DMD Genetics: complicated, complex and critical to understand
|
|
- Rachel Jones
- 5 years ago
- Views:
Transcription
1 DMD Genetics: complicated, complex and critical to understand Stanley Nelson, MD Professor of Human Genetics, Pathology and Laboratory Medicine, and Psychiatry Co Director, Center for Duchenne Muscular Dystrophy UCLA
2 Duchenne is an X linked recessive DMD: X-linked recessive, genetic lethal in males and overall frequency not changing
3 Human Genome 3 billion letters (GATC) ~24,000 genes ~ Gene for Duchenne/Becker Muscular Dystrophy identified ~5,000 Different Genetic Diseases known
4 DMD Gene Found in 1986 (Kunkel) Improved diagnosis and counseling Provided insight into Duchenne and Becker Suggested therapeutic strategies Gene therapy Exon skipping Utrophin upregulation
5 LARGEST GENE, Discovered in 1986, 79 exons
6 LARGEST GENE, Discovered in 1986, 79 exons
7 Dystrophin Protein domains
8 Normal Muscle Dystrophin
9 Muscle fibers contain myofibrils, which are bundles of myofilaments.
10 Dystrophin is an essential part of a large protein complex at the muscle membrane
11 Duchenne Muscular Dystrophy Dystrophin at the Muscle Membrane dystrophin hematoxylin and eosin staining unaffected DMD
12 Identification of DMD gene mutations proved that both Duchenne and Becker muscular dystrophy are caused by mutations in DMD Duchenne MD Becker Muscular Dystrophy
13 Western Blot in DMD and BMD Normal dystrophin MW = 427 kda DMD No dystrophin seen BMD Smaller dystrophin protein observed MWs differ in patients from different families Thompson & Thompson,
14 Histology and Dystrophin staining in DMD and BMD Muscle Normal BMD H&E Duchenne: increased connective tissue and leukocytes Dystrophin Normal: localized to myocyte membrane Becker: present but reduced Duchenne: completely absent DMD
15 DMD gene is LARGE. 79 EXONS Exon Frame Map of the Dystrophin gene Genetics of DMD and BMD
16 More Severe or typical Duchenne: OUT OF FRAME DNA MUTATION Genetics of DMD and BMD
17 SEVERE DISEASE: Because the end of the protein is not made Genetics of DMD and BMD
18 MILDER DISEASE= IN FRAME MUTATION Genetics of DMD and BMD
19 MILDER DISEASE= IN FRAME MUTATION Because the end of the protein is made Genetics of DMD and BMD
20
21 DNA: CTGAGCCAACTATTGATGAA RNA: c CUGAGCCAACUAUUGAUGAA CODE: CUG AGC CAA CUA UUG AUG AA Protein LSQLLM
22
23 Most mutations are in exons and are deletions Magri, et al 2010 J. Neuro
24 Single exon skipping relevance (Flanigan, et al 2009
25 Modest differences in age at loss of walking with different deletions Exon 44 skippable/others Exon 45 skippable/others R. Wang, Duchenne Connect Data, 2014
26 Small mutations
27 Dystrophin Protein domains
28 Different types of dystrophin protein are made from the DMD gene E30 e45 e51 e56 e63
29 New Diagnostic technique: Combination of RNA_SEQ and Whole Genome Sequencing for DMD mutation identification No expression after exon37
30 Assembly of RNA-Seq reads Pulled out all reads matching the end of DMD exon 37 (red) and assembled using Velvet BLAT of resulting contig showed intron 37 joined to intergenic region 5Mb upstream
31 Paired End WGS Large number of paired end reads with larger than expected insert size at two different locations
32 Assembly Assembly of whole genome reads in both regions showed a strand flip in the contig Right breakpoint strand switch Left breakpoint strand switch
33 Conclusion CDMD 1048 ~5mb region of chrx is inverted = Pathogenic mutation Allows creation of a specific clinical DNA test Mother is carrier, sister can be tested, appropriate genetic counseling now possible
