Table S1. Differentially expressed transcripts between hepatic inkt cells. sorted form WT and plck-hcd1d tg mice. Differentially expressed
|
|
|
- Aubrey Cunningham
- 6 years ago
- Views:
Transcription
1 Supplementary Information Table S1. Differentially expressed transcripts between hepatic inkt cells sorted form and plck-hcd1d tg mice. Differentially expressed transcripts identified by gene expression analysis are reported as fold change (FC) down-regulation (upper table) or up-regulation in plck-hcd1d tg inkt cells compared with inkt cells. Figure S1. inkt cell hyperresponsiveness independent of the leaky expression of hcd1d in peripheral T cells of plck-hcd1d tg mice. To rule out that the leaky hcd1d expression on peripheral T cells might play a role in the altered reactivity of inkt cells from plck-hcd1d Tg mice, we generated mixed BM chimeras in which hcd1d was expressed only on DP thymocytes. Lethally irradiated mcd1d -/- recipient mice were reconstituted with a 1:1 mixture of BM derived from plck-hcd1d tg x mcd1d -/- TCRα -/- and from mcd1d -/- mice, respectively. In this chimera, hcd1d is expressed only on DP thymocytes because of their differentiation block due to the TCRα -/- mutation, while mature peripheral inkt and T cells derive from mcd1d -/- BM cell precursors. A. hcd1d expression on peripheral T cells is completely abrogated in plck-hcd1dtgtcrα -/- x mcd1d -/- BM chimeras. Upper panel, hcd1d expression on CD3 + PBMCs from plck-hcd1d tg mice. Lower panel, hcd1d expression on CD3 + PBMCs from and plck-hcd1d TCRα -/- x mcd1d - /- BM chimeras. Black line and gray histogram indicate staining with antihcd1d mab and IgG isotype control, respectively. B. Hepatic mononuclear cells from plck-hcd1d tg mice (upper panels) and plck-hcd1dtg TCRα -/- x mcd1d -/- BM chimeras (lower panels) were stained with mcd1d-dimers, anti- 1
2 TCRβ and anti-nk1.1 mabs. Histograms show the expression of NK1.1 among gated inkt cells. Percentages of positive cells in the indicated gates are shown. Data refer to a pool of 6 mice/group. C. hcd1d-dimers + sorted inkt cells (1x1 4 ) from plck-hcd1d mice and plck-hcd1d TCRα -/- xmcd1d -/- BM chimeras were activated with plastic-bound goat anti-rat IgGs plus soluble anti-cd8 mabs. IFNγ production in the supernatant was measured after 48 hours by ELISA. Mean ± SD of one representative experiment of two is shown. D. RT-qPCR performed using probe specific for ptpn6 transcript on RNA extracted from inkt cells sorted from pools of 6 plck-hcd1d tg and 8 BM chimeric mice. Data are shown as expression fold change of ptpn6 in inkt cells from plck-hcd1d tg or chimeric mice compared to inkt cells. Figure S. Quantification of SHP-1 protein by i.c. flow cytometry. Splenocytes were purified from control littermate mice (bearing two functional Ptpn6 alleles), heterozygous me/+ animals (bearing one functional and one mutated Ptpn6 allele) and homozygous me/me mice (bearing two mutated Ptpn6 alleles) before staining with anti-cd19 and anti-tcrβ-mabs. After fixation and permeabilization, cells were stained with varying concentrations of SHP-1 antibody. Shown is the optimal quantity of anti-shp- 1 Ab (15ng/1 6 cells). Upper panels show histograms for SHP-1 expression in B and T cells from each mouse type. Lower panels show the RFI of SHP-1 expression. SHP-1 staining of B and T cells from me/me mice represents the negative control histogram. Figure S3. Flow cytometry gating strategy for the analysis of SHP-1
3 expression in inkt cells. To directly compare SHP-1 expression in inkt-cells with plck-hcd1d tg inkt cells, we mixed cells from CD and CD plck-hcd1d tg mice and stained them with hcd1d-dimers and mabs specific for CD19, TCRβ and CD45.1. The progressive gating strategy used to define inkt cells from and plck-hcd1d tg mice are indicated. The same CD45.1 gate strategy was used to identify T cells (not shown). One representative staining from hepatic inkt cells is shown. 3
