to-methionine change at amino acid residue 193, preventing N-glucosylation (2, 3). The C-to-T base substitution also creates a BsmI restriction enzyme site, which provides a reliable DNA test for diagnosis of the KEL genotype. In the case of a pregnancy with a K1 fetus in a K2 mother, antibodies to K1 may be developed, which lead to maternofetal incompatibility causing severe HDN. Although prenatal diagnosis is available for identification of pregnancies at risk for HDN, this may not always prevent the potential complications for the fetus, stillbirth or neonatal death, making preimplantation genetic diagnosis (PGD) a possible option for preventing both Kell and Rhesus hemolytic diseases. This article presents the first experience with PGD for the KEL genotype performed in two at-risk couples with a history of neonatal death in previous pregnancies due to HDN. PGD resulted in preselection and transfer of embryos free from the K1 allele of the KEL gene in each couple and yielded a clinical 1047

2 FIGURE 1 Pedigree of couples at risk for producing children with Kell disease presented for PGD. (A), Pedigree of the first family. Upper panel: The father (upper left) has the K1/K2 genotype, K1 allele linked to 118-bp repeats and K2 allele to 116-bp repeats of intron 1 of the CFTR polymorphic marker, while the mother (upper right) has the K2/K2 genotype, one allele linked to 118-bp repeats and the other to 112-bp repeats of intron 1 of the CFTR polymorphic marker. Lower panel: Reproductive outcomes of this couple, including previous twin pregnancy resulting in death of one of the twins near the birth due to HDN (lower left). Two healthy twins with the K2/K2 genotype as assessed by PGD are shown on the lower right, as also seen from the information on linked polymorphic markers. (B), Pedigree of the second family. Upper panel: The father (upper left) has the K1/K2 genotype, with linkage shown for K1 and K2 alleles, while the mother (upper right) has the K2/K2 genotype, with linkage shown for both normal alleles. Lower panel: Reproductive outcomes of this couple, including previous two pregnancies resulting in the birth of healthy children, although the first one had the K1/K2 genotype (lower left), and one resulting in premature delivery and death with genotype K1/K2 (lower right). The K1 allele is shown as solid black bars, with polymorphic markers linked to both K1 and K2 alleles. pregnancy and the birth of healthy twins confirmed to be free of the K1 allele. CASE REPORT Two couples presented for PGD, both with the paternal K1/K2 genotype, i.e., heterozygous for the C-to-T base substitution in exon 6, creating a BsmI restriction enzyme site. In one couple, a 36-year-old woman had a previous dizygotic twin pregnancy, which resulted in the death near the time of birth of one of the twins carrying the K1 allele due to HDN (Fig. 1A). In the second couple, a 37-year-old woman had three previous pregnancies. The first pregnancy resulted in the birth of a healthy boy carrying the K1 allele, the second in the birth of a normal K2/K2 boy, and the third in a premature delivery of a 32-week female carrying the K1 allele. This baby died the day after birth with the clinical features of severe HDN (Fig. 1B). MATERIALS AND METHODS PGD was performed using the IVF protocol coupled with intracytoplasmic sperm injection, blastomere biopsy, and multiplex nested polymerase chain reaction (PCR) analysis (4). Short tandem repeats (STRs) associated with the cystic fibrosis transmembrane regulator (CFTR) gene, which is located close to the K1 and K2 alleles (5), were used for 1048 Verlinsky et al. Preimplantation testing for Kell disease Vol. 80, No. 4, October 2003

