Pyrosequencing Experience from Mumbai, India. Camilla Rodrigues MD Consultant Microbiologist Hinduja Hospital,Mumbai India
|
|
- Shannon Peters
- 5 years ago
- Views:
Transcription
1 Pyrosequencing Experience from Mumbai, India Camilla Rodrigues MD Consultant Microbiologist Hinduja Hospital,Mumbai India
2 Mumbai maximum city
3 Slow Fast 1-2 D With increasing drug resistance, DST is vital Suspected MDR Case Solid Culture & DST Liquid Culture & DST Molecular Tests Rapid diagnosis with DST is fundamental
4 India s PMDT Scale up Diagnostic algorithm for DR TB Guidelines on Programmatic Management of DR TB in India 2017
5 Beyond Xpert & LPA : Sequencing in the DR TB world - Sanger Sequencing - Pyrosequencing (PSQ) - Targeted NGS - Whole Genome Sequencing
6 PSQ Outline Principle & Cost Clinical applications Challenges
7 What is pyrosequencing? Real time diagnostic DNA sequencing by synthesis based on actual short segment sequencing (<100bp ) at a speed of 1 min / nucleotide Unlike Sanger sequencing ( chain termination with dideoxynucleotides), PSQ relies on pyrophosphate detection on nucleotide incorporation Can produce clinically relevant results in < 6 hrs from clinical samples Flexible & adaptable to regional prevalence specifics & new mutations
8 DNA extraction PCR amplification of 8 specific targets Post PCR, biotinylated ss DNA template is coupled to streptavidin coated beads Pyrosequencing Software analysis search for 100% identity match in target library containing all expected mutations
9 Pyrosequencing : cascade of enzymatic reactions 1. Iterative dntp dispensation only 1 at a time the order determined by known mutations 2. Incorporation of dntp generates PPi. 3. PPi reacts with substrate & triggers a series of chemical reactions catalyzed by enzymes. 4. Nucleotide incorporation catalyses a flash of light 5. Apyrase degrades unincorporated dntp & ATP 6. Pyrogram shows a sequential event of dntps incorporated
10 Pyrogram Target: inha promoter 100% match with wild type sequence. <Sequence read <Nucleotide Dispensation 10
11 Detecting a rpob mutation Complementary nucleotide to the base strand is accompanied by release of pyrophosphate (PPi) which generates light Query 1 TGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCC 42 Library1 TGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCC 42
12 PSQ : detecting > 64 mutations in < 6 hrs Target Location Mutations Length M tuberculosis complex Isoniazid IS katg inha promoter - 4 to ahpc- oxyr - 4 to Rifampicin rpob Fluoroquinolone gyra SLI KAN,AMK,CAP rrs KAN eis -6 to
13 PSQ : Instrumentation PyroMark Q24 PyroMark Q96 ID PyroMark Q96 MD PyroMark Q48/ Q96 MD Automated Throughput 1 24 samples 1 96 samples 1 96 samples with automation option Running volume 25 µl 40 µl 12 µl 12 µl Read lengths SQA ~ bp SNP ~ bp SQA SNP ~50 70 bp ~ bp SNP ~ bp SNP ~ bp AQ ~ bp AQ ~ bp AQ ~ bp AQ ~ bp CpG ~ bp CpG ~ bp CpG ~ bp CpG ~ bp Main applications Genetic testing Epigenetics Microbilogy Genetic testing Epigenetics Microbiology Epigenetics Genetic testing Epigenetics Genetic testing (SNP/AQ only in batch mode) Sensitivity 5% limit of detection 10% limit of detection 2% limit of detection 2% limit of detection
14 PSQ : cost Equipment : Pyromark Q 48 : approx INR 50 lakhs Q 96 : approx INR 75 lakhs Consumables : TB & XDR detection :approx INR 4500 per sample with controls
15 PSQ Outline Principle & Cost Clinical applications Challenges
16
17 : implications for global implementation BMC Infect Dis 2016;16:458
18 PTB : PSQ Sequencing success by Smear & Culture PSQ success for each target region stratified by smear and culture BMC Infect Dis 2016;16:458
19 What do we use Pyrosequencing for? (i) Smear Positive Samples with a LPA WT band present but no corresponding mutant band or LPA indeterminate (ii) Smear negative TB : PTB & EPTB (iii) Resolving discordant Xpert & MGIT DST (iv) Confirming RIF Resistant in Xpert MTB detected very low
20 HNH 2017 : DR conferring mutations detected by MTBDRplus & MTBDRsl Resistant Phenotype Reference Genes DR conferring mutations No(%) Detected ONLY WT absent Only WT absent with no Mutant band INH R kat G S315T1/ S315T (87%) katg (2.23%) inha C15T A16G T 8C 202 ( 9.2%) 27 (1.23%) inha RIF R rpob D516V H526Y H526D S531L 32 ( 1.4%) 6 ( 0.2%) 4 ( 0.18%) 1717 (93%) WT 1 : WT 2 : WT 2/3 : WT 3/4 : Wt 4/5 : WT 5/6 : WT 7 : WT 8 : (0.5%) 8 (0.3%) 13 (0.5%) 6 (0.27%) - 52 (2.3%) 21 (0.95%) OFX R gyra gyrb A90V S91P D94A D94N/Y D94G D94H N538D/ E540G 318 (26%) 14 (1.1%) 30 (2.4%) 21 (1.73%) 423 (64%) 12 (1%) 2 (0.1%) gyra WT1 : WT2 : WT3: gyrb WT1 : (3.96%) 4 ( 0.3%) KAN R KAN R /AMK R / CAP R eis rrs C14T A1401G G1484T 4 (0.33%) 106 (94%) eis WT1: G37T, WT2: : WT3 : -2 rrs WT 1: WT (0.4%) 44 (3.63%) 9 (0.8%) 20
