Supplementary Information
|
|
- Julia Waters
- 5 years ago
- Views:
Transcription
1 Supplementary Information Detection and differential diagnosis of colon cancer by a cumulative analysis of promoter methylation Qiong Yang 1,3*, Ying Dong 2,3, Wei Wu 1, Chunlei Zhu 1, Hui Chong 1, Jiangyang Lu 2*, Dehai Yu 1 Libing Liu 1, Fengting Lv 1, Shu Wang 1* 1 Beijing National Laboratory for Molecular Sciences, Key Laboratory of Organic Solids, Institute of Chemistry, Chinese Academy of Sciences, Beijing , P. R. China. yangqiong@iccas.ac.cn; wangshu@iccas.ac.cn 2 The First Hospital Affiliated to General Hospital of the Chinese People s Liberation Army, Beijing , P. R. China. lujy@263.com 3 Equal contributions to this work 1
2 Supplementary Figure S1. Standard curves for quantitative determination of the degree of DNA methylation Supplementary Figure S1. The degree of methylation indicates the percentage of methylation of the CDKN2A/P16 gene promoter. The samples showing different degrees of methylation are prepared by mixing known fully methylated and unmethylated DNA samples. 2
3 Supplementary Table S1. Comparision of CCP-based FRET method and bisulfite sequencing for detecting the methylation degree of CDKN2A/p16 gene promoter Sample CCP-based FRET method Bisulfite sequencing Caco2 cell line 100% 100% Colo320 cell line 97% 100% HT29 cell line 96% 100% HEK293cell line 0% 0% 1# Normal colon tissue Can not be detected 11 % 2# Normal colon tissue 0% 2.7 % 4 # Adenoma 63% 52% 5# Adenoma 9% 0 % 8# Adenoma 6% 0 % 11# Adenoma 33% 20% 15# Adenoma 14% 7.5% 17# Adenoma 10% 0 % 26# Adenoma 3% 0 % 31# Carcinoma 68% 66 % 32# Carcinoma 68% 53 % 33# Carcinoma 12% 0 % 34# Carcinoma 10% 0 % 35# Carcinoma 31% 10 % 3
4 Supplementary Table S2. Statistical significance of each of the colon cancer-related gene promoter methylation in 80 cases. Colon-related gene P value a Carcinoma+Adenoma VS. Normal Carcinoma VS. Adenoma VIM < MGMT CDKN2A/p16 <0.001 <0.001 MLH ESR1 < APC < TMEFF2/HPP <0.001 a Statistical significance was analyzed by the Mann-Whitney U test. 4
5 Supplementary Table S3. Validation of the CCP-FRET system and discrimination equations in 30 blind cases using three combined methylation alterations (VIM, APC and CDKN2A/P16). Samples Detection results from CCP-FRET and discrimination equation Pathologic diagnosis P81 Positive Carcinoma P82 Positive Carcinoma P83 Positive Carcinoma P84 Positive Carcinoma P85 Positive Carcinoma P86 Positive Carcinoma P87 Positive Carcinoma P88 Positive Carcinoma P89 Positive Carcinoma P90 Positive Carcinoma P91 Positive Adenoma P92 Positive Adenoma P93 Negative (False) Adenoma P94 Positive Adenoma P95 Positive Adenoma P96 Negative (False) Adenoma P97 Positive Adenoma P98 Positive Adenoma P99 Negative (False) Adenoma P100 Positive Adenoma P101 Negative Normal P102 Negative Normal P103 Negative Normal P104 Negative Normal P105 Negative Normal P106 Negative Normal P107 Positive (False) Normal P108 Negative Normal P109 Positive (False) Normal P110 Positive (False) Normal Correct rate 80% 5
6 Supplementary Table S4. Validation of the differential diagnosis in 20 blind patient cases using two combined methylation alterations (TMEFF2/HPP1 and CDKN2A/P16). Samples Detection results from CCP-based FRET and Pathologic diagnosis discrimination equation P81 Carcinoma Carcinoma P82 Carcinoma Carcinoma P83 Carcinoma Carcinoma P84 Carcinoma Carcinoma P85 Carcinoma Carcinoma P86 Carcinoma Carcinoma P87 Carcinoma Carcinoma P88 Carcinoma Carcinoma P89 Carcinoma Carcinoma P90 Carcinoma Carcinoma P91 Adenoma Adenoma P92 Adenoma Adenoma P93 Adenoma Adenoma P94 Carcinoma (False) Adenoma P95 Adenoma Adenoma P96 Adenoma Adenoma P97 Adenoma Adenoma P98 Adenoma Adenoma P99 Adenoma Adenoma P100 Adenoma Adenoma Correct rate 97.6% 6
