Supplementary Figure 1 IL-27 IL
|
|
- Coral Rose
- 5 years ago
- Views:
Transcription
1 Tim-3 Supplementary Figure 1 Tc Tc Un IL IL-27 Supplementary Figure 1. IL-27 induces the expression of Tim-3 and IL-10 in CD8 + T cells. Naïve CD8 + T cells were activated with anti-cd3 and anti-cd28 antibodies under neutral (Tc0) or Tc1 (IL-12 treatment) culture conditions with or without the presence of IL-27 for 24 hours. Cells were then rested for 4 days. To analyze the protein expression of Tim-3 and IL-10, the cells were restimulated by anti-cd3 Supplementary and anti-cd28 antibodies Figure 1. for IL induces hours and the were expression subjected of Tim-3 to Tim-3 and and IL-10 in CD8 + T IL-10 detection cells. Naïve by CD8 flow + T cytometry. cells were activated Data are with representative anti-cd3 and of anti-cd28 at least antibodies 2 under independent neutral experiments (Tc0) or Tc1 with (by similar IL-12 treatment) results. culture conditions with or without the presence of IL-27 for 24 hours. Cells were then rested for 4 days. To analyze the protein expression of Tim-3 and IL-10, the cells were restimulated by anti-cd3 and anti-cd28 antibodies for 24 hours and were subjected to Tim-3 and IL-10 detection by flow cytometry. Data are representative of at least 2 independent experiments with similar results.
2 Supplementary Figure 2. IL-27 is one of most potent cytokines to induce transcription. Naïve CD4+ T cells were activated by anti-cd3 and anti-cd28 antibodies in the presence of various cytokines for 48 hours. cdna was prepared for real time PCR to quantify the expression of (mean s.d). expression was normalized to the -actin signal. Results represent at least 3 independent experiments.
3 Rela+ve"Expression" Rela+ve"Expression" Rela+ve"Expression" a 400" & b 1500" & 300" 1200" 900" 200" 600" 100" 300" 0" 0" Un" Iono" c 400" Havcr2& 300" 200" 100" 0" Un" Iono" Supplementary Figure 3. RT-qPCR analyses for and Tim-3 expression. (a) B6 mice were infected with either LCMV clone13 (Cln13) or Armstrong (Arm). Viral antigen-specific CD8 + T cell mrna was isolated 8 days or 40 days after infection. transcription was detected by RT-qPCR. (b) and (c) In vitro differentiated Th1 cells were treated with 0.5 M ionomycin for 16 hours to induce T cell anergy (Immunity 2004, 21: ). RNA samples were isolated and subjected to RT-qPCR to detect (b) and Tim-3 (Havcr2) (c) transcription without (Ctrl) or with (Iono) T cell anergy induction results (a, b, c: mean s.d).
4 a b Un IL WT& / Tim-3 Supplementary Figure 4. is important for Tim-3 expression in CD8 + T cells. (a). Naïve CD8 + T cells were activated by anti-cd3 and anti-cd28 with or without the presence of IL-27. Three days after TcR activation, the mrna expression of Tim-3 (Havcr2) was determined by RT-qPCR. (b) To examine Tim- 3 protein expression, cells were restimulated with anti-cd3 and CD28 for 24 hours and subjected to detection of the expression of Tim-3 by flow cytometry. Data are representative of at least 2 independent experiments with similar results (a: mean s.d)
5 Tim-3 PD-1 LAG-3 CD160 NKG2D FAS Th Th Tim-3 Shaded: GFP Empty: Supplementary Figure 5. Ectopic expression of results in the induction of Tim-3 expression. Naïve CD4 + T cells were activated with anti-cd3 and anti- CD28 antibodies under Th0 or Th1 condition, and were subsequently transduced with expressing retrovirus () or empty control retrovirus (GFP). The expression of indicated inhibitory receptors on transduced cells was examined by flow cytometry.