21 Comparison of PSQ, GenotypeMTBDR & MGIT DST Incremental increase in SNP identification RIF : 13% FQL : 8.2% Tuberculosis 2018 ;110:86-90
22 Drug Number PSQ mutations / confidence Rifampicin rpob 13 / 100 L511(1) Minimal Q513K (2) High D516Y (1) Moderate D516Y+533gag (1) Moderate H526P(1) Moderate H526C (1) High H526L (1) High S531Q (1) High L533P (4) Moderate FQL gyra 5 / 61 G88C+S95T(1) High 94gtc +S95T(1)? Phenotypic MGIT Susceptible with PSQ mutations Tuberculosis 2018 ;110:86-90
23 What do we use Pyrosequencing for? (i) Smear Positive Samples with a LPA WT band present but no corresponding mutant band or LPA indeterminate (ii) Smear negative TB : PTB & EPTB (iii) Resolving discordant Xpert & MGIT DST (iv) Confirming RIF Resistant in Xpert MTB detected very low
24 Case 1 PM 32 F Miliary TB : DOTS for 3 months A month later developed seizures Tuberculomas found Sputum Xpert MTB / RIF R Smear negative : LPA indeterminate TB MGIT culture done
25 Case 1 : Sputum Pyrosequencing Rifampicin R rpob S531L Fluoroquinolone R gyra D94G Isoniazid R katg S315T Global Consortium for Drug resistant TB Diagnostics (GCDD) funded by NIH, USA : Grant #5U01AI082229
26 Case 1. PreXDR (katg S315T,rpoB S531L & gyra D94G) Treated with KAN, CLF, LZD,PAS, ETH Follow up well at 6 months
27 What do we use Pyrosequencing for? (i) Smear Positive Samples with a LPA WT band present but no corresponding mutant band or LPA indeterminate (ii) Smear negative TB : PTB & EPTB (iii) Resolving discordant Xpert & MGIT DST (iv) Confirming RIF Resistant in Xpert MTB detected very low
28
29 Case 2 19 year male being treated elsewhere diagnosed as Pulmonary TB H 300 R 450 E 800 Z months later, developed abscess Left palm Drained pus, smear +, MGIT culture neg
30 Case Months later developed abscess in Lt ankle Amikacin & levoflox added Abscess in Rt forearm, Smear + MGIT : No growth after 6 weeks 3 months later Pus from Rt forearm, Smear + MGIT : No growth at 6 weeks
31 Pyrosequencing : No mutations detected MTB detected Isoniazid ahpc No mutations Isoniazid : katg No mutations FLQ : no mutations Isoniazid :inha No mutation SLI : rrs No mutations v RIF : no mutations RIF : no mutations
32 TB : Treatment failure not always drug resistance Compliance Dosage issues Absorption of drugs Poor quality drugs Drug Interactions Penetration at site
33 TBM
34 To date 67 TBM suspects, 46 PSQ + ve,17 MGIT culture + ve, 21 Xpert + ve
35 Dilemmas in the management of TBM / tuberculomas Drug resistance Paradoxical response Adequate drug penetration Vasculitis / infarcts Hyponatremia Brain edema Hydrocephalus Seizures Mixed infections ( HIV )
36 Penetration of TB drugs High (>90%): Intermediate (60-90%): Low (<50%): Isoniazid, Pyrazinamide, Ethionamide Levofloxacin, Moxifloxacin, Linezolid, Cycloserine Rifampicin, Streptomycin, Amikacin, Capreomycin Ethambutol
37 Case 3 AK 16 years TBM Started on HRZE & steroids partial improvement After tapering of steroids, c/o severe headache Intercisternal tuberculomas with exudates Referred to ID
38 Case 3..? DRTB or paradoxical response Xpert : Not detected PSQ: INH mono R katg 315ACC INH replaced with ETH (better CSF penetration & EBA) Re started steroids Patient improved on FU
39 What do we use Pyrosequencing for? (i) Smear Positive Samples with a LPA WT band present but no corresponding mutant band (ii) Smear negative TB : PTB & EPTB (iii) Resolving discordant Xpert & MGIT DST (iv) Confirming RIF Resistant in Xpert MTB detected very low
40 Operator related Protocol related Heteroresistance Inadequate knowledge about mutations Lung India 2018;35(2):
41 Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST Xpert MTB/ RIF : Susceptible MGIT DST RIF : Resistant Xpert MTB / RIF : Resistant MGIT DST RIF : Susceptible Repeat Xpert from original MGIT tube Repeat Xpert RIF: Resistant Repeat Xpert RIF: Resistant Repeat Xpert RIF : Resistant Repeat Xpert RIF : Resistant Check LJ for 2 types of colonies Check LJ for 2 types of colonies (Heteroresistance) Repeat Xpert RIF Repeat Xpert RIF Susceptible Perform PSQ for the Perform PSQ for the exact SNP SNP Perform RIF MGIT MICs at 0.25 /0.12 Perform RIF MIC at 0.25 / 0.12 Send isolate for WGS Send isolate for WGS Lung India 2018;35(2):
42 Mechanisms that underlie resistance Drug resistance in M. tuberculosis is a mixed bag: significant heterogeneity is present with low, moderate & high level phenotypic resistance In high incidence settings an average of 17% of new TB cases, can be multiply infected Clin Microbiol Rev 2011; 2 : doi: /CMR
43 Understanding heterogeneity Upper lobectomy specimen of a 19 year old male with MDR-TB Within the lung, each lesion is independent & engaged in various phases of immune battles at diff metabolic states of TB bacilli
44 Single infecting strain showed heteroresistance Mixed infection in presence of hetero resistance could worsen outcome.