7 Supplementary Table S5. Comparing the sensitivity of combination and single biomarker in differential diagnosis Detection mode Sensitivity (P value) Specificity Single TMEFF2/HPP1 80% (=0.0373) 92% Signal CDKN2A/P16 22% (<0.001) 92% Combination of two biomarkers 94% 92% P, Chi-square test is used to compare the different significance of detection sensitivity of combined methylation alterations to that of single one. n carcinoma = 50; n adenoma = 50. 7
8 Supplementary Table S6. Clinical characteristics of 50 carcinomas cases Patient Degree of tumor Serosa Lymph node CIMP Gender Age at surgery no. differentiation invasion metastasis 44 N Female 70 Well Negative Positive 35 N Male 57 Well Negative Negative 8 N Male 65 Well Negative Positive 1 N Male 66 Moderate Negative Positive 29 N Female 75 Moderate Positive Positive 39 N Male 84 Moderate Negative Negative 12 N Male 74 Moderate Negative Negative 13 N Male 67 Moderate Negative Negative 34 N Female 72 Moderate Negative Positive 37 N Female 63 Poor Negative Negative 43 N Female 70 Moderate Negative Negative 50 N Female 73 Poor Negative Negative 17 N Female 75 Moderate Positive Positive 20 L Female 77 Poor Positive Positive 25 L Female 55 Poor Negative Positive 45 L Male 65 Well Positive Negative 47 L Female 87 Moderate Negative Negative 2 L Male 52 Moderate Negative Negative 3 L Male 63 Moderate Positive Positive 6 L Male 74 Moderate Negative Negative 9 L Female 71 Moderate Negative Negative 14 L Female 66 Moderate Positive Positive 22 L Female 74 Moderate Negative Negative 23 L Male 73 Moderate Negative Negative 26 L Male 60 Poor Positive Positive 28 L Male 60 Moderate Negative Negative 46 L Female 66 Well Positive Positive 49 L Male 70 Moderate Negative Negative 7 H Male 75 Poor Positive Positive 15 H Male 57 Moderate Negative Positive 16 H Male 85 Moderate Positive Negative 19 H Male 42 Poor Positive Positive 24 H Female 50 Poor Positive Negative 27 H Female 78 Moderate Positive Negative 30 H Female 70 Moderate Positive Positive 32 H Male 74 Poor Positive Negative 33 H Female 75 Poor Positive Positive 36 H Female 35 Poor Negative Negative 38 H Female 87 Moderate Positive Negative 40 H Male 60 Moderate Positive Positive 41 H Female 85 Poor Negative Positive 8
9 42 H Female 59 Moderate Positive Positive 48 H Female 86 Moderate Positive Positive 4 H Female 68 Poor Negative Negative 5 H Female 60 Moderate Negative Positive 10 H Male 68 Poor Positive Positive 18 H Female 74 Well Positive Negative 21 H Female 79 Moderate Negative Negative 31 H Female 53 Well Negative Negative 11 H Male 56 Poor Positive Positive 9
10 Supplementary Table S7. Sequences of primers for amplifying the promoter regions of seven colon cancer-related genes Gene symbol Forward primer 5-3 Reverse primer (5-3 ) Product size (bp) Number of 5 CCGG3 site VIM GCCCTCGTTCGCCTCTTCT GGTGGACGTAGTCACGTAGC MGMT TGGCAAACTAAGGCACAGA GCATCCTCGCTGGACGC TMEFF2/ HPP1 GTTAGACCTTCTCTCGTCGC GAAAGGCTCCTCTGCATACG ESR1 GCATATGAGCTCGGGAGACC GCCGACACGCGAGCTCTGG CDKN2A/ P16 TCCTTCCTTGCCAACGCT GCCCCTCCTCTTTCTTCCTC APC GACAGAACAGCGAAGCAGTG AGGTGGGAAGACTACAATGC MLH1 TACGATGAGGCGGCGACAGA GCCAATAGGA GCAGAGATG
11 Supplementary Table S8. Sequences of primers for amplying the promoter regions in three CIMP-related genes Pimers Sequences (5-3 ) NEUROG1-F CAGCTTAGCCCGAGCCGA NEUROG1-R TTTATGCTCGCGGGAGGCC CACNA1G-F CAGGGGAAGCGGGACTCG CACNA1G-R ATCTGGTGGGCTCTAGGG CRABP1-F TGGAGGCTGAGGCACAAC CRABP1-R GCGGCGGCAGGTACGGACA 11