3 TABLE 1 Primers for Kell gene and polymorphic markers. Gene/polymorphism Upper primer Lower primer Annealing temperature Kell gene (nested) Outside 5 TCAGCCCCCTCTCTCTCCTT 3 5 GTGTCTTCGCCAGTGCATCC 3 Inside a 5 AACTTGGAGGCTGGCGCAT 3 5 CCTCACCTGGATGACTGGTG 3 55 C D7s550 (heminested) Outside 5 ACTATCATCCACAATCCACTCC 3 Outside 5 GCAGTTGGGTTATTTCAAGTCT 3 Inside 5 ACTATCATCCACAATCCACTCC 3 Inside 5 HexGATGTTGTGATTAGAGTTGCTGTA 3 56 C CFTR intron 1 (CA)n (heminested) Outside 5 TACAATGAGTTATCCTTATCTTTAC 3 Inside 5 HexCTCCAGAGAAGTAGAACCAATG 3 5 AGATTTTGGACTTGTTAGCC 3 5 AGATTTTGGACTTGTTAGCC 3 50 C CFTR intron 6 (GATT)n (nested) Outside b 5 TGGAATGAGTCTGTACAGCG 3 Inside c 5 TGAGCAGTTCTTAATAGATAA 3 5 GAGGTGGAAGTCTACCATGA 3 5 HexCAAGTCTTTCACTGATCTTC 3 50 C CFTR intron 8 (CA)n (heminested) a Reference 6. b Reference 7. c Reference 8. Outside 5 GAGTCACAGTCTACAGCTTTG 3 Inside 5 FamCGCTTATAGGAGAAGAGGGT 3 5 AACTGTCCTCTTTCTATCTTG 3 5 AGATATTTGCCCATTATCAAG 3 60 C linked marker analysis. The analysis of single sperms showed that the CFTR intron 1 marker was informative in the first couple and the D7S550, CFTR intron 6 and CFTR intron 8 markers in the second couple. The K1 allele was linked to the 118 (CFTR intron 1) repeat in the first (Fig. 1A), and to the 158 (D7S550), 7 (CFTR intron 6) and 124 (CFTR intron 8) repeats in the second couple (Fig. 1B). Outside and inside primer sequences and primer melting temperatures for DNA analysis are shown in Table 1 (6 8). Based on BsmI restriction digestion and STR analysis, K1 allele free embryos were preselected for transfer back to patients, while those predicted to contain the K1 allele were exposed to confirmatory analysis. The protocol was approved by the institutional review board. RESULTS In a single PGD cycle for the first couple, 16 embryos on day 3 were tested, of which 9 were excluded from transfer because of the presence of the K1 allele (Fig. 2). The remaining 7 embryos did not contain the K1 allele (embryo nos. 1, 4, 7, 9, 10, 11, and 17), which was also in agreement with the absence of the linked intron 1 CFTR (118 repeats) marker. In addition, these embryos showed the presence of the paternal K2 allele, evidenced also by the linked intron 1 CFTR (116 repeats) marker. One of these embryos (embryo no. 11) did not develop, 4 were frozen (embryo nos. 4, 7, 10, and 17), and 2 (embryo nos. 1 and 9) were transferred back to the patient, resulting in a clinical twin pregnancy and the birth of a healthy boy and girl homozygous for the K2 genotype (Fig. 2). In the second couple, a total of 20 embryos were tested in four PGD cycles (8 in the first, 5 in the second, 3 in the third, and 4 in the fourth cycle). Nine were heterozygous for the K1 allele, i.e., unsuitable for transfer. Seven of 11 K1 allele free embryos were transferred (2 in the first, 1 in the second, 1 in the third, and 3 in the fourth cycle), yielding no clinical pregnancy. The follow-up analysis of nine K1 allele containing embryos, which were excluded from transfer and available for study, confirmed predicted genotypes. The study suggested that PGD for the Kell genotype based on the absence of the K1 allele, together with absence of the linked intron 1 CFTR (118 repeats) marker and presence of both paternal and maternal K2 alleles, is reliable for practical application. DISCUSSION The presented cases are the only PGD cycles resulting in the birth of unaffected K1-free children in the experience of over 4,000 PGDs performed at the present time (9). A number of attempts have been undertaken to perform PGD for Rhesus disease, which, however, have not yet resulted in a clinical pregnancy (10). Both of these conditions are quite prevalent, with a frequency of approximately 15% for RhD and 9% for the KEL antigen, which presents a risk for alloimmunization that may lead to HDN in some of the