DMD Genetics: complicated, complex and critical to understand

Size: px
Start display at page:

Download "DMD Genetics: complicated, complex and critical to understand"

Transcription

1 DMD Genetics: complicated, complex and critical to understand Stanley Nelson, MD Professor of Human Genetics, Pathology and Laboratory Medicine, and Psychiatry Co Director, Center for Duchenne Muscular Dystrophy UCLA

2 Duchenne is an X linked recessive DMD: X-linked recessive, genetic lethal in males and overall frequency not changing

3 Human Genome 3 billion letters (GATC) ~24,000 genes ~ Gene for Duchenne/Becker Muscular Dystrophy identified ~5,000 Different Genetic Diseases known

4 DMD Gene Found in 1986 (Kunkel) Improved diagnosis and counseling Provided insight into Duchenne and Becker Suggested therapeutic strategies Gene therapy Exon skipping Utrophin upregulation

5 LARGEST GENE, Discovered in 1986, 79 exons

6 LARGEST GENE, Discovered in 1986, 79 exons

7 Dystrophin Protein domains

8 Normal Muscle Dystrophin

9 Muscle fibers contain myofibrils, which are bundles of myofilaments.

10 Dystrophin is an essential part of a large protein complex at the muscle membrane

11 Duchenne Muscular Dystrophy Dystrophin at the Muscle Membrane dystrophin hematoxylin and eosin staining unaffected DMD

12 Identification of DMD gene mutations proved that both Duchenne and Becker muscular dystrophy are caused by mutations in DMD Duchenne MD Becker Muscular Dystrophy

13 Western Blot in DMD and BMD Normal dystrophin MW = 427 kda DMD No dystrophin seen BMD Smaller dystrophin protein observed MWs differ in patients from different families Thompson & Thompson,

14 Histology and Dystrophin staining in DMD and BMD Muscle Normal BMD H&E Duchenne: increased connective tissue and leukocytes Dystrophin Normal: localized to myocyte membrane Becker: present but reduced Duchenne: completely absent DMD

15 DMD gene is LARGE. 79 EXONS Exon Frame Map of the Dystrophin gene Genetics of DMD and BMD

16 More Severe or typical Duchenne: OUT OF FRAME DNA MUTATION Genetics of DMD and BMD

17 SEVERE DISEASE: Because the end of the protein is not made Genetics of DMD and BMD

18 MILDER DISEASE= IN FRAME MUTATION Genetics of DMD and BMD

19 MILDER DISEASE= IN FRAME MUTATION Because the end of the protein is made Genetics of DMD and BMD

20

21 DNA: CTGAGCCAACTATTGATGAA RNA: c CUGAGCCAACUAUUGAUGAA CODE: CUG AGC CAA CUA UUG AUG AA Protein LSQLLM

22

23 Most mutations are in exons and are deletions Magri, et al 2010 J. Neuro

24 Single exon skipping relevance (Flanigan, et al 2009

25 Modest differences in age at loss of walking with different deletions Exon 44 skippable/others Exon 45 skippable/others R. Wang, Duchenne Connect Data, 2014

26 Small mutations

27 Dystrophin Protein domains

28 Different types of dystrophin protein are made from the DMD gene E30 e45 e51 e56 e63

29 New Diagnostic technique: Combination of RNA_SEQ and Whole Genome Sequencing for DMD mutation identification No expression after exon37

30 Assembly of RNA-Seq reads Pulled out all reads matching the end of DMD exon 37 (red) and assembled using Velvet BLAT of resulting contig showed intron 37 joined to intergenic region 5Mb upstream

31 Paired End WGS Large number of paired end reads with larger than expected insert size at two different locations

32 Assembly Assembly of whole genome reads in both regions showed a strand flip in the contig Right breakpoint strand switch Left breakpoint strand switch

33 Conclusion CDMD 1048 ~5mb region of chrx is inverted = Pathogenic mutation Allows creation of a specific clinical DNA test Mother is carrier, sister can be tested, appropriate genetic counseling now possible

34 Example 2: MUSCLE BIOPSY STILL GIVES IMPORTANT INFORMATION.

35 MUSCLE BIOPSY STILL GIVES IMPORTANT INFORMATION.?

36 RNA ANALYSIS FROM MUSCLE BIOPSY

37 Almost all families have their own distinct DMD mutation Relatively common 1 in 5,000 live male births HIGH Mutation rate Calculated at 1 in 10,000!! Often new mutation in child (Mom germline mosaic with an unknown fraction of eggs affected): mutation occurred when mom was in utero! OR Mom is a carrier (unbeknownst to her) (And her Mom or Dad may be a germline mosaic)

