Echinocandin Susceptibility Testing of Candida Isolates Collected during a 1-Year Period in Sweden

Transcription

1 JOURNAL OF CLINICAL MICROBIOLOGY, July 2011, p Vol. 49, No /11/$12.00 doi: /jcm Copyright 2011, American Society for Microbiology. All Rights Reserved. Echinocandin Susceptibility Testing of Candida Isolates Collected during a 1-Year Period in Sweden Marlene Axner-Elings, 1 Silvia Botero-Kleiven, 1 Rasmus Hare Jensen, 2 and Maiken Cavling Arendrup 2 * Swedish Institute for Infectious Disease Control, Solna, Sweden, 1 and Statens Serum Institute, Copenhagen, Denmark 2 Received 31 January 2011/Returned for modification 22 March 2011/Accepted 26 April 2011 The susceptibilities of Candida to the echinocandins anidulafungin, caspofungin, and micafungin were determined by using the recently revised CLSI breakpoints and Etest on 238 clinical bloodstream Candida collected between September 2005 and August The represent approximately 95% of all non-albicans Candida bloodstream infections and one-third of Candida albicans bloodstream infections during this 1-year period in Sweden. The collection included 81 C. albicans, 81 C. glabrata, 36 C. parapsilosis, 14 C. dubliniensis, 8 C. tropicalis, 8 C. lusitaniae, 5 C. krusei, 2 C. guilliermondii and 2 C. inconspicua as well as 1 C. pelliculosa isolate. The MICs were largely consistent with the global epidemiology of bloodstream Candida. All C. albicans and C. glabrata were susceptible to all 3 echinocandins (MIC < g/ml in all instances). Resistance (MIC > 8 g/ml) to anidulafungin alone was observed for 4 (11.1%) C. parapsilosis and for 1/2 C. guilliermondii. Intermediate susceptibility to caspofungin alone was observed for 2/5 C. krusei. One of the eight C. tropicalis was classified as being intermediately susceptible to micafungin (MIC, 0.5 g/ml) and as being resistant to anidulafungin and caspofungin (MIC > 1 g/ml). This isolate harbored a heterozygous FKS1 hot spot mutation (S80P) known to confer echinocandin resistance. This first study to apply the revised CLSI breakpoints for Etest endpoints showed that the breakpoints worked successfully in detecting an isolate with a hot spot mutation. Acquired echinocandin resistance is rare in Sweden. Echinocandin MICs against C. parapsilosis and C. guilliermondii were lowest for micafungin. Downloaded from The echinocandins anidulafungin, caspofungin, and micafungin are effective and widely used for the treatment of invasive candidiasis. Reports of echinocandin resistance in clinical causing invasive candidiasis have been rare. Mutations in two hot spot regions of FKS genes, which encode the target and major subunit of the 1,3- -D-glucan synthase complex, account for most cases of acquired echinocandin resistance reported for Candida strains (3, 7, 23, 26, 28, 30). Although rare in clinical practice, the early detection of echinocandin resistance in clinical Candida is necessary to ensure good clinical outcomes (24, 31). Based on limited data when the echinocandins were first introduced, the Clinical and Laboratory Standards Institute (CLSI) proposed an interpretive susceptibility breakpoint of 2 g/ml for all three echinocandins against all Candida species (12, 30). More recently, species-specific susceptibility (S) breakpoints and resistance (R) breakpoints have been approved by the CLSI (28). The revised CLSI breakpoints are summarized in Table 1, along with epidemiological cutoff values (ECVs) in cases in which no CLSI breakpoint has been established. The CLSI M27-A3 and EUCAST EDef 7.1 protocols for broth microdilution assays are validated and widely used for the testing of the susceptibility of Candida to antifungals, including echinocandins (12, 32). There is also a widely * Corresponding author. Mailing address: Unit of Mycology, Department of Microbiological Surveillance and Research, Statens Serum Institute, Building 43/117, DK-2300 Copenhagen, Denmark. Phone: (45) Fax: (45) mad@ssi.dk. Published ahead of print on 4 May used commercially available method for susceptibility testing (Etest; AB biomèrieux), which is validated. All