Mitochondrial mutagenesis induced by tumor-specific radiation bystander effects

Transcription

1 J Mol Med (2010) 88: DOI /s ORIGINAL ARTICLE Mitochondrial mutagenesis induced by tumor-specific radiation bystander effects Sheeona Gorman & Edward Fox & Diarmuid O Donoghue & Kieran Sheahan & John Hyland & Hugh Mulcahy & Lawrence A. Loeb & Jacintha O Sullivan Received: 28 October 2009 / Revised: 22 January 2010 / Accepted: 25 February 2010 / Published online: 28 March 2010 # Springer-Verlag 2010 Abstract The radiation bystander effect is a cellular process whereby cells not directly exposed to radiation display cellular alterations similar to directly irradiated cells. Cellular targets including mitochondria have been postulated to play a significant role in this process. In this study, we utilized the Random Mutation Capture assay to quantify the levels of random mutations and deletions in the mitochondrial genome of bystander cells. A significant increase in the frequency of random mitochondrial mutations was found at 24 h in bystander cells exposed to conditioned media from irradiated tumor explants (p= 0.018). CG:TA mutations were the most abundant lesion induced. A transient increase in the frequency of random mitochondrial deletions was also detected in bystander cells exposed to conditioned media from tumor but not normal tissue at 24 h (p=0.028). The increase in both point mutations and deletions was transient and not detected at 72 h. To further investigate mitochondrial dysfunction, mitochondrial membrane potential and reactive oxygen species were assessed in these bystander cells. There was a significant reduction in mitochondrial membrane potential and this was positively associated with the frequency of random point mutation and deletions in bystander cells Sheeona Gorman and Edward Fox contributed equally to this work. S. Gorman : E. Fox : D. O Donoghue : K. Sheahan : J. Hyland : H. Mulcahy : J. O Sullivan (*) Centre for Colorectal Disease, St. Vincent s University Hospital, Elm Park, Dublin 4, Ireland jacintha.osullivan@ucd.ie E. Fox : L. A. Loeb Joseph Gottstein Memorial Laboratory, Department of Pathology, University of Washington, Seattle, WA 98195, USA treated with conditioned media from tumor tissue (r=0.71, p=0.02). This study has shown that mitochondrial genome alterations are an acute consequence of the radiation bystander effect secondary to mitochondrial dysfunction and suggests that this cannot be solely attributable to changes in ROS levels alone. Keywords Radiation bystander. Mitchondrial genome. Random mutations. Reactive oxygen species. Mitochondrial membrane potential Introduction The radiation-induced bystander effect is a biological phenomenon whereby cells not directly exposed to radiation exhibit cellular responses similar to those of neighboring, directly irradiated cells [1, 2]. These non-irradiated cells respond to signals produced by irradiated cells in what has been termed a bystander effect. These bystander cells may be immediately adjacent or anatomically distant from the exposed cells. The radiation bystander effect has been shown to cause apoptosis [1, 3], mitochondrial dysfunction [4, 5], DNA damage [6, 7] and enhanced mutagenesis [8, 9], with the potential to ultimately lead to oncogenic transformation [10]. The induction of bystander effects in neighboring cells is not limited to radiation but appears to be a more general phenomena induced by processes including persistent DNA damage [11], chemotherapeutic or chemical insult [12 14], and thermal injury [15, 16]. Experiments using microbeams to target radiation to specific subregions of cells have even shown that direct nuclear DNA damage of an irradiated cell is not required to trigger a bystander response [17]. Therefore, it has been proposed that subcellular targets

2 702 J Mol Med (2010) 88: such as mitochondria could play an important role, either as direct targets for the production of bystander signals or as parts of a signal transduction mechanism [18, 19]. This may involve the direct release of reactive oxygen species (ROS) in response to direct irradiation or indirect triggering of cytochrome c release owing to changes in mitochondrial membrane permeability. There is also evidence to suggest that the mitochondrial genome of the bystander cell itself may be central in bystander signaling, as cells deficient in mitochondrial DNA show a significantly reduced response to bystander signaling [19]. So far, only clonal alterations have been detected in the mitochondrial genome of bystander cells maintained in tissue culture [4]. Radiation-induced bystander responses have been observed in a range