38 Female Carriers for DMD Majority have no overt clinical manifestations ~ 70% have slightly increased serum CK and liver enzyme tests Manifesting carriers: Non-mutated X chromosome inactivated non-randomly such that the majority of myofiber nuclei produce defective dystrophin A few percent of females have muscle weakness, some with a Duchenne-like clinical course Cardiomyopathy can develop in carrier women without muscle weakness and requires surveillance All potential carrier females should be tested

39 Summary Most Duchenne causing DMD mutations lead to complete loss of dystrophin function DMD mutations that allow some dystrophin expression usually cause a more mild phenotype (Becker) All patients should receive a specific molecular diagnosis Molecular diagnosis relevant to clinical trials DNA marker necessary for carrier testing in females A portion of patients need muscle biopsy to establish molecular diagnosis with RNA analysis or to clarify an unusual DNA mutation Whole genome sequencing/rna analysis of DMD gene can find mutations when standard clinical testing is normal. RNA sequencing in some cases clarifies exact RNA consequence of DNA mutation and is necessary.

Understanding genetics, mutation and other details. Stanley F. Nelson, MD 6/29/18

Understanding genetics, mutation and other details. Stanley F. Nelson, MD 6/29/18 Understanding genetics, mutation and other details Stanley F. Nelson, MD 6/29/18 1 6 11 16 21 Duchenne muscular dystrophy 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 600 500 400 300 200 100 0 Duchenne/Becker

More information

Muscular Dystrophy. Biol 405 Molecular Medicine

Muscular Dystrophy. Biol 405 Molecular Medicine Muscular Dystrophy Biol 405 Molecular Medicine Duchenne muscular dystrophy Duchenne muscular dystrophy is a neuromuscular disease that occurs in ~ 1/3,500 male births. The disease causes developmental

More information

Gene therapy and genome editing technologies for the study and potential treatment of :

Gene therapy and genome editing technologies for the study and potential treatment of : WORKSHOP ON GENOME EDITING Gene therapy and genome editing technologies for the study and potential treatment of : Duchenne Muscular Dystrophy by Dr France Piétri-Rouxel, Institut de Myologie Centre de

More information

Mutations. A2 Biology For WJEC

Mutations. A2 Biology For WJEC 12. Mutation is a change in the amount, arrangement or structure in the DNA of an organism. 13. There are two types of mutations, chromosome mutations and gene mutations. Mutations A2 Biology For WJEC

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Genetic Testing for Duchenne and Becker Muscular Dystrophy File Name: Origination: Last CAP Review: Next CAP Review: Last Review: genetic_testing_for_duchenne_and_becker_muscular_dystrophy

More information

SEX-LINKED INHERITANCE. Dr Rasime Kalkan

SEX-LINKED INHERITANCE. Dr Rasime Kalkan SEX-LINKED INHERITANCE Dr Rasime Kalkan Human Karyotype Picture of Human Chromosomes 22 Autosomes and 2 Sex Chromosomes Autosomal vs. Sex-Linked Traits can be either: Autosomal: traits (genes) are located

More information

14 2 Human Chromosomes

14 2 Human Chromosomes 14-2 Human Chromosomes 1 of 25 Sex-Linked Genes Sex-Linked Genes The X chromosome and the Y chromosomes determine sex. Genes located on these chromosomes are called sex-linked genes. More than 100 sex-linked

More information

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

How to go around conducting a clinical trial in small populations: Duchenne muscular dystrophy

How to go around conducting a clinical trial in small populations: Duchenne muscular dystrophy How to go around conducting a clinical trial in small populations: Duchenne muscular dystrophy CTs in rare diseases London 30 th November 2015 Michela Guglieri JWMDRC Newcastle upon Tyne Michela.guglieri@Newcastle.ac.uk

More information

DSS-1. No financial disclosures

DSS-1. No financial disclosures DSS-1 No financial disclosures Clinical History 9 year old boy with past medical history significant for cerebral palsy, in-turning right foot, left clubfoot that was surgically corrected at 3 years of

More information

Genetic diagnosis of limb girdle muscular dystrophy type 2A, A Case Report

Genetic diagnosis of limb girdle muscular dystrophy type 2A, A Case Report Genetic diagnosis of limb girdle muscular dystrophy type 2A, A Case Report Roshanak Jazayeri, MD, PhD Assistant Professor of Medical Genetics Faculty of Medicine, Alborz University of Medical Sciences