34 Example 2: MUSCLE BIOPSY STILL GIVES IMPORTANT INFORMATION.
35 MUSCLE BIOPSY STILL GIVES IMPORTANT INFORMATION.?
36 RNA ANALYSIS FROM MUSCLE BIOPSY
37 Almost all families have their own distinct DMD mutation Relatively common 1 in 5,000 live male births HIGH Mutation rate Calculated at 1 in 10,000!! Often new mutation in child (Mom germline mosaic with an unknown fraction of eggs affected): mutation occurred when mom was in utero! OR Mom is a carrier (unbeknownst to her) (And her Mom or Dad may be a germline mosaic)
38 Female Carriers for DMD Majority have no overt clinical manifestations ~ 70% have slightly increased serum CK and liver enzyme tests Manifesting carriers: Non-mutated X chromosome inactivated non-randomly such that the majority of myofiber nuclei produce defective dystrophin A few percent of females have muscle weakness, some with a Duchenne-like clinical course Cardiomyopathy can develop in carrier women without muscle weakness and requires surveillance All potential carrier females should be tested
39 Summary Most Duchenne causing DMD mutations lead to complete loss of dystrophin function DMD mutations that allow some dystrophin expression usually cause a more mild phenotype (Becker) All patients should receive a specific molecular diagnosis Molecular diagnosis relevant to clinical trials DNA marker necessary for carrier testing in females A portion of patients need muscle biopsy to establish molecular diagnosis with RNA analysis or to clarify an unusual DNA mutation Whole genome sequencing/rna analysis of DMD gene can find mutations when standard clinical testing is normal. RNA sequencing in some cases clarifies exact RNA consequence of DNA mutation and is necessary.
Understanding genetics, mutation and other details. Stanley F. Nelson, MD 6/29/18
Understanding genetics, mutation and other details Stanley F. Nelson, MD 6/29/18 1 6 11 16 21 Duchenne muscular dystrophy 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 600 500 400 300 200 100 0 Duchenne/Becker
More informationMuscular Dystrophy. Biol 405 Molecular Medicine
Muscular Dystrophy Biol 405 Molecular Medicine Duchenne muscular dystrophy Duchenne muscular dystrophy is a neuromuscular disease that occurs in ~ 1/3,500 male births. The disease causes developmental
More informationGene therapy and genome editing technologies for the study and potential treatment of :
WORKSHOP ON GENOME EDITING Gene therapy and genome editing technologies for the study and potential treatment of : Duchenne Muscular Dystrophy by Dr France Piétri-Rouxel, Institut de Myologie Centre de
More informationMutations. A2 Biology For WJEC
12. Mutation is a change in the amount, arrangement or structure in the DNA of an organism. 13. There are two types of mutations, chromosome mutations and gene mutations. Mutations A2 Biology For WJEC
More informationCorporate Medical Policy
Corporate Medical Policy Genetic Testing for Duchenne and Becker Muscular Dystrophy File Name: Origination: Last CAP Review: Next CAP Review: Last Review: genetic_testing_for_duchenne_and_becker_muscular_dystrophy
More informationSEX-LINKED INHERITANCE. Dr Rasime Kalkan
SEX-LINKED INHERITANCE Dr Rasime Kalkan Human Karyotype Picture of Human Chromosomes 22 Autosomes and 2 Sex Chromosomes Autosomal vs. Sex-Linked Traits can be either: Autosomal: traits (genes) are located
More information14 2 Human Chromosomes
14-2 Human Chromosomes 1 of 25 Sex-Linked Genes Sex-Linked Genes The X chromosome and the Y chromosomes determine sex. Genes located on these chromosomes are called sex-linked genes. More than 100 sex-linked
More informationHST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007
MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationHow to go around conducting a clinical trial in small populations: Duchenne muscular dystrophy
How to go around conducting a clinical trial in small populations: Duchenne muscular dystrophy CTs in rare diseases London 30 th November 2015 Michela Guglieri JWMDRC Newcastle upon Tyne Michela.guglieri@Newcastle.ac.uk
More informationDSS-1. No financial disclosures
DSS-1 No financial disclosures Clinical History 9 year old boy with past medical history significant for cerebral palsy, in-turning right foot, left clubfoot that was surgically corrected at 3 years of
More informationGenetic diagnosis of limb girdle muscular dystrophy type 2A, A Case Report
Genetic diagnosis of limb girdle muscular dystrophy type 2A, A Case Report Roshanak Jazayeri, MD, PhD Assistant Professor of Medical Genetics Faculty of Medicine, Alborz University of Medical Sciences