of cell types, tissue models and in vivo. To facilitate the study of the radiation bystander effect using an ex vivo system, we have recently described a human colorectal tumor explant model which maintains the three dimensional architecture of the tissue and incorporates the entire tumor micro-environment [20]. Using this system, we have shown that radiation and chemotherapy bystander effects induce telomere length shortening and bridge formations coupled with mitochondrial dysfunction. Here, we examined the effect of the radiation bystander response on the frequency of random mitochondrial genome alterations using the recently developed Random Mutation Capture (RMC) assay [21, 22] which allows the quantification of point mutations and deletions in the mitochondrial genome at single molecule resolution. Materials and methods Ex vivo explant culture Resected tumor and matching normal adjacent mucosa was obtained from seven patients from the Centre for Colorectal Disease s explant tissue bio-bank in St Vincent s University Hospital, Dublin (four male, three female, median age 69). Explant tissue was cut into 12 equal-sized pieces of approximately 5 mm 3 allowing each treatment (described below) to be performed in duplicate. Tumor and matched normal explant tissue were cultured in 5 ml RPMI 1640 containing 100 U/ml Penicillin, 100 µg/ml Streptomycin, 4 µg/ml Fungizone and supplemented with 20% fetal bovine serum in six-well plates for 24 h prior to treatment. Radiation treatments and media transfer Figure 1 shows the schematic of the experimental design. Tumor and matched normal tissue were treated with 0 or 2 Gy radiation. The clinically relevant 2-Gy dose was administered at room temperature using a cobalt-60 teletherapy unit in St Luke s Hospital, Dublin, delivering approximately 0.8 Gy/min. Culture Media was removed from the untreated and treated explant tissue following 24 h and filtered through a 0.2-µm filter (Nalgene, Rochester, NY) to remove any floating cells and cellular debris. This conditioned media was incubated on bystander SW480 (American Type Culture Collection) cells for either 24 or 72 h at 37 C cultured in RPMI 1640 medium and supplemented with 10% fetal bovine serum and 50 U/ml penicillin, 50 µg/ml streptomycin, 4 µg/ml fungizone in an atmosphere of 5% CO 2. Passage number 4 for SW480 cells was used for all experiments in this study. MtDNA extraction All bystander cell pellets were blinded and then digested with Proteinase K (Sigma, at a final concentration of 0.2 mg/ml) in 10 mm Tris HCl, ph 8.0, 150 mm NaCl, 20 mm EDTA, 0.5% SDS buffer. Samples were incubated at 55 C for 3 h, RNaseA (Fermentas) was added to hydrolyze the RNA to a final concentration of 30 ng/ml. DNA was isolated by phenol chloroform isoamyl extraction, followed by ethanol precipitation [23]. Phenol chloroform isoamyl alcohol (25:24:1 by volume, Invitrogen) was added in a 1:1 ratio with the lysis reaction, mixed thoroughly by shaking, and centrifuged for 20 min at 13,000 rpm. The aqueous phase was gently removed from the top of the solution, without disturbing the interphase. The aqueous solution was mixed again with phenol chloroform isoamyl alcohol in a 1:1 ratio, and the extraction repeated. A 1:20 volume to volume ratio of 3 M sodium acetate was added to the final extract, and the sample precipitated with 100% ethanol. The DNA sample was then resuspended in 10 mm Tris Cl. αtaqi digestion DNA digestion was carried out in 100 μl reactions that contain 100 units of αtaqi New England Biosciences), 100 mm NaCl, 10 mm Tris HCl, 1 BSA, and 10 mm MgCl 2.The DNA samples were exhaustively digested with an additional 100 units of αtaqi added to the reaction mixture every hour, for 10 h, to replenish any enzyme inactivated due to extended incubation. Incomplete digestion by αtaqi results in false positive PCR amplification of DNA molecules that do not contain a mutation in the αtaqi restriction site [24]. Quantitative PCR Terminal dilution to identify digestion-resistant, mutant molecule PCR was carried out in 25 μl reactions, containing 12.5 μl 2 SYBR Green Brilliant Mastermix (Agilent Technologies), 0.2 μl UDG (New England Biosciences),