6 Relative Enrichment (fold) Relative Enrichment (fold) 2 kb Tim-3 Primer b T-bet WT T-bet-/- 2 c T-bet pre-gtigg pre-
7 d m m Supplementary Figure 6. Cooperative binding of T-bet and in the intronic (d) To generate Tim-3-luc promoter, genomic DNA sequence that contains partial intron 1 to region of the locus. (a) Summary of ChIP-seq data analysis. Sequencing distal promoter region ( from 283bp down stream to about 1.5kb upstream of the transcription reads initiation were site) mapped of Tim-3 gene to the was mouse sublconed reference into pgl3 basic genome luciferase (mm9) reporter using vector the Bowtie aligner (Promega), (Genome where Biology, and T-bet 2009, binding 10:R25). sites are identified Uniquely by ChIP-PCR mapped and ChIP-seq. reads with two or 293T cells were transfected with either only or T-bet, or combination of both. Tim-3 fewer mismatches were retained for downstream peak calling analysis. Peak promoter-driven firefly luciferase activities were normalized with an internal control, CMV detection promoter-driven was Renilla performed luciferase (Promega) by the (mean Model-based ± s.d.). Analysis of ChIP-Seq (MACS) program (Genome Biology, 2008, 9:R137) using the isotype sample as the control (peak p-value<10-5 and FDR<=0.05). ChIP-seq dataset of T-bet (GSM836124) was obtained from a previous publication (Immunity, 2011, 35:919 31). All the identified peaks were mapped to the UCSC Genes in the UCSC Genome Browser ( The motif sequences of all the TF were analyzed by the MEME-ChIP program (Bioinformatics, 2011, 27:1696 7) from ChIP-seq identified peaks. (b) T-bet -/- and WT CD4 + T cells were activated by anti-cd3 and anti-cd28 antibodies under Th1 culture condition in the presence of IL-27. Four days after T cell activation, the cells were subjected to ChIP-qPCR to analyze T-bet enrichment to the Tim-3 locus. (c) Competition ChIP-qPCR. WT CD4 + T cells were activated by anti-cd3 and anti-cd28 antibodies under Th1 culture condition in the presence of IL-27. Four days after T cell activation, the chromatin sample was prepared and precleared with an antibody to or control goat IgG (gtigg) prior to T-bet ChIP. Locations for PCR primer sets marked in red indicate previously identified binding region in Figure 5f. (d) To generate Tim-3-luc promoter, genomic DNA sequence that contains partial intron 1 to distal promoter region (from 283bp down stream to about 1.5kb upstream of the transcription initiation site) of Tim-3 gene was sublconed into pgl3 basic luciferase reporter vector (Promega), where and T-bet binding sites are identified by ChIP-PCR and ChIP-seq. 293T cells were transfected with either only or T-bet, or combination of both. Tim-3 promoter-driven firefly luciferase activities were normalized with an internal control, CMV promoter-driven Renilla luciferase (Promega) (mean s.d.).
8 CNS 28 a 0 10,000 20,000 30,000 40,000 kb b CNS 6 Tim-3 CNS 12 CNS 13 CNS 15
9 CNS 15 CNS 28 Supplementary Figure 7. Computational analysis of the human and mouse Tim-3 locus (Havcr2). (a) CNSs in the Tim-3 locus. By aligning the human and mouse Tim-3 Supplementary locus in the ECR Figure Browser 7. Computational ( analysis 36 of CNSs, the human having 70% and or mouse greater Tim- 3 locus identity (Havcr2). over at least (a) CNSs 100bp in length, the Tim-3 were identified locus. By between aligning human the and human mouse and mouse Tim-3 Tim-3 locus. locus CNSs in predicted the ECR to have Browser potential -binding ( sites were marked 36 in red. CNSs, having (b) 70% CNSs or with greater significant identity over enrichment at least that 100bp were identified in length, by were ChIP-QPCR. identified between Numbers human are the and positions mouse relative Tim-3 to the locus. start of CNSs predicated predicted CNS sequence to have identified potential by the ECR Browser. Sequences in red are putative binding sites. -binding sites were marked in red. (b) CNSs with significant enrichment that were identified by ChIP-QPCR. Numbers are the positions relative to the start of predicated CNS sequence identified by the ECR Browser. Sequences in red are putative binding sites.
10 a b Supplementary Figure 8. Measurement of intestinal pathology. (a) Gut inflammation scored by crypt damage and immune cell infiltration. Two randomly selected sections from each individual mouse were scored to represent the final grade of gut pathology. Each section represents about cm of intestine and 3-4 cm of colon. Inflammation were graded as follows: none = 0, a few areas of inflammation detected = 1, mild inflammation in proximally ¼ of the gut = 2, extensive inflammation in the majority of the gut = 3, extensive inflammation with hyperplasia = 4. Scale bars represent 200 m in length. (b) Histological result representing mice free from gut inflammation after transferring -transduced T cells. T cells were detected Peyer s paches in but failed to cause tissue damage. Scale bar represents 50 m in length.