More informationDifferences in carrier frequency between mothers of Duchenne and Becker muscular dystrophy patients
(2014) 59, 46 50 & 2014 The Japan Society of Human Genetics All rights reserved 1434-5161/14 www.nature.com/jhg OPEN ORIGINAL ARTICLE Differences in carrier frequency between mothers of Duchenne and Becker
More informationGenetics, The Duchenne Registry and Your Family! Jen Ely, MS, CGC June 2, 2018
Genetics, The Duchenne Registry and Your Family! Jen Ely, MS, CGC June 2, 2018 The Duchenne Registry Team Two Genetic Counselors to help you: Ann Martin, MS, CGC Jen Ely, MS, CGC Registry also supported
More informationExondys 51 (eteplirsen) injection Policy Number: Last Review: 10/2018 Origination: 10/2016 Next Review: 10/2019
Exondys 51 (eteplirsen) injection Policy Number: 5.01.618 Last Review: 10/2018 Origination: 10/2016 Next Review: 10/2019 Policy Blue Cross and Blue Shield of Kansas City (Blue KC) will not provide coverage
More informationRisk assessment and genetic counseling in families with Duchenne muscular dystrophy
Acta Myologica 2012; XXXI: p. 179-183 Risk assessment and genetic counseling in families with Duchenne muscular dystrophy Tiemo Grimm, Wolfram Kress, Gerhard Meng and Clemens R. Müller Department of Human
More informationLecture 17: Human Genetics. I. Types of Genetic Disorders. A. Single gene disorders
Lecture 17: Human Genetics I. Types of Genetic Disorders A. Single gene disorders B. Multifactorial traits 1. Mutant alleles at several loci acting in concert C. Chromosomal abnormalities 1. Physical changes
More informationCover Page. The handle holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/1887/29354 holds various files of this Leiden University dissertation. Author: Straathof, Chiara Title: dystrophinopathies : heterogeneous clinical aspects of
More informationChapter 11 Gene Expression
Chapter 11 Gene Expression 11-1 Control of Gene Expression Gene Expression- the activation of a gene to form a protein -a gene is on or expressed when it is transcribed. -cells do not always need to produce
More informationSUPPLEMENTAL DATA AGING, July 2014, Vol. 6 No. 7
SUPPLEMENTAL DATA Figure S1. Muscle mass changes in different anatomical regions with age. (A) The TA and gastrocnemius muscle showed a significant loss of weight in aged mice (24 month old) compared to
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationLab Activity 36. Principles of Heredity. Portland Community College BI 233
Lab Activity 36 Principles of Heredity Portland Community College BI 233 Terminology of Chromosomes Homologous chromosomes: A pair, of which you get one from mom, and one from dad. Example: the pair of
More informationBenefits and pitfalls of new genetic tests
Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,
More informationProtocol. Genetic Testing for Duchenne and Becker Muscular Dystrophy
Protocol Genetic Testing for Duchenne and Becker Muscular Dystrophy (20486) Medical Benefit Effective Date: 10/01/17 Next Review Date: 05/18 Preauthorization Yes Review Dates: 05/13, 05/14, 05/15, 05/16,
More informationDuchenne muscular dystrophy quantification of muscular parameters and prednisone therapy Beenakker, Ernesto Alexander Christiaan
University of Groningen Duchenne muscular dystrophy quantification of muscular parameters and prednisone therapy Beenakker, Ernesto Alexander Christiaan IMPORTANT NOTE: You are advised to consult the publisher's
More informationHuman Genetics Notes:
Human Genetics Notes: Human Chromosomes Cell biologists analyze chromosomes by looking at. Cells are during mitosis. Scientists then cut out the chromosomes from the and group them together in pairs. A
More informationSingle Gene (Monogenic) Disorders. Mendelian Inheritance: Definitions. Mendelian Inheritance: Definitions
Single Gene (Monogenic) Disorders Mendelian Inheritance: Definitions A genetic locus is a specific position or location on a chromosome. Frequently, locus is used to refer to a specific gene. Alleles are
More informationREAD ORPHA.NET WEBSITE ABOUT BETA-SARCOGLYOCANOPATHY LIMB-GIRDLE MUSCULAR DYSTROPHIES
READ ORPHA.NET WEBSITE ABOUT BETA-SARCOGLYOCANOPATHY LIMB-GIRDLE MUSCULAR DYSTROPHIES (LGMD) Limb-girdle muscular dystrophies (LGMD) are a heterogeneous group of genetically determined disorders with a
More informationHuman Heredity: The genetic transmission of characteristics from parent to offspring.