12 Supplementary Table S9. Sequences of primers for amplying the promoter regions in bisulfate-modified DNA Pimers Sequences (5-3 ) VIM-in-Forward TGGGATGGTAGTGGGAGG VIM-in-Reverse TAAACATAATCACATAACTC C VIM-out-Forward GGAGTAGGAAGGTTTGAGG VIM-out-Reverse AAATCCACCA AATCCTAC p16-in-forward GTA GGT GGG GAG GAG TTTAGT T p16-in-reverse CCCACCCTCTAA TAACCA ACCAA p16-out-forward GAGGGGGTAGGGGGATAT p16-out-reverse ACCAATCAACCAAAAACTCCATACTA 12
13 Supplementary Table S10. Correlation analysis of CIMP status and tumor location in 50 carcinomas cases Parameter CIMP N CIMP L CIMP H P Tumor location Proximal, n (%) 3 (23.08%) 2 (13.33%) 8 (36.36%) Distal, n (%) 10 (76.92%) 13 (86.67%) 14 (63.64%) CIMP, CpG island methylator phenotype; H, high; L, low; N, negative. Statistical significance is determined using Fisher's exact test. 13
14 Supplementary Methods To confirm the semi-quantitative results obtained from CCP-based FRET method, the methylation degrees of p16 CpG islands in 17 representative tissue samples and 4 cell lines were determined by using the bisulfite sequencing. 2 µg of the extracted DNA from cell lines, tissue samples were converted using an Epitect Bisulfite kit (Qiagen, Valencia, CA, USA) in accordance with the manufacturer s instructions. The nested -PCRs were then performed in a 25-µL reaction volume containing 1 µl of bisulfate modified DNA, 1 U of GoTaq Hot Start polymerase (Promega, Madison, USA ), 0.4 µm of each primer, 1.5 mm MgCl 2, 0.2 mm each dntp, and 1 GoTaq Flexi buffer. PCR for the sense strand of promoter areas in bisulfite-treated DNA was performed with the primers listed in the Supplementary Table 5. The reaction conditions were 95 C for 5 minutes, followed by 40 cycles at 95 C for 30 seconds and 58 C for 40 seconds, and final extension at 72 C for 10 minutes. The PCR fragments were inserted in to TA vector (Tiangen, Beijing, China) by a standard molecular experiment. About clones for each sample were picked up and cultured. Individual clones were sequenced by the deoxynucleotide chain-termination method using an ABI 310 Genetic analyzer (Applied Biosystems). 14
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon
More informationConstruction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation
Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationOriginal Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population
Int J Clin Exp Med 2014;7(12):5832-5836 www.ijcem.com /ISSN:1940-5901/IJCEM0002117 Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk
More informationThe silence of the genes: clinical applications of (colorectal) cancer epigenetics
The silence of the genes: clinical applications of (colorectal) cancer epigenetics Manon van Engeland, PhD Dept. of Pathology GROW - School for Oncology & Developmental Biology Maastricht University Medical
More informationAberrant DNA methylation of MGMT and hmlh1 genes in prediction of gastric cancer
Aberrant DNA methylation of MGMT and hmlh1 genes in prediction of gastric cancer J. Jin 1,2, L. Xie 2, C.H. Xie 1 and Y.F. Zhou 1 1 Department of Radiation & Medical Oncology, Zhongnan Hospital of Wuhan
More informationQIAGEN Driving Innovation in Epigenetics
QIAGEN Driving Innovation in Epigenetics EpiTect and PyroMark A novel Relation setting Standards for the reliable Detection and accurate Quantification of DNA-Methylation May 2009 Gerald Schock, Ph.D.