at-risk couples. Therefore, PGD may be a useful option for these couples to avoid the establishment of the RhD or K1 pregnancy in the sensitized mothers. Our results also demonstrate the further extension of indications for PGD to blood group incompatibility, which has not been the case even in the practice of prenatal diagnosis. Although the at-risk pregnancies detected by prenatal diagnosis may be treated by an intrauterine transfusion, the potential complication for the fetus cannot be completely excluded even after this procedure. Pregnancy termination in such cases will also be unacceptable, as the antibodies to K1, FERTILITY & STERILITY 1049

4 FIGURE 2 PGD for Kell genotype. (A), Schematic diagram showing C-to-T substitution in exon 6 of KEL gene on chromosome 7. Black arrows demonstrate the positions of nested primers. (B), Restriction map for BsmI digestion showing the gain of the BsmI site by the K1 allele (lower line). (C), Polyacrylamid gel electrophoresis of the BsmI digested PCR products of 16 blastomeres from the first PGD couple, demonstrating the K1 allele free genotype in embryo nos. 1, 4, 7, 9, 10, 11, and 17, from which embryo nos. 1 and 9 were transferred, resulting in a twin pregnancy and the birth of healthy K1 allele free children. The remaining 9 embryos have the K1/K2 genotype. L standard; F paternal DNA amplified from sperm; M maternal normal amplified DNA; Un undigested PCR product; K1/K2 affected blastomere; K2/K2 normal blastomere. for example, are developed in only 5% of persons obtaining incompatible blood (3). On the other hand, some of the at-risk couples have had such an unfortunate experience with HDN, resulting in neonatal death, as in both of our couples, that they regard PGD as their only option to plan another pregnancy. This makes PGD attractive for patients at risk for alloimmunization, although such conditions have rarely been an indication for prenatal diagnosis. Thus, PGD for the Kell genotype and other red blood group systems is feasible, providing a novel approach for sensitized mothers to avoid the risk of having children with HDN. References 1. Online Mendelian Inheritance in Man (OMIM). Baltimore: John Hopkins University, 2001, at [MIM ]. 2. Lee S, Zambas E, Wu X, Reid M, Zelinsky T, Redman C. Molecular basis of the Kell (K1) phenotype. Blood 1995;85: Lee S, Zambas E, Green ED, Redman C. Organization of the gene for encoding the human Kell group protein. Blood 1995;85: Verlinsky Y, Kuliev A. Atlas of preimplantation genetic diagnosis. New York, London: Parthenon, Verlinsky et al. Preimplantation testing for Kell disease Vol. 80, No. 4, October 2003

5 5. Purohit KR, Weber JL, Ward LJ, Keats JB. The Kell blood group locus is close to the cystic fibrosis locus on chromosome 7. Hum Genet 1992;89: Reid ME, Rios M, Powell VI, Charles-Pierre D, Malavade V. DNA from blood samples can be used to genotype patients who have recently received a transfusion. Transfusion 2000;40: Zielenski J, Rozmahel R, Bozon D, Kerem BS, Grzelczak Z, Riordan J, et al. Genomic DNA sequence of the cystic fibrosis transmembrane conductance regulator (CFTR). Gene Genomics 1991;10: Chehab FF, Johnson J, Louie E, Goossens M, Kawasaki E, Elrich H. A dimorphic 4-bp repeat in the cystic fibrosis gene is in absolute linkage disequilibrium with the delta F508 mutation: implications for prenatal diagnosis and mutation origin. Am J Hum Genet 1991;48: Kuliev A, Verlinsky Y. Current features of preimplantation diagnosis. Reprod biomed online 2002;5: Van Den Veyver IB. Prenatal and preimplantation genetic diagnosis for RhD alloimmunization. In: 10th international conference on prenatal diagnosis and therapy. Barcelona (Spain), June 19 21, Barcelona: University of Barcelona; 2000: FERTILITY & STERILITY 1051