3 J Mol Med (2010) 88: Fig. 1 Schematic of experimental design. Tumor and matching normal explants were exposed to 0 (untreated) or 2 Gy of radiation and incubated at 37 C for 24 h (1). Conditioned media from these cultures were then transferred to bystander SW480 cells and incubated for 24 or 72 h (2). These bystander cells were then analyzed for levels of mitochondrial random mutations and deletions (3) and mitochondrial dysfunction was assessed by measuring mitochondrial membrane potential and the levels of reactive oxygen species (4) 2 μl of 10 pm/μl forward and reverse primers (IDT), and 3.3 μl H 2 O. The samples were amplified on a Roche Lightcycler 480 or MJ Research Opticon 2 as follows: 37 C for 10 min and 95 C for 10 min followed by 45 cycles of 95 C for 15 s, 60 C for 1 min. Samples were held at 72 C for 7 min and then immediately stored at 20 C. The primer sequences used were as follows: for mitochondrial DNA copy number: 5'-acagtttatgtagcttacctcc-3' and 5'-ttgct gcgtgcttgatgcttgt-3'; for random mutations: 5'-cctcaacagt taaatcaacaaaactgc-3' and 5'-gcgcttactttgtagccttca-3'; and for random deletions: 5'-taccgtatggcccaccataattaccc-3' and 5'-att cctgctaatgctaggctgcca-3'. All PCR products were (1) incubated with αtaqi and verified by agarose gel electrophoresis to be insensitive to digestion and (2) sequenced to identify the mutation at the αtaqi recognition site (UW High Throughput Sequencing facility, Seattle, USA). All the mutations identified by the RMC assay occur at a single 5'-TCGA-3' sequence, located at base pairs 1216 to 1220 of the mitochondrial genome. Mitochondrial membrane potential Bystander cells were seeded on glass cover slips (100,000 cells) and incubated with conditioned media from 2 Gy treated and untreated tumor tissue for 6 h. Conditioned media was removed and cells washed twice with a buffer containing 130 mm NaCl, 5 mm KCl, 1 mm Na 2 HPO 4, 1 mm CaCl 2, 1 mm MgCl 2, and 25 mm Hepes (ph 7.4). Cells were loaded with 5 µm rhodamine 123 (Sigma) for 30 min in the buffer at 37 C. Cells were washed three times with the above buffer and then analyzed using a confocal microscope (Zeiss LSM 510 META). Rhodamine 123 was excited at 488 nm, and fluorescence emission at 525 nm was recorded. Mean fluorescence values from ten random fields for each condition were obtained using Image J software. Measurement of reactive oxygen species Bystander cells were seeded on glass cover slips (100,000 cells) and incubated with conditioned media from 2 Gy treated and untreated tumor tissue for 6 h. Conditioned media was removed and cells washed twice with a buffer containing 130 mm NaCl, 5 mm KCl, 1 mm Na 2 HPO 4, 1 mm CaCl 2, 1 mm MgCl 2, and 25 mm Hepes (ph 7.4). Cells were loaded with 5 µm 2,7-dichlorofluorescein diacetate (Sigma) for 30 min in the buffer at 37 C. Cells were washed three times with the above buffer and then analyzed using a confocal microscope (Zeiss LSM 510 META). 2,7-Dichlorofluorescein diacetate was excited at 488 nm and fluorescence emission at 525 nm was recorded. Mean fluorescence values from ten random fields for each condition were obtained using Image J software. Statistical analysis Data are presented as medians and interquartile ranges. Data were assessed using Wilcoxon s signed rank test. Correla-

4 704 J Mol Med (2010) 88: tions were assessed with the Spearman Rank Correlation. All p values are two-sided and p values less than 0.05 were considered statistically significant in all analyses. Results Random mitochondrial point mutations and deletions Figure 2 shows the observed frequencies of random point mutations in bystander cells 24 and 72 h after incubation with conditioned media from 0 and 2 Gy treated normal tissue (a) and tumor tissues from the same individual (b). Media from irradiated normal tissue caused an increase in the frequency of mitochondrial point mutations but this was not statistically significant. A statistically significant increase in the frequency of random mitochondrial mutations was observed at 24 h in cells exposed to conditioned medium from irradiated tumor tissue (p=0.018). The increase in mitochondrial point mutations was transient and not observed at 72 h. The levels of mutations in parental SW480 cells showed no significant difference to the levels of mutations induced by SW480 cells exposed to conditioned media from 0 Gy irradiated tissue. Furthermore, irradiated media (including serum) only incubated on the bystander SW480 cells did not induce mitochondrial mutations and cellular alterations. Mutations at purine residues were the most abundant random mutation in bystander cells exposed to conditioned media from both irradiated normal and tumor tissue (Fig. 3). CG:TA transitions, in particular, were increased in these cells, however they were most markedly elevated in bystander cells exposed to conditioned media from irradiated tumor tissue (Fig. 3b) and largely account for the overall difference in mutation frequency between normal and tumor bystander cells. The frequency of random deletion was quantified using primers that span a sequence of 5,102 nucleotides which includes the common deletion [25]. The