More informationBin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,
The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,
More informationDevelopment of Carcinoma Pathways
The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019
More informationOriginal Article Blood-based DNA methylation of DNA repair genes in the non-homologous end-joining (NEHJ) pathway in patient with glioma
Int J Clin Exp Pathol 2015;8(8):9463-9467 www.ijcep.com /ISSN:1936-2625/IJCEP0011215 Original Article Blood-based DNA methylation of DNA repair genes in the non-homologous end-joining (NEHJ) pathway in
More informationRelationship between SPOP mutation and breast cancer in Chinese population
Relationship between SPOP mutation and breast cancer in Chinese population M.A. Khan 1 *, L. Zhu 1 *, M. Tania 1, X.L. Xiao 2 and J.J. Fu 1 1 Key Laboratory of Epigenetics and Oncology, The Research Center
More informationOligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA
Human immunodeficiency virus (HIV) detection & quantitation by qrt-pcr (Taqman). Created on: Oct 26, 2010; Last modified by: Jul 17, 2017; Version: 3.0 This protocol describes the qrt-pcr taqman based
More informationLow levels of serum mir-99a is a predictor of poor prognosis in breast cancer
Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,
More informationankylosing spondylitis Department of Clinical Immunology, Xijing Hospital, The Fourth Military
Functional defects in CD4 + CD25 high FoxP3 + regulatory cells in ankylosing spondylitis Huifang Guo 1, 2, 3, Ming Zheng 1, 2, 3, Kui Zhang 1, 3, Fengfan Yang 1, 3, Xin Zhang 1, 3, Qing Han 1, 3, Zhi-Nan
More informationAward Number: W81XWH TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. Rajvir Dahiya, Ph.D. CONTRACTING ORGANIZATION:
More informationAssociation between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer
Association between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer M.G. He, K. Zheng, D. Tan and Z.X. Wang Department of Hepatobiliary Surgery, Nuclear Industry 215 Hospital
More informationDNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA
DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA Maria Chimonidou 1, Areti Strati 1, Nikos Malamos 2, Vasilis Georgoulias
More informationCHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)
CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar
More informationStudy on Serotype and Apx Toxins Type of Actinobacillus pleuropneumoniae Strains Isolated from Shandong Province
2005,38(11):2349-2354 Scientia Agricultura Sinica Apx 271018 : 85 APP PCR APX 20 5 APP 7 6 5 5 3 4 4 3 8 2 7 5 APP PCR APP 4 (Apx) 3 4 8 APP Apx 5 Apx 7 20 APP APP 99.5 ~100 APP Apx 5 APP PCR : Study on
More informationEpigenetic profiling of synchronous colorectal neoplasias by quantitative DNA methylation analysis
& 2006 USCAP, Inc All rights reserved 0893-3952/06 $30.00 www.modernpathology.org Epigenetic profiling of synchronous colorectal neoplasias by quantitative DNA methylation analysis Shuji Ogino 1,2,3, Mohan
More informationMyoglobin A79G polymorphism association with exercise-induced skeletal muscle damage
Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage T. Cui and M.S. Jiang College of Physical Education, Shandong University of Finance and Economics, Ji nan, Shandong,
More informationXMRV among Prostate Cancer Patients from the Southern United States and Analysis of Possible Correlates of Infection
XMRV among Prostate Cancer Patients from the Southern United States and Analysis of Possible Correlates of Infection Bryan Danielson Baylor College of Medicine Department of Molecular Virology and Microbiology
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
More informationTITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. CONTRACTING ORGANIZATION: Northern California
More informationLack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population
Lack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population J.J. Lu, H.Q. Zhang, P. Mai, X. Ma, X. Chen, Y.X. Yang and L.P. Zhang Gansu Provincial Hospital, Donggang
More informationSerrated Polyps and a Classification of Colorectal Cancer
Serrated Polyps and a Classification of Colorectal Cancer Ian Chandler June 2011 Structure Serrated polyps and cancer Molecular biology The Jass classification The familiar but oversimplified Vogelsteingram
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationJoint Department of Biomedical Engineering
Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for
More informationCytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M0042F): Acid-mediated intra-molecular cycloadditions enhance
SUPPORTING INFORMATION Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M42F): Acid-mediated intra-molecular cycloadditions enhance chemical diversity Zhuo Shang, Ritesh Raju,
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Schlenk RF, Döhner K, Krauter J, et al. Mutations and treatment
More informationLa genetica del carcinoma colo-rettale
La genetica del carcinoma colo-rettale Ivana Cataldo Ospedale Ca Foncello, Treviso ARC-NET Centro di Ricerca Applicata sul Cancro AOUI, Verona OUTLINE What s new in colorectal cancer? Pathological Markers
More informationClinical and Pathological Significance of Epigenomic Changes in Colorectal Cancer
Clinical and Pathological Significance of Epigenomic Changes in Colorectal Cancer Shuji Ogino, M.D., Ph.D. Associate Professor of Pathology Harvard Medical School Brigham and Women s Hospital Dana-Farber
More informationAberrant promoter methylation of the cadherin 13 gene in serum and its relationship with clinicopathological features of prostate cancer
Research Report Aberrant promoter methylation of the cadherin 13 gene in serum and its relationship with clinicopathological features of prostate cancer Journal of International Medical Research 2014,
More informationA panel of DNA methylation markers for the detection of prostate cancer from FV and DRE urine DNA
Brikun et al. Clinical Epigenetics (2018) 10:91 https://doi.org/10.1186/s13148-018-0524-x RESEARCH Open Access A panel of DNA methylation markers for the detection of prostate cancer from FV and DRE urine
More informationInfluence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population
Influence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population H.B. Gui 1, X.G. Du 2, Z.H. Fu 3 and X.M. Chen 1 1 Department of Emergency, The First Affiliated
More informationSupplementary Figures. Supplementary Figure 1. Treatment schematic of SIV infection and ARV and PP therapies.
Supplementary Figures Supplementary Figure 1. Treatment schematic of SIV infection and ARV and PP therapies. Supplementary Figure 2. SIV replication and CD4 + T cell count. (A) Log SIVmac239 copies/ml
More informationSupplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
More informationMethylation regulation of liver-specific microrna-122 expression and its effects on the proliferation and apoptosis of hepatocellular carcinoma cells
Methylation regulation of liver-specific microrna-122 expression and its effects on the proliferation and apoptosis of hepatocellular carcinoma cells T.J. Xing, H.T. Xu, W.Q. Yu and D.F. Jiang Department
More informationIL10 rs polymorphism is associated with liver cirrhosis and chronic hepatitis B
IL10 rs1800896 polymorphism is associated with liver cirrhosis and chronic hepatitis B L.N. Cao 1, S.L. Cheng 2 and W. Liu 3 1 Kidney Disease Department of Internal Medicine, Xianyang Central Hospital,
More informationSUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
More informationCDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
More informationBeyond the APC era Alternative pathways to CRC. Jeremy R Jass McGill University
Beyond the APC era Alternative pathways to CRC Jeremy R Jass McGill University Outline Limitations of APC model KRAS and serrated polyps CRC and CpG island methylation Serrated pathway to CRC Fusion pathways
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
More informationClinical significance of serum mir-21 in breast cancer compared with CA153 and CEA
Original Article Clinical significance of serum mir-21 in breast cancer compared with CA153 and CEA Jianjian Gao, Qingyun Zhang, Jianjun Xu, Lijuan Guo, Xuefeng Li Key Laboratory of Carcinogenesis and
More informationThe Role of the CpG Island Methylator Phenotype on Survival Outcome in Colon Cancer
Gut and Liver, Vol. 9, No. 2, March 215, pp. 22-27 ORiginal Article The Role of the CpG Island Methylator Phenotype on Survival Outcome in Colon Cancer Ki Joo Kang*, Byung-Hoon Min, Kyung Ju Ryu, Kyoung-Mee
More informationSupplementary Material
Supplementary Material 2 4 6 Single-locus gene screening methods We screened for single nucleotide polymorphisms (SNPs) at 16 candidate immune genes (Table S1) by initially sequencing three captive-bred
More informationExpression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 5525-5530 Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer Y.-X. SHI, B.-L. YE, B.-R. HU, X.-J.