4 Supplemental Table S1 Probe ID Gene Protein _s_at Sh3d19 SH3 domain protein D _at Mbnl1 muscleblind-like _at Cd1d1 CD1d1 antigen 14493_at Serpina3g serine or cysteine peptidase inhibitor A, 3G _at Itih5 intera globulin inhibitor H _s_at Maf v-maf oncogene homolog (c-maf) _at Etv3 Ets domain protein 1419_a_at Ccr9 chemokine receptor _at Itih5 intera globulin inhibitor H _at Mgst microsomal glutathione S-transferase _at Ptpn6 protein tyrosine phosphatase, non-receptor 6 (SHP-1) _at Maf v-maf oncogene homolog (c-maf) _at Itih5 intera globulin inhibitor H _at D8Ertd8e _at Klhl4 kelch-like _s_at 57358B9Rik _x_at Phgdh 3-phosphoglycerate dehydrogenase _x_at Phgdh 3-phosphoglycerate dehydrogenase _at Ms4a6d membrane-spanning 4-domains A, 6D 14356_at Ibrdc3 IBR domain containing 3 Probe ID Gene Protein _at H6 histocompatibility _x_at Ceacam1 CEA-related cell adhesion molecule 14787_x_at Igh-6 Immunoglobulin heavy chain _x_at Igh-6 Immunoglobulin heavy chain _at BB _at Csf1r CSF-1 receptor _x_at Lzp-s lysozyme _at Transcribed locus _x_at Lzp-s lysozyme 14547_a_at Igh-6 Immunoglobulin heavy chain _s_at Fcgrb Fc receptor IgG IIb _at Cobll1 Cobl-like _x_at Klra8 killer cell lectin-like receptor A8 (Ly49H) 14763_x_at Ceacam1 CEA-related cell adhesion molecule 14534_x_at Igh-6 Immunoglobulin heavy chain _at st8sia6 ST8 a-n-acetyl-neuraminide a-sialyltransferase _at RP3-48B19.1 similar to histone a _at Lyzs lysozyme 1471_at Slfn4 schlafen _at Rgs18 regulator of G-protein signaling _at Ly86 lymphocyte antigen _at Casc5 cancer susceptibility candidate _at Klra5 killer cell lectin-like receptor A5 (Ly49E) _at Evi5 ecotropic viral integration site _a_at Atp1b1 ATPase beta 1 polypeptide _x_at Klra7 killer cell lectin-like receptor A7 (Ly49G) _at Transcribed locus _a_at Myb myeloblastosis oncogene 14569_a_at Vim vimentin _at Ifi-4 IFN activated gene _at Evi5 Ecotropic viral integration site _at Arhgap15 Rho GTPase activating protein _at Rgs18 regulator of G-protein signaling _s_at Myadm myeloid-associated differentiation marker 14579_at Tyrobp TYRO protein tyrosine kinase binding protein (DAP1) _s_at Tgfbi TGFb induced 14516_at Alox5ap arachidonate 5-lipoxygenase activating protein (F1 ap) _at Edg8 sphingolipid G-protein-coupled receptor _at Nrp1 neuropilin _at Ifitm3 IFN induced transmembrane protein _x_at Vim vimentin _at C313G3Rik _x_at Igh-6 Immunoglobulin heavy chain _at Qser1 glutamine and serine rich _at Transcribed locus _at Tle4 transducin-like enhancer of split _at 31L4Rik _at Ebi Epstein-Barr virus induced gene 14155_a_at Nap5 NLR family apoptosis inhibitory protein _s_at D1Ertd6e _at Pkp4 plakophilin _a_at Rsrc Arginine/serine rich coiled-coil _at Lpp LIM domain containing preferred partner in lipoma _at 96313D1Rik _at EG _at Nrp1 neuropilin _at Akap9 PRKA anchor protein _at Klrc1 /// Klrc killer cell lectin-like receptor C1/ (NKGA/B/C) FC Tg/ 19,67 6,451 4,545 3,5 3,174,785,695,617,557,538,45,41,358,141,17,13,66,53,49,3 FC Tg/ 8,87 8,864 5,44 5,44 4,759 4,451 4,86 4,17 4,133 4,66 4,45 3,668 3,6 3,348 3,338 3,14 3,9 3,81,968,874,87,763,659,567,566,559,559,496,453,443,44,41,367,363,345,36,39,97,69,51,37,31,3,14,167,98,9,87,77,67,58,54,36,34,33,3,15,7 Down-regulated genes Up-regulated genes
5 Supplemental Figure S1 A plck-hcd1d B C plck-hcd1d TCR -/- x mcd1d -/- BMC hcd1d D mcd1d Dimer TCR NK IFN (% of control) ** plck-hcd1d BM chimera Gapdh Ptpn6,1 1 1 Fold change (sample/) plck-hcd1d plck-hcd1d BM chimera
6 Supplemental Figure S 1 8 B cells 1 8 T cells me/+ me/me SHP SHP-1 4 SHP-1 RFI 6 4 SHP-1 RFI 3 1 me/+ me/me me/+ me/me
7 Supplemental Figure S3 SSC-A FSC-A FSC-H FSC-A CD TCR 1 3 C57BL NK CD plck-hcd1d Tg NK1.1
and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
Immunology - Lecture 2 Adaptive Immune System 1
Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
T Cell Differentiation
T Cell Differentiation Ned Braunstein, MD MHC control of Immune Responsiveness: Concept Whether or not an individual makes an immune response to a particular antigen depends on what MHC alleles an individual
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas
Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas Chapter 04: Antigen Recognition in the Adaptive Immune System Test Bank MULTIPLE CHOICE 1. Most T lymphocytes
Supplemental Data. NKp46 Identifies an NKT Cell Subset Susceptible to Leukemic Transformation in Mouse and Man
