apl. Prof. Dr. Dr. rer. nat. Dieter Lütjohann

Size: px
Start display at page:

Download "apl. Prof. Dr. Dr. rer. nat. Dieter Lütjohann"

Transcription

1 apl. Prof. Dr. Dr. rer. nat. Dieter Lütjohann Curriculum Vitae A.) Name: General information apl. Prof. Dr. Dr. rer. nat. Dieter Lütjohann Address: Institute of Clinical Chemistry and Pharmacology Laboratory for Special Lipid Analysis/ Center Internal Medicine/UG 68 University Hospital, University of Bonn Sigmund- Freud- Strasse Bonn Phone: +49 (0) Fax: +49 (0) E- mail: bonn.de Date of birth: Nationality: German B.) Scientific career Education/Degrees: 1986 Diploma in Chemistry, University of Bonn 1990 PhD in Chemistry, University of Bonn 2000 PhD in Medical Biochemistry, Karolinska Institute, Stockholm 2002 Assistant Professor in Clinical Biochemistry (Habilitation, Venia legendi) 2003 Degree: Humanpharmakologe (DGPT) 2008 Associate Professor at the Institute of Clinical Chemistry and Clinical Pharmacology, University Clinics Bonn, University of Bonn, Germany Research Experience: Scientific fellow at the Department of Clinical Pharmacology, University of Bonn 1991 Postdoctoral research fellow at the Department of Clinical Chemistry, Karolinska Institute, Huddinge Hospital, Sweden, Paul- Martini- Stiftung scholarship Senior chemist at the Department of Clinical Pharmacology, University of Bonn

2 Postdoctoral research fellow at the Department of Medical Laboratory Sciences and Technology, Division of Clinical Chemistry, Karolinska Institute, Huddinge University Hospital, Huddinge, Sweden, Swedish Medical Research Council scholarship Senior chemist at the Department of Clinical Pharmacology, University of Bonn 2000 Head of the Laboratory of the Department of Clinical Pharmacology, University of Bonn 2008 Head of the Laboratory of Special Lipid Analysis Central Laboratory, Institute of Clinical Chemistry and Pharmacology, University of Bonn Sholarship and Awards: 1989 Young Investigator Poster Award. 44. Tagung der Deutschen Gesellschaft für Verdauungs- und Stoffwechselerkrankungen. Mainz, Germany Paul- Martini- Stiftung scholarship Swedish Medical Research Council scholarship 1996 Poul Astrup Prize 1996 (2 nd price) Nordic Society of Clinical Chemistry together with U. Diczfalusy, E. Lund und I. Björkhem, Torshavn, Faroe Islands, Denmark Investigator Poster Award. Kern Aspen Lipid Conference. Aspen, Co, USA Investigator Poster Award. Kern Aspen Lipid Conference. Aspen, Co, USA. Member of editorial boards: International Journal of Clinical Pharmacology and Therapeutics Biochimica et Biophysica Acta (BBA) Lipid and Lipid Metabolism Referee for scientific journals: Pharmacology, Lipids, Pediatric Research, Journal of Lipid Research, Clinica Chimica Acta, Arteriosclerosis, Thrombosis, and Vascular Biology, Febbs Letters, Clinical Chemistry and Laboratory Medicine, Nature Medicine, Arteriosclerosis, Thrombosis, and Vascular Biology, Lancet Neurology, Public Health and Nutrition, Britisch Journal of Nutrition, Clinical Endocrinology, European Journal of Clinical Pharmacology, International Journal of Neuropsychiatry, Neuroscience Lett, European Journal of Neuroscience, Nutrition and Food Research, Clinical Chemistry and Laboratory Medicine, Future Lipidology, International Journal of Clinical Pharmacology and Therapeutics, Nutrition, Experimental Neurology, Journal of Mass Spectrometry, American Journal of Physiology, Journal of Cellular Biochemistry, Annals of Nutrition and Metabolism, European Heart Journal, Journal of Mass Spectrometry, Pharmacogenetics and Genomics, Biological Chemistry,

3 Memberships: Deutsche Gesellschaft für Atheroskleroseforschung (DGAF) Deutsche Gesellschaft für Experimentelle und Klinische Pharmakologie und Toxikologie e.v. (DGPT) Arbeitsgemeinschaft für Angewandte Humanpharmakologie (AGAH) Austrian Atherosclerosis Society Fundings: EU- Projects : FP6 FP6 FP7 Marie Curie Early Stage Training Programme (MC- EST) - European Graduate School of Neuroscience (EURON) LIPIDIET LIPIDIDIET Industry C.) 30 most important scientific publications 1. Weingärtner, O., Björkhem, I., and Lütjohann, D. (2014) Intestinal Cholesterol Absorption and Cardiovascular Risk, J Am Coll Cardiol, De Nardo, D., Labzin, L. I., Kono, H., Seki, R., Schmidt, S. V., Beyer, M., Xu, D., Zimmer, S., Lahrmann, C., Schildberg, F. A., Vogelhuber, J., Kraut, M., Ulas, T., Kerksiek, A., Krebs, W., Bode, N., Grebe, A., Fitzgerald, M. L., Hernandez, N. J., Williams, B. R., Knolle, P., Kneilling, M., Rocken, M., Lütjohann, D., Wright, S. D., Schultze, J. L., and Latz, E. (2014) High- density lipoprotein mediates anti- inflammatory reprogramming of macrophages via the transcriptional regulator ATF3, Nat Immunol 15, Popp, J., Meichsner, S., Kölsch, H., Lewczuk, P., Maier, W., Kornhuber, J., Jessen, F., and Lütjohann, D. (2013) Cerebral and extracerebral cholesterol metabolism and CSF markers of Alzheimer's disease, Biochem Pharmacol 86, Horenstein, R. B., Mitchell, B. D., Post, W. S., Lütjohann, D., von Bergmann, K., Ryan, K. A., Terrin, M., Shuldiner, A. R., and Steinle, N. I. (2013) The ABCG8 G574R variant, serum plant sterol levels, and cardiovascular disease risk in the Old Order Amish, Arterioscler Thromb Vasc Biol 33, Burg, V. K., Grimm, H. S., Rothhaar, T. L., Grosgen, S., Hundsdorfer, B., Haupenthal, V. J., Zimmer, V. C., Mett, J., Weingärtner, O., Laufs, U., Broersen, L. M., Tanila, H., Vanmierlo, T., Lütjohann, D., Hartmann, T., and Grimm, M. O. (2013) Plant sterols the better cholesterol in Alzheimer's disease? A mechanistical study, J Neurosci 33,