45 Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST Xpert MTB/ RIF : Susceptible MGIT DST RIF : Resistant Repeat Xpert from original MGIT tube Repeat Xpert RIF: Resistant Repeat Xpert RIF: Resistant Check LJ for 2 types of colonies Check LJ for 2 types of colonies (Heteroresistance) Repeat Xpert RIF Susceptible Send isolate for WGS Lung India 2018;35(2):
46 Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST Xpert MTB/ RIF : Susceptible MGIT DST RIF : Resistant Repeat Xpert from original MGIT tube Repeat Xpert RIF Susceptible Repeat Xpert RIF Susceptible Send isolate for WGS Send isolate for WGS Lung India 2018;35(2):
47 Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST Xpert MTB / RIF : Resistant MGIT DST RIF : Susceptible Repeat Xpert from original MGIT tube Repeat Xpert RIF : Resistant Repeat Xpert RIF : Resistant Perform PSQ for the exact SNP Perform PSQ for the exact SNP Perform RIF MIC at 0.25 / 0.12 Lung India 2018;35(2):
48 Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST Xpert MTB / RIF : Resistant MGIT DST RIF : Susceptible Repeat Xpert from original MGIT tube Rif R maybe missed for specific rpob mutations Repeat Xpert RIF : Resistant Repeat Xpert RIF : Resistant Perform PSQ for the exact SNP Perform RIF MICs Perform RIF MIC at 0.25 / 0.12 Lung India 2018;35(2):
49 What do we use Pyrosequencing for? (i) Smear Positive Samples with a LPA WT band present but no corresponding mutant band (ii) Smear negative TB : PTB & EPTB (iii)resolving discordant Xpert & MGIT DST (iv) Confirming RIF Resistant in Xpert MTB detected very low
50 Xpert MTB Detected Caution : False Resistant in MTB Detected VERY LOW
51 Confirming in RIF R in MTB DETECTED VERY LOW in non MDR suspects In RIF DST S & Xpert R, PSQ confirmed no mutations in 10/40 Submitted
52 PSQ Outline Principle & cost Clinical applications Challenges
53 PSQ : challenges Homopolymers (more than 3-4) Homopolymer string (mainly T) regions influence synchronized extension & synthesis of DNA strand causing non uniform sequence peak heights, affecting read length & possibly cause sequence errors In Smear negative, low sensitivity of gyra & rpob Indeterminate readings (instruments issues, mixed population, new minority mutations) Technical expertise essential PSQ currently standardised for XDR defining drugs
54 Higher rates of Pre XDR TB than MDR TB (56.8% vs 29.4%) PLoS One 2015 :10(1):e
55 Genetic resistance markers Drug Mechanism of Action Genetic Marker Function Frequency (%)
56 Genetic resistance markers Drug Mechanism of Action Genetic Marker Function Frequency (%) Advantages for WGS Sequencing 1) WGS captures complete genetic mutational profile in one test. 2) New mutations identified that relate to adaptive responses (compensatory mutations).
57 WGS for DR conferring mutations XDR drugs : <10% ( LPA WT absent with no mutant) Oral FLD : Ethambutol, PZA Oral SLD : Ethionamide, PAS, cycloserine Re purposed drugs : CFZ, LZD New Drugs : BDG, DLD
58 History will judge us not by our scientific breakthroughs, but how we apply them
Optimising patient care in MDR TB with existing molecular screening tests in high burden countries
Optimising patient care in MDR TB with existing molecular screening tests in high burden countries Camilla Rodrigues MD Consultant Microbiologist Hinduja Hospital,India Outline What is the best empiric
More informationHarmonizing the Use of Molecular & Culture-based DST of Mycobacterium tuberculosis
Harmonizing the Use of Molecular & Culture-based DST of Mycobacterium tuberculosis Grace Lin, MS. Research Scientist grace.lin@cdph.ca.gov APHL 8 th TB Lab Conference San Diego 8-19-13 Harmonizing? There
More informationTB/HIV 2 sides of the same coin. Dr. Shamma Shetye, MD Microbiology Metropolis Healthcare, Mumbai
TB/HIV 2 sides of the same coin Dr. Shamma Shetye, MD Microbiology Metropolis Healthcare, Mumbai Global- Tb new cases Diagnosis-Microscopy ZN,Flourescent microscopy(fm) Rapid, inexpensive test Specificity>95%
More informationDiagnosis of drug resistant TB
Diagnosis of drug resistant TB Megan Murray, MD, ScD Harvard School of Public Health Brigham and Women s Hospital Harvard Medical School Broad Institute Global burden of TB 9 million new cases year 2 million
More informationKen Jost, BA, has the following disclosures to make:
Diagnosis of TB Disease: Laboratory Ken Jost, BA May 10, 2017 TB Intensive May 9-12, 2017 San Antonio, TX EXCELLENCE EXPERTISE INNOVATION Ken Jost, BA, has the following disclosures to make: No conflict
More informationRapid Diagnosis and Detection of Drug Resistance in Tuberculosis
Rapid Diagnosis and Detection of Drug Resistance in Tuberculosis YAM Wing-Cheong 任永昌 Department of Microbiology The University of Hong Kong Tuberculosis Re-emerging problem in industrialized countries
More informationDST for detection of DR TB - roll out of Xpert in South Africa and overview of other technologies: what are the gaps?