Supplemental Data NKp46 Identifies an NKT Cell Subset Susceptible to Leukemic Transformation in Mouse and Man Jianhua Yu 1,2*, Takeki Mitsui 1,3*, Min Wei 1, Hsiaoyin Mao 1, Jonathan P Butchar 4, Mithun
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Mouse Clec9a ORF sequence
Mouse Clec9a gene LOCUS NC_72 13843 bp DNA linear CON 1-JUL-27 DEFINITION Mus musculus chromosome 6, reference assembly (C57BL/6J). ACCESSION NC_72 REGION: 129358881-129372723 Mouse Clec9a ORF sequence
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
Development of B and T lymphocytes
Development of B and T lymphocytes What will we discuss today? B-cell development T-cell development B- cell development overview Stem cell In periphery Pro-B cell Pre-B cell Immature B cell Mature B cell
CD80 and PD-L2 define functionally distinct memory B cell subsets that are. Griselda V Zuccarino-Catania, Saheli Sadanand, Florian J Weisel, Mary M
Supplementary Figures CD8 and PD-L define functionally distinct memory B cell subsets that are independent of antibody isotype Running title: Memory B Cell Subset Function Griselda V Zuccarino-Catania,
Supplemental Figure 1. Protein L
Supplemental Figure 1 Protein L m19delta T m1928z T Suppl. Fig 1. Expression of CAR: B6-derived T cells were transduced with m19delta (left) and m1928z (right) to generate CAR T cells and transduction
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
The Adaptive Immune Response. T-cells
The Adaptive Immune Response T-cells T Lymphocytes T lymphocytes develop from precursors in the thymus. Mature T cells are found in the blood, where they constitute 60% to 70% of lymphocytes, and in T-cell
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
T Cell Development. Xuefang Cao, MD, PhD. November 3, 2015
T Cell Development Xuefang Cao, MD, PhD November 3, 2015 Thymocytes in the cortex of the thymus Early thymocytes development Positive and negative selection Lineage commitment Exit from the thymus and
Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood
Antibody-mediated depletion of CD19-CAR T cells Supplemental 1 Supplemental Materials Supplemental Figure 1. Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood cells were
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
SUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated
1 Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated (U) EGFR TL mice (n=7), Kras mice (n=7), PD-1 blockade
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Supplementary Figure 1
d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP
Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
T Cell Development II: Positive and Negative Selection
T Cell Development II: Positive and Negative Selection 8 88 The two phases of thymic development: - production of T cell receptors for antigen, by rearrangement of the TCR genes CD4 - selection of T cells
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
CD44
MR1-5-OP-RU CD24 CD24 CD44 MAIT cells 2.78 11.2 WT RORγt- GFP reporter 1 5 1 4 1 3 2.28 1 5 1 4 1 3 4.8 1.6 8.1 1 5 1 4 1 3 1 5 1 4 1 3 3.7 3.21 8.5 61.7 1 2 1 3 1 4 1 5 TCRβ 2 1 1 3 1 4 1 5 CD44 1 2 GFP
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation
SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway
IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS
LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the
T cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
A Slfn2 mutation causes lymphoid and myeloid immunodeficiency due to loss of immune cell quiescence
Supplementary Information A Slfn mutation causes lymphoid and myeloid immunodeficiency due to loss of immune cell quiescence Michael Berger, Philippe Kres, Karine Crozat, Xiaohong Li, Ben A. Croker, Owen
Supplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
CD40L TCR IL-12 TLR-L
CD40L B cells plasmacells Neutrophils TCR inkt cells IL-12 Ab production Can inkt cells modulate the cytokine profile of neutrophils? TLR-L CD4+ and CD8+ T cell responses 1. The invariant TCR expressed
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Bead Based Assays for Cytokine Detection
Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)
Nature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?
Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes
Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
Chapter 4 Cellular Oncogenes ~ 4.6 -
Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of
Supplemental Figure 1. CD69 antigen-response curves of CAR engrafted Jurkat T cells. Supplemental Figure 2.
Supplemental Figure 1. CD69 antigen-response curves of CAR engrafted Jurkat T cells. To evaluate the antigen sensitivity of mutant CARs transduced Jurkat T cells were stimulated with varying concentrations
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,
B6.SJL (Ly5.2) mice were obtained from Taconic Farms. Rag1-deficient mice were
Supplementary Methods Mice. B6.SJL (Ly5.2) mice were obtained from Taconic Farms. Rag1-deficient mice were purchased from The Jackson Laboratory. Real-time PCR Total cellular RNA was extracted from the
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection
Supplementary Figure 1 Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection with influenza virus. (a) ST2-GFP reporter mice were generated as described in Methods.
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.
Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature
Nature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
Supplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells
Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard
Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A.
UvA-DARE (Digital Academic Repository) Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A. Link to publication Citation for published
Supplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.
Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
Dual Targeting Nanoparticle Stimulates the Immune
Dual Targeting Nanoparticle Stimulates the Immune System to Inhibit Tumor Growth Alyssa K. Kosmides, John-William Sidhom, Andrew Fraser, Catherine A. Bessell, Jonathan P. Schneck * Supplemental Figure
Major Histocompatibility Complex (MHC) and T Cell Receptors
Major Histocompatibility Complex (MHC) and T Cell Receptors Historical Background Genes in the MHC were first identified as being important genes in rejection of transplanted tissues Genes within the MHC
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL
SUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
MCB 4211 Basic Immunology 2nd Exam; 10/26/17 Peoplesoft #:
For this first section, circle the letter that precedes the best answer for each of the following multiple-choice questions. LOOK AT ALL ALTERNATIVES BEFORE CHOOSING YOUR ANSWER. 1. The TcR (T cell receptor)
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Surface thiol groups and reduction of activated T cells. (a) Activated CD8 + T-cells have high expression levels of free thiol groups on cell surface proteins.
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Structure and Function of Fusion Gene Products in. Childhood Acute Leukemia
Structure and Function of Fusion Gene Products in Childhood Acute Leukemia Chromosomal Translocations Chr. 12 Chr. 21 der(12) der(21) A.T. Look, Science 278 (1997) Distribution Childhood ALL TEL-AML1 t(12;21)
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Structure and Function of Antigen Recognition Molecules
MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and
Supplementary Figure 1
Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.
pplementary Figur Supplementary Figure 1. a.
pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective
HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol
HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
Signal Transduction Cascades
Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,
Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.
Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature
The Generation of Specific Immunity
The Generation of Specific Immunity Antibody structure! Antibodies classified by specificity (antigen, binding site) and class (general structure, function)! Differences in variable regions produce different
Mon, Wed, Fri 11:00 AM-12:00 PM. Owen, Judy, Jenni Punt, and Sharon Stranford Kuby-Immunology, 7th. Edition. W.H. Freeman and Co., New York.
Course Title: Course Number: Immunology Biol-341/541 Semester: Fall 2013 Location: HS 268 Time: Instructor: 8:00-9:30 AM Tue/Thur Dr. Colleen M. McDermott Office: Nursing Ed 101 (424-1217) E-mail*: mcdermot@uwosh.edu
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy
5/1/13. The proportion of thymus that produces T cells decreases with age. The cellular organization of the thymus
T cell precursors migrate from the bone marrow via the blood to the thymus to mature 1 2 The cellular organization of the thymus The proportion of thymus that produces T cells decreases with age 3 4 1