4 6. Bieghs, V., Hendrikx, T., van Gorp, P. J., Verheyen, F., Guichot, Y. D., Walenbergh, S. M., Jeurissen, M. L., Gijbels, M., Rensen, S. S., Bast, A., Plat, J., Kalhan, S. C., Koek, G. H., Leitersdorf, E., Hofker, M. H., Lütjohann, D., and Shiri- Sverdlov, R. (2013) The cholesterol derivative 27- hydroxycholesterol reduces steatohepatitis in mice, Gastroenterology 144, Vanmierlo, T., Weingärtner, O., van der Pol, S., Husche, C., Kerksiek, A., Friedrichs, S., Sijbrands, E., Steinbusch, H., Grimm, M., Hartmann, T., Laufs, U., Bohm, M., de Vries, H. E., Mulder, M., and Lütjohann, D. (2012) Dietary intake of plant sterols stably increases plant sterol levels in the murine brain, J Lipid Res 53, Popp, J., Lewczuk, P., Kölsch, H., Meichsner, S., Maier, W., Kornhuber, J., Jessen, F., and Lütjohann, D. (2012) Cholesterol metabolism is associated with soluble amyloid precursor protein production in Alzheimer's disease, J Neurochem 123, Krawczyk, M., Lütjohann, D., Schirin- Sokhan, R., Villarroel, L., Nervi, F., Pimentel, F., Lammert, F., and Miquel, J. F. (2012) Phytosterol and cholesterol precursor levels indicate increased cholesterol excretion and biosynthesis in gallstone disease, Hepatology 55, Bieghs, V., Wouters, K., van Gorp, P. J., Gijbels, M. J., de Winther, M. P., Binder, C. J., Lütjohann, D., Febbraio, M., Moore, K. J., van Bilsen, M., Hofker, M. H., and Shiri- Sverdlov, R. (2010) Role of scavenger receptor A and CD36 in diet- induced nonalcoholic steatohepatitis in hyperlipidemic mice, Gastroenterology 138, , 2486 e Kenny, E. E., Gusev, A., Riegel, K., Lütjohann, D., Lowe, J. K., Salit, J., Maller, J. B., Stoffel, M., Daly, M. J., Altshuler, D. M., Friedman, J. M., Breslow, J. L., Pe'er, I., and Sehayek, E. (2009) Systematic haplotype analysis resolves a complex plasma plant sterol locus on the Micronesian Island of Kosrae, Proc Natl Acad Sci U S A 106, Wouters, K., van Gorp, P. J., Bieghs, V., Gijbels, M. J., Duimel, H., Lütjohann, D., Kerksiek, A., van Kruchten, R., Maeda, N., Staels, B., van Bilsen, M., Shiri- Sverdlov, R., and Hofker, M. H. (2008) Dietary cholesterol, rather than liver steatosis, leads to hepatic inflammation in hyperlipidemic mouse models of nonalcoholic steatohepatitis, Hepatology 48, Weingärtner, O., Lütjohann, D., Ji, S., Weisshoff, N., List, F., Sudhop, T., von Bergmann, K., Gertz, K., Konig, J., Schafers, H. J., Endres, M., Bohm, M., and Laufs, U. (2008) Vascular effects of diet supplementation with plant sterols, J Am Coll Cardiol 51, Tamboli, I. Y., Prager, K., Thal, D. R., Thelen, K. M., Dewachter, I., Pietrzik, C. U., St George- Hyslop, P., Sisodia, S. S., De Strooper, B., Heneka, M. T., Filippov, M. A., Muller, U., van Leuven, F., Lütjohann, D., and Walter, J. (2008) Loss of gamma- secretase function impairs endocytosis of lipoprotein particles and membrane cholesterol homeostasis, J Neurosci 28, Teunissen, C. E., Floris, S., Sonke, M., Dijkstra, C. D., De Vries, H. E., and Lütjohann, D. (2007) 24S- hydroxycholesterol in relation to disease manifestations of acute experimental autoimmune encephalomyelitis, J Neurosci Res 85,

5 16. Crameri, A., Biondi, E., Kuehnle, K., Lütjohann, D., Thelen, K. M., Perga, S., Dotti, C. G., Nitsch, R. M., Ledesma, M. D., and Mohajeri, M. H. (2006) The role of seladin- 1/DHCR24 in cholesterol biosynthesis, APP processing and Abeta generation in vivo, EMBO J 25, Salen, G., von Bergmann, K., Lütjohann, D., Kwiterovich, P., Kane, J., Patel, S. B., Musliner, T., Stein, P., and Musser, B. (2004) Ezetimibe effectively reduces plasma plant sterols in patients with sitosterolemia, Circulation 109, Wollmer, M. A., Streffer, J. R., Tsolaki, M., Grimaldi, L. M., Lütjohann, D., Thal, D., von Bergmann, K., Nitsch, R. M., Hock, C., and Papassotiropoulos, A. (2003) Genetic association of acyl- coenzyme A: cholesterol acyltransferase with cerebrospinal fluid cholesterol levels, brain amyloid load, and risk for Alzheimer's disease, Mol Psychiatry 8, Vega, G. L., Weiner, M. F., Lipton, A. M., Von Bergmann, K., Lütjohann, D., Moore, C., and Svetlik, D. (2003) Reduction in levels of 24S- hydroxycholesterol by statin treatment in patients with Alzheimer disease, Arch Neurol 60, Papassotiropoulos, A., Streffer, J. R., Tsolaki, M., Schmid, S., Thal, D., Nicosia, F., Iakovidou, V., Maddalena, A., Lütjohann, D., Ghebremedhin, E., Hegi, T., Pasch, T., Traxler, M., Bruhl, A., Benussi, L., Binetti, G., Braak, H., Nitsch, R. M., and Hock, C. (2003) Increased brain beta- amyloid load, phosphorylated tau, and risk of Alzheimer disease associated with an intronic CYP46 polymorphism, Arch Neurol 60, Yu, L., Hammer, R. E., Li- Hawkins, J., Von Bergmann, K., Lütjohann, D., Cohen, J. C., and Hobbs, H. H. (2002) Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion, Proc Natl Acad Sci U S A 99, Sudhop, T.*, Lütjohann, D.*, Kodal, A., Igel, M., Tribble, D. L., Shah, S., Perevozskaya, I., and von Bergmann, K. (2002) Inhibition of intestinal cholesterol absorption by ezetimibe in humans, Circulation 106, Simons, M., Schwarzler, F., Lütjohann, D., von Bergmann, K., Beyreuther, K., Dichgans, J., Wormstall, H., Hartmann, T., and Schulz, J. B. (2002) Treatment with simvastatin in normocholesterolemic patients with Alzheimer's disease: A 26- week randomized, placebo- controlled, double- blind trial, Ann Neurol 52, Sehayek, E., Duncan, E. M., Lütjohann, D., Von Bergmann, K., Ono, J. G., Batta, A. K., Salen, G., and Breslow, J. L. (2002) Loci on chromosomes 14 and 2, distinct from ABCG5/ABCG8, regulate plasma plant sterol levels in a C57BL/6J x CASA/Rk intercross, Proc Natl Acad Sci U S A 99, Locatelli, S., Lütjohann, D.*, Schmidt, H. H., Otto, C., Beisiegel, U., and von Bergmann, K. (2002) Reduction of plasma 24S- hydroxycholesterol (cerebrosterol) levels using high- dosage simvastatin in patients with hypercholesterolemia: evidence that simvastatin affects cholesterol metabolism in the human brain, Arch Neurol 59, Kölsch, H., Lütjohann, D.*, Ludwig, M., Schulte, A., Ptok, U., Jessen, F., von Bergmann, K., Rao, M. L., Maier, W., and Heun, R. (2002) Polymorphism in the