Human Heredity: The genetic transmission of characteristics from parent to offspring. Karyotype : picture of the actual chromosomes arranged in pairs, paired and arranged from largest to smallest. Human
More informationClinical Policy Title: Genetic tests for Duchenne muscular dystrophy
Clinical Policy Title: Genetic tests for Duchenne muscular dystrophy Clinical Policy Number: 02.01.23 Effective Date: February 1, 2017 Initial Review Date: January 18, 2017 Most Recent Review Date: January
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationNATIONAL INSTITUTE FOR HEALTH AND CARE EXCELLENCE. Proposed Highly Specialised Technology Evaluation
NATIONAL INSTITUTE FOR HEALTH AND CARE EXCELLENCE Proposed Highly Specialised Technology Evaluation Drisapersen for treating Duchenne muscular Draft scope (pre-referral) Draft remit/evaluation objective
More informationMOLECULAR DIAGNOSIS for X-LINKED INTELLECTUAL DISABILITY
MOLECULAR DIAGNOSIS for X-LINKED INTELLECTUAL DISABILITY Intellectual disability (ID) or mental retardation is characterized by significant limitations in cognitive abilities and social/behavioral adaptive
More informationCURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
More informationHuman beings contain tens of thousands of genes, the basic material for cell
II. A Brief Overview of Genetics and Genetic Research Human beings contain tens of thousands of genes, the basic material for cell function including the transmission of hereditary characteristics. Genes
More informationGenetic Counselling in relation to genetic testing
Genetic Counselling in relation to genetic testing Dr Julie Vogt Consultant Geneticist West Midlands Regional Genetics Service September 2016 Disclosures for Research Support/P.I. Employee Consultant Major
More informationChapter 12-4 DNA Mutations Notes
Chapter 12-4 DNA Mutations Notes I. Mutations Introduction A. Definition: Changes in the DNA sequence that affect genetic information B. Mutagen= physical or chemical agent that interacts with DNA to cause
More informationGenetic Disorders. and. blood vessels the and. How many genes are affected by this deletion? Turner s Syndrome- An incomplete or missing chromosome
Genetic Disorders A genetic disorder is an abnormality in the. They can range for a deletion of a gene to the deletion of an entire chromosome. List the types of genetic disorders. Williams Syndrome- A
More informationGene Therapy With a Difference By ANDREW POLLACK
September 23, 2013 Gene Therapy With a Difference By ANDREW POLLACK Terri Ellsworth is convinced that her 12-year-old son Billy, who has Duchenne muscular dystrophy, is being helped by an experimental
More informationMutation specific therapies
Taken from www.dmd.nl/gt. Used with permission Mutation specific therapies Introduction Two therapies for Duchenne patients are currently being tested in clinical trials, which are applicable only to patients
More informationMuscle Metabolism. Dr. Nabil Bashir
Muscle Metabolism Dr. Nabil Bashir Learning objectives Understand how skeletal muscles derive energy at rest, moderate exercise, and strong exercise. Recognize the difference between aerobic and anaerobic
More informationJULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology
JULY 21, 2018 Genetics 101: SCN1A Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology Disclosures: I have no financial interests or relationships to disclose. Objectives 1. Review genetic
More informationSALSA MLPA KIT P060-B2 SMA
SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the
More informationExon skipping in a DCM mouse model mimicking a human mutation in titin
Exon skipping in a DCM mouse model mimicking a human mutation in titin Dr. Michael Gramlich Department of Cardiology, University of Tuebingen, Germany I do not have a financial interest/arrangement or
More informationLesson Overview. Human Chromosomes. Lesson Overview. Human Chromosomes
Lesson Overview Karyotypes A genome is the full set of genetic information that an organism carries in its DNA. A study of any genome starts with chromosomes, the bundles of DNA and protein found in the
More informationThe Chromosomal Basis Of Inheritance
The Chromosomal Basis Of Inheritance Chapter 15 Objectives Explain the chromosomal theory of inheritance and its discovery. Explain why sex-linked diseases are more common in human males than females.