DST for detection of DR TB - roll out of Xpert in South Africa and overview of other technologies: what are the gaps? Mark Nicol Division of Medical Microbiology and Institute for Infectious Diseases and
More informationDrug susceptibility testing for tuberculosis KRISTEN DICKS, MD, MPH DUKE UNIVERSITY MEDICAL CENTER
Drug susceptibility testing for tuberculosis KRISTEN DICKS, MD, MPH DUKE UNIVERSITY MEDICAL CENTER Outline Drug resistant TB: definitions and epidemiology How does TB become resistant? Current drug susceptibility
More informationDiagnosis of TB: Laboratory Ken Jost Tuesday April 9, 2013
TB Nurse Case Management San Antonio, Texas April 9-11, 2013 Diagnosis of TB: Laboratory Ken Jost Tuesday April 9, 2013 Ken Jost has the following disclosures to make: No conflict of interests No relevant
More informationUpdate on Management of
Update on Management of DR TB Definitions Presumptive MDR-TB A patient suspected of drug-resistant TB, based on RNTCP criteria for submission of specimens for drug-susceptibility testing MDR-TB Case A
More informationLaboratory Diagnosis for MDR TB
Laboratory Diagnosis for MDR TB Neha Shah MD MPH Centers for Disease Control and Prevention Division of Tuberculosis Elimination California Department of Public Health Guam March 07 Objectives Describe
More informationMIC = Many Inherent Challenges Sensititre MIC for Antimicrobial Susceptibility Testing of Mycobacterium tuberculosis complex
MIC = Many Inherent Challenges Sensititre MIC for Antimicrobial Susceptibility Testing of Mycobacterium tuberculosis complex Marie Claire Rowlinson, PhD D(ABMM) Florida Bureau of Public Health Laboratories
More informationCDC s Approach to Fast Track Laboratory Diagnosis for Persons at Risk of Drug Resistant TB: Molecular Detection of Drug Resistance (MDDR) Service
CDC s Approach to Fast Track Laboratory Diagnosis for Persons at Risk of Drug Resistant TB: Molecular Detection of Drug Resistance (MDDR) Service Beverly Metchock, DrPH, D(ABMM) Team Lead, Reference Laboratory
More informationMaha R Farhat, MD MSc Massachusetts General Hospital Harvard Medical School. I have no financial or other potential conflicts of interest to disclose
Maha R Farhat, MD MSc Massachusetts General Hospital Harvard Medical School I have no financial or other potential conflicts of interest to disclose Update on the epidemiology of TB drug resistance Success
More informationEpidemiology and diagnosis of MDR-TB in children H Simon Schaaf
Epidemiology and diagnosis of MDR-TB in children H Simon Schaaf Desmond Tutu TB Centre Department of Paediatrics and Child Health, Stellenbosch University, and Tygerberg Children s Hospital (TCH) Definitions
More informationTB Intensive San Antonio, Texas November 11 14, 2014
TB Intensive San Antonio, Texas November 11 14, 2014 Diagnosis of TB: Laboratory Ken Jost, BA November 12, 2014 Ken Jost, BA has the following disclosures to make: No conflict of interests No relevant
More informationMolecular tests for rapid detection of rifampicin and isoniazid resistance in Mycobacterium tuberculosis.
Title Molecular tests for rapid detection of rifampicin and isoniazid resistance in Mycobacterium. Author(s) Ho, PL; Yam, WC; Leung, CC; Yew, WW; Mok, TYW; Chan, KS; Tam, CM Citation Hong Kong Medical
More informationRecognizing MDR-TB in Children. Ma. Cecilia G. Ama, MD 23 rd PIDSP Annual Convention February 2016
Recognizing MDR-TB in Children Ma. Cecilia G. Ama, MD 23 rd PIDSP Annual Convention 17-18 February 2016 Objectives Review the definitions and categorization of drugresistant tuberculosis Understand the
More informationElizabeth A. Talbot MD Assoc Professor, ID and Int l Health Deputy State Epidemiologist, NH GEISELMED.DARTMOUTH.EDU GEISELMED.DARTMOUTH.
The image part with relationship ID rid2 was not found in the file. MDR TB Management Review of the Evolution (or Revolution?) Elizabeth A. Talbot MD Assoc Professor, ID and Int l Health Deputy State Epidemiologist,
More informationOnline Annexes (5-8)
2016 Online Annexes (5-8) to WHO Policy guidance: The use of molecular line probe assay for the detection of resistance to second-line anti-tuberculosis drugs 1 Contents: Annex 5: GRADE summary of findings
More informationOnline Annexes (5-8)
Online Annexes (5-8) to WHO Policy guidance: The use of molecular line probe assay for the detection of resistance to second-line anti-tuberculosis drugs THE END TB STRATEGY Online Annexes (5-8) to WHO
More informationMULTIDRUG- RESISTANT TUBERCULOSIS. Dean Tsukayama Hennepin County Medical Center Hennepin County Public Health Clinic
MULTIDRUG- RESISTANT TUBERCULOSIS Dean Tsukayama Hennepin County Medical Center Hennepin County Public Health Clinic I have no relevant financial relationships. Discussion includes off label use of: amikacin
More informationAnalysis. Answers. Action. Saturday Night Fever. Shaka Brown Capital Congress
Saturday Night Fever Shaka Brown Capital Congress Shaka Zulu October 31, 2012 SICK SUCKS How my illness started October 2013 August to October 2013 Symptoms: Severe fatigue Night sweats Low grade fever
More informationDiagnosis of TB: Laboratory Ken Jost Tuesday April 1, 2014
TB Nurse Case Management San Antonio, Texas April 1 3, 2014 Diagnosis of TB: Laboratory Ken Jost Tuesday April 1, 2014 Ken Jost, BA has the following disclosures to make: No conflict of interests No relevant
More informationTB Nurse Case Management. March 7-9, Diagnosis of TB: Ken Jost Wednesday March 7, 2012
TB Nurse Case Management San Antonio, Texas March 7-9, 2012 Diagnosis of TB: Laboratory Ken Jost Wednesday March 7, 2012 Ken Jost has the following disclosures to make: No conflict of interests No relevant
More informationCPTR title slide. A Standardized System for Grading Mutations in Mycobacterium tuberculosis for Association with Drug Resistance