three of these methods provide reliable results. An assessment of anidulafungin, caspofungin, and micafungin MICs using methods based on EUCAST EDef 7.1, CLSI M27-A3, and Etest methods showed all three methods to give acceptable results with regard to interpretations of susceptibility endpoints with the application of wild-type upper-limit values as breakpoints (6). The testing of Candida for susceptibility to anidulafungin showed an essential agreement of 80% between the CLSI M27-A3 and Etest methods (14). The present study was performed by using the Etest to assess the in vitro susceptibilities of bloodstream collected over a 1-year period from candidemia patients in Sweden to anidulafungin, caspofungin, and micafungin. MATERIALS AND METHODS Organisms. We tested 238 clinical of Candida species from patients with confirmed candidemia. All of the had been retrieved by 28 clinical microbiology laboratories from different Swedish hospitals between September 2005 and August Susceptibility testing of the was performed by the Swedish Institute for Infectious Disease Control. The 157 non-albicans Candida from Sweden were obtained from 157 candidemia patients; these comprise all of the non-albicans Candida retrieved from Sweden during the 1-year survey and represent approximately 95% of all cases of non-albicans candidemia in Sweden during this period. The 81 C. albicans obtained from 81 patients represent approximately one-third of all cases of microbiologically confirmed candidemia caused by C. albicans in Sweden during this period. The confirmation of species identity was performed by the pyrosequencing of species-specific internal transcribed spacer (ITS) DNA signatures in the ribosomal DNA locus (9). Using the BioEdit program (version ), all ITS2 sequences available in the GenBank database were aligned. Subsequently, 40 nucleotides (5 bp in the 28S rrna gene and 35 bp in the ITS2 region) were identified to be sufficient to discriminate between species of medically important on September 16, 2016 by PENN STATE UNIV 2516

2 VOL. 49, 2011 ECHINOCANDIN SUSCEPTIBILITY TESTING OF CANDIDA SPECIES 2517 TABLE 1. Susceptibility and resistance breakpoints for echinocandins Species MIC breakpoint for S/MIC breakpoint for R ( g/ml) Anidulafungin Caspofungin Micafungin C. albicans a 0.25/ / / 1 C. dubliniensis b 0.25/ / / 1 C. glabrata a 0.125/ / / 0.25 C. krusei a 0.25/ / / 1 C. tropicalis a 0.25/ / / 1 C. parapsilosis a 2/ 8 2/ 8 2/ 8 C. guilliermondii a 2/ 8 2/ 8 2/ 8 C. lusitaniae c 2/ 8 0.5/ 2 0.5/ 2 a CLSI breakpoints as approved at the CLSI meeting, 9 to 11 January 2011, Orlando, FL, and based on reference 28. b Based on C. albicans, because MICs for C. albicans and C. dubliniensis are similar, and no breakpoints have been established for C. dubliniensis. c Based on epidemiological cutoff values (ECVs) described previously by Pfaller et al. (27). yeasts. Using this information, a local nucleotide database with the 40-nucleotide-long reference sequences was generated. The pyrosequencing technology can read from the first nucleotide after primer binding and generates short 40- to 60-bp-long sequences. Therefore, the last nucleotide of the sequencing primer Drug and organism is located 6 bp before the end of the 28S rrna gene. The clinical were identified through the first 40 nucleotides after primer binding. The sequences obtained by pyrosequencing analysis were BLAST searched against the local nucleotide database. Alignments with 100% identity between the query and a sequence in the local database identified the clinical to the species level. Antifungal agents. Etest strips (0.002 to 32 g/ml) for micafungin (batch BI2518), caspofungin (batches BH0576 and BI2525), and anidulafungin (batches BI3578, BJ0645, BI3107, BI1808, and BJ0428) were purchased from AB biomèrieux, Sweden. Susceptibility testing. The Etest (AB biomèrieux, Sweden) was used for susceptibility testing according to the manufacturer s instructions. RPMI 1640 medium (Sigma) supplemented with 2% glucose buffered with M morpholinepropanesulfonic acid (MOPS) at ph 7.0 (Sigma) and 1.5% Bacto agar (Difco Laboratories) was used to prepare Etest RPMI agar plates. Before susceptibility testing, each isolate was subcultured onto Sabouraud agar. Inocula were prepared by transferring colonies from the 24-h-old cultures into 0.85% NaCl and adjusting the suspension to a McFarland standard turbidity equivalent of 0.5. The agar plates were inoculated with the cell suspension by flooding the entire surface of the agar. The volume used for the inoculation of the plates was approximately 5 ml. The excess fluid was discarded after approximately 1 min, and the plates were placed inside a laminar flow cabinet until they were completely dry (about 20 to 25 min). The same cell suspensions obtained from each isolate were used for the susceptibility testing of all three echinocandins. As Etest strips contain a continuous gradient of drug rather than a standard 2-fold dilution series, the Etest MICs were elevated as required to the next drug concentration that matches the standard microdilution scheme. Etests were read at 24 TABLE 2. In vitro susceptibilities of common yeast from 238 bloodstream to micafungin, caspofungin, and anidulafungin determined by Etests read at 24 h Total no. of MIC ( g/ml) a No. of with MIC ( g/ml) of: Range 50% 90% Anidulafungin C. albicans 80 b C. glabrata C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C. guilliermondii C. inconspicua C. pelliculosa Caspofungin C. albicans 80 b C. glabrata C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C. guilliermondii C. inconspicua C. pelliculosa Micafungin C. albicans 80 b C. glabrata C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C. guilliermondii C. inconspicua C. pelliculosa a Fifty percent and 90% MICs are MICs for which 50% and 90% of are inhibited, respectively. b The MIC value at 24 h for one C. albicans isolate is missing.

3 2518 AXNER-ELINGS ET AL. J. CLIN. MICROBIOL. TABLE 3. In vitro susceptibilities of common yeast from 238 bloodstream to micafungin, caspofungin, and anidulafungin determined by Etests read at 48 h Drug and organism Total no. of MIC ( g/ml) a and 48 h by reading the trailing endpoints at the first visual point of significant inhibition of growth (i.e., 80% inhibition) (1). The recently revised CLSI breakpoints (28) and ECVs (27) were used to define resistance for Candida strains; these are summarized in Table 1. Quality control. Quality control was performed on each day of testing by using the reference strains C. albicans ATCC 90028, C. parapsilosis ATCC 22019, and C. krusei ATCC FKS gene sequence analysis. For the one C. tropicalis isolate that showed MIC values suggestive of resistance, genomic DNA was extracted from the culture grown for 2 days on Chrom agar using a 2-step buffer extraction procedure as previously described (10, 11). The following primers were applied as PCR and sequencing primers targeting two hot spots in the FKS1 target gene encoding 1,3- -D-glucan synthase subunit 1 of C. tropicalis: GSC_1F (TCATTGCTGTG GCCACTTTAG) and GSC_1R (TAGAATGAACGACCAATGGAGA) (21), and GSC_2F (ATTGCTCCTGCCGTTGATTG) and GSC_2R (GGTCAAATC AGTGAAACCG). Sequencing was performed at Macrogen Holland, and the obtained sequences were aligned with the FKS1 reference sequence of C. tropicalis (GenBank accession no. EU676168), using the bioinformatics software CLC DNA Workbench (CLC, Aarhus, Denmark). RESULTS AND DISCUSSION The susceptibilities of 238 clinical of Candida species from 238 patients with bloodstream Candida infections to the echinocandins anidulafungin, caspofungin, and micafungin were determined. Of these 238, 81 (34.0%) were C. No. of with MIC ( g/ml) of: Range 50% 90% Anidulafungin C. albicans C. glabrata C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C. guilliermondii C. inconspicua C. pelliculosa Caspofungin C. albicans C. glabrata C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C. guilliermondii C. inconspicua C. pelliculosa Micafungin C. albicans C. glabrata C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C. guilliermondii C. inconspicua C. pelliculosa a Fifty percent and 