Molecular Markers and Pathway Analysis of Colorectal Carcinoma in the Middle East

Transcription

1 Molecular Markers and Pathway Analysis of Colorectal Carcinoma in the Middle East Shaham Beg, MD 1 ; Abdul K. Siraj, PhD 1 ; Sarita Prabhakaran, MD 1 ; Rong Bu, MD, PhD 1 ; Maha Al-Rasheed, BSc 1 ; Mehar Sultana, MSc 1 ; Zeeshan Qadri, MSc 1 ; Mohammed Al-Assiri, MD 2 ; Rami Sairafi, MD 2 ; Fouad Al-Dayel, MD 3 ; Nasser Al-Sanea, MD 4 ; Shahab Uddin, PhD 1 ; and Khawla S. Al-Kuraya, MD 1,5 BACKGROUND: Colorectal cancer (CRC) is one of the most common cancers in the world. A newly proposed integrated pathway comprising traditional, alternate, and serrated pathways by genetic and epigenetic factors was defined recently and hypothesized to play a role in the pathogenesis of CRC; however, to the authors knowledge, there is a paucity of information regarding these proposed molecular pathways in different ethnic groups. METHODS: Molecular characterization of 770 CRC specimens was performed for microsatellite instability, BRAF, and KRAS by polymerase chain reaction and 500 cases for CpG island methylator phenotype (CIMP) high phenotype by MethyLight technology. Tumors were assigned to different molecular pathways and examined for clinicopathological correlation and survival analysis. RESULTS: The traditional pathway constituted 33.4% of CRC cases, the alternate pathway comprised 11.6%, and the serrated molecular pathway accounted for only 0.8% of Middle Eastern CRC cases. Approximately 54.2% of CRC cases did not qualify to fit into any pathway and thus were designated as an unassigned group. Molecular pathways were found to be significantly associated with tumor site and grade. A subset of cases with an uncategorized pathway demonstrated a significant survival difference (P ). CONCLUSIONS: The serrated pathway was found to account for a very low percentage of the CRC patient cohort in the current study. The unassigned group accounted for the majority of Middle Eastern CRC cases, and therefore methods of CRC pathway analysis might not be applicable to this ethnic group. The current study demonstrates the need to unravel the molecular genetic basis of this disease to further subcategorize these CRC cases. It also identifies a need for further studies on different populations for a better understanding of their exact role and incidence. Cancer 2015;121: VC 2015 American Cancer Society. KEYWORDS: alternate pathway, colorectal cancer, Middle East, molecular pathways, serrated pathway, traditional pathway. INTRODUCTION Colorectal cancer (CRC) is the third most common cancer worldwide and is the second most common cause of cancerrelated death. 1 According to the Saudi Cancer Registry 2010, CRC accounts for 10.4% of all cancers in Saudi Arabia and is the most common cancer in males and the third most common in females after breast and thyroid cancers. 2 It is estimated that the incidence will increase by 4-fold in both sexes by the year Earlier reports from Saudi Arabia suggest it represents a more aggressive disease characterized by larger tumor size, advanced stage, and an early age of onset. 4,5 Combinations of genetic and epigenetic events are involved in the pathogenesis of CRC that may differ with regard to their precursor lesions, site of disease, and molecular variability. 6 Among the genetic and epigenetic events, 3 types of instability in CRC that have been proposed, namely chromosomal instability, microsatellite instability (MSI), and CpG island methylator phenotype (CIMP). 7 Recently, other models of colorectal carcinogenesis such as integrated pathways have been proposed by Leggett and Whitehall. 8 These recent developments in the predominant pathways for sporadic CRC development have paved the way toward a better understanding of the molecular basis of CRC initiation and progression. These defined traditional, alternate, and serrated pathways are based on the following combination of genomic alterations: the traditional pathway, characterized Corresponding author: Khawla S. Al-Kuraya, MD, Human Cancer Genomic Research, King Faisal Specialist Hospital and Research Cancer, MBC#98-16, PO Box 3354, Riyadh 11211, Saudi Arabia; Fax: (011) ; Kkuraya@kfshrc.edu.sa 1 Human Cancer Genomic Research, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia; 2 Department of Surgery, Security Forces Hospital, Riyadh, Saudi Arabia; 3 Department of Pathology, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia; 4 Colorectal Unit, Department of Surgery, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia; 5 Department of Pathology, College of Medicine, Alfaisal University, Riyadh, Saudi Arabia. The first 2 authors contributed equally to this work. We thank Valorie Balde, Padmanaban Annaiyappanaidu, Hassan Al Dossarie, and Mohsen Al Hazmi for technical assistance. DOI: /cncr.29580, Received: March 10, 2015; Revised: June 11, 2015; Accepted: June 22, 2015, Published online July 28, 2015 in Wiley Online Library (wileyonlinelibrary.com) Cancer November 1,