CPTR title slide A Standardized System for Grading Mutations in Mycobacterium tuberculosis for Association with Drug Resistance PAOLO MIOTTO CPTR 2017 Workshop, March 20 23 The Need A lack of user-friendly
More informationStacy White, PhD May 12, TB for Community Providers. Phoenix, Arizona
Role of the Laboratory in TB Diagnosis Stacy White, PhD May 12, 2015 TB for Community Providers May 12, 2015 Phoenix, Arizona EXCELLENCE EXPERTISE INNOVATION Stacy White, PhD has the following disclosures
More informationResearch Article Use of Genotype MTBDRplus Assay for Diagnosis of Multidrug-Resistant Tuberculosis in Nepal
Hindawi International Scholarly Research Notices Volume 2017, Article ID 1635780, 5 pages https://doi.org/10.1155/2017/1635780 Research Article Use of Genotype MTBDRplus Assay for Diagnosis of Multidrug-Resistant
More informationDRUG RESISTANCE IN TUBERCULOSIS
DRUG RESISTANCE IN TUBERCULOSIS INTRODUCTION Up to 50 million people may be infected with drug-resistant resistant TB.* Hot zones of MDR-TB such as Russia, Latvia, Estonia, Argentina and the Dominican
More informationHA Convention 2016 : Special Topic Session 3 May 2016
HA Convention 2016 : Special Topic Session 3 May 2016 Diagnosis and Management of TB in Adults Dr. Thomas Mok COS(RMD), KH Tuberculosis An airborne infectious disease caused by Mycobacterium tuberculosis
More informationManaging Complex TB Cases Diana M. Nilsen, MD, RN
Managing Complex TB Cases Diana M. Nilsen, MD, RN Director of Medical Affairs NYC Department of Health & Mental Hygiene Bureau of TB Control Case #1 You are managing a patient who was seen at a private
More informationBedaquiline and delamanid combination as part of a MDR-TB treatment regimen: Current evidence and practices
Bedaquiline and delamanid combination as part of a MDR-TB treatment regimen: Current evidence and practices Cathy Hewison, Médecins Sans Frontières RESIST-TB 5 th April 2018 Outline Current recommendations
More informationDetection of Multidrug Resistance and Characterization of Mutations in Mycobacterium tuberculosis Isolates in Raichur District, India
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 10 (2017) pp. 1543-1549 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.610.185
More informationMolecular assays in Tuberculosis. Jatin Yegurla Junior resident
Molecular assays in Tuberculosis Jatin Yegurla Junior resident 17-3-2018 Contents Introduction TB-PCR Line Probe assay (LPA) GenoType MTBDRsl test (Second line LPA) Xpert MTB/RIF (GeneXpert) (CB-NAAT)
More informationManagement of MDR TB. Dr Priscilla Rupali MD; DTM&H Professor and Head Department of Infectious Diseases Christian Medical College Vellore
Management of MDR TB Dr Priscilla Rupali MD; DTM&H Professor and Head Department of Infectious Diseases Christian Medical College Vellore Outline Global epidemiology of Tuberculosis Epidemiology of Tuberculosis
More informationWhite Paper Application
White Paper Application Project Title: Whole genome sequencing of clinical strains of Mycobacterium tuberculosis Authors: David Alland, Jerrold Ellner, Susan Dorman, Moses Joloba, Clifton Barry Primary
More informationRevised National Tuberculosis Control Programme (RNTCP) Dr.Kishore Yadav J Assistant Professor
Revised National Tuberculosis Control Programme (RNTCP) Dr.Kishore Yadav J Assistant Professor Global scenario*: Burden of TB Incidence : 9.6 million (58% SEAR and Western Pacific) Deaths : 1.5 million
More informationMycobacteria Diagnostic Testing in Manitoba. Dr. Michelle Alfa Medical Director, DSM Clin Micro Discipline
Mycobacteria Diagnostic Testing in Manitoba Dr. Michelle Alfa Medical Director, DSM Clin Micro Discipline Acknowlegements: Assunta Rendina: Charge Tech HSC Lab Joyce Wolf & Dr. Meenu Sharma: NML Dr. Kanchana
More informationWhen good genes go bad
When good genes go bad Dr Kessendri Reddy NHLS Tygerberg Hospital Division of Clinical Microbiology Fakulteit Geneeskunde en Gesondheidswetenskappe Faculty of Medicine and Health Sciences Overview Cases
More informationMulti-country surveillance project on fluoroquinolones and PZA resistance
Multi-country surveillance project on fluoroquinolones and PZA resistance Matteo Zignol CPTR Rapid DST 2014 Workshop September 22-23, 2014 Washington DC, US Objectives of the FQLs and PZA surveillance
More informationRapid Diagnostic Techniques for Identifying Tuberculosis Ken Jost November 13, 2008
Tuberculosis Updates for Clinicians San Antonio, Texas November 13, 2008 Rapid Diagnostic Techniques for Identifying Tuberculosis Ken Jost November 13, 2008 Rapid Diagnostic Techniques for Identifying
More informationHow best to structure a laboratory network with new technologies
How best to structure a laboratory network with new technologies Cristina Gutierrez, MD, PhD Uniting to scale up TB care in Central Asia 14 and 15 April 2011 Tashkent, Uzbekistan New laboratory diagnostics
More informationManagement of Multidrug- Resistant TB in Children. Jennifer Furin, MD., PhD. Sentinel Project, Director of Capacity Building
Management of Multidrug- Resistant TB in Children Jennifer Furin, MD., PhD. Sentinel Project, Director of Capacity Building Objectives To review data on best practices for diagnosis, treatment and prevention
More informationLaboratory Diagnosis and Antimicrobial Susceptibility Testing of Mycobacterium tuberculosis Complex. Objectives
Laboratory Diagnosis and Antimicrobial Susceptibility Testing of Mycobacterium tuberculosis Complex Marie-Claire Rowlinson, PhD D(ABMM) Calin Chiribau, PhD, MT(ASCP) Florida Bureau of Public Health Laboratories
More informationWSLH Testing and Surveillance Updates
WSLH Testing and Surveillance Updates Wisconsin Mycobacteriology Laboratory Network annual conference November 4, 2015, Madison, WI Updates Outline Collection and Transport Smear and Culture Nucleic Acid
More informationHHS Public Access Author manuscript Int J Tuberc Lung Dis. Author manuscript; available in PMC 2016 April 01.
