HIV Neutralization Assays: p24 PBMC Assays as Compared with the Pseudovirus (TZM-bl) Assay Using Multiple HIV-1 Subtypes
|
|
- Gwendoline Daniels
- 5 years ago
- Views:
Transcription
1 HIV Neutralization Assays: p24 PBMC Assays as Compared with the Pseudovirus (TZM-bl) Assay Using Multiple HIV-1 Subtypes Vicky Polonis The USMHRP: Walter Reed Institute of Research and The Henry M. Jackson Foundation WHO Global Neutralization Workshop, March 17, 2007, Varese, Italy
2 NeutNet Project: Reagents and Assays Employed A methods comparison in numerous international labs using 11 viruses (7 PV) and 4 reagents: 4E10, D, TriMab, scd4 PBMC: stimulated (3-4 days, PHA), Nabs +/- virus inc 30 min, 150,000/well added over night, washed and cultured (4-6 days), p24 meas. by ag. capture. % Neutralization is calculated as: [(p24 in control - p24 with Ab) X 100 p24 control] TZM-bl assay with pseudoviruses
3
4 NeutNet: IC 50 for 4 Reagents (7 viruses) 25 -PB -TZ TriMab * 25 4E10 * IC50 (ug/ml) PBMC Assay TZM-bl Assay IC50 (ug/ml) PBMC Assay TZM-bl Assay VI 191 SF162 MN(P) DU174 CM244 QH0692 AC10 Viral Isolate 0 VI 191 SF162 MN(P) DU174 CM244 QH0692 AC10 Viral Isolate D-52D 10 * scd IC50 (ug/ml) PBMC Assay TZM-bl Assay IC50 (ug/ml) 6 4 PBMC Assay TZM-bl Assay VI 191 SF162 MN(P) DU174 CM244 QH0692 AC10 Viral Isolate 0 VI 191 SF162 MN(P) DU174 CM244 QH0692 AC10 Viral Isolate
5 Summary: NeutNet Data Both EC p24 PBMC and TZM-bl pseudovirus assays run for 7 viruses. In general, IC 50 s/ic 80 s lower in TZM-bl pseudovirus assay- more sensitive. While the qualitative patterns of neutralization are similar for some reagents in both assays (ie, TriMab and 447 anti V3), distinct examples exist (ie. 4E10, Zeptometrix plasmas) where the 2 assays provide different results Recommend continuing parallel capacity for primary cell based assays and PV assays in cell lines.
6 SF162 Bal ID50: GMT of 6 HIV-1 + Serum Samples Bx08 W61D ADX Du151 TV1 CM Luc-UAB Luc-Duke Luc-ViroLogic PBMC-VRC PBMC-Duke ID50
7 ID50: Based on GMT of 6 HIV-1 + sera Frequency of Outliers Bal SF162 Bx08 W61D ADX Du151 TV1 CM244 PBMC-Duke +++ PBMC-VRC Luc-ViroLogic + Luc-Duke ++ Luc-UAB Pairwise comparisons of all groups tested by ANOVA (alpha =.01). Significant differences with one or more assays are represented by +.
8 Conclusions Uniform trends were seen in how each assay rank-ordered the neutralizationsensitivity of virus isolates and the neutralization-potency of serologic reagents, i.e., no indication of general qualitative differences in outcomes
9 The USMHRP Multi-clade Virus Panel and Cross-clade NAb 60 Pure clade Full-length sequenced isolates (10 each from clades A-D, CRF01, CRF02) The majority are from chronic infection 6 clade-specific plasma pools from subjects presumed to have pure clade/crf infections (Full-length sequenced from PBMC (Francine McCutchan s lab) Cloning and sequencing: functional gp160 env clones from 56/60 virus stocks
10 Env gp160 phylogenetic analysis: Panel of 60 Viruses CRF01_AE NP1695 NI1149 NI1052 NI1046 M02138 NP1525 NP1251 CM244 TH253 CM240 CM235 J H D G K F (Isolates from 15 countries, 10 from each of 6 clade/crfs 100 CF CRF02_AG 0002BBY 0014BBY MSC BBY 1970LE SE BBY KNH BBY 0005BBY KNH MV KER2018 UG029 DJ264 UG037 KER2008 DJ263 KNH1209 IbNG TZ02 KSM4030 KEQ23 KNH1144 KNH1135 RW TZ A03349 UG065 UG57128 A07412 E08364 A08483 UG114 D26830 NKU3006 E13613 J32228 UGE2343 KE2059 Red: Current or candidate vaccine strains, (Brown et al., J Virol 79: , 2005.) RL42 NP1538 US873 BAL LAI BX08 BZ167 US1 US33931 RF MN US4 BK132 B A BW0504 IN905 IN20635 SM145 TZ05 ZA151DU TZ_BD9 MW965 SE364 TZ04 TZA246 ET14 ET288 TZA125 MSC5016 C
11 The USMHRP Multi-clade Virus Panel and Cross-clade NAb Tested all 60 viruses using each of the 6 clade pools, a US pool, scd4 and Tri-mAb PBMC assay: reduction of p24 production at day 4; 50% and 80% endpoint neutralization titers were determined Prepared Pseudoviruses from the 56 functional env clones and tested them in the luciferase reporter, TZM-bl cell assay (at day 2); 50% and 80% endpoint titers were determined
12 International Panel: IC80s PBMC vs TZM-bl PBMC vs TZMbl titers IC R 2 = Titers of pseudoviruses on TZMbl cells Titers of primary isolates on PBMC (6 Plasma Pools) R 2 =0.004
13 Neutralization of HIV-1 Primary Isolates (PBMC assay) and Individual Pseudoviruses (TZM-bl assay) Using Clade-specific Plasma Pools Virus/ Clade: BZ167ec9/ B BZ167/ B ec2/ C 56313/ C GS16.ec1/ C GS16/ C Assay/Cells: TZM-bl PBMC TZM-bl PBMC TZM-bl PBMC Plasma Pool: A B C D CRF01_AE CRF02_AG US HIV # of AA Changes: Plasma dilution= 1:40