More information

Differences in carrier frequency between mothers of Duchenne and Becker muscular dystrophy patients

Differences in carrier frequency between mothers of Duchenne and Becker muscular dystrophy patients (2014) 59, 46 50 & 2014 The Japan Society of Human Genetics All rights reserved 1434-5161/14 www.nature.com/jhg OPEN ORIGINAL ARTICLE Differences in carrier frequency between mothers of Duchenne and Becker

More information

Genetics, The Duchenne Registry and Your Family! Jen Ely, MS, CGC June 2, 2018

Genetics, The Duchenne Registry and Your Family! Jen Ely, MS, CGC June 2, 2018 Genetics, The Duchenne Registry and Your Family! Jen Ely, MS, CGC June 2, 2018 The Duchenne Registry Team Two Genetic Counselors to help you: Ann Martin, MS, CGC Jen Ely, MS, CGC Registry also supported

More information

Exondys 51 (eteplirsen) injection Policy Number: Last Review: 10/2018 Origination: 10/2016 Next Review: 10/2019

Exondys 51 (eteplirsen) injection Policy Number: Last Review: 10/2018 Origination: 10/2016 Next Review: 10/2019 Exondys 51 (eteplirsen) injection Policy Number: 5.01.618 Last Review: 10/2018 Origination: 10/2016 Next Review: 10/2019 Policy Blue Cross and Blue Shield of Kansas City (Blue KC) will not provide coverage

More information

Risk assessment and genetic counseling in families with Duchenne muscular dystrophy

Risk assessment and genetic counseling in families with Duchenne muscular dystrophy Acta Myologica 2012; XXXI: p. 179-183 Risk assessment and genetic counseling in families with Duchenne muscular dystrophy Tiemo Grimm, Wolfram Kress, Gerhard Meng and Clemens R. Müller Department of Human

More information

Lecture 17: Human Genetics. I. Types of Genetic Disorders. A. Single gene disorders

Lecture 17: Human Genetics. I. Types of Genetic Disorders. A. Single gene disorders Lecture 17: Human Genetics I. Types of Genetic Disorders A. Single gene disorders B. Multifactorial traits 1. Mutant alleles at several loci acting in concert C. Chromosomal abnormalities 1. Physical changes

More information

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page. The handle   holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/29354 holds various files of this Leiden University dissertation. Author: Straathof, Chiara Title: dystrophinopathies : heterogeneous clinical aspects of

More information

Chapter 11 Gene Expression

Chapter 11 Gene Expression Chapter 11 Gene Expression 11-1 Control of Gene Expression Gene Expression- the activation of a gene to form a protein -a gene is on or expressed when it is transcribed. -cells do not always need to produce

More information

SUPPLEMENTAL DATA AGING, July 2014, Vol. 6 No. 7

SUPPLEMENTAL DATA AGING, July 2014, Vol. 6 No. 7 SUPPLEMENTAL DATA Figure S1. Muscle mass changes in different anatomical regions with age. (A) The TA and gastrocnemius muscle showed a significant loss of weight in aged mice (24 month old) compared to

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

Lab Activity 36. Principles of Heredity. Portland Community College BI 233

Lab Activity 36. Principles of Heredity. Portland Community College BI 233 Lab Activity 36 Principles of Heredity Portland Community College BI 233 Terminology of Chromosomes Homologous chromosomes: A pair, of which you get one from mom, and one from dad. Example: the pair of

More information

Benefits and pitfalls of new genetic tests

Benefits and pitfalls of new genetic tests Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,

More information

Protocol. Genetic Testing for Duchenne and Becker Muscular Dystrophy

Protocol. Genetic Testing for Duchenne and Becker Muscular Dystrophy Protocol Genetic Testing for Duchenne and Becker Muscular Dystrophy (20486) Medical Benefit Effective Date: 10/01/17 Next Review Date: 05/18 Preauthorization Yes Review Dates: 05/13, 05/14, 05/15, 05/16,

More information

Duchenne muscular dystrophy quantification of muscular parameters and prednisone therapy Beenakker, Ernesto Alexander Christiaan

Duchenne muscular dystrophy quantification of muscular parameters and prednisone therapy Beenakker, Ernesto Alexander Christiaan University of Groningen Duchenne muscular dystrophy quantification of muscular parameters and prednisone therapy Beenakker, Ernesto Alexander Christiaan IMPORTANT NOTE: You are advised to consult the publisher's