Determination of MICs of Levofloxacin for Mycobacterium tuberculosis with gyra Mutations Priti Kambli a, Kanchan Ajbani a, Chaitali Nikam a, Archana Khillari a, Anjali Shetty a, Zarir Udwadia b, Sophia
More informationTB 101 Disease, Clinical Assessment and Lab Testing
TB 101 Disease, Clinical Assessment and Lab Testing Pacific Islands Tuberculosis Controllers Association Conference (PITCA) Clinical Laboratory Breakout None Disclosure Objectives Be able to list and explain
More informationMolecular Methods in the Diagnosis of Drug Resistant Tuberculosis. Dr Sahajal Dhooria
Molecular Methods in the Diagnosis of Drug Resistant Tuberculosis Dr Sahajal Dhooria What is drug resistant TB? Definitions MDR TB defined as resistance to isoniazid and rifampicin, with or without resistance
More informationShah: Discordant Growth- Molecular Rifampin Resistance 2/27/16 RELAPSED FAILED
/7/6 Discordant Growth- Molecular Diagnos7c Challenges and Treatment Outcomes Neha Shah, MD MPH Centers for Disease Control and Preven7on California Department of Health Tuberculosis Control NAR February
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Mitnick CD, Shin SS, Seung KJ, et al. Comprehensive treatment
More informationPharmacokinetics and doses of antituberculosis drugs in children
Pharmacokinetics and doses of antituberculosis drugs in children HS Schaaf Desmond Tutu TB Centre Department of Paediatrics and Child Health Stellenbosch University Declarations I have no conflict of interest
More informationTOG The Way Forward
TOG 2016- The Way Forward Main Changes in Diagnostic algorithm Definition (Type, Classification, Outcome) Registration at the time of Diagnosis (PHI level Notification Register) Long term follow up (till
More informationGlobal epidemiology of drug-resistant tuberculosis. Factors contributing to the epidemic of MDR/XDR-TB. CHIANG Chen-Yuan MD, MPH, DrPhilos
Global epidemiology of drug-resistant tuberculosis Factors contributing to the epidemic of MDR/XDR-TB CHIANG Chen-Yuan MD, MPH, DrPhilos By the end of this presentation, participants would be able to describe
More informationLaboratory s Role in the Battle Against Drug Resistant Tuberculosis
Laboratory s Role in the Battle Against Drug Resistant Tuberculosis Angela M. Starks, Ph.D. Chief, Laboratory Branch Division of Tuberculosis Elimination June 6, 2016 National Center for HIV/AIDS, Viral
More informationThe current state of knowledge: genotypic vs phenotypic drug-susceptibility testing (DST)
The current state of knowledge: genotypic vs phenotypic drug-susceptibility testing (DST) Daniela M Cirillo Emerging Bacterial Pathogens Unit, San Raffaele Scientific Institute Milan Outline Concordance
More informationReceived 4 June 2013; Final revision 1 August 2013; Accepted 30 August 2013; first published online 27 September 2013
Epidemiol. Infect. (2014), 142, 1328 1333. Cambridge University Press 2013 doi:10.1017/s0950268813002409 SHORT REPORT Characterization of multi-drug resistant Mycobacterium tuberculosis from immigrants
More informationTreatment of Active Tuberculosis
Treatment of Active Tuberculosis Jeremy Clain, MD Pulmonary & Critical Care Medicine Mayo Clinic October 16, 2017 2014 MFMER slide-1 Disclosures No relevant financial relationships No conflicts of interest
More informationMDR, XDR and Untreatable Tuberculosis and Laboratory Perspectives. Martie van der Walt TUBERCULOSIS EPIDEMIOLOGY & INTERVENTION RESEARCH UNIT
TUBERCULOSIS EPIDEMIOLOGY & INTERVENTION RESEARCH UNIT MDR, XDR and Untreatable Tuberculosis and Laboratory Perspectives Martie van der Walt IOM Meeting 15-17 January 2013 introduction 1 min 150 words
More informationMSF Field Research. Diagnosis and management of drug-resistant tuberculosis. South African adults. Hughes, J; Osman, M
MSF Field Research Diagnosis and management of drug-resistant tuberculosis in South African adults Authors Citation DOI Publisher Journal Rights Hughes, J; Osman, M Diagnosis and management of drug-resistant
More informationDefinitions and reporting framework for tuberculosis 2013 revision. Dennis Falzon Global Forum of Xpert MTB/RIF Implementers Annecy 17 April 2013
Definitions and reporting framework for tuberculosis 2013 revision Dennis Falzon Global Forum of Xpert MTB/RIF Implementers Annecy 17 April 2013 2-year revision process WHO/HTM/TB/2013.2 2 www.who.int/iris/bitstream/10665/79199/1/9789241505345_eng.pdf
More informationThe Molecular MDR Screen is an Important Tool in the Diagnosis and Initiation of Appropriate Therapy in TB Patients in the State of Florida
The Molecular MDR Screen is an Important Tool in the Diagnosis and Initiation of Appropriate Therapy in TB Patients in the State of Florida Calin B. Chiribau, 1 M-C. Rowlinson, 1 S.Crowe, 1 B. Jones, 1
More informationThe shorter regimen for MDR-TB: evidence and pitfalls
The shorter regimen for MDR-TB: evidence and pitfalls Helen Cox 10 November 2017 What is the shortened regimen? Current conventional regimen (SA): Intensive Phase (at least 6 months): PZA / (EMB) / Kana
More informationManagement of Drug-resistant Tuberculosis (DR-TB)
Management of Drug-resistant Tuberculosis (DR-TB) Nitipatana Chierakul Division of Respiratory Disease & Tuberculosis Department of Medicine Faculty of Medicine Siriraj Hospital October 14 th, 2008 Tropical