2 TABLE 1. Primer Sequence of BRAF and KRAS Genes Exon Forward Primer Reverse Primer BRAF Exon 15 TGCTTGCTCTGATAGGAAAATG AGCATCTCAGGGCCAAAAAT KRAS Exon 1 TTAACCTTATGTGTGACATGTTCTAA AGAATGGTCCTGCACCAGTAA Exon 2 CCAGACTGTGTTTCTCCCTTC TTTAAACCCACCTATAATGGTGAA by early adenomatous polyposis coli (APC) mutation and chromosomal instability, resulting in low or stable MSI (MSS), and CIMP-negative, BRAF mutation-negative, and KRAS mutation-negative tumors; the alternate pathway, in which either KRAS or APC mutation precedes the development of MSI-low or MSS and CIMP-low tumors; and the serrated pathway, in which BRAF mutation can lead to CRCs with CIMP-high, MSI-low, or MSS phenotype. 8,9 In keeping with this classification, another study had placed the cases that do not conform to either of the pathways in an unassigned group. 10 Although the prognostic potential of these integrated pathways has been analyzed in CRC from a Western population, to our knowledge to date these traditional, alternate, and serrated pathways have not been characterized in CRC in different ethnic groups. Molecular profiles of CRC from the Middle East differ among themselves and also from those of the West and recently it has also been shown that CRC from individuals of different ethnicities harbor different mutational landscapes It is known that treatment based on KRAS status has revolutionized personalized medicine. Similarly, mutations in BRAF that have been observed in several sessile serrated adenomas also rule out the diagnosis of Lynch syndrome. 8 These findings demonstrate that stratifying patients with CRC can help with early detection and targeted interventions for better survival outcomes. To our knowledge, to date, the proposed molecular pathways have not been characterized with respect to their clinicopathologic associations or prognostic potential among CRCs occurring within different ethnic populations. To determine whether these pathways are applicable in different ethnic groups, we undertook the task of categorizing Saudi individuals with CRC to establish important correlations with clinicopathological features and understand their biologic and prognostic implications, anticipating that the results will impact clinical approaches and benefit patients. MATERIAL AND METHODS Patients and Tumor Samples Archival formalin-fixed paraffin-embedded (FFPE) blocks from 770 patients who were diagnosed with CRC and treated at the King Faisal Specialist Hospital and Research Centre between 1990 and 2011 were collected from the pathology department. All patients diagnosed with CRC during this period were randomly selected and only those with available FFPE blocks were selected. Detailed clinicopathological data were noted from case records and the institution s integrated clinical information system. This was a retrospective study approved by Research Ethics Committee of King Faisal Specialist Hospital and Research Centre and a waiver of consent was obtained for the Research Advisory Council (RAC) project RAC# DNA Extraction Genomic DNAs were extracted from FFPE cancer samples using the Gentra kit (Qiagen, Valencia, Calif) following the manufacturer s recommendation as described previously. 14 Multiple DNA punches were taken from different FFPE blocks for each case to avoid possible tumor heterogeneity in gene expression. Polymerase Chain Reaction and DNA Sequencing for KRAS and BRAF Exon 15 of BRAF and exon 1 and 2 of KRAS and their splicing sites were screened on 500 CRC samples. Primer 3 software (Whitehead Institute, Cambridge and Howard Hughes Medical Institute, Chevy Chase, Md.) was used to design the primers for the exons and their flanking intronic sequences (Table 1). Polymerase chain reaction (PCR) was performed in a total volume of 25 ll using 20 ng of genomic DNA, 2.5 ll of103 Taq buffer, 0.8 ll of MgCl2 (24 mm), 0.2 ll of dntp (24 mm), 0.2 llof Taq polymerase (5U/lL) (all reagents were from Qiagen Inc), 0.5 ll of each primer (5 lm), and water. Sequencing results were compared with the reference DNA sequence using Mutation Surveyor software (V4.04; Soft Genetics, LLC, State College, Pa). Bisulfite Modification of DNA Bisulfite modification was performed as described previously. 15 Briefly, 5 lg of genomic DNA was denatured in 0.4 M of sodium hydroxide and modified with 3 M of sodium bisulfite and 10 mm of hydroquinone at 558C for 3800 Cancer November 1, 2015