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationScreening and identification of a tumor specific methylation phenotype in the colorectal laterally spreading tumor
European Review for Medical and Pharmacological Sciences 2017; 21: 2611-2616 Screening and identification of a tumor specific methylation phenotype in the colorectal laterally spreading tumor H.-B. NI
More informationSerum mirna expression profile as a prognostic biomarker of stage II/III
Serum mirna expression profile as a prognostic biomarker of stage II/III colorectal adenocarcinoma Jialu Li a,b,, Yang Liu c,, Cheng Wang d,, Ting Deng a,, Hongwei Liang b, Yifei Wang e, Dingzhi Huang
More informationGenome-scale detection of hypermethylated CpG islands in circulating cell-free DNA of hepatocellular carcinoma patients
ORIGINAL ARTICLE Cell Research (2015):1-15. www.nature.com/cr npg Genome-scale detection of hypermethylated CpG islands in circulating cell-free DNA of hepatocellular carcinoma patients Lu Wen 1, *, Jingyi
More informationCentre for Scientific Computing and Complex Systems Modelling (Sci-Sym), School of Computing, Dublin City University, Ireland.
795 Ivyspring International Publisher Research Paper Journal of Cancer 2015; 6(8): 795-811. doi: 10.7150/jca.9883 Comparative Correlation Structure of Colon Cancer Locus Specific Methylation: Characterisation
More informationAnalysis of glutathione peroxidase 1 gene polymorphism and Keshan disease in Heilongjiang Province, China
Analysis of glutathione peroxidase 1 gene polymorphism and Keshan disease in Heilongjiang Province, China H.L. Wei, J.R. Pei, C.X. Jiang, L.W. Zhou, T. Lan, M. Liu and T. Wang Center for Endemic Disease
More informationc Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
More informationIs Hepatic Resection Needed in the Patients with Peritoneal Side T2 Gallbladder Cancer?
Is Hepatic Resection Needed in the Patients with Peritoneal Side T2 Gallbladder Cancer? Lee H, Park JY, Youn S, Kwon W, Heo JS, Choi SH, Choi DW Department of Surgery, Samsung Medical Center Sungkyunkwan
More informationDiversity and Assembling Processes of Bacterial Communities in Cryoconite
Diversity and Assembling Processes of Bacterial Communities in Cryoconite Holes of a Karakoram Glacier Roberto Ambrosini 1, Federica Musitelli 1, Federico Navarra 1, Ilario Tagliaferri 1, Isabella Gandolfi
More informationIdentification the potential of stool-based SNCA methylation as a candidate biomarker for early colorectal cancer detection
Original Article Identification the potential of stool-based SNCA methylation as a candidate biomarker for early colorectal cancer detection Qinglan Yang 1 *, Shuiming Wang 2 *, Jiong Ma 3, Xiaowei Li
More informationA preliminary study on the relationship between circulating tumor cells count and clinical features in patients with non-small cell lung cancer
Original Article Page 1 of 5 A preliminary study on the relationship between circulating tumor cells count and clinical features in patients with non-small cell lung cancer Jia-Wei Wan 1,2 *, Ming-Zhu
More informationin the Gastrointestinal and Reproductive Tracts of Quarter Horse Mares
Influence of Probiotics on Microflora in the Gastrointestinal and Reproductive Tracts of Quarter Horse Mares Katie Barnhart Research Advisors: Dr. Kimberly Cole and Dr. John Mark Reddish Department of
More informationSupporting Information. Electrochemiluminescence for Electric-Driven Antibacterial. Therapeutics
Supporting Information Electrochemiluminescence for Electric-Driven Antibacterial Therapeutics Shanshan Liu, a,b Huanxiang Yuan, a Haotian Bai, a Pengbo Zhang, a Fengting Lv, a Libing Liu, a Zhihui Dai,
More informationInfluence of the c.1517g>c genetic variant in the XRCC1 gene on pancreatic cancer susceptibility in a Chinese population
Influence of the c.1517g>c genetic variant in the XRCC1 gene on pancreatic cancer susceptibility in a Chinese population Z.M. Zhao*, C.G. Li*, M.G. Hu, Y.X. Gao and R. Liu Department of Surgical Oncology,
More informationCONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center Seattle, WA 98109
AWARD NUMBER: W81XWH-10-1-0711 TITLE: Transgenerational Radiation Epigenetics PRINCIPAL INVESTIGATOR: Christopher J. Kemp, Ph.D. CONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center Seattle,