More information- Aya Alomoush. - Talal Al-Zabin. - Belal Azab. 1 P a g e
24 - Aya Alomoush - Talal Al-Zabin - Belal Azab 1 P a g e 1) Features of autosomal dominant inheritance: A) Vertical transmission: direct transmission from grandparent to parent to child without skipping
More informationImplementation of Newborn Screening for Duchenne Muscular Dystrophy.
Implementation of Newborn Screening for Duchenne Muscular Dystrophy. Michele A. Lloyd-Puryear, MD, PhD 1, Stuart J Moat, PhD 2, Amy Brower 3, PhD, Annie Kennedy 1, Petra Furu 4, Michael Watson, PhD 3,
More informationPrecision Medicine and Genetic Counseling : Is Yes always the correct answer?
Precision Medicine and Genetic Counseling : Is Yes always the correct answer? Beverly M. Yashar, MS, PhD, CGC Director, Graduate Program in Genetic Counseling Professor, Department of Human Genetics. (yashar@umich.edu)
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationMRC-Holland MLPA. Description version 19;
SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL
More informationA gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single
8.3 A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single chromosome can alter their pattern of inheritance from those
More informationProteins. Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids
Proteins Protein carbon, hydrogen, oxygen, nitrogen and often sulphur Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids During protein synthesis, amino acids
More informationHuman inherited diseases
Human inherited diseases A genetic disorder that is caused by abnormality in an individual's DNA. Abnormalities can range from small mutation in a single gene to the addition or subtraction of a whole
More informationClinical features, particularly those of the central nervous system, of patients with Becker s muscular dystrophy, including autopsied cases
Clinical features, particularly those of the central nervous system, of patients with Becker s muscular dystrophy, including autopsied cases Katuhito Adachi, M.D. #1, Hisaomi Kawai, M.D. #1, Miho Saito,
More informationCh. 15 The Chromosomal Basis of Inheritance
Ch. 15 The Chromosomal Basis of Inheritance Nov 12 12:58 PM 1 Essential Question: Are chromosomes the basis of inheritance? Nov 12 1:00 PM 2 1902 Walter S. Sutton, Theodor Boveri, et al Chromosome Theory
More informationExercise induced cramps and myoglobinuria in dystrophinopathy a report of three Malaysian patients
Neurology Asia 2010; 15(2) : 125 131 Exercise induced cramps and myoglobinuria in dystrophinopathy a report of three Malaysian patients 1 Azlina Ahmad Annuar, 2 Kum Thong Wong, 1 Ai Sze Ching, 3 Meow Keong
More informationChapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
More informationGenomics and Genetics in Healthcare. By Mary Knutson, RN, MSN
Genomics and Genetics in Healthcare By Mary Knutson, RN, MSN Clinical Objectives Understand the importance of genomics to provide effective nursing care Integrate genetic knowledge and skills into nursing
More informationChapter 15 Notes 15.1: Mendelian inheritance chromosome theory of inheritance wild type 15.2: Sex-linked genes
Chapter 15 Notes The Chromosomal Basis of Inheritance Mendel s hereditary factors were genes, though this wasn t known at the time Now we know that genes are located on The location of a particular gene
More informationPaula Clemens NS-065/NCNP-01 Study Chair
A Phase II, Dose Finding Study to Assess the Safety, Tolerability, Pharmacokinetics, and Pharmacodynamics of NS-065/NCNP-01 in Boys with Duchenne Muscular Dystrophy (DMD) Paula Clemens NS-065/NCNP-01 Study
More informationInheritance and the muscular dystrophies
Inheritance and the muscular dystrophies This leaflet provides a brief summary of the genetics of the muscular dystrophies. An understanding of their inheritance patterns makes it possible for families
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) (A)-Testing
More informationUnit 2 Physiology and Health Part (a) The Reproductive System HOMEWORK BOOKLET
Unit 2 Physiology and Health Part (a) The Reproductive System HOMEWORK BOOKLET Name: Homework Date Due Mark % Key Area 1 The structure and function of reproductive organs Key Area 2 Hormonal control of
More informationvariant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still
157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can
More informationBasic Definitions. Dr. Mohammed Hussein Assi MBChB MSc DCH (UK) MRCPCH
Basic Definitions Chromosomes There are two types of chromosomes: autosomes (1-22) and sex chromosomes (X & Y). Humans are composed of two groups of cells: Gametes. Ova and sperm cells, which are haploid,
More informationNon-Mendelian inheritance
Non-Mendelian inheritance Focus on Human Disorders Peter K. Rogan, Ph.D. Laboratory of Human Molecular Genetics Children s Mercy Hospital Schools of Medicine & Computer Science and Engineering University