14 M47 M9 2F5 4E10 HIV+ P+ TZ - P+/- TZ++ P+ TZ++
15 HIV-1 Neutralization Using an anti-pip mab in the PBMC vs TZM-bl Assays A, B PBMC: A B C D C, D TZM-bl: C. Alving mab; Brown et al., J. Virol. 81: , 2007
16 Common features of Current Neutralization Assays Assay: Cells: Virus: Assay Length: Common endpoint: Rounds of Infection: Measures inhibition of Attachment/Entry- Cell-cell transmission- Coreceptors used: CCR5 density on cells: PBMC PBMC Uncloned primary 4-7 days EC or IC p24 Multiple Yes Yes R5, X4 (other?) Psuedovirus (PV) TZM-bl, JC53-BL13 Cloned env PV (or primary) 2-3 days Luciferase activity Single Yes No R5, X
17 CCR5 and CD4 Receptor Quantitation on TZM-bl Cells vs PBMC TZM-bl PBMC PHA-PBMC CD4 * * CCR5 * > 2 Log difference 6 Passages of TZM-bl, 6 different PBMC donors
18
19 The mechanism(s) of HIV entry into target cells: T lymphocytes: entry predominantly by classic retrovirus pathway of receptor dependent (ph independent) fusion at the plasma membrane Epithelial cells (HeLa and derivatives): 85-90% of virions enter by endocytosis, ph dependent and requires endosomal acidification (Schaeffer et al., W. Greene J. Virol. 78: , 2004) Others: J.V. Garcia et al., Ira Mellman
20 Why do some Antibodies function better in one assay than another? May be related to: Valency, avidity, affinity and effectiveness during the preattachment phase. Abs that function post-cd4 attachment and/or whose function is linked to coreceptor (CCR5) engagement may show greater assay-specific differences? Abs that can attach to the cell surface may show differences if endocytosis is a key entry pathway in epithelial cell models No single assay to date---what will best predict or reflect what occurs in natural targets in vivo? Dengue virus-->enhancement predicted by cell line model Thus, parallel assay evaluation is recommended
21 ACKNOWLEDGEMENTS The Trial Volunteers Siriraj Hospital Dr. Kovit Pattanapanyasat AFRIMS Dr. Sorachai Nittayaphan Dr. Mark desouza The JCRC staff K. Somsak Chantakulkij AIP Penprapa Chanbancherd International Sites Aventis Pasteur VaxGen DAIDS Janice M. Darden WRAIR/ HMJF Bruce Brown Lindsay Wieczorek Kara Lombardi Eric Odom Charline Bermudez Andrew RosaBorges Anita Gillis Dr. Merlin Robb Dr. Jerome Kim Dr. Deborah Birx VTC Dr. Punnee Pitisuttithum Dr. Prasert Thoncharoen TAVEG
22 Assay A, B, C Assay D, E, F
23 Carbohydrate Compound-Mediated Inhibition or Enhancement of HIV Globotriose PBMC 3'-sialyllactose PBMC Globotriose TZM-bl 3'-sialyllactose TZM-bl A B C D CRF Viral Clade
24 Why FL-Sequenced Pure HIV Panel? Loss of B vs E Serotype Observations Using a CRF01_ AE/B Recombinant Virus and AE or B Plasma % Neutralization E 2007se-E AE/B 2003se-B 1538-B Virus name - Subtype E pool B pool 1:20) (1623 AE/B : E gp120 / B gp41 )
25 NeutNet: IC 80 for 4 Reagents (7 viruses) -PB -TZ TriMab 4E IC80 (ug/ml) PBMC Assay TZM-bl Assay IC80 (ug/ml) PBMC Assay TZM-bl Assay VI 191 SF162 MN(P) DU174 CM244 QH0692 AC10 Viral Isolate 0 VI 191 SF162 MN(P) DU174 CM244 QH0692 AC10 Viral Isolate 447D-52D scd IC80 (ug/ml) PBMC Assay TZM-bl Assay IC80 (ug/ml) 6 4 PBMC Assay TZM-bl Assay VI 191 SF162 MN(P) DU174 CM244 QH0692 AC10 Viral Isolate 0 VI 191 SF162 MN(P) DU174 CM244 QH0692 AC10 Viral Isolate
26 Gold Standard PBMC Assay Primary human lymphocytes are stimulated in culture (3-4 days, PHA) and infected in the presence or absence of NAbs. The cells (150,000/well) are washed and cultured (4-6 days), the virus in culture fluids is collected, lysed and the core (gag) p24 is measured by antigen capture (kit). % Neutralization is calculated as: [(p24 in control - p24 with Ab) X 100 p24 control]
27 Neutralization of US-1/B Using Serum from Volunteer (BA) Prime-Boost B/B, Boost = o-gp160mn/b Pre 13% 11% Pre (duplicates) CD4-PE Post 0.5% 1% Post (duplicates) X % NT = 93% p24-fitc (day 182 post)
28 Neutralization of SI 2079 B/E Recomb. Virus (env BE) Value of double staining: Blocking CD4 down-regulation - X4 Uninf 55% 92% U+L=0.4% 92% 5% 4% Media 45% 91% CD4-PE E Pool 1:40 8% 6% 86% 47% 6% 47% B Pool 1:40 EC: B& E =0% CD4 down reg. blocked > 50% p24-fitc
Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies
Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies Michael Seaman, Ph.D. Center for Virology and Vaccine Research Beth Israel Deaconess Medical Center Harvard Medical School J. Virol.