90% MICs are MICs at which 50% and 90% of are inhibited, respectively. albicans, 81 (34.0%) were C. glabrata, 36 (15.1%) were C. parapsilosis, 14 (5.9%) were C. dubliniensis, 8 (3.4%) were C. tropicalis, 8 (3.4%) were C. lusitaniae, 5 (2.1%) were C. krusei, 2 (0.8%) were C. guilliermondii, and 2 (0.8%) were C. inconspicua; and there was 1 (0.4%) isolate of C. pelliculosa. For most Candida species tested, MIC values were low for all three echinocandins and below the susceptibility breakpoint. From the Etest readings at 24 h, MIC 90 values for anidulafungin, caspofungin, and micafungin were 0.004, and g/ml, respectively, for C. albicans; 0.004, 0.064, and g/ml, respectively, for C. dubliniensis; 0.008, 0.125, and g/ml, respectively, for C. glabrata; and 0.032, 0.5, and g/ml, respectively, for C. lusitaniae (Table 2). Etest readings at 48 h gave similar results (Table 3). No MIC value was suggestive of resistance for these species at 24 or 48 h, but a single C. albicans isolate was classified as being intermediately susceptible to caspofungin (MIC, 0.5 g/ml) at the 48-h reading (Table 4). These results are consistent with those reported elsewhere previously for these species (30) and support the use of the revised CLSI breakpoints for interpretations of Etest endpoints for these species. The MIC values for caspofungin were in general 3 to 4

4 VOL. 49, 2011 ECHINOCANDIN SUSCEPTIBILITY TESTING OF CANDIDA SPECIES 2519 TABLE 4. Rates of resistance of 238 bloodstream yeast to anidulafungin, caspofungin, and micafungin Drug and organism Total no. of Etest at 24 h a intermediately resistant dilution steps higher than those for anidulafungin and micafungin across the species, in contrast to what was observed previously using the CLSI microdilution reference method (28). For C. krusei particularly, the MIC 90 value at 24 h was 0.5 g/ml for caspofungin, compared to and g/ml for anidulafungin and micafungin, respectively (Table 2). Thus, 2/5 C. krusei were classified as being intermediately susceptible to caspofungin (MICs of 0.5 g/ml) at the 24-h reading, and 5/5 were classified as being intermediately susceptible to caspofungin at the 48-h reading, whereas there was no C. krusei isolate found to be intermediately susceptible or resistant to anidulafungin or micafungin at any time point (Table 4). In general, the three echinocandins are regarded as being equally effective, and therefore, any isolate would be expected to have the same susceptibility profile for all three compounds. In our study the MIC values for the five C. krusei were either identical or only one dilution step apart, which indicates that none of the five possessed acquired resistance mechanisms. A future evaluation of Etest results is needed to determine whether the revised resistance breakpoint of 0.5 g/ml may be too restrictive for caspofungin and C. krusei. As generally observed with echinocandin susceptibility testing of C. parapsilosis and C. guilliermondii, MIC values were relatively high, especially for anidulafungin. By applying the recently revised CLSI breakpoints, with resistance defined as resistant Total no. of Etest at 48 h a intermediately resistant resistant Anidulafungin C. albicans 80 b 0 (0.0) 0 (0.0) 81 0 (0.0) 0 (0.0) C. glabrata 81 0 (0.0) 0 (0.0) 81 0 (0.0) 0 (0.0) C. parapsilosis 36 6 (16.7) 4 (11.1) (41.6) 6 (16.7) C. dubliniensis 14 0 (0.0) 0 (0.0) 14 0 (0.0) 0 (0.0) C. tropicalis 8 0 (0.0) (0.0) 1 C. lusitaniae C. krusei C. guilliermondii Caspofungin C. albicans 80 b 0 (0.0) 0 (0.0) 81 0 (0.0) 1 (1.2) C. glabrata 81 0 (0.0) 0 (0.0) 81 0 (0.0) 0 (0.0) C. parapsilosis 36 0 (0.0) 0 (0.0) 36 0 (0.0) 0 (0.0) C. dubliniensis 14 0 (0.0) 0 (0.0) 14 0 (0.0) 0 (0.0) C. tropicalis C. lusitaniae C. krusei C. guilliermondii Micafungin C. albicans 80 b 0 (0.0) 0 (0.0) 81 0 (0.0) 0 (0.0) C. glabrata 81 0 (0.0) 0 (0.0) 81 0 (0.0) 0 (0.0) C. parapsilosis 36 0 (0.0) 0 (0.0) 36 0 (0.0) 0 (0.0) C. dubliniensis 14 0 (0.0) 0 (0.0) 14 0 (0.0) 0 (0.0) C. tropicalis C. lusitaniae C. krusei C. guilliermondii a Resistance (R) as defined in Table 1. There are no accepted