6 cholesterol 24S- hydroxylase gene is associated with Alzheimer's disease, Mol Psychiatry 7, Fassbender, K., Stroick, M., Bertsch, T., Ragoschke, A., Kuehl, S., Walter, S., Walter, J., Brechtel, K., Muehlhauser, F., Von Bergmann, K., and Lütjohann, D. (2002) Effects of statins on human cerebral cholesterol metabolism and secretion of Alzheimer amyloid peptide, Neurology 59, Fassbender, K., Simons, M., Bergmann, C., Stroick, M., Lütjohann, D., Keller, P., Runz, H., Kuhl, S., Bertsch, T., von Bergmann, K., Hennerici, M., Beyreuther, K., and Hartmann, T. (2001) Simvastatin strongly reduces levels of Alzheimer's disease beta - amyloid peptides Abeta 42 and Abeta 40 in vitro and in vivo, Proc Natl Acad Sci U S A 98, Chandalia, M., Garg, A., Lütjohann, D., von Bergmann, K., Grundy, S. M., and Brinkley, L. J. (2000) Beneficial effects of high dietary fiber intake in patients with type 2 diabetes mellitus, N Engl J Med 342, Lütjohann, D., Breuer, O., Ahlborg, G., Nennesmo, I., Siden, A., Diczfalusy, U., and Björkhem, I. (1996) Cholesterol homeostasis in human brain: evidence for an age- dependent flux of 24S- hydroxycholesterol from the brain into the circulation, Proc Natl Acad Sci U S A 93, * contributed equally Stand: 04/2014

Lionel Bretillon,* Dieter Lütjohann,** Lars Ståhle, Torulf Widhe, Lutz Bindl, Gösta Eggertsen,* Ulf Diczfalusy,* and Ingemar Björkhem 1, *

Lionel Bretillon,* Dieter Lütjohann,** Lars Ståhle, Torulf Widhe, Lutz Bindl, Gösta Eggertsen,* Ulf Diczfalusy,* and Ingemar Björkhem 1, * Plasma levels of 24S-hydroxycholesterol reflect the balance between cerebral production and hepatic metabolism and are inversely related to body surface Lionel Bretillon,* Dieter Lütjohann,** Lars Ståhle,

More information

Weekly Treatment of 2-Hydroxypropyl-betacyclodextrin Improves Intracellular Cholesterol Levels in LDL Receptor Knockout Mice

Weekly Treatment of 2-Hydroxypropyl-betacyclodextrin Improves Intracellular Cholesterol Levels in LDL Receptor Knockout Mice University of Massachusetts Medical School escholarship@umms Open Access Articles Open Access Publications by UMMS Authors 9-2-2015 Weekly Treatment of 2-Hydroxypropyl-betacyclodextrin Improves Intracellular

More information

POSTERS POSTER PRESENTATIONS

POSTERS POSTER PRESENTATIONS POSTER PRESENTATIONS The following are based on posters presented at the American Heart Association s 75th Annual Scientific Sessions, held November 17-20,2002 in Chicago, Illinois THE CHANGING NATURE

More information

The benefits of lipid-lowering therapy on coronary heart

The benefits of lipid-lowering therapy on coronary heart Inhibition of Intestinal Cholesterol Absorption by Ezetimibe in Humans Thomas Sudhop, MD*; Dieter Lütjohann, PhD, MS*; Annette Kodal, MD; Michael Igel, MD; Diane L. Tribble, PhD; Sukrut Shah, PhD; Inna

More information

Curriculum vitae. PD Dr. med. Georg Werner Feldmann

Curriculum vitae. PD Dr. med. Georg Werner Feldmann Curriculum vitae Personal data: Name: Nationality: Familial status: PD Dr. med. Georg Werner Feldmann German married Business Address: Department of Internal Medicine 3 Center of Integrated Oncology (CIO)

More information

ORIGINAL CONTRIBUTION

ORIGINAL CONTRIBUTION ORIGINAL CONTRIBUTION Plasma Levels of -Amyloid (1-4), -Amyloid (1-42), and Total -Amyloid Remain Unaffected in Adult Patients With Hypercholesterolemia After Treatment With Statins Kina Höglund, MSc;

More information

American Journal of Human Genetics. American Journal of Hypertension. American Journal of Neuroradiology

American Journal of Human Genetics. American Journal of Hypertension. American Journal of Neuroradiology A) Acta Neurochir AJNR Am J Neuroradiol Am Coll Rheumatol Am J Cardiol Am J Hum Genet Am J Hypertens Am J Neuroradiol AJNR Am J Physiol Am J Physiol Gastrointest Liver Physiol Am J Physiol Heart Circ physiol

More information

Oxysterols in the circulation of patients with the Smith-Lemli-Opitz syndrome: abnormal levels of 24S- and 27-hydroxycholesterol

Oxysterols in the circulation of patients with the Smith-Lemli-Opitz syndrome: abnormal levels of 24S- and 27-hydroxycholesterol Oxysterols in the circulation of patients with the Smith-Lemli-Opitz syndrome: abnormal levels of 24S- and 27-hydroxycholesterol Ingemar Björkhem, 1, * Lena Starck,*, Ulla Andersson,* Dieter Lütjohann,*,

More information

Side chain oxidized oxysterols in cerebrospinal fluid and the integrity of blood-brain and blood-cerebrospinal fluid barriers