More informationValue of serum galectin-3 and midkine level determination for assessing tumor severity in patients with thyroid cancer
148 Journal of Hainan Medical University 2017; 23(3): 148-152 Journal of Hainan Medical University http://www.hnykdxxb.com Value of serum galectin-3 and midkine level determination for assessing tumor
More informationEstablishment of in Vivo Metastasis Model of Human Adenoid Cystic Carcinoma: Detection of Metastasis by PCR with Human β -Globin Gene
Kobe J. Med. Sci., Vol. 48, No. 5, pp. 145-152, 2002 Establishment of in Vivo Metastasis Model of Human Adenoid Cystic Carcinoma: Detection of Metastasis by PCR with Human β -Globin Gene HIDEKI KOMATSUBARA,
More informationCancer incidence and patient survival rates among the residents in the Pudong New Area of Shanghai between 2002 and 2006
Chinese Journal of Cancer Original Article Cancer incidence and patient survival rates among the residents in the Pudong New Area of Shanghai between 2002 and 2006 Xiao-Pan Li 1, Guang-Wen Cao 2, Qiao
More informationT ranscriptional inactivation by cytosine methylation at
1000 GASTROINTESTINAL CANCER CpG island methylator phenotype () of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies S Ogino, M Cantor, T Kawasaki,
More informationInfluence of ERCC2 gene polymorphisms on the treatment outcome of osteosarcoma
Influence of ERCC2 gene polymorphisms on the treatment outcome of osteosarcoma Z.F. Liu, A.L.J. Asila, K. Aikenmu, J. Zhao, Q.C. Meng and R. Fang Department of Orthopaedics, Chinese Medicine Hospital of
More informationAuthor's response to reviews
Author's response to reviews Title: Hypermethylated 14-3-3-sigma and ESR1 gene promoters in serum as candidate biomarkers for the diagnosis and treatment efficacy of breast cancer metastasis Authors: Mercedes
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationAssociation between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population
Association between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population R. Zhao and M.F. Ying Department of Pharmacy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University,
More informationPredictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D.
Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D. Department of Environmental Health University of Cincinnati Background Breast cancer (BCa) The second most common cancer among women in
More informationQIAGEN's Growing Immuno-Oncology Testing Portfolio
QIAGEN's Growing Immuno-Oncology Testing Portfolio QIAGEN Your Partner in Translational Medicine Current Biomarkers of Immuno-Oncology Focus: Immuno-Oncology Testing Portfolio Tumor mutation burden (TMB)
More informationAbsence of Kaposi s Sarcoma-Associated Herpesvirus in Patients with Pulmonary
Online Data Supplement Absence of Kaposi s Sarcoma-Associated Herpesvirus in Patients with Pulmonary Arterial Hypertension Cornelia Henke-Gendo, Michael Mengel, Marius M. Hoeper, Khaled Alkharsah, Thomas
More informationSupplementary Information
Supplementary Information Prognostic Impact of Signet Ring Cell Type in Node Negative Gastric Cancer Pengfei Kong1,4,Ruiyan Wu1,Chenlu Yang1,3,Jianjun Liu1,2,Shangxiang Chen1,2, Xuechao Liu1,2, Minting
More informationHigh expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis
High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis Supplementary Material Supplementary Figure S1. Representative CRBP-1 immunostaining of non-neoplastic
More informationRNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
Xu et al. Molecular Cancer (2019) 18:8 https://doi.org/10.1186/s12943-018-0932-8 LETTER TO THE EDITOR RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
More informationGermline mutation analysis in the CYLD gene in Chinese patients with multiple trichoepitheliomas
Germline mutation analysis in the CYLD gene in Chinese patients with multiple trichoepitheliomas Z.L. Li 1,2, H.H. Guan 3, X.M. Xiao 1,2, Y. Hui 3, W.X. Jia 1,2, R.X. Yu 1,2, H. Chen 1,2 and C.R. Li 1,2
More informationEnd of the Note Book
End of the Note Book 16 September 2016 Colonies PCR Mix (25 µl total volume reaction): + clones - 12.5 µl DreamTaq PCR Mastermix 2X (ThermoScientific) - 2.5 µl 10X DreamTaq Green Buffer (ThermoScientific)
More informationGenetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma
Genetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma M.J. Wang, Y. Zhu, X.J. Guo and Z.Z. Tian Department of Orthopaedics, Xinxiang Central Hospital, Xinxiang,
More informationResearch Article The CIMP Phenotype in BRAF Mutant Serrated Polyps from a Prospective Colonoscopy Patient Cohort
Gastroenterology Research and Practice, Article ID 374926, 1 pages http://dx.doi.org/1.1155/214/374926 Research Article The CIMP Phenotype in BRAF Mutant Serrated Polyps from a Prospective Colonoscopy
More informationInvestigation on ERCC5 genetic polymorphisms and the development of gastric cancer in a Chinese population
Investigation on ERCC5 genetic polymorphisms and the development of gastric cancer in a Chinese population L.Q. Yang 1, Y. Zhang 2 and H.F. Sun 3 1 Department of Gastroenterology, The Second Affiliated
More informationInvestigating the role of polymorphisms in mir-146a, -149, and -196a2 in the development of gastric cancer
Investigating the role of polymorphisms in mir-146a, -149, and -196a2 in the development of gastric cancer Department of Gastrointestinal Surgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong
More informationIL-17 rs genetic variation contributes to the development of gastric cancer in a Chinese population
IL-17 rs2275913 genetic variation contributes to the development of gastric cancer in a Chinese population B.L. Xu, Y.T. Li, S.X. Dong, J. Qi, H.M. Feng, L. Zi and D.Y. Yang Department of General Surgery,
More informationRelationship of EGFR DNA methylation with the severity of non-small cell lung cancer
Relationship of EGFR DNA methylation with the severity of non-small cell lung cancer J. Li 1 *, X.F. Jia 1 *, J. Liu 2, J.J. Liu 3 and H.B. Zhao 1 1 Department of Oncology, First People s Hospital of Jining,
More informationExpression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.
More informationSupplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
More informationPre-diagnostic cruciferous vegetables intake and lung cancer survival among Chinese women
Pre-diagnostic cruciferous vegetables intake and lung cancer survival among Chinese women Qi-Jun Wu, Gong Yang, Wei Zheng, Hong-Lan Li, Jing Gao, Jing Wang, Yu-Tang Gao, Xiao-Ou Shu, Yong-Bing Xiang Supplementary
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More informationGeneral Session 7: Controversies in Screening and Surveillance in Colorectal Cancer
General Session 7: Controversies in Screening and Surveillance in Colorectal Cancer Complexities of Pathological Assessment: Serrated Polyps/Adenomas Carolyn Compton, MD, PhD Professor of Life Sciences,
More informationSupplementary webappendix
Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kratz JR, He J, Van Den Eeden SK, et
More informationAberrant CpG Island Hypermethylation in Pediatric Gastric Mucosa in Association With Helicobacter pylori Infection
Aberrant CpG Island Hypermethylation in Pediatric Gastric Mucosa in Association With Helicobacter pylori Infection So-Hyun Shin, MSc; Seog-Yun Park, MD; Jae-Sung Ko, MD; Nayoung Kim, MD; Gyeong Hoon Kang,
More informationYork criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
More informationRALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD
RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration
More informationA smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
More informationSALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407
SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA
More informationRecommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
More informationDoctor of Philosophy
Regulation of Gene Expression of the 25-Hydroxyvitamin D la-hydroxylase (CYP27BI) Promoter: Study of A Transgenic Mouse Model Ivanka Hendrix School of Molecular and Biomedical Science The University of
More informationPersonalized Healthcare Update
Dr. Kai - Oliver Wesche Market Development Manager, Personalized Healthcare QIAGEN Personalized Healthcare Update Pioneering Personalized Medicine through Partnering TOMTOVOK BKM120 Zelboraf QIAGEN partners:
More informationA TEST FOR COLORECTAL CANCER THAT IS 92% SENSITIVE AND NON-INVASIVE. Stool DNA test
A TEST FOR COLORECTAL CANCER THAT IS 92% SENSITIVE AND NON-INVASIVE Stool DNA test THE NEW NON-INVASIVE SCREENING TEST FOR COLORECTAL CANCER Sensitive Clinically proven 1 Easy to use FDA approved COLOGUARD
More information