3 Pathways in Colorectal Cancer/Beg et al 16 hours. After purification with a GeneCleanIII kit (BIO 101 Inc, Vista, Calif), the DNA was desulfonated in 0.4 M of sodium hydroxide, precipitated in ethanol, and resuspended in distilled water. Real-Time PCR for Quantitative DNA Methylation Analysis Real-time PCR (MethyLight; Qiagen) for the determination of CIMP was performed as described previously. 16 We used the ABI 7300 Real-Time PCR System (Applied Biosystems, Foster City, Calif) for quantitative real-time PCR. The PCR condition was initial denaturation at 958C for 10 minutes followed by 45 cycles of 958C for 15 seconds and 608C for 1 minute. Nine sets of primers and probes were used to amplify promoters of 8 genes of interest (including cyclin-dependent kinase inhibitor 2A [CDKN2A]; cellular retinoic acid binding protein 1 [CRABP1]; neurogenin 1 [NEUROG1]; calcium channel, voltage-dependent, T type, alpha 1G subunit [CAC- NA1G]; insulin-like growth factor 2 [IGF2]; runt-related transcription factor 3 [RUNX3]; mutl homolog 1 [MLH- 1]; and suppressor of cytokine signaling 1 [SOCS1]) and COL2A1 (the collagen 2A1 gene) to normalize for the amount of input bisulfite-converted DNA. Primers and probes for all genes were previously validated and published. 17,18 The percentage of methylated reference (PMR) as described 19 for each gene was calculated by dividing the GENE:COL2A1 ratio of a sample by the GENE:COL2A1 ratio of M SssI-treated human genomic DNA (assuming it was fully methylated) and multiplying it by 100. The PMR cutoff was set at 4 to distinguish methylation positivity (PMR >4) from methylation negativity (PMR 4). The PMR cutoff of 4 as previously described 17,19-22 was used for CDKN2A, NEUROG1, CACNA1G, RUNX3, MLH-1, and SOCS1 and a PMR of 6 was used for IGF2 and CRABP1. 23 For labeling a sample as CIMP-high, a cutoff of 5 of 8 methylated CIMPspecific markers was used. One to 4 methylated genes were designated as low for CIMP and no methylated genes in the sample were labeled as CIMP negative. 24 Microsatellite Markers and Analyses Allelic imbalances were measured by performing microsatellite analysis on all matched normal and tumor tissues by PCR amplification. A reference panel of 5 pairs of microsatellite primers, comprising 2 mononucleotide microsatellites (BAT24 and BAT26) and 3 dinucleotide microsatellites (DS123, D5S346, and D17S240) were used to determine tumor MSI status. 25 Multiplex PCR was performed in a total volume of 24 ll using 50 ng of genomic DNA, 2.5 ll of103 Taq buffer, 1.5 of ll MgCl 2 (24 mm), 10 pmol of fluorescent-labeled primers, 0.05 ll of dntp (10 mm), and 0.2 ll of Taq polymerase (1UlmL-1; all reagents were from Qiagen Inc). PCR was performed using an MJ Research PTC-200 thermal cycler (MJ Research Inc., Waltham, Mass.). The samples in which the novel alleles were found in 1 and in 2 of those 5 loci were classified low MSI (MSI-L) and high MSI (MSI-H), respectively, and samples without novel alleles at any one of those loci were classified as MSS. Molecular Pathways All the molecular marker data available were used to assign CRC cases into 1 of the different proposed molecular pathways as described previously. 10 Briefly, cases were grouped into the 3 main molecular pathways: traditional (MSS, CIMP negative, BRAF negative, and KRAS negative); alternate (MSS, CIMP-low, BRAF negative, and KRAS positive); and serrated (any MSI, CIMP positive, BRAF positive, and KRAS negative). The remaining cases that could not be assigned to the above 3 pathways were classified under a separate category that was further subdivided based on dominant groups into cluster A (MSS/ MSI-L, CIMP-low, BRAF negative, and KRAS negative), cluster B (MSS/MSI-L, CIMP negative, BRAF negative, and KRAS positive) and unassigned. Correlations of these molecular pathways groups with clinicopathological parameters were performed along with survival analysis among these subgroups. Of 770 cases analyzed for tumor DNA, molecular data were available in 741 cases for MSI, in 757 cases for BRAF, and in 755 cases for KRAS. Because only 500 cases could be analyzed for CIMP, the molecular pathway study was conducted among these 500 cases (64.9%). Statistical Analysis The JMP 10.0 statistical software package (SAS Institute Inc, Cary, NC) was used for data analyses. Survival curves were generated using the Kaplan-Meier method, with significance evaluated using the Mantel-Cox log-rank test. The risk ratio (RR) was calculated using the Cox proportional hazards model on both univariate and multivariate analyses. Values of P<.05 were considered statistically significant. RESULTS Patient Characteristics Clinicopathological features of 500 molecularly analyzed CRC cases are summarized in Table 2. The median age of the patients at the time of surgery was 57 years Cancer November 1,

4 TABLE 2. Clinicopathological Variables for the Patient Cohort (n 5 500) Age, y Median 57.0 Range (IQR) b Sex Male 262 (52.4) Female 238 (47.6) Status Alive 379 (75.8) Dead 118 (23.6) Unknown 3 (0.6) Histological type Adenocarcinoma 443 (88.6) Mucinous carcinoma 57 (11.4) Histological grade Well differentiated 43 (8.6) Moderately differentiated 385 (77.2) Poorly differentiated 70 (14.2) Tumor site Left 403 (80.6) Right 85 (17.0) Unknown 12 (2.4) TNM stage of disease I 60 (12.0) II 161 (32.2) III 196 (39.2) IV 61 (12.2) Unknown 22 (4.4) a Abbreviations: IQR, interquartile range. (interquartile range, years). The majority of the tumors were moderately differentiated (77.2%) and 80.6% of the total tumors were observed in left side of the colon. The 5-year overall survival rate of the CRC cases in the current study was 70%. Of 500 patients, 97 patients received neoadjuvant