More information

Human Genetics Notes:

Human Genetics Notes: Human Genetics Notes: Human Chromosomes Cell biologists analyze chromosomes by looking at. Cells are during mitosis. Scientists then cut out the chromosomes from the and group them together in pairs. A

More information

Single Gene (Monogenic) Disorders. Mendelian Inheritance: Definitions. Mendelian Inheritance: Definitions

Single Gene (Monogenic) Disorders. Mendelian Inheritance: Definitions. Mendelian Inheritance: Definitions Single Gene (Monogenic) Disorders Mendelian Inheritance: Definitions A genetic locus is a specific position or location on a chromosome. Frequently, locus is used to refer to a specific gene. Alleles are

More information

READ ORPHA.NET WEBSITE ABOUT BETA-SARCOGLYOCANOPATHY LIMB-GIRDLE MUSCULAR DYSTROPHIES

READ ORPHA.NET WEBSITE ABOUT BETA-SARCOGLYOCANOPATHY LIMB-GIRDLE MUSCULAR DYSTROPHIES READ ORPHA.NET WEBSITE ABOUT BETA-SARCOGLYOCANOPATHY LIMB-GIRDLE MUSCULAR DYSTROPHIES (LGMD) Limb-girdle muscular dystrophies (LGMD) are a heterogeneous group of genetically determined disorders with a

More information

Human Heredity: The genetic transmission of characteristics from parent to offspring.

Human Heredity: The genetic transmission of characteristics from parent to offspring. Human Heredity: The genetic transmission of characteristics from parent to offspring. Karyotype : picture of the actual chromosomes arranged in pairs, paired and arranged from largest to smallest. Human

More information

Clinical Policy Title: Genetic tests for Duchenne muscular dystrophy

Clinical Policy Title: Genetic tests for Duchenne muscular dystrophy Clinical Policy Title: Genetic tests for Duchenne muscular dystrophy Clinical Policy Number: 02.01.23 Effective Date: February 1, 2017 Initial Review Date: January 18, 2017 Most Recent Review Date: January

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

NATIONAL INSTITUTE FOR HEALTH AND CARE EXCELLENCE. Proposed Highly Specialised Technology Evaluation

NATIONAL INSTITUTE FOR HEALTH AND CARE EXCELLENCE. Proposed Highly Specialised Technology Evaluation NATIONAL INSTITUTE FOR HEALTH AND CARE EXCELLENCE Proposed Highly Specialised Technology Evaluation Drisapersen for treating Duchenne muscular Draft scope (pre-referral) Draft remit/evaluation objective

More information

MOLECULAR DIAGNOSIS for X-LINKED INTELLECTUAL DISABILITY

MOLECULAR DIAGNOSIS for X-LINKED INTELLECTUAL DISABILITY MOLECULAR DIAGNOSIS for X-LINKED INTELLECTUAL DISABILITY Intellectual disability (ID) or mental retardation is characterized by significant limitations in cognitive abilities and social/behavioral adaptive

More information

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi 2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000

More information

Human beings contain tens of thousands of genes, the basic material for cell

Human beings contain tens of thousands of genes, the basic material for cell II. A Brief Overview of Genetics and Genetic Research Human beings contain tens of thousands of genes, the basic material for cell function including the transmission of hereditary characteristics. Genes

More information

Genetic Counselling in relation to genetic testing

Genetic Counselling in relation to genetic testing Genetic Counselling in relation to genetic testing Dr Julie Vogt Consultant Geneticist West Midlands Regional Genetics Service September 2016 Disclosures for Research Support/P.I. Employee Consultant Major

More information

Chapter 12-4 DNA Mutations Notes

Chapter 12-4 DNA Mutations Notes Chapter 12-4 DNA Mutations Notes I. Mutations Introduction A. Definition: Changes in the DNA sequence that affect genetic information B. Mutagen= physical or chemical agent that interacts with DNA to cause

More information

Genetic Disorders. and. blood vessels the and. How many genes are affected by this deletion? Turner s Syndrome- An incomplete or missing chromosome

Genetic Disorders. and. blood vessels the and. How many genes are affected by this deletion? Turner s Syndrome- An incomplete or missing chromosome Genetic Disorders A genetic disorder is an abnormality in the. They can range for a deletion of a gene to the deletion of an entire chromosome. List the types of genetic disorders. Williams Syndrome- A