More informationChapter 4 PEDIGREE ANALYSIS IN HUMAN GENETICS
Chapter 4 PEDIGREE ANALYSIS IN HUMAN GENETICS Chapter Summary In order to study the transmission of human genetic traits to the next generation, a different method of operation had to be adopted. Instead
More informationIowa Wellstone Center Muscle Tissue and Cell Culture Repository
Iowa Wellstone Center Muscle Tissue and Cell Culture Repository Steven A. Moore, M.D., Ph.D. The University of Iowa Department of Pathology and Iowa Wellstone Muscular Dystrophy Cooperative Research Center
More informationSee pedigree info on extra sheet 1. ( 6 pts)
Biol 321 Quiz #2 Spring 2010 40 pts NAME See pedigree info on extra sheet 1. ( 6 pts) Examine the pedigree shown above. For each mode of inheritance listed below indicate: E = this mode of inheritance
More informationThe c.65-2a>g splice site mutation is associated with a mild phenotype in Danon disease due to the transcription of normal LAMP2 mrna
Clin Genet 2016: 90: 366 371 Printed in Singapore. All rights reserved Short Report 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12724 The c.65-2a>g
More informationWhat is New in Genetic Testing. Steven D. Shapiro MS, DMD, MD
What is New in Genetic Testing Steven D. Shapiro MS, DMD, MD 18th Annual Primary Care Symposium Financial and Commercial Disclosure I have a no financial or commercial interest in my presentation. 2 Genetic
More informationSubject: Eteplirsen (Exondys 51)
09-J2000-69 Original Effective Date: 10/15/16 Reviewed: 12/12/18 Revised: 01/01/19 Next Review: 12/11/18 Subject: Eteplirsen (Exondys 51) THIS MEDICAL COVERAGE GUIDELINE IS NOT AN AUTHORIZATION, CERTIFICATION,
More informationSMA IS A SEVERE NEUROLOGICAL DISORDER [1]
SMA OVERVIEW SMA IS A SEVERE NEUROLOGICAL DISORDER [1] Autosomal recessive genetic inheritance 1 in 50 people (approximately 6 million Americans) are carriers [2] 1 in 6,000 to 1 in 10,000 children born
More informationMuscular Dystrophies. Pinki Munot Consultant Paediatric Neurologist Great Ormond Street Hospital Practical Neurology Study days April 2018
Muscular Dystrophies Pinki Munot Consultant Paediatric Neurologist Great Ormond Street Hospital Practical Neurology Study days April 2018 Definition and classification Clinical guide to recognize muscular
More informationBio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
More informationHYBRID GENE THERAPY FOR AD-EDMD
HYBRID GENE THERAPY FOR AD-EDMD Gene Therapy Prof. Isabella Saggio 2017/2018 Bertani Camilla Dezi Clara Difeo Giorgia di Palma Carmen AUTOSOMAL DOMINANT EMERY-DREIFUSS MUSCULAR DYSTROPHY Fig.1 Adapted
More informationAgro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17
Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17 INTRODUCTION - Our genes underlie every aspect of human health, both in function and
More informationCentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For certain patients the combination of symptoms does not allow
More informationGenetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance
Genetics Review Alleles These two different versions of gene A create a condition known as heterozygous. Only the dominant allele (A) will be expressed. When both chromosomes have identical copies of the
More informationGenetics, Mendel and Units of Heredity
Genetics, Mendel and Units of Heredity ¾ Austrian monk and naturalist. ¾ Conducted research in Brno, Czech Republic from 1856-1863 ¾ Curious about how traits were passed from parents to offspring. Gregor
More informationNOTES: : HUMAN HEREDITY
NOTES: 14.1-14.2: HUMAN HEREDITY Human Genes: The human genome is the complete set of genetic information -it determines characteristics such as eye color and how proteins function within cells Recessive
More informationObjectives. Genetics and Rett syndrome: As easy as apple pie! Chromosome to gene to protein
Genetics and Rett syndrome: As easy as apple pie! Victoria Mok Siu M.D., FRCPC, FCCMG ORSA conference Ottawa April 24, 2016 Objectives Review chromosomes and genes Understand s Explore the reasons behind
More informationCentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For some patients, the combination of symptoms does not allow
More informationTreatment of Duchenne Muscular Dystrophy with Oligonucleotides
Treatment of Duchenne Muscular Dystrophy with Oligonucleotides against an Exonic Splicing Enhancer Sequence Masafumi Matsuo, Mariko Yagi and Yasuhiro Takeshima Department of Pediatrics, Kobe University
More informationPERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST
INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED
More informationGenetic Disorders. n A genetic disorder is an abnormality
+ GENETIC DISORDERS + Genetic Disorders n A genetic disorder is an abnormality in an individual's DNA. Abnormalities can range from a small mutation in a single gene to the addition or subtraction of an
More informationDNA Basics. We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work.