More informationALVAC -HIV and AIDSVAX B/E Prime-Boost HIV-1 Preventive Vaccine Regimen. Results of the Thai HIV Vaccine Trial, RV144
ALVAC -HIV and AIDSVAX B/E Prime-Boost HIV-1 Preventive Vaccine Regimen Results of the Thai HIV Vaccine Trial, RV144 SupachaiRerks-Ngarm, PunneePittisutthithum, SorachaiNitayaphan, JaranitKaewkungwal,
More informationAvailable online at Minireview
Available online at www.sciencedirect.com Virology 375 (2008) 315 320 www.elsevier.com/locate/yviro Minireview Recent advances in the characterization of HIV-1 neutralization assays for standardized evaluation
More informationIdentification of Mutation(s) in. Associated with Neutralization Resistance. Miah Blomquist
Identification of Mutation(s) in the HIV 1 gp41 Subunit Associated with Neutralization Resistance Miah Blomquist What is HIV 1? HIV-1 is an epidemic that affects over 34 million people worldwide. HIV-1
More informationBoosts Following Priming with gp120 DNA
Neutralizing Antibody Responses Induced with V3-scaffold Protein Boosts Following Priming with gp120 DNA Susan Zolla-Pazner NYU School of Medicine Problems with Whole Env Immunogens Poor induction of Abs
More informationHIV 1 Preventive Vaccine Regimen. Community based Trial in Thailand V 144. for the MOPH TAVEG Collaboration
V ALVAC HIV and AIDSVAX B/E Prime Boost HIV 1 Preventive Vaccine Regimen Final Results of the Phase III Community based Trial in Thailand Supachai Rerks Ngarm, Punnee Pittisutthithum, Sorachai Nitayaphan,
More informationTiered Categorization of a Diverse Panel of HIV-1 Env Pseudoviruses for Assessment of Neutralizing Antibodies
JOURNAL OF VIROLOGY, Feb. 2010, p. 1439 1452 Vol. 84, No. 3 0022-538X/10/$12.00 doi:10.1128/jvi.02108-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Tiered Categorization of
More informationRecombinant Baculovirus Derived HIV-1 Virus-Like Particles Elicit Potent Neutralizing Antibody Responses
Recombinant Baculovirus Derived HIV-1 Virus-Like Particles Elicit Potent Neutralizing Antibody Responses Weimin Liu University of Alabama at Birmingham Introduction and Rationale Virus-like particles (VLPs)
More informationImmunogenicity of ALVAC HIV (vcp1521) and AIDSVAX B/E Prime Boost Vaccination in RV144, Thai Phase III HIV Vaccine Trial
Immunogenicity of ALVAC HIV (vcp1521) and AIDSVAX B/E Prime Boost Vaccination in RV144, Thai Phase III HIV Vaccine Trial M. de Souza, R. Trichavaroj, A. Schuetz, W. Chuenarom, Y. Phuang ngern, S. Jongrakthaitae,
More informationSupplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood
Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial
More informationWhy are validated immunogenicity assays important for HIV vaccine development?
Why are validated immunogenicity assays important for HIV vaccine development? There is a need to compare immunogenicity of products in the pipeline, when similar or different in class when developed by
More informationSafety and Immunogenicity of an HIV Subtype B and E Prime-Boost Vaccine Combination in HIV-Negative Thai Adults
BRIEF REPORT Safety and Immunogenicity of an HIV Subtype B and E Prime-Boost Vaccine Combination in HIV-Negative Thai Adults Sorachai Nitayaphan, 1 Punnee Pitisuttithum, 3 Chitraporn Karnasuta, 2 Chirapa
More informationInternational network for comparison of HIV neutralization assays: the NeutNet report.