chemotherapy and 280 patients received adjuvant chemotherapy after surgery. The majority of patients received 5-flouorouracil-based regimens. A total of 175 patients received neoadjuvant radiotherapy and 80 patients received adjuvant radiotherapy. Molecular Markers Analysis For the molecular markers analyzed among the 500 CRC cases, the observed independent marker values were 54 cases with MSI-H (10.9%), 94 cases with MSI-L (19.1%), and 346 cases with MSS (70%). A total of 12 cases were BRAF mutation positive (2.4%) and 486 cases were BRAF mutation negative (97.6%); 150 cases were positive for the KRAS mutation (30.1%) whereas 348 cases were negative (69.9%). A total of 24 cases were labeled as CIMP-high, which constituted 4.8% of the current patient cohort (24 of 500 cases). A total of 223 cases were CIMP-low (44.6%) and 253 cases were CIMP negative (50.6%). MSI-high tumors were found to be significantly associated with right-sided tumors, mucinous histology, TNM stage II disease, and high-grade tumors. CIMP-high tumors were also significantly associated with right-sided tumors. CIMP-high phenotype and BRAF mutation were found to be significantly associated with each other (P ). A significant association was also observed between BRAF and MSI-high tumors (P ) (data not shown). Molecular Pathways Analysis We were able to assign 229 of 500 cases (45.8%) into 1 of the 3 molecular pathways. The traditional pathway had 167 cases (33.4%), the alternate pathway had 58 cases (11.6%), and only 4 cases (0.8%) were assigned to the serrated pathway. The remaining 271 cases (54.2%) that could not be assigned to the 3 groups cited above were subdivided into closely matching similar subgroups, as defined earlier: 130 cases in cluster A (48.0%), 67 cases in cluster B (24.7%), and 74 cases in the unassigned group (27.3%). All 500 cases with a possible combination of individual markers assessment and their pathway categorization are shown in Table 3. Because the serrated pathway was comprised of only 4 cases, we performed a clinicopathological correlation after excluding these 4 cases from the current analysis to maintain the significance of the P value. Patients with traditional pathway tumors had a mean age of 55 years, which was lower than that of patients with serrated and alternate pathway tumors, but this difference was not found to be statistically significant (P ). Molecular pathways demonstrated a significant association with tumor grade (P ) and TNM stage (P ) and a strong association with tumor site (P<.0001) (Table 4). All 4 cases of serrated pathway tumors were right-sided tumors. Survival Analysis Survival analysis was performed for each individual molecular marker and different molecular pathways. Kaplan- Meier survival curves were generated for each marker and integrated pathways. The results indicated that MSI-H tumors were significantly associated with a better overall survival of 86.3 months compared with 65.8 months for tumors with MSS and 80.0 months in MSI-L tumors (P ). KRAS-mutated tumors were significantly associated with a worse survival outcome when compared with KRAS wild-type tumors (P ) (Fig. 1). No significant survival difference was noted between BRAFmutated and wild-type tumors or between CIMP-high and non-cimp-high tumors. Kaplan-Meier survival curves demonstrated the alternate pathway to have worse 3802 Cancer November 1, 2015

5 Pathways in Colorectal Cancer/Beg et al TABLE 3. Molecular Pathways Assignment According to Individual Molecular Marker MSI CIMP BRAF KRAS No. of Cases (n) Pathway MSI-H CIMP low Negative Positive 13 Unassigned MSI-H CIMP low Negative Negative 17 Unassigned MSI-H CIMP high Positive Negative 3 Serrated MSI-H CIMP high Negative Positive 1 Unassigned MSI-H CIMP high Negative Negative 4 Unassigned MSI-H CIMP negative Positive Negative 1 Unassigned MSI-H CIMP negative Negative Positive 4 Unassigned MSI-H CIMP negative Negative Negative 10 Unassigned MSI-H CIMP negative NA Negative 1 Unassigned MSI-L CIMP low Positive Positive 1 Unassigned MSI-L CIMP low Positive Negative 1 Unassigned MSI-L CIMP low Negative Positive 13 Alternate MSI-L CIMP low Negative Negative 30 Cluster A MSI-L CIMP Low NA NA 1 Unassigned MSI-L CIMP high Negative Positive 2 Unassigned MSI-L CIMP high Negative Negative 3 Unassigned MSI-L CIMP negative Negative Positive 14 Cluster B MSI-L CIMP negative Negative Negative 29 Traditional MSI-S CIMP low Positive Negative 2 Unassigned MSI-S CIMP low Negative Positive 44 Alternate MSI-S CIMP low Negative Negative 100 Cluster A MSI-S CIMP high Positive Negative 1 Serrated MSI-S CIMP high Negative Positive 4 Unassigned MSI-S CIMP high Negative Negative 5 Unassigned MSI-S CIMP negative Positive Negative 3 Unassigned MSI-S CIMP-Negative Negative Positive 52 Cluster B MSI-S CIMP negative Negative Negative 135 Traditional NA CIMP low Negative Positive 1 Alternate NA CIMP high Negative NA 1 Unassigned NA CIMP negative Negative Positive 1 Cluster B NA CIMP negative Negative Negative 3 Traditional Abbreviations: CIMP, CpG