More information

Gene Therapy With a Difference By ANDREW POLLACK

Gene Therapy With a Difference By ANDREW POLLACK September 23, 2013 Gene Therapy With a Difference By ANDREW POLLACK Terri Ellsworth is convinced that her 12-year-old son Billy, who has Duchenne muscular dystrophy, is being helped by an experimental

More information

Mutation specific therapies

Mutation specific therapies Taken from www.dmd.nl/gt. Used with permission Mutation specific therapies Introduction Two therapies for Duchenne patients are currently being tested in clinical trials, which are applicable only to patients

More information

Muscle Metabolism. Dr. Nabil Bashir

Muscle Metabolism. Dr. Nabil Bashir Muscle Metabolism Dr. Nabil Bashir Learning objectives Understand how skeletal muscles derive energy at rest, moderate exercise, and strong exercise. Recognize the difference between aerobic and anaerobic

More information

JULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology

JULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology JULY 21, 2018 Genetics 101: SCN1A Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology Disclosures: I have no financial interests or relationships to disclose. Objectives 1. Review genetic

More information

SALSA MLPA KIT P060-B2 SMA

SALSA MLPA KIT P060-B2 SMA SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the

More information

Exon skipping in a DCM mouse model mimicking a human mutation in titin

Exon skipping in a DCM mouse model mimicking a human mutation in titin Exon skipping in a DCM mouse model mimicking a human mutation in titin Dr. Michael Gramlich Department of Cardiology, University of Tuebingen, Germany I do not have a financial interest/arrangement or

More information

Lesson Overview. Human Chromosomes. Lesson Overview. Human Chromosomes

Lesson Overview. Human Chromosomes. Lesson Overview. Human Chromosomes Lesson Overview Karyotypes A genome is the full set of genetic information that an organism carries in its DNA. A study of any genome starts with chromosomes, the bundles of DNA and protein found in the

More information

The Chromosomal Basis Of Inheritance

The Chromosomal Basis Of Inheritance The Chromosomal Basis Of Inheritance Chapter 15 Objectives Explain the chromosomal theory of inheritance and its discovery. Explain why sex-linked diseases are more common in human males than females.

More information

- Aya Alomoush. - Talal Al-Zabin. - Belal Azab. 1 P a g e

- Aya Alomoush. - Talal Al-Zabin. - Belal Azab. 1 P a g e 24 - Aya Alomoush - Talal Al-Zabin - Belal Azab 1 P a g e 1) Features of autosomal dominant inheritance: A) Vertical transmission: direct transmission from grandparent to parent to child without skipping

More information

Implementation of Newborn Screening for Duchenne Muscular Dystrophy.

Implementation of Newborn Screening for Duchenne Muscular Dystrophy. Implementation of Newborn Screening for Duchenne Muscular Dystrophy. Michele A. Lloyd-Puryear, MD, PhD 1, Stuart J Moat, PhD 2, Amy Brower 3, PhD, Annie Kennedy 1, Petra Furu 4, Michael Watson, PhD 3,

More information

Precision Medicine and Genetic Counseling : Is Yes always the correct answer?

Precision Medicine and Genetic Counseling : Is Yes always the correct answer? Precision Medicine and Genetic Counseling : Is Yes always the correct answer? Beverly M. Yashar, MS, PhD, CGC Director, Graduate Program in Genetic Counseling Professor, Department of Human Genetics. (yashar@umich.edu)

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

MRC-Holland MLPA. Description version 19;

MRC-Holland MLPA. Description version 19; SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL

More information

A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single

A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single 8.3 A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single chromosome can alter their pattern of inheritance from those

More information

Proteins. Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids

Proteins. Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids Proteins Protein carbon, hydrogen, oxygen, nitrogen and often sulphur Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids During protein synthesis, amino acids

More information

Human inherited diseases

Human inherited diseases Human inherited diseases A genetic disorder that is caused by abnormality in an individual's DNA. Abnormalities can range from small mutation in a single gene to the addition or subtraction of a whole

More information

Clinical features, particularly those of the central nervous system, of patients with Becker s muscular dystrophy, including autopsied cases

Clinical features, particularly those of the central nervous system, of patients with Becker s muscular dystrophy, including autopsied cases Clinical features, particularly those of the central nervous system, of patients with Becker s muscular dystrophy, including autopsied cases Katuhito Adachi, M.D. #1, Hisaomi Kawai, M.D. #1, Miho Saito,