International network for comparison of HIV neutralization assays: the NeutNet report. Fenyö, Eva Maria; Heath, Alan; Dispinseri, Stefania; Holmes, Harvey; Lusso, Paolo; ZollaPazner, Susan; Donners, Helen;
More informationGlobal Panel of HIV-1 Env Reference Strains for Standardized Assessments of Vaccine- Elicited Neutralizing Antibodies
JVI Accepts, published online ahead of print on 18 December 2013 J. Virol. doi:10.1128/jvi.02853-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 Global Panel of HIV-1 Env
More informationSupporting Information
Supporting Information Walker et al. 1.173/pnas.111753118 - JR-CSF 1 3 1 4 1 5 1 6 1 7 1 8 blank beads protein A beads JR-FL - 1 3 1 4 1 5 1 6 1 7 1 8 - MGRM-C26 1 3 1 4 1 5 1 6 1 7 1 8 reciprocal serum
More informationExploratory Age-stratified Analysis of Risk-taking Behaviors and Trial Participation Outcomes in the Thai Phase III HIV Vaccine Trial
RV RV 144 Exploratory Age-stratified Analysis of Risk-taking Behaviors and Trial Participation Outcomes in the Thai Phase III HIV Vaccine Trial J Kaewkungwal, P Pitisuttithum, S Nitayapan, D. Stablein,
More informationIncreasing Neutralisation resistance in HIV-1 Clade C over the course of the southern African Epidemic. Cecilia Rademeyer 26 October 2014
Increasing Neutralisation resistance in HIV-1 Clade C over the course of the southern African Epidemic. Cecilia Rademeyer 26 October 2014 HIV-1 Transmission and Antigenic Drift Individual Selection Transmission
More informationMin Levine, Ph. D. Influenza Division US Centers for Disease Control and Prevention. June 18, 2015 NIBSC
Workshop on Immunoassay Standardization for Universal Flu Vaccines Min Levine, Ph. D. Influenza Division US Centers for Disease Control and Prevention June 18, 2015 NIBSC 1 Multiple Immune Mechanisms Contribute
More informationRegional Clustering of Shared Neutralization Determinants on Primary Isolates of Clade C Human Immunodeficiency Virus Type 1 from South Africa
JOURNAL OF VIROLOGY, Mar. 2002, p. 2233 2244 Vol. 76, No. 5 0022-538X/02/$04.00 0 DOI: 10.1128/JVI.76.5.2233 2244.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Regional Clustering
More informationUniversity of Massachusetts Medical School Thomas A. Musich University of Massachusetts Medical School
University of Massachusetts Medical School escholarship@umms Open Access Articles Open Access Publications by UMMS Authors 3-14-2015 HIV-1 non-macrophage-tropic R5 envelope glycoproteins are not more tropic
More informationSupplementary information. Early development of broad neutralizing antibodies in HIV-1 infected infants
Supplementary information Early development of broad neutralizing antibodies in HIV-1 infected infants Leslie Goo, Vrasha Chohan, Ruth Nduati, Julie Overbaugh Supplementary Figure 1. Neutralization profile
More informationAIDSVaccine2010 Atlanta, Georgia Willy Bogers. NIH HIVRad Grant nr 5P01AI066287
HIV-1 envelope-cd4 receptor complexes elicit broad T- and B- cell immune responses as well as cross-reactive neutralizing antibodies in Rhesus macaques NIH HIVRad Grant nr 5P01AI066287 AIDSVaccine2010
More informationP G K R P E W M G W L K P R G G A V N Y A R P L Q G R V T M T R D V Y S D T A F
Supplementary Figure 1 VRC01 45-08-110497H 45-08-212510H 45-08-511533H 45-08-541880H Q V Q L V Q S G G Q M K K P G E S M R I S C R A S G Y E F I D C T L N W I R L A CAGGTGCAGCTGGTGCAGTCTGGGGGTCAGATGAAGAAGCCTGGCGAGTCGATGAGAATTTCTTGTCGGGCTTCTGGATATGAATTTATTGATTGTACGCTAAATTGGATTCGTCTGGCC
More informationCEPHIA Consortium for the Evaluation and Performance of HIV Incidence Assays STANDARD OPERATING PROCEDURE
CEPHIA Consortium for the Evaluation and Performance of HIV Incidence Assays STANDARD OPERATING PROCEDURE TITLE : SOP for (off board dilution) Less Sensitive Modified VITROS Enzyme Immunoassay CEPHIA DOCUMENT
More informationCurrent State of HIV Vaccine Development
Current State of HIV Vaccine Development Sandhya Vasan, MD US Military HIV Research Program Henry M. Jackson Foundation Armed Forces Research Institute of Medical Sciences, Bangkok, Thailand AVAC HVAD
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 27 with the sole aim of making
More informationTracing HIV 1 transmission: envelope traits of HIV 1 transmitter and recipient pairs
DOI 10.1186/s12977-016-0299-0 Retrovirology RESEARCH Open Access Tracing HIV 1 transmission: envelope traits of HIV 1 transmitter and recipient pairs Corinna S. Oberle 1,2, Beda Joos 1,2, Peter Rusert
More informationSEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS:
SEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS: POSSIBILITIES OF SEROLOGICAL DIAGNOSIS TYPES OF SEROLOGICAL REACTIONS SEROLOGICAL REACTIONS Ag-Ab reactions used for the detection of unknown Ag or Ab, in vitro
More informationMolecular Evolution of Broadly Neutralizing Llama Antibodies to the CD4-Binding Site of HIV-1