island methylator phenotype; MSI, microsatellite instability; MSI-H, high MSI; MSI-L, low MSI, MSI-S, stable MSI; NA, not available. TABLE 4. Clinicopathological Correlation of Molecular Pathways in 500 Cases of CRC Characteristics All Cases Traditional Alternative Unassigned Total n n (33.7%) n 5 58 (11.7%) n (54.6%) P Age, y Mean > (65.5) 105 (62.9) 40 (69.0) 180 (66.4) (34.5) 62 (37.1) 18 (31.0) 91 (33.6) Sex Male 260 (52.4) 85 (50.9) 30 (51.7) 145 (53.5).8632 Female 236 (47.6) 82 (49.1) 28 (48.3) 126 (46.5) Histology Adenocarcinoma 439 (88.5) 153 (91.6) 53 (91.4) 233 (86.0).1460 Mucinous 57 (11.5) 14 (8.4) 5 (8.6) 38 (14.0) TNM stage of disease I 59 (12.4) 16 (9.9) 5 (9.6) 38 (14.6).0078 II 159 (33.5) 52 (32.1) 9 (17.3) 98 (37.7) III 195 (41.1) 71 (43.8) 33 (63.5) 91 (35.0) IV 61 (12.9) 23 (14.2) 5 (9.6) 33 (12.7) Grade Well differentiated 42 (8.5) 9 (5.4) 5 (8.8) 28 (10.4).0150 Moderately differentiated 383 (77.5) 143 (85.6) 46 (80.7) 194 (71.8) Poorly differentiated 69 (14.0) 15 (9.0) 6 (10.5) 48 (17.8) Tumor site Left 403 (83.3) 156 (95.1) 48 (84.2) 199 (75.7) <.0001 Right 81 (6.7) 8 (4.9) 9 (15.8) 64 (24.3) Status Dead 376 (76.3) 133 (80.6) 40 (69.0) 203 (75.2).1674 Alive 117 (23.7) 32 (9.4) 18 (31.0) 67 (24.8) Abbreviation: CRC, colorectal carcinoma. Cancer November 1,

6 Figure 1. Kaplan-Meier survival curves of individual molecular markers: (A) KRAS; (B) BRAF; (C) CpG island methylator phenotype (CIMP), and (D) microsatellite instability (MSI). MSI-H indicates high MSI, MSI-L, low MSI, MSS, microsatellite stable. survival compared with traditional and unassigned groups, but this difference demonstrated only a trend (P ); however, when uncategorized subgroups were compared among each other, tumors in cluster B demonstrated statistically significantly poor survival (P ) (Fig. 2). On multivariate analysis using the Cox proportional hazards model, MSI-H cases demonstrated better survival when adjusted for age (hazard ratio, 0.38; 95% confidence interval [95% CI], [P 5.008]) and also maintained significance when adjusted for multiple factors such as age at diagnosis, sex, tumor site, TNM stage, grade, adjuvant chemotherapy, and unassigned category. When adjusted for age, KRAS-positive tumors were found to be significantly associated with poor survival, with a hazard ratio of 1.74 (95% CI, ; P 5.004) and were also statistically significant when adjusted for age at diagnosis, sex, tumor site, TNM stage, and grade (hazard ratio, 1.83; 95% CI, [P 5.003]). BRAF was not found to be associated with significant survival differences on the multivariate model when adjusted for age alone or in combination with other clinical variables, but CIMP-high cases demonstrated a significantly poor outcome when adjusted for multiple variables (hazard ratio, 2.90; 95% CI, [P 5.031]) (Table 5). We did not include the molecular pathways in the above multivariate analysis due to the low number of cases in the serrated group that made comparison less meaningful. On univariate analysis, cluster B was associated with a worse survival outcome with a risk ratio of 2.56 (95% CI, ; P 5.006) (Table 6), but this difference was not found to be statistically significant on multivariate analysis. DISCUSSION CRC arises from the accumulation of genetic and epigenetic changes that comprise the basis of different assigned molecular pathways. These molecular pathways were not elucidated in our population. In our attempt to study molecular alterations in pathway analysis of Saudi cases of CRC, we found that the traditional pathway accounts for 33.4% and the alternate pathway 11.6%, which is in concordance with previously published data regarding a 3804 Cancer November 1, 2015

7 Pathways in Colorectal Cancer/Beg et al Figure 2. Kaplan-Meier survival curves for molecular pathways. (A) Survival by 3 major pathways and unassigned group. (B) Survival by 3 subgroups of the unassigned group. Western population. 10 It is interesting to note that the serrated pathway, which is shown to comprise approximately 25% of cases in the published literature, accounted only for 0.8% of the analyzed Saudi cases of CRC in the current study. There are many hypothesized reasons to explain this significant difference between Saudi CRC case and published Western data. One reason could possibly be ethnicity, which might play a role in the genetic characterization of tumors in different populations. Because the serrated pathway depends on the CIMP positivity, the strikingly low prevalence of CIMP-positive cases in the current study contributed to the lower percentage of cases with the serrated pathway. Conversely, the lower incidence of CIMP can be attributed to many factors that could possibly be genetic and/or environmental. 26 A published association of CIMP-high tumors included right-sided tumors, older age, physical inactivity, and smoking. 