More information

Ch. 15 The Chromosomal Basis of Inheritance

Ch. 15 The Chromosomal Basis of Inheritance Ch. 15 The Chromosomal Basis of Inheritance Nov 12 12:58 PM 1 Essential Question: Are chromosomes the basis of inheritance? Nov 12 1:00 PM 2 1902 Walter S. Sutton, Theodor Boveri, et al Chromosome Theory

More information

Exercise induced cramps and myoglobinuria in dystrophinopathy a report of three Malaysian patients

Exercise induced cramps and myoglobinuria in dystrophinopathy a report of three Malaysian patients Neurology Asia 2010; 15(2) : 125 131 Exercise induced cramps and myoglobinuria in dystrophinopathy a report of three Malaysian patients 1 Azlina Ahmad Annuar, 2 Kum Thong Wong, 1 Ai Sze Ching, 3 Meow Keong

More information

Chapter 1 : Genetics 101

Chapter 1 : Genetics 101 Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic

More information

Genomics and Genetics in Healthcare. By Mary Knutson, RN, MSN

Genomics and Genetics in Healthcare. By Mary Knutson, RN, MSN Genomics and Genetics in Healthcare By Mary Knutson, RN, MSN Clinical Objectives Understand the importance of genomics to provide effective nursing care Integrate genetic knowledge and skills into nursing

More information

Chapter 15 Notes 15.1: Mendelian inheritance chromosome theory of inheritance wild type 15.2: Sex-linked genes

Chapter 15 Notes 15.1: Mendelian inheritance chromosome theory of inheritance wild type 15.2: Sex-linked genes Chapter 15 Notes The Chromosomal Basis of Inheritance Mendel s hereditary factors were genes, though this wasn t known at the time Now we know that genes are located on The location of a particular gene

More information

Paula Clemens NS-065/NCNP-01 Study Chair

Paula Clemens NS-065/NCNP-01 Study Chair A Phase II, Dose Finding Study to Assess the Safety, Tolerability, Pharmacokinetics, and Pharmacodynamics of NS-065/NCNP-01 in Boys with Duchenne Muscular Dystrophy (DMD) Paula Clemens NS-065/NCNP-01 Study

More information

Inheritance and the muscular dystrophies

Inheritance and the muscular dystrophies Inheritance and the muscular dystrophies This leaflet provides a brief summary of the genetics of the muscular dystrophies. An understanding of their inheritance patterns makes it possible for families

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) (A)-Testing

More information

Unit 2 Physiology and Health Part (a) The Reproductive System HOMEWORK BOOKLET

Unit 2 Physiology and Health Part (a) The Reproductive System HOMEWORK BOOKLET Unit 2 Physiology and Health Part (a) The Reproductive System HOMEWORK BOOKLET Name: Homework Date Due Mark % Key Area 1 The structure and function of reproductive organs Key Area 2 Hormonal control of

More information

variant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still

variant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still 157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can

More information

Basic Definitions. Dr. Mohammed Hussein Assi MBChB MSc DCH (UK) MRCPCH

Basic Definitions. Dr. Mohammed Hussein Assi MBChB MSc DCH (UK) MRCPCH Basic Definitions Chromosomes There are two types of chromosomes: autosomes (1-22) and sex chromosomes (X & Y). Humans are composed of two groups of cells: Gametes. Ova and sperm cells, which are haploid,

More information

Non-Mendelian inheritance

Non-Mendelian inheritance Non-Mendelian inheritance Focus on Human Disorders Peter K. Rogan, Ph.D. Laboratory of Human Molecular Genetics Children s Mercy Hospital Schools of Medicine & Computer Science and Engineering University

More information

Chapter 4 PEDIGREE ANALYSIS IN HUMAN GENETICS

Chapter 4 PEDIGREE ANALYSIS IN HUMAN GENETICS Chapter 4 PEDIGREE ANALYSIS IN HUMAN GENETICS Chapter Summary In order to study the transmission of human genetic traits to the next generation, a different method of operation had to be adopted. Instead

More information

Iowa Wellstone Center Muscle Tissue and Cell Culture Repository

Iowa Wellstone Center Muscle Tissue and Cell Culture Repository Iowa Wellstone Center Muscle Tissue and Cell Culture Repository Steven A. Moore, M.D., Ph.D. The University of Iowa Department of Pathology and Iowa Wellstone Muscular Dystrophy Cooperative Research Center

More information

See pedigree info on extra sheet 1. ( 6 pts)

See pedigree info on extra sheet 1. ( 6 pts) Biol 321 Quiz #2 Spring 2010 40 pts NAME See pedigree info on extra sheet 1. ( 6 pts) Examine the pedigree shown above. For each mode of inheritance listed below indicate: E = this mode of inheritance