point mutations were all somatic and occurred within a single 4-bp sequence (TCGA) located at chrm: (Cambridge reference sequence AC_ ). This 4- base-pair site examined lies within the mitochondrial 12S ribosomal RNA gene. Media from irradiated normal tissue caused an increase in the frequency of mitochondrial deletions but, as with the increase in point mutations, this was not statistically significant (Fig. 4a). A statistically significant increase in the frequency of random mitochondrial deletions was seen for bystander cells exposed to conditioned media from irradiated tumor tissue at 24 h (p=0.028). This increase was not found 72 h after exposure (Fig. 4b). Sequencing of the breakpoints of the deletion molecules revealed that the vast majority of deletions occurred between direct repeats within the mitochondrial genome (Table 1). Mitochondrial dysfunction in bystander cells Fig. 2 Frequency of random mitochondrial point mutations in bystander cells. Cells were exposed to conditioned media from unirradiated and irradiated normal and tumor explants for 24 or 72 h. Random mitochondrial mutations were assayed by single molecule PCR after exhaustive digestion of a single TaqI site within mitochondrial 12S ribosomal gene. The frequency given is calculated per basepair (bp). A statistically significant, but transient, increase in the frequency of random mitochondrial mutations was found specifically in bystander cells exposed to conditioned media from irradiated explant tumor tissue (p=0.018) To determine the direct consequences of the bystander effect on mitochondrial function we next measured changes in the levels of reactive oxygen species and the extent of depolarization of the mitochondrial membrane. Bystander cells exposed to conditioned media from a 2-Gy treated tumor and normal tissue showed an increase in ROS levels; however, this was not statistically significant in either case (Fig. 5). The frequency of mitochondrial point mutations correlated significantly with the levels of reactive oxygen species in cells exposed to conditioned medium from unirradiated normal (p=0.004). The fold changes of random point mutation frequencies and the ROS levels correlated positively for bystander cells treated with conditioned media from normal tissue (r=0.857, p=0.014) but negatively for bystander cells treated with conditioned media from tumor tissue (r= 0.857, p=0.014). Figure 6 shows representative images of mitochondrial membrane staining with rhodamine 123 fluorescent dye in bystander cells following incubation with conditioned media from untreated tumor (0 Gy) and 2 Gy treated tissue (b). Bystanders cells exposed to conditioned media from a 2-Gy irradiated tumor and matched normal tissue displayed a significant reduction in rhodamine staining intensity

5 J Mol Med (2010) 88: Fig. 3 Spectrum of random mitochondrial point mutations identified in bystander cells at 24 h. Sequencing of all mutants recovered from bystander cells at 24 h showed transitions occurring at purines to be the most common mutation (a). CG:TA transitions were most highly indicating depolarization of the mitochondrial membrane potential relative to control bystander cells (p values 0.012). Furthermore, mitochondrial membrane depolarization was positively associated with the frequencies of random point mutation and deletions in bystander cells treated with conditioned media from tumor tissue (r=0.71, p=0.02). Discussion This is the first report using the newly validated mitochondrial RMC assay to quantitatively evaluate alterations of the Fig. 4 Frequency of random mitochondrial deletions in bystander cells. Mitochondrial deletions that resulted in the deletion of TaqI restriction sites between basepair positions 8384 and of the mitochondrial genome, were identified by single molecule amplification. The frequency of random deletions was increased only in bystander cells exposed to conditioned media from irradiated tumor tissue and only at 24 h (p=0.028). All deletion breakpoints were subsequently confirmed by sequencing elevated in cells exposed to conditioned media from irradiated tumor tissue (b). Unfilled bars represent bystander cells exposed to conditioned media from unirradiated tissue; filled bars represent bystander cells exposed to conditioned media from irradiated tissue mitochondrial genome induced by the radiation bystander effect in a tissue explant model. We have demonstrated that there is a rapid and transient increase in the frequency of random mitochondrial point mutations and deletions after exposure to conditioned medium from ex vivo irradiated tumor tissue. The transient increase in random point mutations