27,28 The current study population was at least a decade younger compared with Western populations studied, 83.3% of the tumors were left sided, and the patients belonged to a distinct ethnic group. These findings may possibly explain the low incidence of CIMPhigh tumors in the current population. In the literature, mixed results have been published regarding the prognostic role of CIMP in CRC. 16,29-31 To the best of our knowledge, there currently are no set guidelines for labeling CRC as CIMP-high because incidences vary depending on the panel of genes selected, choices of probes, location of the methylation island, cutoff points, and the TABLE 5. Multivariate Analysis of Individual Molecular Markers in 500 Cases of CRC Molecular Features Total Deaths Multivariate HR (95% CI) a Multivariate HR (95% CI) b MSS (referent) 1.00 (referent) MSI low ( ) 0.54 ( ) MSI high ( ) 0.26 ( ) P CIMP negative (referent) 1.00 (referent) CIMP low ( ) 1.36 ( ) CIMP high ( ) 2.90 ( ) P BRAF mutation negative (referent) 1.00 (referent) BRAF mutation positive ( ) 2.71 ( ) P KRAS mutation negative (referent) 1.00 (referent) KRAS mutation positive ( ) 1.83 ( ) P Abbreviations: 95% CI, 95% confidence interval; CIMP, CpG island methylator phenotype; CRC, colorectal carcinoma; HR, hazard ratio; MSI, microsatellite instability; MSS, microsatellite stable. a Adjusted for age at diagnosis. b Adjusted for age at diagnosis, sex, TNM stage of disease, tumor grade, and anatomic subsite. Cancer November 1,

8 TABLE 6. Univariate and Multivariate Analysis of Unassigned Pathways Using the Cox Proportional Hazards Model Univariate Multivariate Clinical Parameters RR (95% CI) P a RR (95% CI) P a Age, y > ( ) 0.64 ( ) Sex Male 1.15 ( ) 1.01 ( ) TNM stage of disease <.0001 <.0001 IV 8.00 ( ) 7.93 ( ) Grade Poorly differentiated 1.48 ( ) 1.78 ( ) Tumor site ( ) 0.72 ( ) MSI MSI-low/MSS 0.46 ( ) 0.20 ( ) Adjuvant chemotherapy ( ) 0.71 ( ) Pathways Unassigned Cluster A 1.33 ( ) ( ).170 Cluster B 2.56 ( ) ( ).884 Abbreviations: 95% CI, 95% confidence interval; MSI, microsatellite instability; MSI-L, low MSI, MSS, stable MSI; RR, risk ratio. a Bold type indicates statistical significance. technology used. Therefore, a consensus must be established for true comparison among different population. The other factor that contributes to the very low serrated pathway is the lower incidence of BRAF mutation in patients with CRC. The incidence of BRAF in the Saudi population is 2.5%, as also shown previously by our group, whereas in the West it is reportedly >10%. 7,32 Again ethnicity as well as genetic and environmental factors might play a role in the low rate of BRAF mutations noted in the Saudi population. BRAF mutation has been known to be associated with right-sided tumors and an older age group. 33,34 Moreover, the significantly lower incidence of BRAF mutations in the current study suggests the existence of a possibly higher number of familial syndromes such as hereditary nonpolyposis colorectal cancer that are characterized by a virtual lack of BRAF abnormalities. Another striking difference is that CRC among Saudi patients has a very low predilection for right-sided tumors. As mentioned earlier, left-sided tumors constituted 83.3% of the cases in the current study, which is higher than the rate of 60% reported in high-incidence populations. 35 In addition, age at onset is being proposed as one of the major criteria in classifying CRC. 36 The mean age in the current study cohort was at least a decade younger than that of Western populations. 37 Because leftsided CRC has been reported to be associated with younger age, 38 this may possibly explain the high incidence of left-sided tumors noted in the current study population. We believe the finding that the majority of CRC cases in the current study cohort were left-sided tumors and the patients had a lower mean age at the time of diagnosis compared with Western populations can explain in part the low prevalence of BRAF noted herein and hence the low incidence of the serrated pathway compared with a Western population. This is a unique finding in this ethnic population. In addition, published risk factors for left-sided tumors include a high consumption of red meat, which is quite frequent in this region Sugai et al have proposed that the molecular carcinogenesis of left-sided tumors is different from that of right-sided tumors. 42 Because there is a predilection for left-sided tumors in our region, the molecular pathways involved in the tumorigenesis of left-sided CRC might be playing a dominant role in this ethnic group. We found that tumor site was consistently associated with the molecular pathways and with all 4 individual molecular markers. In the current study cohort, KRAS and MSI were found to be predictors of clinical outcome. KRAS mutation has also previously been reported by our group to be an independent poor prognostic marker on a smaller sample size. 14 MSI-high tumors have been shown to predict a better survival outcome compared with MSS tumors and these results are consistent with the data reported in Western populations. 43 BRAF and CIMP were found to play no prognostic role in the current study cohort. Due to molecular complexities in the pathogenesis of CRC, such combined analyses of molecular markers 3806 Cancer November 1, 2015