Side chain oxidized oxysterols in cerebrospinal fluid and the integrity of blood-brain and blood-cerebrospinal fluid barriers Side chain oxidized oxysterols in cerebrospinal fluid and the integrity of blood-brain and blood-cerebrospinal fluid barriers Valerio Leoni, 2, *, Thomas Masterman, 2, Pria Patel, Steve Meaney, Ulf Diczfalusy,

More information

The absorption of cholesterol from the intestine is an

The absorption of cholesterol from the intestine is an Moderately Decreased Cholesterol Absorption Rates Are Associated With a Large Atheroprotective Effect Michael E. Greenberg, Jonathan D. Smith, Ephraim Sehayek Objective Human treatment with ezetimibe results

More information

Plasma concentrations of plant sterols correlate with and are widely considered a marker for dietary cholesterol

Plasma concentrations of plant sterols correlate with and are widely considered a marker for dietary cholesterol Phytosterolemia on the island of Kosrae: founder effect for a novel ABCG8 mutation results in high carrier rate and increased plasma plant sterol levels Ephraim Sehayek, 1, * Hannah J. Yu,* Klaus von Bergmann,

More information

The lipid-lowering effect of ezetimibe in pure vegetarians

The lipid-lowering effect of ezetimibe in pure vegetarians The lipid-lowering effect of ezetimibe in pure vegetarians Jacob J Clarenbach*, Michael Reber*, Dieter Lütjohann, Klaus von Bergmann, and Thomas Sudhop Department of Clinical Pharmacology, University of

More information

A systems biology model studying the role of cholesterol in Alzheimer s disease progression

A systems biology model studying the role of cholesterol in Alzheimer s disease progression A systems biology model studying the role of cholesterol in Alzheimer s disease progression C. Rose Kyrtsos and John S. Baras Abstract A simplified network describing the interactions between the cholesterol

More information

Genetic regulation of cholesterol absorption and plasma plant sterol levels: commonalities and differences

Genetic regulation of cholesterol absorption and plasma plant sterol levels: commonalities and differences JLR Papers In Press. Published on August 1, 2003 as Manuscript R300008-JLR200 Genetic regulation of cholesterol absorption and plasma plant sterol levels: commonalities and differences Ephraim Sehayek

More information

Inhibition of cholesterol absorption by the combination of dietary plant sterols and ezetimibe: effects on plasma lipid levels

Inhibition of cholesterol absorption by the combination of dietary plant sterols and ezetimibe: effects on plasma lipid levels Inhibition of cholesterol absorption by the combination of dietary plant sterols and ezetimibe: effects on plasma lipid levels Lily Jakulj,* Mieke D. Trip, Thomas Sudhop, Klaus von Bergmann, John J. P.

More information

Changes in cholesterol absorption and cholesterol synthesis caused by ezetimibe

Changes in cholesterol absorption and cholesterol synthesis caused by ezetimibe Changes in cholesterol absorption and cholesterol synthesis caused by ezetimibe and/or simvastatin in men Thomas Sudhop, 1 * Michael Reber, 1 * Diane Tribble, 2 Aditi Sapre, 2 William Taggart, 2 Patrice

More information

Statins and Cognition A Focus on Mechanisms

Statins and Cognition A Focus on Mechanisms Statins and Cognition A Focus on Mechanisms Note: Deleted copyrighted graphs/tables are described In red text and source references are provided Disclosures: SPARCL Steering Committee and past consultant

More information

Cholesterol: from heart attacks to Alzheimer s disease.

Cholesterol: from heart attacks to Alzheimer s disease. thematic review Cholesterol: from heart attacks to Alzheimer s disease Robert L. Raffaï* and Karl H. Weisgraber 1, *, Department of Pathology* and Cardiovascular Research Institute, Gladstone Institutes

More information

Phytosterolemia on the Island of Kosrae: A founder effect for a novel ABCG8

Phytosterolemia on the Island of Kosrae: A founder effect for a novel ABCG8 Phytosterolemia on the Island of Kosrae: A founder effect for a novel ABCG8 mutation results in a high carrier rate and increased plasma plant sterol levels Ephraim Sehayek, Hannah J. Yu, Klaus von Bergmann,

More information

Changes in the levels of cerebral and extracerebral sterols in the brain of patients with Alzheimer s disease

Changes in the levels of cerebral and extracerebral sterols in the brain of patients with Alzheimer s disease Changes in the levels of cerebral and extracerebral sterols in the brain of patients with Alzheimer s disease Maura Heverin,* Nenad Bogdanovic, Dieter Lütjohann, Thomas Bayer,** Irina Pikuleva, Lionel

More information

Habilitation in Experimental Pathology, Medical Faculty, University Hospital

Habilitation in Experimental Pathology, Medical Faculty, University Hospital Curriculum vitae Name: Date of birth: Mathias Florian Heikenwälder 14 th of July, 1976, Vienna, Austria Current address: Ammergaustrasse 20, 81377 München Germany Education history 2009-09 Habilitation

More information

The new guidelines issued in PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice

The new guidelines issued in PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice ... PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice Based on a presentation by Daniel J. Rader, MD Presentation Summary The guidelines recently released by the National Cholesterol

More information

Vascular Effects of Diet Supplementation With Plant Sterols

Vascular Effects of Diet Supplementation With Plant Sterols Journal of the American College of Cardiology Vol. 51, No. 16, 2008 2008 by the American College of Cardiology Foundation ISSN 0735-1097/08/$34.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2007.09.074

More information

Title Hepatic Cholesterol Crystals and Crown-Like Structures Distinguish NASH from Simple Steatosis

Title Hepatic Cholesterol Crystals and Crown-Like Structures Distinguish NASH from Simple Steatosis Title Hepatic Cholesterol Crystals and Crown-Like Structures Distinguish NASH from Simple Steatosis Running Title Cholesterol Crystals and Crown-Like Structures in NASH George N. Ioannou 1,2, W. Geoffrey

More information

Determination of 24S- and 27-hydroxycholesterol in plasma by high-performance liquid chromatography-mass spectrometry

Determination of 24S- and 27-hydroxycholesterol in plasma by high-performance liquid chromatography-mass spectrometry Determination of 24S- and 27-hydroxycholesterol in plasma by high-performance liquid chromatography-mass spectrometry methods Ines Burkard, Katharina M. Rentsch, 1 and Arnold von Eckardstein Institute

More information

Author Manuscript Faculty of Biology and Medicine Publication

Author Manuscript Faculty of Biology and Medicine Publication Serveur Académique Lausannois SERVAL serval.unil.ch Author Manuscript Faculty of Biology and Medicine Publication This paper has been peer-reviewed but dos not include the final publisher proof-corrections

More information

別紙 No. 掲載雑誌名 ISSN Impact Factor (2016) 1 Acs Nano Acta Biomaterialia Acta Crystallographica Section D-Structural