More information

The c.65-2a>g splice site mutation is associated with a mild phenotype in Danon disease due to the transcription of normal LAMP2 mrna

The c.65-2a>g splice site mutation is associated with a mild phenotype in Danon disease due to the transcription of normal LAMP2 mrna Clin Genet 2016: 90: 366 371 Printed in Singapore. All rights reserved Short Report 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12724 The c.65-2a>g

More information

What is New in Genetic Testing. Steven D. Shapiro MS, DMD, MD

What is New in Genetic Testing. Steven D. Shapiro MS, DMD, MD What is New in Genetic Testing Steven D. Shapiro MS, DMD, MD 18th Annual Primary Care Symposium Financial and Commercial Disclosure I have a no financial or commercial interest in my presentation. 2 Genetic

More information

Subject: Eteplirsen (Exondys 51)

Subject: Eteplirsen (Exondys 51) 09-J2000-69 Original Effective Date: 10/15/16 Reviewed: 12/12/18 Revised: 01/01/19 Next Review: 12/11/18 Subject: Eteplirsen (Exondys 51) THIS MEDICAL COVERAGE GUIDELINE IS NOT AN AUTHORIZATION, CERTIFICATION,

More information

SMA IS A SEVERE NEUROLOGICAL DISORDER [1]

SMA IS A SEVERE NEUROLOGICAL DISORDER [1] SMA OVERVIEW SMA IS A SEVERE NEUROLOGICAL DISORDER [1] Autosomal recessive genetic inheritance 1 in 50 people (approximately 6 million Americans) are carriers [2] 1 in 6,000 to 1 in 10,000 children born

More information

Muscular Dystrophies. Pinki Munot Consultant Paediatric Neurologist Great Ormond Street Hospital Practical Neurology Study days April 2018

Muscular Dystrophies. Pinki Munot Consultant Paediatric Neurologist Great Ormond Street Hospital Practical Neurology Study days April 2018 Muscular Dystrophies Pinki Munot Consultant Paediatric Neurologist Great Ormond Street Hospital Practical Neurology Study days April 2018 Definition and classification Clinical guide to recognize muscular

More information

Bio 111 Study Guide Chapter 17 From Gene to Protein

Bio 111 Study Guide Chapter 17 From Gene to Protein Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and

More information

HYBRID GENE THERAPY FOR AD-EDMD

HYBRID GENE THERAPY FOR AD-EDMD HYBRID GENE THERAPY FOR AD-EDMD Gene Therapy Prof. Isabella Saggio 2017/2018 Bertani Camilla Dezi Clara Difeo Giorgia di Palma Carmen AUTOSOMAL DOMINANT EMERY-DREIFUSS MUSCULAR DYSTROPHY Fig.1 Adapted

More information

Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17

Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17 Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17 INTRODUCTION - Our genes underlie every aspect of human health, both in function and

More information

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For certain patients the combination of symptoms does not allow

More information

Genetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance

Genetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance Genetics Review Alleles These two different versions of gene A create a condition known as heterozygous. Only the dominant allele (A) will be expressed. When both chromosomes have identical copies of the

More information

Genetics, Mendel and Units of Heredity

Genetics, Mendel and Units of Heredity Genetics, Mendel and Units of Heredity ¾ Austrian monk and naturalist. ¾ Conducted research in Brno, Czech Republic from 1856-1863 ¾ Curious about how traits were passed from parents to offspring. Gregor

More information

NOTES: : HUMAN HEREDITY

NOTES: : HUMAN HEREDITY NOTES: 14.1-14.2: HUMAN HEREDITY Human Genes: The human genome is the complete set of genetic information -it determines characteristics such as eye color and how proteins function within cells Recessive

More information

Objectives. Genetics and Rett syndrome: As easy as apple pie! Chromosome to gene to protein

Objectives. Genetics and Rett syndrome: As easy as apple pie! Chromosome to gene to protein Genetics and Rett syndrome: As easy as apple pie! Victoria Mok Siu M.D., FRCPC, FCCMG ORSA conference Ottawa April 24, 2016 Objectives Review chromosomes and genes Understand s Explore the reasons behind

More information

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For some patients, the combination of symptoms does not allow

More information

Treatment of Duchenne Muscular Dystrophy with Oligonucleotides

Treatment of Duchenne Muscular Dystrophy with Oligonucleotides Treatment of Duchenne Muscular Dystrophy with Oligonucleotides against an Exonic Splicing Enhancer Sequence Masafumi Matsuo, Mariko Yagi and Yasuhiro Takeshima Department of Pediatrics, Kobe University

More information

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED

More information

Genetic Disorders. n A genetic disorder is an abnormality

Genetic Disorders. n A genetic disorder is an abnormality + GENETIC DISORDERS + Genetic Disorders n A genetic disorder is an abnormality in an individual's DNA. Abnormalities can range from a small mutation in a single gene to the addition or subtraction of an

More information

DNA Basics. We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work.