breakpoints for C. inconspicua and C. pelliculosa resistance; thus, these are not included. b The MIC value at 24 h for one C. albicans isolate is missing. an MIC of 8 g/ml for these species (Table 1) (28), 4 (11.1%) C. parapsilosis and 1 of 2 C. guilliermondii were resistant to anidulafungin when the Etest was read at 24 h, but none were resistant to caspofungin or micafungin (Table 4). Similar findings were observed with the Etest read at 48 h but with 6 (16.7%) C. parapsilosis and both C. guilliermondii being resistant to anidulafungin and 1 C. guilliermondii isolate being resistant to caspofungin. The MIC 90 values at 24 h were 8 g/ml for anidulafungin for both C. parapsilosis and C. guilliermondii, compared with 0.5 and 1 g/ml, respectively, for caspofungin and 0.5 g/ml for micafungin (Table 2). The naturally occurring polymorphism at hot spot 1 in FKS1 in C. parapsilosis and C. guilliermondii accounts for the MIC values being in the same range as those of hot spot mutant of other Candida species (17). Whereas C. guilliermondii is a rare species for which only limited clinical data are available (5, 13, 29, 33), studies have been reported that show that the overall clinical responses to micafungin and caspofungin for invasive C. parapsilosis infections are comparable to those for infections caused by other Candida species (22, 25). C. parapsilosis has low virulence in animal models (4), and clinical data suggest that infections caused by this species are less severe than those caused by other Candida species, as they are associated with lower rates of mortality, neutropenia, corticosteroid therapy, and hospitalization (2, 18, 20). Previous echinocandin use may predispose patients to C. parapsilosis

5 2520 AXNER-ELINGS ET AL. J. CLIN. MICROBIOL. infections, and breakthrough infections during echinocandin treatment have been significantly associated with C. parapsilosis (15, 34); thus, other drug classes are generally preferred for infections caused by this species. With regard to clinical pharmacokinetics, the 3 echinocandins have average C min and C max plasma values of approximately 2 and 10 g/ml, respectively (8, 19, 35). Thus, the higher anidulafungin MIC values for C. guilliermondii than micafungin MICs in our study may be of clinical relevance, although the general perception has been that susceptibility to the three compounds of the echinocandin class of drugs is uniform. MIC 50 values for the 8 of C. tropicalis were g/ml for anidulafungin, g/ml for caspofungin, and g/ml for micafungin when the Etest reading was taken at 24 h (Table 2) or 48 h (Table 3). For one of the eight C. tropicalis, obtained from a patient receiving caspofungin, the MIC values were suggestive of resistance (MIC 1 g/ml) to anidulafungin (MICs of 1 g/ml at 24 h and 2 g/ml at 48 h) and caspofungin (4 and 8 g/ml, respectively) and of intermediate susceptibility to micafungin (0.5 g/ml at both 24 and 48 h). Sequence analysis of the FKS1 region of this isolate revealed a heterozygous Fks1p (S80P) mutation, which is known to confer echinocandin resistance (16). Unfortunately, no information was available as to the length of time of caspofungin exposure prior to the isolation of the isolate or the clinical outcome. For the other included in our study (C. inconspicua and C. pelliculosa), MIC values of 0.25 g/ml or lower were observed for all three echinocandins (Tables 2 and 3), which are consistent with MIC values reported in the literature and suggest that these species are good targets for echinocandin treatment (13). In conclusion, the MIC values for Candida from candidemia patients in Sweden were largely consistent with the global epidemiology of infective Candida strains reported in the literature. To our knowledge, this is the first study to demonstrate the applicability of the revised breakpoints for the interpretation of Etest endpoints for clinical. The revised susceptibility CLSI breakpoints (Table 1) worked well for most species and successfully identified one resistant isolate with a heterozygous hot spot mutation in the FKS gene. However, as