11 Supplementary Figure 9. IL-27-suppressed Th1-mediated colitis is dependent. (a) Naïve CD4 + T cells from WT FoxP3-GFP KI and -/- x FoxP3- GFP KI mice (CD4 + CD62L + GFP - ) were activate by plate-bound anti-cd3/cd28 in the presence of IL-12, anit-tgf antibody (Clone 1D11, R&D Systems), and anti-il-4 antibody. The cells were simultaneously treated with or without IL- 27. On day 6, cells were sorted again to deplete GFP + (FoxP3 + ) cells, and were peritoneally injected into Rag1 -/- recipients to induce colitis. 8 weeks after transfer, the recipient mice were killed to analyze colon pathology. The images represent pathology from each experimental group. Scale bars represent 100 m in length. (b) In vitro differentiated CD4 + T cells as described in (a) were transferred into Rag1 -/- recipient mice. After 5 weeks, T cells were isolated from mesenteric lymph nodes and analyzed for Tim-3 and IL-10 expression by flow cytometry. (WT Th1 n=4; WT Th1+IL-27 n=4; -/- Th1 n=4; -/- Th1+IL- 27 n=3. mean ± SEM, t test)
12 Supplementary Figure 10. WSX-1 -/- mice are resistant to tumor growth. (a) Lewis Lung carcinoma (LLC) cells were implanted into C57BL/6 (WT) (n=10) and WSX-1 -/- (n=9) mice and tumor growth was monitored in two dimensions. Statistics was based on combination of total animals from two independent experiments. (b) The expression of Tim-3 and PD-1 on CD8 + TILs from WT (n=4) and WSX-1 -/- (n=4) recipient tumor-bearing mice was determined by flow cytometry. (a and b: mean SEM, t test).
13 Supplementary Figure 11. -/- T cells suppress tumor growth. (a) WT or -/- T cells were transferred into Rag-1 -/- mice (WT: n=4; -/- : n=5). Recipient mice were then innoculated with 5x10 5 B16F10 melanoma cells. Tumor growth was monitored in two dimensions. Mean tumor growth is shown. (P=0.0317, t test). (b) Summary data showing mean tumor size at termination. (c) Summary data showing Tim-3 expression on CD4 + (P=0.046, t test) and CD8 + (n.s., t test) TILs (WT: n=3; -/- : n=3).
14 Supplementary Figure 12. Full Western blots. (a) Full Western blot for and -actin expression. Cropped figures were shown in manuscript Figure 3c. (b) Full Western blot for detection of -T-bet interaction by co-ip. Cropped figures were shown in manuscript Figure 5g.
15 No. Forward primers Reverse primers 1 ATTCAGTCCACCGTCTTTGC GAACACAATGTAATTTTATCGTAATGG 2 CCTGAAGCTCACCAAACCTC TGGCAGTCTTTGCTTCCTTT 3 GATCCCGCATTTTTAAGAGG GCTGCACTGTTGCGACTTC 4 CTCTCAGGAAGGGCTGACAC GGAAGGGGGACTTTGAACAT 5 AGTGCCTTGCAGGGTGTATC TCCTGAGTCCCCAGAATCAC 6 AAGGAGGAGGGATGTCCTGT ACCAGACCAGGAACGATGAC 7 TGTCAACTGGTTGCTTGCTC AAGATGCCGCAGGATATTTG 8 AAGGCTCACAGCATCGTCTT CTTCTGGGACAGCTTTCAGC 9 aacaaaaccaaatcaaaccaaa TCCTGGGGAACTCAAGACTG 10 GTTGCTGGGTGAAGCTCTTG CCGCAACTGTTCTAAAGGGTA 11 AAAAGACTGCGAACCACCAT GCTTGGGACCACCCTAATCT 12 CTAGGCACCTCAGCCTTTTG GGAGGGTCACCAGTGTCTGT 13 GGGGGCAGGTGAGATAAAAT CCCTAGTTCAAATCCCAGCA 14 TGTGGGCACATAAAATAAAGG AACTGGCAGCATTTGGAAAG 15 AGATCCCAATGTTCCCATCA TGAACACCAGAGATGGCCTA 16 CATGTGTTGCTTGCTTGCTT GATCGGGTTGGTGTCAAAAC 17 AAGGGCTGTCCTGAAAGTCA TCCTAAGCACGAGGCTTGTT 18 CATTCCTGGAGGAAACTGGA ATAGATGGGAGCCAGCACAG 19 ACTGCCCAGGAGTCATCTGT CCCAAAGATTTGATCCCTCA Supplementary Table 1. Sequences for Tim-3 ChIP-PCR primers.