Molecular Evolution of Broadly Neutralizing Llama Antibodies to the CD4-Binding Site of HIV-1 The Harvard community has made this article openly available. Please share how this access benefits you. Your
More informationHVTN Laboratory Program: Immunogenicity and Research Assays
HVTN Laboratory Program: Immunogenicity and Research Assays Erica Andersen-Nissen, PhD Director, Cape Town HVTN Immunology Laboratory Considerations for a Pan-African HIV Vaccine Development Agenda Kigali,
More informationCurr Opin HIV AIDS 4: ß 2009 Wolters Kluwer Health Lippincott Williams & Wilkins X
Impact of host cell variation on the neutralization of HIV-1 in vitro Victoria R. Polonis a, Hanneke Schuitemaker b, Evelien M. Bunnik b, Bruce K. Brown c and Gabriella Scarlatti d a Department of Vaccine
More informationDengue and Zika vaccine development
Dengue and Zika vaccine development Carolyn E. Clark, PhD, MPH Scientist, Infection Control and Environmental Health Norwegian Institute of Public Health Kurs i import- og reisemedisin for helsepersonell
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Acetone and methanol fruit extracts of Terminalia paniculata inhibit HIV-1 infection in vitro Ankita Durge a, Pratiksha Jadaun a, Ashish Wadhwani a, Ashish A. Chinchansure b, Madhukar
More informationCrystallization-grade After D After V3 cocktail. Time (s) Time (s) Time (s) Time (s) Time (s) Time (s)
Ligand Type Name 6 Crystallization-grade After 447-52D After V3 cocktail Receptor CD4 Resonance Units 5 1 5 1 5 1 Broadly neutralizing antibodies 2G12 VRC26.9 Resonance Units Resonance Units 3 1 15 1 5
More informationSupporting Information
Supporting Information Guan et al. 10.1073/pnas.1217609110 Fig. S1. Three patterns of reactivity for CD4-induced (CD4i) mabs. The following representative ELISAs show three patterns of reactivity for CD4i
More informationImmunotypes of a Quaternary Site of HIV-1 Vulnerability and Their Recognition by Antibodies
JOURNAL OF VIROLOGY, May 2011, p. 4578 4585 Vol. 85, No. 9 0022-538X/11/$12.00 doi:10.1128/jvi.02585-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Immunotypes of a Quaternary
More informationMagnitude and Breadth of a Nonprotective Neutralizing Antibody Response in an Efficacy Trial of a Candidate HIV-1 gp120 Vaccine
MAJOR ARTICLE Magnitude and Breadth of a Nonprotective Neutralizing Antibody Response in an Efficacy Trial of a Candidate HIV-1 gp120 Vaccine Peter Gilbert, 1 Maggie Wang, 1 Terri Wrin, 2 Chris Petropoulos,
More informationCarbohydrate-based strategies of antiviral therapeutics
Carbohydrate-based strategies of antiviral therapeutics Prof. Jan Balzarini Rega Institute for Medical Research B-3000 Leuven, Belgium VII Jornadas de la Sociedad Espanola de Química Terapéutica, Sitges,
More informationResults of Pilot NIH Study of Global HIV Variants
Results of Pilot NIH Study of Global HIV Variants SoGAT Blood Virology Meeting Vilnius, Lithuania - 16-17 April 2012 Mark Manak, Ph.D. MHRP, USA The opinions expressed herein are those of the authors and
More informationHIV and Challenges of Vaccine Development
Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health HIV and Challenges of Vaccine Development Richard A. Koup, MD INTEREST
More informationClinical Trials of Pandemic Vaccines: Key Issues. John Treanor University of Rochester Rochester, NY
Clinical Trials of Pandemic Vaccines: Key Issues John Treanor University of Rochester Rochester, NY Inactivated vaccine approach Proven technology Used successfully in 1957 and 1968 Abundant efficacy data
More informationReplicating measles-shiv vaccine induces long term preservation of central memory CD4 cells in the gut of macaques challenged with SHIV89.
Replicating measles-shiv vaccine induces long term preservation of central memory CD4 cells in the gut of macaques challenged with SHIV89.6P Frédéric Tangy Viral Genomics and Vaccination Laboratory Measles
More informationNovel Heterologous Prime-Boost Vaccine Strategies for HIV. Dan Barouch April 18, 2012
Novel Heterologous Prime-Boost Vaccine Strategies for HIV Dan Barouch April 18, 2012 Desired Features of a Next Generation HIV-1 Vaccine Candidate The RV1 study suggests that an HIV-1 vaccine is possible
More informationDEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED
DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED Viv Peut Kent Laboratory, University of Melbourne, Australia WHY ENVELOPE? Env subject to both humoral and cellular immune responses Perhaps
More informationAntibody Dependent Cellular Cytotxic activity: Past and Future. Guido Ferrari, M.D. Duke University Medical Center
Antibody Dependent Cellular Cytotxic activity: Past and Future Guido Ferrari, M.D. Duke University Medical Center Mechanism of Antibody Dependent Cellular Cytotoxicity (ADCC) ADCC Effector Cells (NK, monocytes/macrophages,