the Etest MIC values of anidulafungin and micafungin, in contrast to those of caspofungin, were considerably lower than the revised CLSI microdilution susceptibility breakpoints, it remains to be elucidated if the sensitivity with respect to the identification of FKS hot spot mutant may vary depending on which Etest strip is used. Furthermore, the breakpoint bisected the caspofungin MIC distribution for C. krusei, and thus, further studies are needed in order to evaluate whether susceptible C. krusei may be misclassified as being caspofungin resistant using the Etest and the revised CLSI breakpoints. Resistance to anidulafungin (but not to caspofungin or micafungin) was observed among C. parapsilosis and C. guilliermondii. Future studies are needed to explore whether this observation translates into differential clinical efficacy for the three echinocandins with regard to infections caused by C. parapsilosis and C. guilliermondii. ACKNOWLEDGMENTS This work was supported by a grant from Astellas Pharma. We thank Connie Grogan (Irsee, Germany) for editorial assistance in the preparation of the manuscript. We also thank the members of the Swedish Reference Group for Antifungal Agents (RAM) for their support in the initiative of obtaining this collection of fungal and Srisuda Pannanusorn for expert advice in the pyrosequencing experiments. REFERENCES 1. Alexander, B. D., et al Comparative evaluation of Etest and Sensititre YeastOne panels against the Clinical and Laboratory Standards Institute M27-A2 reference broth microdilution method for testing Candida susceptibility to seven antifungal agents. J. Clin. Microbiol. 45: Almirante, B., et al Epidemiology, risk factors, and prognosis of Candida parapsilosis bloodstream infections: case-control population-based surveillance study of patients in Barcelona, Spain, from 2002 to J. Clin. Microbiol. 44: doi: /jcm Arendrup, M., et al Breakthrough Aspergillus fumigatus and Candida albicans double infection during caspofungin treatment: laboratory characteristics and implication for susceptibility testing. Antimicrob. Agents Chemother. 53: doi: /aac Arendrup, M., T. Horn, and N. Frimodt-Møller In vivo pathogenicity of eight medically relevant Candida species in an animal model. Infection 30: Arendrup, M. C., et al National surveillance of fungemia in Denmark (2004 to 2009). J. Clin. Microbiol. 49: doi: /jcm Arendrup, M. C., et al Echinocandin susceptibility testing of Candida species: comparison of EUCAST EDef 7.1, CLSI M27-A3, Etest, disk diffusion, and agar dilution methods with RPMI and IsoSensitest media. Antimicrob. Agents Chemother. 54: Baixench, M. T., et al Acquired resistance to echinocandins in Candida albicans: case report and review. J. Antimicrob. Chemother. 59: Benjamin, D. K. J., et al Safety and pharmacokinetics of intravenous anidulafungin in children with neutropenia at high risk for invasive fungal infections. Antimicrob. Agents Chemother. 50: Boyanton, B. L., R. A. Luna, L. R. Fasciano, K. G. Menne, and J. Versalovic DNA pyrosequencing-based identification of pathogenic Candida species by using the internal transcribed spacer 2 region. Arch. Pathol. Lab. Med. 132: Brillowska-Dabrowska, A. December DNA preparation from nail samples. Denmark patent WO Brillowska-Dabrowska, A. D., M. Saunte, and M. C. Arendrup Fivehour diagnosis of dermatophyte nail infections with specific detection of Trichophyton rubrum. J. Clin. Microbiol. 45: doi: / JCM CLSI Reference method for broth dilution antifungal susceptibility testing of yeasts; approved standard, 3rd ed. CLSI document M27-A3. Clinical and Laboratory Standards Institute, Wayne, PA. 13. Diekema, D. J., et al In vitro activity of seven systemically active antifungal agents against a large global collection of rare Candida species as determined by CLSI broth microdilution methods. J. Clin. Microbiol. 47: Espinel-Ingroff, A., E. Canton, J. Peman, and E. Martín-Mazuelo Comparison of anidulafungin MICs determined by the Clinical and Laboratory Standards Institute broth microdilution method (M27-A3 document) and Etest for Candida species. Antimicrob. Agents Chemother. 