DNA Basics We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work. DNA is packaged into structures called chromosomes. Each chromosome contains many genes and each
More informationX-linked Genetic Disorders
X-linked Genetic Disorders A genetic disorder is caused by one or more faulty genes. What are genes? Our bodies are made up of millions of cells. Each cell contains a complete set of genes. We have thousands
More informationBIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE
!! www.clutchprep.com Chromosomal theory of inheritance: chromosomes are the carriers of genetic material. Independent Assortment alleles for different characters sort independently of each other during
More informationExam #2 BSC Fall. NAME_Key correct answers in BOLD FORM A
Exam #2 BSC 2011 2004 Fall NAME_Key correct answers in BOLD FORM A Before you begin, please write your name and social security number on the computerized score sheet. Mark in the corresponding bubbles
More informationInternational Journal of Health Sciences and Research ISSN:
International Journal of Health Sciences and Research www.ijhsr.org ISSN: 2249-9571 Original Research Article Health Inequalities in Connection with Socioeconomic Position of Duchenne / Becker Muscular
More informationHuman Genetic Disorders
Human Genetic Disorders HOMOLOGOUS CHROMOSOMES Human somatic cells have 23 pairs of homologous chromosomes 23 are inherited from the mother and 23 from the father HOMOLOGOUS CHROMOSOMES Autosomes o Are
More informationLYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)!
LYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)! Kathryn Singh, MPH, MS, LCGC Associate Clinical Professor Assistant Director, Graduate Program in Genetic Counseling Division of Genetic and Genomic
More informationChapter 11. Chromosomes and Human Inheritance
Chapter 11 Chromosomes and Human Inheritance Human Chromosomes Human body cells have 23 pairs of homologous chromosomes 22 pairs of autosomes 1 pair of sex chromosomes Autosomesand Sex Chromosomes Paired
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationClass *GENETIC NOTES & WORKSHEETS
Name Class *GENETIC NOTES & WORKSHEETS DAY 1: Mendelian Genetics Vocabulary A. Genetics- Study of B. Heredity- The passing on of characteristics (traits) from to C. Trait A particular that can vary from
More informationUnderstanding The Genetics of Diamond Blackfan Anemia
Understanding The Genetics of Diamond Blackfan Anemia Jason Farrar, MD jefarrar@ About Me Assistant Professor of Pediatrics at University of Arkansas for Medical Sciences & Arkansas Children s Hospital
More informationAmyloid neuropathy: (A) scattered Congo Red positive material in endoneurium displays apple green birefringence under polarized light.
Cơ vân Cơ vân Cơ vân (cắt dọc) Amyloid neuropathy: (A) scattered Congo Red positive material in endoneurium displays apple green birefringence under polarized light. (A, Congo Red). Amyloid neuropathy:
More informationX Linked Inheritance. Information for Patients and Families. Illustrations by Rebecca J Kent
12 X Linked Inheritance M o d i f i e d f r o m l e a f l e t s p r o d u c e d b y G u y s a n d S t T h o m a s Hospital, London; and the London IDEAS Genetic Knowledge Park, according to their quality
More informationTHE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15
THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15 What you must know: Inheritance in sex-linked genes. Inheritance of linked genes and chromosomal mapping. How alteration of chromosome number or structurally
More information