More informationISBT WP-TTID Annual Report for Subgroup on Virology Drs. Michael Busch, Kurt Roth and Susan Stramer
ISBT WP-TTID Annual Report for Subgroup on Virology Drs. Michael Busch, Kurt Roth and Susan Stramer Questionnaire on NAT Screening of Blood Donations for an International Forum on 10 years of NAT Screening
More informationBroad and Potent Neutralizing Antibodies from an African Donor Reveal a New HIV-1 Vaccine Target
Broad and Potent Neutralizing Antibodies from an African Donor Reveal a New HIV-1 Vaccine Target Laura M. Walker, 1 * Sanjay K. Phogat, 2 * Po-Ying Chan-Hui, 3 Denise Wagner, 2 Pham Phung, 4 Julie L. Goss,
More informationBispecific Fusion Antibodies. Exhibit 100% Breadth and Picomolar Potency. Craig Pace, PhD
The Aaron Diamond AIDS Research Center Affiliate of The Rockefeller University Bispecific Fusion Antibodies PG9 Ibalizumab & VRC Ibalizumab Exhibit % Breadth and Picomolar Potency Craig Pace, PhD AIDS
More informationSalivary mucinmuc5b inhibits HIV-1 subtype C in an in vitro pseudoviral assay
Salivary mucinmuc5b inhibits HIV-1 subtype C in an in vitro pseudoviral assay Julia Peacocke, Zoe Lotz, Jeffrey R Dorfman 1, Delawir Kahn, Paul Roux 2 and Anwar S Mall* Division of General Surgery and
More informationReceived 24 October 2004/Accepted 11 January 2005
JOURNAL OF VIROLOGY, June 2005, p. 6957 6968 Vol. 79, No. 11 0022-538X/05/$08.00 0 doi:10.1128/jvi.79.11.6957 6968.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. Cryptic Nature
More informationInnate and Cellular Immunology Control of Infection by Cell-mediated Immunity
Innate & adaptive Immunity Innate and Cellular Immunology Control of Infection by Cell-mediated Immunity Helen Horton PhD Seattle Biomedical Research Institute Depts of Global Health & Medicine, UW Cellular
More informationHIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual)
HIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual) BACKGROUND Human Immunodeficiency Virus ( HIV ) can be divided into two major types, HIV type 1 (HIV-1) and HIV type 2 (HIV-2). HIV-1 is related to
More informationHIV-1 Subtypes: An Overview. Anna Maria Geretti Royal Free Hospital
HIV-1 Subtypes: An Overview Anna Maria Geretti Royal Free Hospital Group M Subtypes A (1, 2, 3) B C D F (1, 2) G H J K Mechanisms of HIV-1 genetic diversification Point mutations RT error rate: ~1 per
More informationSupplementary Information for. Heavy chain-only IgG2b-llama antibody effects near-pan HIV-1 neutralization by
Supplementary Information for Heavy chain-only IgG2b-llama antibody effects near-pan HIV-1 neutralization by recognizing a CD4-induced epitope that includes elements of co-receptor- and CD4-binding sites
More informationApplication of μmacs Streptavidin MicroBeads for the analysis of HIV-1 directly from patient plasma
Excerpt from MACS&more Vol 8 1/2004 Application of μmacs Streptavidin MicroBeads for the analysis of HIV-1 directly from patient plasma L. Davis Lupo and Salvatore T. Butera HIV and Retrovirology Branch,
More informationDissecting the Neutralizing Antibody Specificities of Broadly Neutralizing Sera from Human Immunodeficiency Virus Type 1-Infected Donors
JOURNAL OF VIROLOGY, June 2007, p. 6548 6562 Vol. 81, No. 12 0022-538X/07/$08.00 0 doi:10.1128/jvi.02749-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Dissecting the Neutralizing
More information7/14/2014. Multiple immune effector mechanisms contribute to protection influenza. What is a correlate of protection?
What is a correlate of protection? Immunological Assessment of Influenza Vaccines and Correlates of Protection Jacqueline Katz Influenza Division Centers for Disease Control and Prevention Defined immune
More informationTAP HERE TO SEE THE PRODUCT
TAP HERE TO SEE THE PRODUCT Make every testing opportunity count. Acute infection accounts for 5-20% of all cases of HIV infection among persons seeking testing.1 This acute phase of infection is associated
More informationDATA SHEET. Provided: 500 µl of 5.6 mm Tris HCl, 4.4 mm Tris base, 0.05% sodium azide 0.1 mm EDTA, 5 mg/liter calf thymus DNA.
Viral Load DNA >> Standard PCR standard 0 Copies Catalog Number: 1122 Lot Number: 150298 Release Category: A Provided: 500 µl of 5.6 mm Tris HCl, 4.4 mm Tris base, 0.05% sodium azide 0.1 mm EDTA, 5 mg/liter
More informationCBER update and International Collaboration for development of HIV variant panels
CBER update and International Collaboration for development of HIV variant panels Indira K. Hewlett, Ph.D Chief, Laboratory of Molecular Virology DETTD/CBER/FDA XXII SoGAT meeting HIV genetic diversity:
More informationHuman Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set
Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set Catalog Number : SEK11695 To achieve the best assay results, this manual must be read carefully before using this product