9 Pathways in Colorectal Cancer/Beg et al (pathways) are being performed to better understand the disease process and to elucidate a possible relationship with factors affecting patient outcome. In our analysis of pathways, we found that tumor site, stage of disease, and tumor grade were significantly associated with molecular pathways (P<.001; P , and P , respectively). Approximately 95.1% of the traditional pathway tumors were left sided, and 80.7% of the alternate pathway and 85.6% of the traditional pathway tumors were grade 2. When comparing the prognostic role of different molecular pathways in the current study cohort, we found that there was no significant survival difference among the 4 major pathways. In our attempt to segregate the unassigned groups into 3 further subgroups (namely cluster A, cluster B, and the truly unassigned group) based on dominant clustering of cases, we found cluster B to have a significantly poor survival outcome compared with other subgroups of unassigned pathways (P<.0079). The current study showed results comparable to that of single study 10 performed regarding molecular pathways for survival outcome. The only known difference in the published study was that it was performed on an older-aged female population in comparison with the current study, which tended to be representative of all patients irrespective of age or sex. These findings may provide a basis for categorizing tumors according to the molecular pathways. However, approximately one-half of the cases in the current study could not be categorized into known major pathways and therefore we hypothesized there might be other unknown pathways or molecular mechanisms distinct to this ethnic group. Because molecular pathways are found to be associated with some clinicopathological parameters, more studies are warranted for better understanding the pathogenesis of CRC in the Saudi population. One of the limitations of the current study was that we were unable to analyze for CRC-specific mortality, for which the data were lacking. Conclusions To the best of our knowledge, the current study is the first of its kind from this continent and the results demonstrated differences in pathways in our ethnic population compared with the West. It is interesting to note that the majority of cases in the current study could not be classified under any of these pathways, which account for >50% of the current study cases, and reflects the complexity and heterogeneity of CRC pathogenesis. Identifying the molecular pathways and characterization of CRC in this group might be crucial for identifying a new targetable pathway in CRC in the era of personalized medicine. Therefore, efforts are currently ongoing in our laboratory to further analyze these cases using state-of-art technologies such as next-generation sequencing for a better understanding of these proposed and other unknown pathways that might exist and have significant clinical relevance and prognostic outcomes. FUNDING SUPPORT No specific funding was disclosed. CONFLICT OF INTEREST DISCLOSURES The authors made no disclosures. REFERENCES 1. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin. 2011;61: Bazarbashi S. Cancer Incidence Report, Saudi Arabia. Kingdom of Saudi Arabia, Ministry of Health, Saudi Cancer Registry; 2010: Ibrahim EM, Zeeneldin AA, El-Khodary TR, Al-Gahmi AM, Bin Sadiq BM. Past, present and future of colorectal cancer in the Kingdom of Saudi Arabia. Saudi J Gastroenterol. 2008;14: Aljebreen AM. Clinico-pathological patterns of colorectal cancer in Saudi Arabia: younger with an advanced stage presentation. Saudi J Gastroenterol. 2007;13: Isbister WH. Colorectal cancer below age 40 in the Kingdom of Saudi Arabia. Aust N Z J Surg. 1992;62: Vogelstein B, Kinzler KW. Cancer genes and the pathways they control. Nat Med. 2004;10: Pritchard CC, Grady WM. Colorectal cancer molecular biology moves into clinical practice. Gut. 2011;60: Leggett B, Whitehall V. Role of the serrated pathway in colorectal cancer pathogenesis. Gastroenterology. 2010;138: Bettington M, Walker N, Clouston A, Brown I, Leggett B, Whitehall V. The serrated pathway to colorectal carcinoma: current concepts and challenges. Histopathology. 2013;62: Samadder NJ, Vierkant RA, Tillmans LS, et al. Associations between colorectal cancer molecular markers and pathways with clinicopathologic features in older women. Gastroenterology. 2013;145: e Chan AO, Soliman AS, Zhang Q, et al. Differing DNA methylation patterns and gene mutation frequencies in colorectal carcinomas from Middle Eastern countries. Clin Cancer Res. 2005;11: Soliman AS, Bondy ML, El-Badawy SA, et al. Contrasting molecular pathology of colorectal carcinoma in Egyptian and Western patients. Br J Cancer. 2001;85: Guda K, Veigl ML, Varadan V, et al. Novel recurrently mutated genes in African American colon cancers. Proc Natl Acad Sci U S A. 2015;112: Abubaker J, Bavi P, Al-Haqawi W, et al. Prognostic significance of alterations in KRAS isoforms KRAS-4A/4B and KRAS mutations in colorectal carcinoma. J Pathol. 