and deletions was observed only in bystander cells treated with conditioned media from irradiated tumor tissue. With treated normal cells, there was an increase but it was less than significant. Possibly, this may be due to the phenotype of the cells and maybe a time dependent process, probably at a later time point the levels of the mutations induced from normal irradiated tissue may reach significance. The spectrum of random point mutations observed in the samples were predominantly transitions at purine residues, is consistent with that associated with oxidative damage [21] and with the spectrum of nuclear mutations induced by the radiation bystander effect [6]. The frequency of mitochondrial point mutations correlated significantly with the levels of ROS in cells exposed to conditioned medium from unirradiated normal (p=0.004), suggesting that the background mitochondrial point mutation frequency of normal tissue is associated with ROS levels. There was, however, an inverse correlation between ROS levels and frequency of random point mutations in bystander cells treated with conditioned media from irradiated tumor tissue (r= 0.857, p=0.014). Thus, the increase in random mitochondrial genome alterations, induced by the bystander effect, is likely to be mediated by factors in addition to those associated with the generation of reactive oxygen. Therefore, the marked increase in random mitochondrial mutation frequency in bystander cells treated with conditioned media from irradiated cells is due, at least in part to events other that the observed increase in the levels of ROS. Differences exist between the bystander effect produced by

6 706 J Mol Med (2010) 88: Table 1 Characteristics of mitochondrial deletions Deletion size (bp) Breakpoint location a Breakpoint sequence Homology (bp) b % Observed :13447 actaccacct ACCTCCCTCACCATTGGCAGC :13419 ttaaacacaa ACTACTCAAAACC :13430 ataattaccc CCATACCTCTCACT :13460 tacactattc TTGGCAGCCT 0 <1 a Basepair positions are according to the Revised Cambridge Sequence (NC_012920) b Basepairs of sequence homology flanking the deletion site are given in bold normal and tumor explants. The more marked membrane depolarization observed for bystander cells treated with conditioned medium from irradiated normal explants further demonstrates, for example, that the nature of the mitochondrial response in bystander cells appears to be dependent on the phenotype of the irradiated cells. We have previously shown rapid mitochondrial membrane depolarization is induced by the radiation bystander effect [20]. In this study, all bystander samples exposed to conditioned media from irradiated explant tumor tissue showed an increase in the frequency of random point mutations at 24 h and as well as demonstrating a collapse in mitochondrial membrane potential by 6 h. Such an association was not seen using conditioned media from irradiated normal tissue. We found a similar increase in the frequency of random mitochondrial deletions in bystander cells exposed to conditioned medium from irradiated tumor tissue (Fig. 4). Fig. 5 ROS levels in bystander cells. Representative images of 2,7- dichlorofluorescein diacetate staining (a). While ROS levels in bystander cells exposed to media from irradiated tumor and matched normal tissue were increased, this did not reach significance in either case (b) Fig. 6 Mitochondrial membrane potential. Images showing mitochondrial membrane potential in bystander cells exposed to either 0 or 2 Gy conditioned media from tumor (upper panels) and normal tissue (lower panels; a). A significant decrease in mitochondrial membrane potential in bystander cells exposed to either 2 Gy conditioned media from irradiated tumors and matched normal tissue was observed (both p=0.012; b). Magnification size bar 10

7 J Mol Med (2010) 88: A similar but semi-quantitative increase in the frequency of one particular mitochondrial genome deletion induced by the radiation bystander effect has been previously described [4]. Sequence analysis of the deletion breakpoints described here shows that random deletions occurred predominantly at direct repeats consistent with repair by a homologydriven mechanism or mitochondrial fusion events [26]. The bystander cells exposed to irradiated tumor tissue showed an increase in the frequency of random deletions at 24 h, and had reduced mitochondrial membrane potential; however, the frequency of these random mitochondrial deletions did not appear to be correlated with alterations in the levels of reactive oxygen species. A link between the radiation bystander effect and nuclear instability has been well established [7]. Here, we demonstrated