More informationNK mediated Antibody Dependent Cellular Cytotoxicity in HIV infections
NK mediated Antibody Dependent Cellular Cytotoxicity in HIV infections Amy Chung Dr. Ivan Stratov Prof. Stephen Kent ADCC process consists of Target cell QuickTime and a TIFF (Uncompressed) FcγR decompressor
More informationEMERGING ISSUES IN THE HUMORAL IMMUNE RESPONSE TO HIV. (Summary of the recommendations from an Enterprise Working Group)
AIDS Vaccine 07, Seattle, August 20-23, 2007 EMERGING ISSUES IN THE HUMORAL IMMUNE RESPONSE TO HIV (Summary of the recommendations from an Enterprise Working Group) The Working Group Reston, Virginia,
More informationPRO140 SC Monotherapy (MT) Provides Long-Term, Full Virologic Suppression in HIV Patients
PRO140 SC Monotherapy (MT) Provides Long-Term, Full Virologic Suppression in HIV Patients Jay Lalezari, Kush Dhody, Ula Kowalczyk, Kazem Kazempour, Nader Pourhassan, and Paul J. Maddon 1 ASM Microbe 2016
More informationBinding of the Mannose-Specific Lectin, Griffithsin, to HIV-1 gp120 Exposes the CD4-Binding Site
JOURNAL OF VIROLOGY, Sept. 2011, p. 9039 9050 Vol. 85, No. 17 0022-538X/11/$12.00 doi:10.1128/jvi.02675-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Binding of the Mannose-Specific
More informationSupporting Information
Supporting Information Horwitz et al. 73/pnas.35295 A Copies ml - C 3NC7 7 697 698 7 7 73 76-2 2 Days Gp2 residue G458D G459D T278A 7/36 N28 K D 28 459 A28T ID# 697 ID# 698 ID# 7 ID# 7 ID# 73 ID# 76 ID#
More information08/02/59. Tumor Immunotherapy. Development of Tumor Vaccines. Types of Tumor Vaccines. Immunotherapy w/ Cytokine Gene-Transfected Tumor Cells
Tumor Immunotherapy Autologous virus Inactivation Inactivated virus Lymphopheresis Culture? Monocyte s Dendritic cells Immunization Autologous vaccine Development of Tumor Vaccines Types of Tumor Vaccines
More informationStudying Repeated Immunization in an Animal Model. Kanta Subbarao Laboratory of Infectious Diseases, NIAID
Studying Repeated Immunization in an Animal Model Kanta Subbarao Laboratory of Infectious Diseases, NIAID Animal models in Influenza Research Commonly used Mice Ferrets Guinea pigs Non human primates Less
More informationHVTN P5 Vaccine Trials
HVTN P5 Vaccine Trials Erica Andersen-Nissen, PhD Director, Cape Town HVTN Immunology Laboratory Considerations for a Pan-African HIV Vaccine Development Agenda Kigali, Rwanda 16-17 March 2015 HVTN Mission
More informationThe Harvard community has made this article openly available. Please share how this access benefits you. Your story matters
Antibody Responses After Analytic Treatment Interruption in Human Immunodeficiency Virus-1- Infected Individuals on Early Initiated Antiretroviral Therapy The Harvard community has made this article openly
More informationReceived 6 May 2011/Accepted 4 August 2011
JOURNAL OF VIROLOGY, Oct. 2011, p. 10529 10541 Vol. 85, No. 20 0022-538X/11/$12.00 doi:10.1128/jvi.05050-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Newcastle Disease Virus
More informationFAO Collaborative Study Phase XVII: Standardisation of FMD Antibody Detection
Appendix 28 FAO Collaborative Study Phase XVII: Standardisation of FMD Antibody Detection D J Paton, R M Armstrong, L S Turner, P A Hamblin, M Corteyn, D Gibson, J Anderson Institute for Animal Health,
More informationHuman B Cell Responses to Influenza Virus Vaccination
Human B Cell Responses to Influenza Virus Vaccination Nucleoprotein (RNA) Influenza Virus Neuraminidase (NA) Hemagglutinin (HA) Enveloped, single-stranded, negative-sense RNA virus with segmented genome.
More informationSEROLOGICAL DIAGNOSIS OF DENGUE INFECTIONS
ECDC training Workshop on laboratory diagnosis of dengue virus infections Berlin, 23 27 January 2012 SEROLOGICAL DIAGNOSIS OF DENGUE INFECTIONS Cristina Domingo Carrasco Robert Koch Institut FACILITIES
More informationEquine Infectious Anemia
Equine Infectious Anemia CJ Issel, DVM, PhD University of Kentucky Gluck Equine Research Center Typical Clinical Course of EIAV Infections Acute Chronic Inapparent 42 10 9 10 8 41 200 Viral RNA log 10
More informationA JOINT CLINICAL RESEARCH CENTER IN THAILAND: ROLE IN HIV VACCINE DEVELOPMENT
SOUTHEAST ASIAN J TROP MED PUBLIC HEALTH A JOINT CLINICAL RESEARCH CENTER IN THAILAND: ROLE IN HIV VACCINE DEVELOPMENT Patricia A Morgan 1,2, Suchada Chinaworapong 1, Jean-Louis Excler 1,2, Siriluck Wongkamheng
More informationTherapeutic Immunization with Autologous DC Pulsed with Autologous Inactivated HIV-1 Infected Apoptotic Cells
Therapeutic Immunization with Autologous DC Pulsed with Autologous Inactivated HIV-1 Infected Apoptotic Cells Sharon A. Riddler, MD, MPH University of Pittsburgh May 2008 Slide 1 HIV and DC Vaccines During
More informationNIH Public Access Author Manuscript Nat Med. Author manuscript; available in PMC 2010 September 1.