別紙 No. 掲載雑誌名 ISSN Impact Factor (2016) 1 Acs Nano Acta Biomaterialia Acta Crystallographica Section D-Structural 別紙 1 Acs Nano 1936-0851 13.942 2 Acta Biomaterialia 1742-7061 6.319 3 Acta Crystallographica Section D-Structural Biology 0907-4449 2.114 4 Acta Neuropathologica 0001-6322 12.213 5 Acta Ophthalmologica

More information

Dietary intake of plant sterols stably increases plant sterol levels in the

Dietary intake of plant sterols stably increases plant sterol levels in the Dietary intake of plant sterols stably increases plant sterol levels in the murine brain Tim Vanmierlo a,b,f, Oliver Weingärtner c, Susanne van der Pol d, Constanze Husche a, Anja Kerksiek a, Silvia Friedrichs

More information

Evidence that the major oxysterols in human circulation originate from distinct pools of cholesterol: a stable isotope study

Evidence that the major oxysterols in human circulation originate from distinct pools of cholesterol: a stable isotope study Evidence that the major oxysterols in human circulation originate from distinct pools of cholesterol: a stable isotope study Steve Meaney,* Moustapha Hassan, Augustinas Sakinis, Dieter Lütjohann,*, **

More information

Lipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels

Lipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels Lipoprotein Formation, Structure and Metabolism: Balance and the Regulation of Plasma Lipid Levels David E. Cohen, MD, PhD Director of Hepatology, Gastroenterology Division, Brigham and Women s Hospital

More information

Dietary intake of plant sterols stably increases plant sterol levels in the murine brain

Dietary intake of plant sterols stably increases plant sterol levels in the murine brain Dietary intake of plant sterols stably increases plant sterol levels in the murine brain Tim Vanmierlo, *,, Oliver Weingärtner, ** Susanne van der Pol, Constanze Husche, * Anja Kerksiek, * Silvia Friedrichs,

More information

The effect of diets on neurodegenerative diseases

The effect of diets on neurodegenerative diseases The effect of diets on neurodegenerative diseases Results from the FP7 project LIPIDIDIET A Kiliaan Donders Institute for Brain, Cognition and Behaviour, Centre for Neuroscience Dept Anatomy and dept Cognitive

More information

cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010

cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010 cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is

More information

INTRODUCTION. Clinical Science (2005) 109, (Printed in Great Britain) 183

INTRODUCTION. Clinical Science (2005) 109, (Printed in Great Britain) 183 Clinical Science (2005) 109, 183 188 (Printed in Great Britain) 183 ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic

More information

Summary and concluding remarks

Summary and concluding remarks Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated

More information

Coronary heart disease is the leading cause of death in

Coronary heart disease is the leading cause of death in PHARMACOLOGY NOTES Ezetimibe (Zetia): a new type of lipid-lowering agent JIGNA PATEL, PHARMD CANDIDATE, VALERIE SHEEHAN, PHARMD, AND CHERYLE GURK-TURNER, RPH Coronary heart disease is the leading cause

More information

University of Parma - Karolinska Institutet IV Workshop on Lipid Metabolism and Vascular Biology

University of Parma - Karolinska Institutet IV Workshop on Lipid Metabolism and Vascular Biology University of Parma - Karolinska Institutet IV Workshop on Lipid Metabolism and Vascular Biology Parma, Centro S. Elisabetta Campus Universitario 8-10 October, 2018 Organized by Franco Bernini (University

More information

Profile of cholesterol-related sterols in aged amyloid precursor protein transgenic mouse brain

Profile of cholesterol-related sterols in aged amyloid precursor protein transgenic mouse brain Profile of cholesterol-related sterols in aged amyloid precursor protein transgenic mouse brain Dieter Lütjohann, 1, * Andreas Brzezinka,* Esther Barth, Dorothee Abramowski, Matthias Staufenbiel, Klaus

More information

Do oxysterols control cholesterol homeostasis?

Do oxysterols control cholesterol homeostasis? PERSPECTIVE Biology and biochemistry of cholesterol Ira Tabas, Series Editor Do oxysterols control cholesterol homeostasis? Ingemar Björkhem Division of Clinical Chemistry, Karolinska Institutet, Huddinge

More information

Platelet Amyloid Precursor Protein Processing: A Biomarker for Alzheimer s Disease.

Platelet Amyloid Precursor Protein Processing: A Biomarker for Alzheimer s Disease. Platelet Amyloid Precursor Protein Processing: A Biomarker for Alzheimer s Disease. Roger N. Rosenberg, MD Alzheimer s Disease Center University of Texas Southwestern Medical Center at Dallas Disclosures:

More information

Noncholesterol Sterols and Cholesterol Lowering by Long-Term Simvastatin Treatment in Coronary Patients. Relation to Basal Serum Cholestanol

Noncholesterol Sterols and Cholesterol Lowering by Long-Term Simvastatin Treatment in Coronary Patients. Relation to Basal Serum Cholestanol Noncholesterol Sterols and Cholesterol Lowering by Long-Term Simvastatin Treatment in Coronary Patients Relation to Basal Serum Cholestanol T.A. Miettinen, T.E. Strandberg, H. Gylling, for the Finnish

More information

Amyloid pathways and diseasemodifying treatments for AD: what changes are necessary in new trials? John Hardy

Amyloid pathways and diseasemodifying treatments for AD: what changes are necessary in new trials? John Hardy Amyloid pathways and diseasemodifying treatments for AD: what changes are necessary in new trials? John Hardy Reta Lila Weston Research Laboratories Department of Molecular Neuroscience UCL Institute of

More information

B. Patient has not reached the percentage reduction goal with statin therapy

B. Patient has not reached the percentage reduction goal with statin therapy Managing Cardiovascular Risk: The Importance of Lowering LDL Cholesterol and Reaching Treatment Goals for LDL Cholesterol The Role of the Pharmacist Learning Objectives 1. Review the role of lipid levels

More information

INTERNAL MEDICINE - PEDIATRICS

INTERNAL MEDICINE - PEDIATRICS Rev. Med. Chir. Soc. Med. Nat., Iaşi 2016 vol. 120, no. 2 INTERNAL MEDICINE - PEDIATRICS UPDATES NEW CLASS OF DRUGS: THERAPEUTIC RNAi INHIBITION OF PCSK9 AS A SPECIFIC LDL-C LOWERING THERAPY A.L. Strat