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationSupplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationNature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationAn IL-27/NFIL3 signaling axis drives Tim-3 and IL-10 expression and T cell dysfunction
An IL-27/NFIL3 signaling axis drives Tim-3 and IL-10 expression and T cell dysfunction The Harvard community has made this article openly available. Please share how this access benefits you. Your story
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationSupplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationfor six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and
SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1
More informationNature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.
Supplementary Figure 1 Id2 and Id3 define polyclonal T H 1 and T FH cell subsets. Id2 YFP/+ (a) or Id3 GFP/+ (b) mice were analyzed 7 days after LCMV infection. T H 1 (SLAM + CXCR5 or CXCR5 PD-1 ), T FH
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSupplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
More informationSupplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.
Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationNature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationNature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
More informationSupplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More informationand follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationThe encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationKerdiles et al - Figure S1
Kerdiles et al - Figure S1 a b Homo sapiens T B ce ce l ls c l M ls ac r PM oph N ag es Mus musculus Foxo1 PLCγ Supplementary Figure 1 Foxo1 expression pattern is conserved between mouse and human. (a)
More informationSupplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
More informationSupplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
More informationSupplementary Figures
MiR-29 controls innate and adaptive immune responses against intracellular bacterial infection by targeting IFN-γ Feng Ma 1,2,5, Sheng Xu 1,5, Xingguang Liu 1, Qian Zhang 1, Xiongfei Xu 1, Mofang Liu 3,
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationSUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
More informationCD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
More informationTranscription factor Foxp3 and its protein partners form a complex regulatory network
Supplementary figures Resource Paper Transcription factor Foxp3 and its protein partners form a complex regulatory network Dipayan Rudra 1, Paul deroos 1, Ashutosh Chaudhry 1, Rachel Niec 1, Aaron Arvey
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationTranscript-indexed ATAC-seq for immune profiling
Transcript-indexed ATAC-seq for immune profiling Technical Journal Club 22 nd of May 2018 Christina Müller Nature Methods, Vol.10 No.12, 2013 Nature Biotechnology, Vol.32 No.7, 2014 Nature Medicine, Vol.24,
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationSupplemental Figure S1. A. Venn diagram depicting overlap between anti-correlated genes of
Supplemental Figure S1. A. Venn diagram depicting overlap between anti-correlated genes of 1,000 most differentially expressed genes with NKX2-1 amplification in lung adenocarcinoma cell lines and anti-correlated
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationSupplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
More informationRecombinant Protein Expression Retroviral system
Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential
More informationL1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationExposure of virus-specific or tumor-reactive CD8 + T cells to
Exhaustion-associated regulatory regions in CD8 + tumor-infiltrating T cells Giuliana P. Mognol a,1, Roberto Spreafico b,1, Victor Wong a,1,2, James P. Scott-Browne a, Susan Togher a, Alexander Hoffmann
More informationNature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al. .. Supplementary Figure 1 % of initial
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
More informationSUPPLEMENT Supplementary Figure 1: (A) (B)
SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationFig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR ChIP-PCR was performed on PPARγ and RXR-enriched chromatin harvested during adipocyte differentiation at day and day 6 as described
More informationD CD8 T cell number (x10 6 )
IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationSupplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
More informationDynamic Changes in Chromatin Accessibility Occur in CD8 + T Cells Responding to Viral Infection
Resource Dynamic Changes in Chromatin Accessibility Occur in CD8 + T Cells Responding to Viral Infection Highlights d Examined chromatin accessibility in endogenous CD8 + T cells during viral infection
More informationPeli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
More informationSupplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table File Name: Peer Review File Description: Supplementary Table 1 Primers and taqman probes used were the following:
More informationSupplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationSupplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationRegulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D.
Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D. Professor, Departments of Pathology and Medicine Program Leader,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationW/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
More informationEosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
More informationSupplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,
More informationSupplementary Material
Supplementary Material Fig. S1. Gpa33 -/- mice do not express Gpa33 mrna or GPA33 protein. (A) The Gpa33 null allele contains a premature translational stop codon (STOP) in exon 2, and almost all of the
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
More information