NIH Public Access Author Manuscript Published in final edited form as: Nat Med. 2010 March ; 16(3): 319 323. doi:10.1038/nm.2089. Mosaic HIV-1 Vaccines Expand the Breadth and Depth of Cellular Immune Responses
More informationHIV Vaccine. Sunee Sirivichayakul, Ph.D. Faculty of Medicine Chulalongkorn University. August 22, 2014
HIV Vaccine Sunee Sirivichayakul, Ph.D. Faculty of Medicine Chulalongkorn University August 22, 2014 Immunity Natural immunity Active natural immunity e.g., infection Passive natural immunity e.g., trans-placental
More informationHIV: RV 144 prime boost HIV vaccine efficacy study
HIV: RV 144 prime boost HIV vaccine efficacy study Nelson L. Michael, M.D., Ph.D Colonel, Medical Corps, U.S. Army Director US Military HIV Research Program (MHRP) Walter Reed Army Institute of Research
More informationComplicated viral infections
Complicated viral infections Clinical case discussion Diagnostic dilemmas NSW State Reference Laboratory for HIV St Vincent s Hospital Sydney Diagnostic dilemmas Indeterminate or discordant serology (western
More informationCurrent Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a Case Study
Note: I have added some clarifying comments to the slides -- please click on Comments under View to see them. Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a
More informationSex steroid hormone influences replication of major HIV subtypes
Sex steroid hormone influences replication of major HIV subtypes Viswanath Ragupathy, Ph.D CBER/FDA Bethesda, MD st International Workshop on HIV & Women from Adolescence through Menopause Washington DC,
More informationInfection by Discordant Strains of HIV-1 Markedly Enhances the Neutralizing Antibody Response against Heterologous Virus
JOURNAL OF VIROLOGY, Sept. 2010, p. 9415 9426 Vol. 84, No. 18 0022-538X/10/$12.00 doi:10.1128/jvi.02732-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Infection by Discordant
More informationIsolation of a Broadly Neutralizing Antibody with Low Somatic Mutation from a Chronically Infected HIV-1 Patient
Isolation of a Broadly Neutralizing Antibody with Low Somatic Mutation from a Chronically Infected HIV-1 Patient Amanda Fabra García, Carolina Beltrán Pavez, Alberto Merino Mansilla, Cristina Xufré, Isabel
More informationNovel Vaccine Products for Planned Phase I Immunogenicity Studies in Infants
Office of AIDS Research Novel Vaccine Products for Planned Phase I Immunogenicity Studies in Infants L. Jean Patterson, PhD Office of AIDS Research, NIH February 7, 2017 Office of AIDS Research OAR Responsibilities
More informationCrystal structure of the neutralizing antibody HK20 in complex with its gp41 antigen
Crystal structure of the neutralizing antibody HK20 in complex with its gp41 antigen David Lutje Hulsik Unit for Virus Host Cell Interaction UMI 3265 University Joseph Fourier-EMBL-CNRS, Grenoble Env catalyzed
More informationUniversity of Massachusetts Medical School Michael Vaine University of Massachusetts Medical School
University of Massachusetts Medical School escholarship@umms GSBS Student Publications Graduate School of Biomedical Sciences 8-23-2008 Improved induction of antibodies against key neutralizing epitopes
More informationSupplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads
Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads Representative example of comparative ex vivo tetramer enrichment performed in three independent experiments with either conventional
More informationHIV Update in Laboratory Testing. Patricia Slev, PhD, D(ABCC)
HIV Update in Laboratory Testing Patricia Slev, PhD, D(ABCC) Objectives Explain the advances in HIV diagnostics, including fourth generation Ag/Ab combination HIV screening assays Describe the new CDC
More informationInternational Technology Transfer of a GCLP-Compliant HIV-1 Neutralizing Antibody Assay for Human Clinical Trials
International Technology Transfer of a GCLP-Compliant HIV-1 Neutralizing Antibody Assay for Human Clinical Trials Daniel A. Ozaki 1., Hongmei Gao 1., Christopher A. Todd 1, Kelli M. Greene 1, David C.
More informationGOVX-B11: A Clade B HIV Vaccine for the Developed World
GeoVax Labs, Inc. 19 Lake Park Drive Suite 3 Atlanta, GA 3 (678) 384-72 GOVX-B11: A Clade B HIV Vaccine for the Developed World Executive summary: GOVX-B11 is a Clade B HIV vaccine targeted for use in
More informationHIV-specific humoral responses benefit from stronger prime in phase Ib clinical trial
The Journal of Clinical Investigation Clinical Medicine HIV-specific humoral responses benefit from stronger prime in phase Ib clinical trial Pierre-Alexandre Bart, 1,2,11 Yunda Huang, 3,11 Shelly T. Karuna,
More informationJOURNAL OF VIROLOGY, Oct. 1999, p Vol. 73, No. 10. Copyright 1999, American Society for Microbiology. All Rights Reserved.
JOURNAL OF VIROLOGY, Oct. 1999, p. 8201 8215 Vol. 73, No. 10 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Role of Immune Responses against the Envelope
More informationIdentification and Characterization of CD4 T cells actively transcribing HIV RNA in Peripheral Blood
Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Identification and Characterization of CD4 T cells actively transcribing
More informationHigher priming doses enhance HIV-specific humoral but not cellular. responses in a randomized, double-blind phase Ib clinical trial of
Higher priming doses enhance HIV-specific humoral but not cellular responses in a randomized, double-blind phase Ib clinical trial of preventive HIV-1 vaccines Pierre-Alexandre Bart a,b, Yunda Huang c,
More informationA Path to an HIV Vaccine: GSID Consortium Activities. Faruk Sinangil, PhD 4th Annual CAVD Meeting Miami, FL December 1-4, 2009
A Path to an HIV Vaccine: GSID Consortium Activities Faruk Sinangil, PhD 4th Annual CAVD Meeting Miami, FL December 1-4, 2009 Project Goals Acquire and disseminate information that will contribute to the
More informationHIV-1 subtype C in Karonga District, Malawi. Simon Travers
HIV-1 subtype C in Karonga District, Malawi Simon Travers HIV-1; closely related to HIV found in chimps HIV-2; closely related to HIV found in mangabys Worldwide Distribution of HIV-1 group M subtypes
More information4/14/2016. HIV Vaccines and Immunoprotection: Where Are We? Learning Objectives. After attending this presentation, participants will be able to:
HIV Vaccines and Immunoprotection: Where Are We? Mark J. Mulligan, MD, FIDSA Distinguished Professor of Medicine Emory University School of Medicine Atlanta, Georgia FINAL: 04/01/16 Atlanta, Georgia: Friday,
More information