More information

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary

More information

Cholesterol and Liver Inflammation: from Mice to Human

Cholesterol and Liver Inflammation: from Mice to Human Cholesterol and Liver Inflammation: from Mice to Human Sofie M.A. Walenbergh 1, Tim Hendrikx 1 and Ronit Shiri-Sverdlov 1 1 Introduction Nowadays, obesity is seen as one of the leading health concerns

More information

DOWNLOAD OR READ : TREATMENT OF SEVERE HYPERCHOLESTEROLEMIA IN THE PREVENTION OF CORONARY HEART DISEASE PDF EBOOK EPUB MOBI

DOWNLOAD OR READ : TREATMENT OF SEVERE HYPERCHOLESTEROLEMIA IN THE PREVENTION OF CORONARY HEART DISEASE PDF EBOOK EPUB MOBI DOWNLOAD OR READ : TREATMENT OF SEVERE HYPERCHOLESTEROLEMIA IN THE PREVENTION OF CORONARY HEART DISEASE PDF EBOOK EPUB MOBI Page 1 Page 2 treatment of severe hypercholesterolemia pdf Pure hypercholesterolemia

More information

Strathprints Institutional Repository

Strathprints Institutional Repository Strathprints Institutional Repository Tate, Rothwelle and Rotondo, Dino and Davidson, Jillian (2015) Regulation of lipid metabolism by micrornas. Current Opinion in Lipidology, 26 (3). pp. 243-244. ISSN

More information

Curriculum Vitae. CV P. Khader 1 of 5. Patrick H. Khader Prof. Dr. rer. nat., Dipl.-Psych. April 19, 1976, in Marburg

Curriculum Vitae. CV P. Khader 1 of 5. Patrick H. Khader Prof. Dr. rer. nat., Dipl.-Psych. April 19, 1976, in Marburg CV P. Khader 1 of 5 Curriculum Vitae Name: Born: Citizenship: Work Address: Patrick H. Khader Prof. Dr. rer. nat., Dipl.-Psych. April 19, 1976, in Marburg German Medizinische Hochschule Brandenburg Theodor

More information

Evan A. Stein 1, David Sullivan 2, Anders G. Olsson 3, Rob Scott 4, Jae B. Kim 4, Allen Xue 4, Thomas Liu 4, Scott M. Wasserman 4

Evan A. Stein 1, David Sullivan 2, Anders G. Olsson 3, Rob Scott 4, Jae B. Kim 4, Allen Xue 4, Thomas Liu 4, Scott M. Wasserman 4 Goal Achievement after Utilizing an Anti-PCSK9 Antibody in Statin-Intolerant Subjects (GAUSS): Results from a Randomized, Double-blind, Placebo and Ezetimibe Controlled Study Evan A. Stein 1, David Sullivan

More information

Elements for a public summary

Elements for a public summary VI.2 Elements for a public summary VI.2.1 Overview of disease epidemiology Cardiovascular disease (CVD) is responsible for one-third of global deaths and is a leading and increasing contributor to the

More information

Treatment of Atherosclerosis in 2007

Treatment of Atherosclerosis in 2007 Treatment of Atherosclerosis in 2007 Szilard Voros, M.D. Medical Director Cardiovascular MR and CT Piedmont Hospital, Piedmont Hospital Our Paradigm Genotype Phenotype Environment Atherosclerotic Disease

More information

Prof.dr. Frans J Kok. Nutrition & Health Perspectives over the Life course

Prof.dr. Frans J Kok. Nutrition & Health Perspectives over the Life course Prof.dr. Frans J Kok Nutrition & Health Perspectives over the Life course Midlife Early life Midlife Late life Double Burden of Malnutrition Global population in 2015 and 2060 Modern Science and Technology

More information

The role of seladin-1/dhcr24 in cholesterol biosynthesis, APP processing and Ab generation in vivo

The role of seladin-1/dhcr24 in cholesterol biosynthesis, APP processing and Ab generation in vivo The EMBO Journal (26) 25, 432 443 & 26 European Molecular Biology Organization All Rights Reserved 261-419/6 www.embojournal.org The role of adin-1/dhcr24 in cholesterol biosynthesis, APP processing and

More information

Problem patients in primary care Patient 4: Peripheral artery disease

Problem patients in primary care Patient 4: Peripheral artery disease Problem patients in primary care Patient 4: Peripheral artery disease Dr Terry McCormack Hambleton Richmond Whitby Clinical Commissioning Group Research Lead 01/05/2014 Delivering clinical research to

More information

Plant sterols/stanols for cholesterol lowering and prevention of cardiovascular disease

Plant sterols/stanols for cholesterol lowering and prevention of cardiovascular disease Plant sterols/stanols for cholesterol lowering and prevention of cardiovascular disease Prof Dr Elke A. Trautwein, Senior Scientist Cardiovascular Health, Unilever, on behalf of the International Plant

More information

Lack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims

Lack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims Kobe J. Med. Sci., Vol. 53, No. 4, pp. 151-155, 2007 Lack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims KAORU SAKURAI 1, NAOKI NISHIGUCHI 2, OSAMU SHIRAKAWA 2,

More information

Cholesterol-Lowering Drugs And Alzheimer S Disease

Cholesterol-Lowering Drugs And Alzheimer S Disease Future Lipidology ISSN: 1746-0875 (Print) (Online) Journal homepage: http://www.tandfonline.com/loi/tlip19 Cholesterol-Lowering Drugs And Alzheimer S Disease Gunter P Eckert, Walter E Müller & Gibson W.

More information

Lipid Metabolism in Familial Hypercholesterolemia

Lipid Metabolism in Familial Hypercholesterolemia Lipid Metabolism in Familial Hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis

More information

Inhibition of PCSK9: The Birth of a New Therapy

Inhibition of PCSK9: The Birth of a New Therapy Inhibition of PCSK9: The Birth of a New Therapy Prof. John J.P. Kastelein, MD PhD FESC Dept. of Vascular Medicine Academic Medical Center / University of Amsterdam The Netherlands Disclosures Dr. Kastelein

More information

Curriculum Vitae Professor Dr. Helmut Ernst Remschmidt

Curriculum Vitae Professor Dr. Helmut Ernst Remschmidt Curriculum Vitae Professor Dr. Helmut Ernst Remschmidt Name: Remschmidt, Helmut Ernst Born: 25 April 1938 Family Status: married, two children Academic and Professional Carrer since 2006 since 1980 Professor

More information

Curriculum Vitae. Educational Background

Curriculum Vitae. Educational Background Curriculum Vitae Current Address : Food Science and Technology Department, Faculty of Agriculture, Tanta University, Egypt. Home Address : Al-Mahrosa, Sidi Besher Building No.6 Flat 86 Alex. Home : 002-03-

More information

Factors Affecting Intestinal Absorption of Cholesterol and Plant Sterols and Stanols

Factors Affecting Intestinal Absorption of Cholesterol and Plant Sterols and Stanols Journal of Oleo Science Copyright 2015 by Japan Oil Chemists Society doi : 10.5650/jos.ess14221 REVIEW Factors Affecting Intestinal Absorption of Cholesterol and Plant Sterols and Stanols Ikuo Ikeda Laboratory

More information

Intestinal cholesterol transport: Measuring cholesterol absorption and its reverse Jakulj, L.