2009;219: Siraj AK, Hussain AR, Al-Rasheed M, et al. Demethylation of TMS1 gene sensitizes thyroid cancer cells to TRAIL-induced apoptosis. J Clin Endocrinol Metab. 2011;96:E215-E Ogino S, Nosho K, Kirkner GJ, et al. CpG island methylator phenotype, microsatellite instability, BRAF mutation and clinical outcome in colon cancer. Gut. 2009;58: Ogino S, Kawasaki T, Brahmandam M, et al. Precision and performance characteristics of bisulfite conversion and real-time PCR (MethyLight) for quantitative DNA methylation analysis. J Mol Diagn. 2006;8: Ogino S, Cantor M, Kawasaki T, et al. CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies. Gut. 2006;55: Cancer November 1,

10 19. Eads CA, Lord RV, Wickramasinghe K, et al. Epigenetic patterns in the progression of esophageal adenocarcinoma. Cancer Res. 2001;61: Eads CA, Danenberg KD, Kawakami K, et al. MethyLight: a highthroughput assay to measure DNA methylation. Nucleic Acids Res. 2000;28:e Widschwendter M, Siegmund KD, Muller HM, et al. Association of breast cancer DNA methylation profiles with hormone receptor status and response to tamoxifen. Cancer Res. 2004;64: Eads CA, Lord RV, Kurumboor SK, et al. Fields of aberrant CpG island hypermethylation in Barrett s esophagus and associated adenocarcinoma. Cancer Res. 2000;60: Samowitz WS. The CpG island methylator phenotype in colorectal cancer. J Mol Diagn. 2007;9: Kim JH, Shin SH, Kwon HJ, Cho NY, Kang GH. Prognostic implications of CpG island hypermethylator phenotype in colorectal cancers. Virchows Arch. 2009;455: Boland CR, Thibodeau SN, Hamilton SR, et al. A National Cancer Institute Workshop on Microsatellite Instability for cancer detection and familial predisposition: development of international criteria for the determination of microsatellite instability in colorectal cancer. Cancer Res. 1998;58: Hughes LA, Khalid-de Bakker CA, Smits KM, et al. The CpG island methylator phenotype in colorectal cancer: progress and problems. Biochim Biophys Acta. 2012;1825: Hughes LA, Simons CC, van den Brandt PA, et al. Body size, physical activity and risk of colorectal cancer with or without the CpG island methylator phenotype (CIMP). PLoS One. 2011;6:e Slattery ML, Curtin K, Sweeney C, et al. Diet and lifestyle factor associations with CpG island methylator phenotype and BRAF mutations in colon cancer. Int J Cancer. 2007;120: Arain MA, Sawhney M, Sheikh S, et al. CIMP status of interval colon cancers: another piece to the puzzle. Am J Gastroenterol. 2010; 105: Van Rijnsoever M, Elsaleh H, Joseph D, McCaul K, Iacopetta B. CpG island methylator phenotype is an independent predictor of survival benefit from 5-fluorouracil in stage III colorectal cancer. Clin Cancer Res. 2003;9: Ogino S, Meyerhardt JA, Kawasaki T, et al. CpG island methylation, response to combination chemotherapy, and patient survival in advanced microsatellite stable colorectal carcinoma. Virchows Arch. 2007;450: Siraj AK, Bu R, Prabhakaran S, et al. A very low incidence of BRAF mutations in Middle Eastern colorectal carcinoma. Mol Cancer. 2014;13: Kalady MF, Dejulius KL, Sanchez JA, et al. BRAF mutations in colorectal cancer are associated with distinct clinical characteristics and worse prognosis. Dis Colon Rectum. 2012;55: Thiel A, Ristimaki A. Toward a molecular classification of colorectal cancer: the role of BRAF. Front Oncol. 2013;3: Haenszel W, Correa P. Cancer of the large intestine: epidemiologic findings. Dis Colon Rectum. 1973;16: Perea J, Rueda D, Canal A, et al. Age at onset should be a major criterion for subclassification of colorectal cancer. J Mol Diagn. 2014;16: Yamauchi M, Morikawa T, Kuchiba A, et al. Assessment of colorectal cancer molecular features along bowel subsites challenges the conception of distinct dichotomy of proximal versus distal colorectum. Gut. 2012;61: Saltzstein SL, Behling CA. Age and time as factors in the left-toright shift of the subsite of colorectal adenocarcinoma: a study of 213,383 cases from the California Cancer Registry. J Clin Gastroenterol. 2007;41: Musaiger AO. Socio-cultural and economic factors affecting food consumption patterns in the Arab countries. J R Soc Health. 1993; 113: Norat T, Lukanova A, Ferrari P, Riboli E. Meat consumption and colorectal cancer risk: dose-response meta-analysis of epidemiological studies. Int J Cancer. 2002;98: Larsson SC, Wolk A. Meat consumption and risk of colorectal cancer: a meta-analysis of prospective studies. Int J Cancer. 2006;119: Sugai T, Habano W, Jiao YF, et al. Analysis of molecular alterations in left- and right-sided colorectal carcinomas reveals distinct pathways of carcinogenesis: proposal for new molecular profile of colorectal carcinomas. J Mol Diagn. 2006;8: Guastadisegni C, Colafranceschi M, Ottini L, Dogliotti E. Microsatellite instability as a marker of prognosis and response to therapy: a meta-analysis of colorectal cancer survival data. Eur J Cancer. 2010; 46: Cancer November 1, 2015