More informationDiagnosis and Treatment of Tuberculosis, 2011
Diagnosis of TB Diagnosis and Treatment of Tuberculosis, 2011 Alfred Lardizabal, MD NJMS Global Tuberculosis Institute Diagnosis of TB, 2011 Diagnosis follows Suspicion When should we Think TB? Who is
More informationWhole Genome Next Genera/on Sequencing of TB in a Public Health Laboratory: A New Diagnos/c Era
Whole Genome Next Genera/on Sequencing of TB in a Public Health Laboratory: A New Diagnos/c Era March 31, 2016 Kimberlee Musser, PhD Chief, Bacterial Diseases Wadsworth Center 900,000 sq. O. state- of-
More informationDNA sequencing for the confirmation of rifampin resistance detected by Cepheid Xpert
JCM Accepted Manuscript Posted Online 4 March 2015 J. Clin. Microbiol. doi:10.1128/jcm.03433-14 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 DNA sequencing for the confirmation
More informationTuberculosis. New TB diagnostics. New drugs.new vaccines. Dr: Hussein M. Jumaah CABM Mosul College of Medicine 23/12/2012
Tuberculosis New TB diagnostics. New drugs.new vaccines Dr: Hussein M. Jumaah CABM Mosul College of Medicine 23/12/2012 Tuberculosis (TB )is a bacterial disease caused by Mycobacterium tuberculosis (occasionally
More informationRapid Diagnosis of Extensively Drug-Resistant Tuberculosis by Use of a Reverse Line Blot Hybridization Assay
JOURNAL OF CLINICAL MICROBIOLOGY, July 2011, p. 2546 2551 Vol. 49, No. 7 0095-1137/11/$12.00 doi:10.1128/jcm.02511-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Rapid Diagnosis
More informationCompassionate use of bedaquiline in highly drug-resistant tuberculosis patients in Mumbai, India
AGORA RESEARCH LETTER Compassionate use of bedaquiline in highly drug-resistant tuberculosis patients in Mumbai, India To the Editor: Bedaquiline, a mycobacterial ATP synthase inhibitor [1], is the first
More informationAssessing the programmatic management of drug-resistant TB
Assessing the programmatic management of drug-resistant TB a. Review the programmatic management of drug-resistant TB patients with the TB manager. i. What is the size of MDR-TB problem locally? How many
More informationOnline Annexes (2-4)
Online Annexes (2-4) to WHO Policy update: The use of molecular line probe assays for the detection of resistance to isoniazid and rifampicin THE END TB STRATEGY Online Annexes (2-4) to WHO Policy update:
More informationCommunication between clinician and laboratory Molecular detection of M. tuberculosis complex
3 Laboratory 3rd edition contributors: PENNAN M. BARRY, MD, MPH & SHOU-YEAN GRACE LIN, MS General information on TB laboratory work..................... 32 Molecular methods for detection of M. tuberculosis
More informationGLI model TB diagnostic algorithms
GLI model TB diagnostic algorithms GLI model TB diagnostic algorithms Revised June 2018 Contents Acknowledgements Abbreviations v vi Background 1 Algorithm 1: Preferred algorithm for universal patient
More informationOverview of Mycobacterial Culture, Identification, and Drug Susceptibility Testing
Overview of Mycobacterial Culture, Identification, and Drug Susceptibility Testing 1. Essentials for the Mycobacteriology Laboratory: Promoting Quality Practices 1.1 Overview: Mycobacterial Culture, Identification,
More informationLet s Talk TB. A Series on Tuberculosis, A Disease That Affects Over 2 Million Indians Every Year
A Series on Tuberculosis, A Disease That Affects Over 2 Million Indians Every Year Lancelot M. Pinto, MD, MSc Author Madhukar Pai, MD, PhD co-author and Series Editor Abstract Nearly 50% of patients with
More informationSupplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Dorman S E, Schumacher S G, Alland D, et al.
More informationThe ABC s of AFB s Laboratory Testing for Tuberculosis. Gary Budnick Connecticut Department of Public Health Mycobacteriology Laboratory
The ABC s of AFB s Laboratory Testing for Tuberculosis Gary Budnick Connecticut Department of Public Health Mycobacteriology Laboratory Laboratory TAT Goals Case Study Specimen Collection Testing Contact
More informationXpert MTB/RIF Ultra: Understanding this new diagnostic and who will have access to it
Xpert MTB/RIF Ultra: Understanding this new diagnostic and who will have access to it Angela Starks, PhD Chief, Laboratory Branch Division of TB Elimination Matt Bankowski, PhD, MS, D(ABMM), HCLD/CC(ABB)
More informationDiagnosis of tuberculosis in children
Diagnosis of tuberculosis in children H Simon Schaaf Desmond Tutu TB Centre Department of Paediatrics and Child Health, Stellenbosch University, and Tygerberg Children s Hospital (TCH) Estimated TB incidence
More informationTransmission of MDR/XDR Tuberculosis in Shanghai. Qian Gao Shanghai Medical College Fudan University
Transmission of MDR/XDR Tuberculosis in Shanghai Qian Gao Shanghai Medical College Fudan University Drug Resistant TB in China The Highest DR-TB Burden Country New TB cases/year Cases with any DR MDR XDR
More informationChallenges in Capacity in SA for diagnosing DR-TB
National Tuberculosis Reference Laboratory Challenges in Capacity in SA for diagnosing DR-TB March 2010 Gerrit Coetzee Rapid response to XDR-TB WHO Global Task Force on XDR-TB, October 2006 Accelerate
More informationA Rapid and Sensitive Chip-based Assay for Detection of rpob Gene Mutations Conferring Rifampicin Resistance in Mycobacterium tuberculosis (TB).