Intestinal cholesterol transport: Measuring cholesterol absorption and its reverse Jakulj, L. UvA-DARE (Digital Academic Repository) Intestinal cholesterol transport: Measuring cholesterol absorption and its reverse Jakulj, L. Link to publication Citation for published version (APA): Jakulj, L.

More information

University of Groningen

University of Groningen University of Groningen LDL Receptor Knock-Out Mice Are a Physiological Model Particularly Vulnerable to Study the Onset of Inflammation in Non-Alcoholic Fatty Liver Disease Bieghs, Veerle; Van Gorp, Patrick

More information

Supersaturated bile is an essential prerequisite for

Supersaturated bile is an essential prerequisite for AMERICAN ASSOCIATION FOR THE STUDY OFLIVERD I S E ASES HEPATOLOGY, VOL. 64, NO. 3, 2016 Evidence That the Adenosine Triphosphate-Binding Cassette G5/G8-Independent Pathway Plays a Determinant Role in Cholesterol

More information

Curriculum Vitae Training in Systems Biology, Chalmers Technical University, Sweden Project title: Modelling Gut Microbiome in Obesity

Curriculum Vitae Training in Systems Biology, Chalmers Technical University, Sweden Project title: Modelling Gut Microbiome in Obesity Curriculum Vitae Full name: Dimiter Vassilev Dimitrov I. EDUCATION 2009 Training in Systems Biology, Chalmers Technical University, Sweden Project title: Modelling Gut Microbiome in Obesity 2005 Specialty

More information

G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille, France

G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille, France LIVER X RECEPTORS (LXRS): TRANSCRIPTIONAL REGULATORS OF MACROPHAGE CHOLESTEROL METABOLISM G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille,

More information

PCSK9 and its Role in LDL Receptor Regulation Muscat, Oman - 9 February 2019

PCSK9 and its Role in LDL Receptor Regulation Muscat, Oman - 9 February 2019 PCSK9 and its Role in LDL Receptor Regulation Muscat, Oman - 9 February 2019 Professor Gilles Lambert, PhD LaboratoireInserm U1188 Universitéde la Réunion Faculté de Médecine Saint Denis de la Réunion,

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): Bempedoic acid (ETC-1002) is an ATP-citrate lyase (ACL) inhibitor that in clinical studies has been shown to decrease plasma LDL cholesterol apparently

More information

ANTIHYPERLIPIDEMIA. Darmawan,dr.,M.Kes,Sp.PD

ANTIHYPERLIPIDEMIA. Darmawan,dr.,M.Kes,Sp.PD ANTIHYPERLIPIDEMIA Darmawan,dr.,M.Kes,Sp.PD Plasma lipids consist mostly of lipoproteins Spherical complexes of lipids and specific proteins (apolipoproteins). The clinically important lipoproteins, listed

More information

Ezetimibe: The First Cholesterol Absorption Inhibitor

Ezetimibe: The First Cholesterol Absorption Inhibitor PHARMACEUTICAL SPOTLIGHT Ezetimibe: The First Cholesterol Absorption Inhibitor Beata M. Domagala, PharmD, Michelle Leady, PharmD, and Daniel S. Streetman, PharmD OVERVIEW Ezetimibe (Zetia TM, Merck/Schering-Plough)

More information

Lipid Lowering in Patients at High Risk for Cardiovascular Disease

Lipid Lowering in Patients at High Risk for Cardiovascular Disease Lipid Lowering in Patients at High Risk for Cardiovascular Disease Prof. John J.P. Kastelein, MD PhD FESC Dept. of Vascular Medicine Academic Medical Center / University of Amsterdam The Netherlands Novel

More information

Plant sterol or stanol esters retard lesion formation in LDL receptor-deficient mice independent of changes in serum plant sterols

Plant sterol or stanol esters retard lesion formation in LDL receptor-deficient mice independent of changes in serum plant sterols Plant sterol or stanol esters retard lesion formation in LDL receptor-deficient mice independent of changes in serum plant sterols Jogchum Plat, 1, * Ilona Beugels,* Marion J. J. Gijbels,, Menno P. J.

More information

Emerging CSF and serum biomarkers in atypical dementia. Laksanun Cheewakriengkrai, MD. Phramongkutklao Hospital March 7 th, 2018

Emerging CSF and serum biomarkers in atypical dementia. Laksanun Cheewakriengkrai, MD. Phramongkutklao Hospital March 7 th, 2018 Emerging CSF and serum biomarkers in atypical dementia Laksanun Cheewakriengkrai, MD. Phramongkutklao Hospital March 7 th, 2018 Biomarkers A characteristic that is objectively measured and evaluated as

More information

PCSK9 Inhibition: From Genetics to Patients

PCSK9 Inhibition: From Genetics to Patients PCSK9 Inhibition: From Genetics to Patients John Chapman BSc, Ph.D., D.Sc., FESC Research Professor, University of Pierre and Marie Curie Director Emeritus, INSERM Dyslipidemia and Atherosclerosis Research

More information

ANNE-LISE CHRISTENSEN Professor of Neuropsychological Rehabilitation CURRICULUM VITAE

ANNE-LISE CHRISTENSEN Professor of Neuropsychological Rehabilitation CURRICULUM VITAE ADDRESS: Jahnsensvej 4 2820 Gentofte Denmark ANNE-LISE CHRISTENSEN Professor of Neuropsychological Rehabilitation CURRICULUM VITAE Phone no: +45 39 65 59 53 Fax no: +45 39 65 09 80 E-mail: a-lc@get2net.dk

More information

The Amyloid Precursor Protein Has a Flexible Transmembrane Domain and Binds Cholesterol

The Amyloid Precursor Protein Has a Flexible Transmembrane Domain and Binds Cholesterol The Amyloid Precursor Protein Has a Flexible Transmembrane Domain and Binds Cholesterol Science 336, 1171 (2013) Coach Prof. : Dr. Chung-I Chang Sit-in Prof.: Dr. Wei Yuan Yang Presenter: Han-Ying Wu Date:

More information

Influence of Previous Statin Therapy on Cholesterol-Lowering Effect of Ezetimibe

Influence of Previous Statin Therapy on Cholesterol-Lowering Effect of Ezetimibe Original Article Print ISSN 1738-5520 On-line ISSN 1738-5555 Korean Circulation Journal Influence of Previous Statin Therapy on Cholesterol-Lowering Effect of Ezetimibe Young Hwan Choi, MD, Young Kim,

More information

Personal Information. Academic Employment

Personal Information. Academic Employment Curriculum Vitae Page 1/6 Personal Information Name Address Phone Fax E-mail Dr. phil. Franziska Meissner Friedrich-Schiller-Universität Jena Institut für Psychologie Lehrstuhl für Allgemeine Psychologie

More information

Sitosterol Blood Levels are Elevated in Diabetics and may be the Cause of Coronary Artery Disease and Stroke

Sitosterol Blood Levels are Elevated in Diabetics and may be the Cause of Coronary Artery Disease and Stroke JMEDS Sitosterol Blood Levels are Elevated in Diabetics and may be the Cause of 10.5005/jp-journals-10045-0065 Coronary Artery Disease and Stroke BRIEF COMMUNICATION Sitosterol Blood Levels are Elevated

More information

Cholesterol and its transport. Alice Skoumalová

Cholesterol and its transport. Alice Skoumalová Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones

More information

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the

More information

The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema

The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema Dept Cardiology, Leiden University Medical Center, Leiden,

More information

Is it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics

Is it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Why we care about hepatic lipogenesis Control of lipid synthesis What can go wrong in humans Animal models dlto study lipoprotein

More information

Welcome! Mark May 14, Sat!

Welcome! Mark May 14, Sat! Welcome! Mark May 14, Sat! Do We Have All Answers with Statins In Treating Patients with Hyperlipidemia? Kwang Kon Koh, MD, PhD, FACC, FAHA Cardiology, Gil Heart Center, Gachon Medical School, Incheon,

More information

Hyperlipidemia in an Otherwise Healthy 80 Year-Old Patient. Theodore D Fraker, Jr, MD Professor of Medicine

Hyperlipidemia in an Otherwise Healthy 80 Year-Old Patient. Theodore D Fraker, Jr, MD Professor of Medicine Hyperlipidemia in an Otherwise Healthy Theodore D Fraker, Jr, MD Professor of Medicine Orlando, Florida October 7-9, 2011 80-Year-Old Patient Primary Prevention Issues in the Elderly: Coronary artery disease

More information

Jordan Chamberlain Brooks

Jordan Chamberlain Brooks Jordan Chamberlain Brooks CURRICULUM VITAE November 2018 CONTACT Life Expectancy Project 1439-17th Avenue San Francisco, CA 94122-3402 Phone: (415) 731-0276 Fax: (415) 731-0290 Cell: (510) 507-1418 Brooks@LifeExpectancy.org

More information

Quantitative detection of free 24S-hydroxycholesterol, and 27-hydroxycholesterol from human serum

Quantitative detection of free 24S-hydroxycholesterol, and 27-hydroxycholesterol from human serum Bandaru and Haughey BMC Neuroscience (214) 15:137 DOI 1.1186/s12868-14-137-z METHODOLOGY ARTICLE Open Access Quantitative detection of free 24S-hydroxycholesterol, and 27-hydroxycholesterol from human

More information

2018 Kern Lipid Conference

2018 Kern Lipid Conference 2018 Kern Lipid Conference Metabolic Regulation of Immunity, Cardiometabolic Diseases and Cancer: New Therapeutic Approaches Monday, August 13, 2018 to Wednesday, August 15, 2018 - Vail, Colorado Organizers:

More information

LXR/RXR ligand activation enhances basolateral efflux of -sitosterol in CaCo-2 cells

LXR/RXR ligand activation enhances basolateral efflux of -sitosterol in CaCo-2 cells LXR/RXR ligand activation enhances basolateral efflux of -sitosterol in CaCo-2 cells F. Jeffrey Field, 1 Ella Born, and Satya N. Mathur Department of Veterans Affairs and the Department of Internal Medicine,

More information

LDL How Low can (should) you Go and be Safe

LDL How Low can (should) you Go and be Safe LDL How Low can (should) you Go and be Safe Edward Shahady MD, FAAFP, ABCL Clinical Professor Family Medicine Medical Director Diabetes Master Clinician Program Definition of Low LDL National Health and

More information

Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR

Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Supplement Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Gene Forward Primer (5-3 ) Reverse primer (5-3 ) Reference Human ST2 CTTGATTGATAAACAGAATG CTGATCCAGATACTGTTGAA

More information

Statins and endothelium function

Statins and endothelium function Statins and endothelium function Matthias Endres Berlin, Germany Klinik und Poliklinik für Neurologie Conflict of interest: research grant from AstraZeneca from prevention to acute therapy... Pleiotropic

More information

Management of Post-transplant hyperlipidemia

Management of Post-transplant hyperlipidemia Management of Post-transplant hyperlipidemia B. Gisella Carranza Leon, MD Assistant Professor of Medicine Lipid Clinic - Vanderbilt Heart and Vascular Institute Division of Diabetes, Endocrinology and

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our

More information

Acetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol

More information

BIOMEDICAL SCIENCES GRADUATE PROGRAM SUMMER 2014

BIOMEDICAL SCIENCES GRADUATE PROGRAM SUMMER 2014 THE OHIO STATE UNIVERSITY BIOMEDICAL SCIENCES GRADUATE PROGRAM SUMMER 2014 Elizabeth Stofko Barrie PhD Candidate Genetic Factors Regulating Expression of Dopaminergic Genes July 15 th, 2014 159 DHLRI 1:00

More information

Relationship between oxysterols and mild cognitive impairment in the elderly: a case control study

Relationship between oxysterols and mild cognitive impairment in the elderly: a case control study Liu et al. Lipids in Health and Disease (2016) 15:177 DOI 10.1186/s12944-016-0344-y RESEARCH Open Access Relationship between oxysterols and mild cognitive impairment in the elderly: a case control study

More information

Curriculum Vitae. Professor Juan Carlos Kaski, DSc, DM (Hons), MD, FRCP, FESC,FAHA, FRSM. Present Position and Address. Training and Education

Curriculum Vitae. Professor Juan Carlos Kaski, DSc, DM (Hons), MD, FRCP, FESC,FAHA, FRSM. Present Position and Address. Training and Education Curriculum Vitae Professor Juan Carlos Kaski, DSc, DM (Hons), MD, FRCP, FESC,FAHA, FRSM Present Position and Address Professor of Cardiovascular Science, Molecular & Clinical Sciences Research Institute,

More information