that following the collapse in the mitochondrial membrane potential, a pronounced instability in the mitochondrial genome is induced independent of oxidative stress. Mitochondrial dysfunction has recently been shown to lead to nuclear instability via an iron sulfur cluster defect [27]. A similar process may underlie the mitochondrial instability described here, whereby radiation bystander signaling induces acute mitochondrial dysfunction which in turn results in an iron sulfur defect and DNA instability. While we show a marked increase in mitochondrial mutagenesis in bystander cells after treatment bystander cells treated with conditioned media from irradiated ex vivo tumor tissue, we recognize our study has certain limitation. While we found a spectrum of random point mutations consistent with that secondary to damage caused by reactive oxygen species, this may in part represent a restriction bias of the αtaqi restriction enzyme (data not shown). Establishing a version of the assay using other restriction enzymes would then allow possible restriction bias to be addressed. Additionally, while 2,7-dichlorofluorescein diacetate is widely used to quantify ROS levels, it may underestimate the contribution of certain reactive oxygen species, for example superoxide, therefore correlations between ROS levels and random mutation frequencies presented here may not be absolute. In examining the sequence characteristics of the random deletion breakpoints observed, it is important to note that the design of the deletion assay used permitted only a subset of mitochondrial genome alterations to be identified and is inherently biased towards detecting deletions involving the bp repeat. The deletions identified may not therefore correlate with the distribution of random deletions throughout the mitochondrial genome. Despite these limitations, the random mutation assay offers a sensitivity for detecting random mitochondrial genome alterations which cannot be currently achieved by any other assay. The mitochondrial genome and the damage it accumulates provide a useful marker of the effects of many stress factors and disease types. The damage itself can however also potentially have functionally effects. While the direct involvement of mitochondrial genome alterations to oncogenic transformation is still debated [28] their role in the acquisition of metastatic potential [29] resistance to chemotherapy [30] and apoptosis [31] in certain tumor types has been clearly demonstrated. Here, we extend such analysis to characterize the effect of the radiation bystander response on mitochondrial genome stability using an ex vivo tissue explant system. This data further implicates mitochondrial genome alterations as an acute consequence of the radiation bystander effect secondary to mitochondrial dysfunction and suggests that this may be not be solely attributable to changes in ROS levels alone. The bystander effect is not limited to radiation but appears to occur in a variety of other cellular stress mechanisms and thus the mitochondrial mutations we observe may be a marker of other stress related phenomena. While conditioned media from both irradiated tumor and normal tissue resulted in an increase the random mitochondrial mutation frequency, this effect was more pronounced with bystander media from explant tumor tissue. This, we believe to be the most significant finding of the paper. The cellular stress response captured by these dynamic changes in the mitochondria genome of bystander cells, while not tumor-specific, is potentiated by the malignant phenotype. Given that radiation is used in a neoadjuvant and not adjuvant setting for rectal cancer, we believe this result may be potentially of clinical significance. Acknowledgements and disclosure statement The authors would like to thank Peter McLoone and Gemma McConnell for assisting with the Cobalt 60 irradiations in St Luke s Hospital. The authors declare they have no conflict of interest. Grant support This work was supported by the Irish Health Foundation (J.O'S.), the Health Research Board JRFC05-01 (E.F.) and a grant from the US NCI CA (L.A.L.) References 1. Prise KM, Belyakov OV, Folkard M, Michael BD (1998) Studies of bystander effects in human fibroblasts using a charged particle microbeam. Int J Radiat Biol 74(6): Mothersill C, Seymour C (2001) Radiation-induced bystander effects: past history and future directions. Radiat Res 155(6): Lyng FM, Seymour CB, Mothersill C (2000) Production of a signal by irradiated cells which leads to a response in unirradiated cells characteristic of initiation of apoptosis. Br J Cancer 83 (9): Murphy JE, Nugent S, Seymour C, Mothersill C (2005) Mitochondrial DNA point mutations and a novel deletion induced by direct low-let radiation and by medium from irradiated cells. Mutat Res 585(1 2): Maguire P, Mothersill C, Seymour C, Lyng FM (2005) Medium from irradiated cells induces dose-dependent mitochondrial