A Rapid and Sensitive Chip-based Assay for Detection of rpob Gene Mutations Conferring Rifampicin Resistance in Mycobacterium tuberculosis (TB). Wanyuan Ao, Steve Aldous, Evelyn Woodruff, Brian Hicke,
More informationAuthor s response to reviews Title: Bacterial risk factors for treatment failure and relapse among patients with isoniazid resistant tuberculosis
Author s response to reviews Title: Bacterial risk factors for treatment failure and relapse among patients with isoniazid resistant tuberculosis Authors: Phan Thai (phanvuongkhacthai@yahoo.com) Dang Ha
More informationPrinciples of laboratory diagnosis of M. tuberculosis. Anne-Marie Demers, MD, FRCPC 11 September 2017
Principles of laboratory diagnosis of M. tuberculosis Anne-Marie Demers, MD, FRCPC 11 September 2017 QUESTION Which statement is false? 1) A smear can only be on a concentrated specimen 2) It is normal
More informationDrug resistance surveillance: progress to date and emerging innovations
Drug resistance surveillance: progress to date and emerging innovations Anna Dean Matteo Zignol WHO Global Task Force on TB Impact Measurement Glion-sur-Montreux 19 21 April 2016 1. Global project on anti-tb
More informationUniversity of Groningen
University of Groningen Current status and opportunities for therapeutic drug monitoring in the treatment of tuberculosis Zuur, Marlanka A.; Bolhuis, Mathieu; Anthony, Richard; den Hertog, Alice; van der
More informationBiomolecular diagnostics, gene sequencing and whole genome sequencing. Rob Warren
Biomolecular diagnostics, gene sequencing and whole genome sequencing Rob Warren Classic molecular epidemiology IS6110 DNA fingerprinting (between 0 and 26 loci) Spoligotyping (1 locus) MIRU-VNTR (24 loci)
More informationGLI model TB diagnostic algorithms
GLI model TB diagnostic algorithms GLI model TB diagnostic algorithms March 2017 Contents Acknowledgements Abbreviations v vi Background 1 Algorithm 1: Preferred algorithm for universal patient access
More informationMarcos Burgos, MD has the following disclosures to make:
Guidelines for the Treatment of Tuberculosis Marcos Burgos, MD May 13, 2015 TB for Pulmonologist March 13, 2015 Phoenix, AZ EXCELLENCE EXPERTISE INNOVATION Marcos Burgos, MD has the following disclosures
More informationTreatment of Tuberculosis Therapeutic Drug Monitoring
Treatment of Tuberculosis Therapeutic Drug Monitoring 2nd European Advanced Course in Clinical Tuberculosis Dr. JWC Alffenaar, clinical pharmacologist Dept Clinical Pharmacy & Pharmacology University Medical
More informationTB Laboratory for Nurses
TB Laboratory for Nurses Shea Rabley, RN, MN Consultant Mayo Clinic Center for Tuberculosis 2014 MFMER slide-1 Disclosures None 2014 MFMER slide-2 Objectives Participants will be able to: 1. Name 2 safety
More informationTB Updates for the Physician Rochester, Minnesota June 19, 2009
TB Updates for the Physician Rochester, Minnesota June 19, 2009 Mycobacterial Laboratory Science Update Nancy L. Wengenack, Ph.D. Associate Professor of Laboratory Medicine and Pathology Division of Clinical
More informationPrinciples and practice of treating drug-sensitive TB
Principles and practice of treating drug-sensitive TB Brian Eley Paediatric Infectious Diseases Unit Red Cross War Memorial Children s Hospital Department of Paediatrics and Child Health University of
More informationPREPARATION OF DRUGS FOR DST TESTING
PREPARATION OF DRUGS FOR DST TESTING Rev 1 Pag. 1 di 7 Destinatari: Coordinatore, Tecnici del Settore Micobatteri - EBP CONTENT 1. SCOPE 2. APPLICATION 3. DEFINITIONS AND ABBREVIATIONS 4. RESPONSIBILITIES
More informationRole of RNTCP in the management MDR-TB
Kamdar DJ, Shah NA, Patel DJ, Parmarr H. Role of RNTCP in the management of MDR-TB. IAIM, 2015; 2(7): 1-5. Original Research Article Role of RNTCP in the management of MDR-TB Deepali J Kamdar 1, Neha A
More informationDr Francis Ogaro MTRH ELDORET
Dr Francis Ogaro MTRH ELDORET TB in children often severe, disseminated and can progress rapidly and with poor outcome TB diagnosis in children has relied on clinical, imaging, microscopy and TST findings.
More informationTreatment of Tuberculosis
TB Clinical i l Intensive Seattle Treatment of Tuberculosis June 16, 2016 Masa Narita, MD Public Health Seattle & King County; Firland Northwest TB Center, University of Washington Outline Unique features
More informationCHAPTER:1 TUBERCULOSIS. BY Mrs. K.SHAILAJA., M. PHARM., LECTURER DEPT OF PHARMACY PRACTICE, SRM COLLEGE OF PHARMACY
CHAPTER:1 TUBERCULOSIS BY Mrs. K.SHAILAJA., M. PHARM., LECTURER DEPT OF PHARMACY PRACTICE, SRM COLLEGE OF PHARMACY GLOBAL EMERGENCY: * Tuberculosis kills 5,000 people a day! * 2.3 million die each year!
More informationTreating Patients, Not Disease: People-Centered Approach
Treating Patients, Not Disease: People-Centered Approach 7th Annual TB Symposium Ministry of Health of the Kyrgyz Republic and Médecins Sans Frontières 1-2 March, 2018, BISHKEK, KYRGYZSTAN TB Diagnostics
More informationLet s Talk TB A Series on Tuberculosis, A Disease That Affects Over 2 Million Indians Every Year
Let s Talk TB A Series on Tuberculosis, A Disease That Affects Over 2 Million Indians Every Year Lancelot M. Pinto, MD, MSc Author Madhukar Pai, MD, PhD co-author and Series Editor Lancelot Pinto is a
More information