54: Forrest, G. N., E. Weekes, and J. K. Johnson Increasing incidence of Candida parapsilosis candidemia with caspofungin usage. J. Infect. 56: Garcia-Effron, G., D. P. Kontoyiannis, R. E. Lewis, and D. S. Perlin Caspofungin-resistant Candida tropicalis strains causing breakthrough fungemia in patients at high risk for hematologic malignancies. Antimicrob. Agents Chemother. 52: doi: /aac Garcia-Effron, G. S., K. Katiyar, S. Park, T. D. Edlind, and D. S. Perlin A naturally occurring proline-to-alanine amino acid change in Fks1p in Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis accounts for reduced echinocandin susceptibility. Antimicrob. Agents Chemother. 52: doi: /aac Hajjeh, R. A., et al Incidence of bloodstream infections due to Candida species and in vitro susceptibilities of collected from 1998 to 2000 in a population-based active surveillance program. J. Clin. Microbiol. 42: Hiemenz, J., et al Pharmacokinetic and maximum tolerated dose study of micafungin in combination with fluconazole versus fluconazole alone for prophylaxis of fungal infections in adult patients undergoing a bone marrow or peripheral stem cell transplant. Antimicrob. Agents Chemother. 49: Horn, D. L., et al Epidemiology and outcomes of candidemia in 2019 patients: data from the prospective antifungal therapy alliance registry. Clin. Infect. Dis. 48:

6 VOL. 49, 2011 ECHINOCANDIN SUSCEPTIBILITY TESTING OF CANDIDA SPECIES Katiyar, S., M. Pfaller, and T. D. Edlind Candida albicans and Candida glabrata clinical exhibiting reduced echinocandin susceptibility. Antimicrob. Agents Chemother. 50: doi: /aac Kuse, E. R., et al Micafungin versus liposomal amphotericin B for candidaemia and invasive candidosis: a phase III randomised double-blind trial. Lancet 369: doi: /s (07) Laverdiere, M., et al Progressive loss of echinocandin activity following prolonged use for treatment of Candida albicans oesophagitis. J. Antimicrob. Chemother. 57: Pappas, P. G., et al Guidelines for treatment of candidiasis. Clin. Infect. Dis. 38: Pappas, P. G., et al Micafungin versus caspofungin for treatment of candidemia and other forms of invasive candidiasis. Clin. Infect. Dis. 45: Pasquale, T., J. R. Tomada, M. Ghannoun, J. Dipersio, and H. Bonilla Emergence of Candida tropicalis resistant to caspofungin. J. Antimicrob. Chemother. 61: Pfaller, M. A., et al Wild-type MIC distributions and epidemiological cutoff values for the echinocandins and Candida spp. J. Clin. Microbiol. 48: Pfaller, M. A., et al. 23 February Clinical breakpoints for the echinocandins and Candida revisited: integration of molecular, clinical, and microbiological data to arrive at species-specific interpretive criteria. Drug Resist. Updat. [Epub ahead of print.] 29. Pfaller, M. A., et al Candida guilliermondii, an opportunistic fungal pathogen with decreased susceptibility to fluconazole: geographic and temporal trends from the ARTEMIS DISK antifungal surveillance program. J. Clin. Microbiol. 44: Pfaller, M. A., et al Correlation of MIC with outcome for Candida species tested against caspofungin, anidulafungin, and micafungin: analysis and proposal for interpretive MIC breakpoints. J. Clin. Microbiol. 46: Rex, J. H., et al Practice guidelines for treatment of candidiasis. Infectious Diseases Society of America. Clin. Infect. Dis. 30: Rodriguez-Tudela, J. L., et al EUCAST definitive document EDef 7.1: method for the determination of broth dilution MICs of antifungal agents for fermentative yeasts. Clin. Microbiol. Infect. 14: Sandven, P., et al Candidemia in Norway (1991 to 2003): results from a nationwide study. J. Clin. Microbiol. 44: Sipsas, N., et al Candidemia in patients with hematologic malignancies in the era of new antifungal agents ( ): stable incidence but changing epidemiology of a still frequently lethal infection. Cancer 115: Spriet, I., et al Pharmacokinetics of caspofungin and voriconazole in critically ill patients during extracorporeal membrane oxygenation. J. Antimicrob. Chemother. 63: Downloaded from on September 16, 2016 by PENN STATE UNIV