DNA Basics. We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work. DNA Basics We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work. DNA is packaged into structures called chromosomes. Each chromosome contains many genes and each

More information

X-linked Genetic Disorders

X-linked Genetic Disorders X-linked Genetic Disorders A genetic disorder is caused by one or more faulty genes. What are genes? Our bodies are made up of millions of cells. Each cell contains a complete set of genes. We have thousands

More information

BIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE

BIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE !! www.clutchprep.com Chromosomal theory of inheritance: chromosomes are the carriers of genetic material. Independent Assortment alleles for different characters sort independently of each other during

More information

Exam #2 BSC Fall. NAME_Key correct answers in BOLD FORM A

Exam #2 BSC Fall. NAME_Key correct answers in BOLD FORM A Exam #2 BSC 2011 2004 Fall NAME_Key correct answers in BOLD FORM A Before you begin, please write your name and social security number on the computerized score sheet. Mark in the corresponding bubbles

More information

International Journal of Health Sciences and Research ISSN:

International Journal of Health Sciences and Research  ISSN: International Journal of Health Sciences and Research www.ijhsr.org ISSN: 2249-9571 Original Research Article Health Inequalities in Connection with Socioeconomic Position of Duchenne / Becker Muscular

More information

Human Genetic Disorders

Human Genetic Disorders Human Genetic Disorders HOMOLOGOUS CHROMOSOMES Human somatic cells have 23 pairs of homologous chromosomes 23 are inherited from the mother and 23 from the father HOMOLOGOUS CHROMOSOMES Autosomes o Are

More information

LYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)!

LYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)! LYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)! Kathryn Singh, MPH, MS, LCGC Associate Clinical Professor Assistant Director, Graduate Program in Genetic Counseling Division of Genetic and Genomic

More information

Chapter 11. Chromosomes and Human Inheritance

Chapter 11. Chromosomes and Human Inheritance Chapter 11 Chromosomes and Human Inheritance Human Chromosomes Human body cells have 23 pairs of homologous chromosomes 22 pairs of autosomes 1 pair of sex chromosomes Autosomesand Sex Chromosomes Paired

More information

Introduction to Genetics

Introduction to Genetics Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist

More information

Class *GENETIC NOTES & WORKSHEETS

Class *GENETIC NOTES & WORKSHEETS Name Class *GENETIC NOTES & WORKSHEETS DAY 1: Mendelian Genetics Vocabulary A. Genetics- Study of B. Heredity- The passing on of characteristics (traits) from to C. Trait A particular that can vary from

More information

Understanding The Genetics of Diamond Blackfan Anemia

Understanding The Genetics of Diamond Blackfan Anemia Understanding The Genetics of Diamond Blackfan Anemia Jason Farrar, MD jefarrar@ About Me Assistant Professor of Pediatrics at University of Arkansas for Medical Sciences & Arkansas Children s Hospital

More information

Amyloid neuropathy: (A) scattered Congo Red positive material in endoneurium displays apple green birefringence under polarized light.

Amyloid neuropathy: (A) scattered Congo Red positive material in endoneurium displays apple green birefringence under polarized light. Cơ vân Cơ vân Cơ vân (cắt dọc) Amyloid neuropathy: (A) scattered Congo Red positive material in endoneurium displays apple green birefringence under polarized light. (A, Congo Red). Amyloid neuropathy:

More information

X Linked Inheritance. Information for Patients and Families. Illustrations by Rebecca J Kent

X Linked Inheritance. Information for Patients and Families. Illustrations by Rebecca J Kent 12 X Linked Inheritance M o d i f i e d f r o m l e a f l e t s p r o d u c e d b y G u y s a n d S t T h o m a s Hospital, London; and the London IDEAS Genetic Knowledge Park, according to their quality

More information

THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15

THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15 What you must know: Inheritance in sex-linked genes. Inheritance of linked genes and chromosomal mapping. How alteration of chromosome number or structurally

More information