8 708 J Mol Med (2010) 88: changes and BCL2 responses in unirradiated human keratinocytes. Radiat Res 163(4): Huo L, Nagasawa H, Little JB (2001) HPRT mutants induced in bystander cells by very low fluences of alpha particles result primarily from point mutations. Radiat Res 156(5 Pt 1): Nagasawa H, Little JB (1992) Induction of sister chromatid exchanges by extremely low doses of alpha-particles. Cancer Res 52(22): Morgan WF, Hartmann A, Limoli CL, Nagar S, Ponnaiya B (2002) Bystander effects in radiation-induced genomic instability. Mutat Res 504(1 2): Hall EJ, Hei TK (2003) Genomic instability and bystander effects induced by high-let radiation. Oncogene 22(45): Lewis DA, Mayhugh BM, Qin Y, Trott K, Mendonca MS (2001) Production of delayed death and neoplastic transformation in CGL1 cells by radiation-induced bystander effects. Radiat Res 156(3): Rodier JF, Dupret A, Weitbruch D, Volkmar PP, Wilt M, Petit T (2009) Prevalent metastatic axillary lymphadenopathy from ovarian cancer: A diagnostic pitfall. J Chir (Paris) 146(2): Demidem A, Morvan D, Madelmont JC (2006) Bystander effects are induced by CENU treatment and associated with altered protein secretory activity of treated tumor cells: a relay for chemotherapy? Int J Cancer 119(5): Rugo RE, Almeida KH, Hendricks CA, Jonnalagadda VS, Engelward BP (2005) A single acute exposure to a chemotherapeutic agent induces hyper-recombination in distantly descendant cells and in their neighbors. Oncogene 24(32): Asur RS, Thomas RA, Tucker JD (2009) Chemical induction of the bystander effect in normal human lymphoblastoid cells. Mutat Res 676(1 2): Dabrowska A, Gos M, Janik P (2005) "Bystander effect" induced by photodynamically or heat-injured ovarian carcinoma cells (OVP10) in vitro. Med Sci Monit 11(9): Purschke M, Laubach HJ, Anderson RR, Manstein D (2009) Thermal injury causes DNA damage and lethality in unheated surrounding cells: active thermal bystander effect. J Invest Dermatol 130: Shao C, Folkard M, Michael BD, Prise KM (2004) Targeted cytoplasmic irradiation induces bystander responses. Proc Natl Acad Sci USA 101(37): Nugent SM, Mothersill CE, Seymour C, McClean B, Lyng FM, Murphy JE (2007) Increased mitochondrial mass in cells with functionally compromised mitochondria after exposure to both direct gamma radiation and bystander factors. Radiat Res 168 (1): Tartier L, Gilchrist S, Burdak-Rothkamm S, Folkard M, Prise KM (2007) Cytoplasmic irradiation induces mitochondrial-dependent 53BP1 protein relocalization in irradiated and bystander cells. Cancer Res 67(12): Gorman S, Tosetto M, Lyng F et al (2009) Radiation and chemotherapy bystander effects induce early genomic instability events. Telomere shortening and bridge formation coupled with mitochondrial dysfunction. Mutat Res 669(1 2): Vermulst M, Bielas JH, Kujoth GC et al (2007) Mitochondrial point mutations do not limit the natural lifespan of mice. Nat Genet 39(4): Vermulst M, Wanagat J, Kujoth GC et al (2008) DNA deletions and clonal mutations drive premature aging in mitochondrial mutator mice. Nat Genet 40(4): Fred M. Ausubel RB, Robert E. Kingston, David D. Moore, J.G. Seidman, John A. Smith, Kevin Struhl (2002) Current protocols in molecular biology. Chanda VB, editor: Wiley 24. Vermulst M, Bielas JH, Loeb LA (2008) Quantification of random mutations in the mitochondrial genome. Methods 46(4): Holt IJ, Harding AE, Morgan-Hughes JA (1988) Deletions of muscle mitochondrial DNA in patients with mitochondrial myopathies. Nature 331(6158): Kaguni LS (2004) DNA polymerase gamma, the mitochondrial replicase. Annu Rev Biochem 73: Veatch JR, McMurray MA, Nelson ZW, Gottschling DE (2009) Mitochondrial dysfunction leads to nuclear genome instability via an iron-sulfur cluster defect. Cell 137(7): Greaves LC, Mathers JC, Taylor RW, Turnbull DM (2009) Modelling mitochondrial DNA mutations in bacterial cytochrome c oxidase: link to colon cancer? Proc Natl Acad Sci USA 106(22):E Ishikawa K, Takenaga K, Akimoto M et al (2008) ROS-generating mitochondrial DNA mutations can regulate tumor cell metastasis. Science 320(5876): Mizutani S, Miyato Y, Shidara Y et al (2009) Mutations in the mitochondrial genome confer resistance of cancer cells to anticancer drugs. Cancer Sci 100(9): Kulawiec M, Owens KM, Singh KK (2009) Cancer cell mitochondria confer apoptosis resistance and promote metastasis. Cancer Biol Ther 8(14):