Serodiagnosis of Canine Babesiosis
|
|
- Lily Casey
- 6 years ago
- Views:
Transcription
1 Serodiagnosis of Canine Babesiosis Xuenan XUAN, DVM, PhD National Research Center for Protozoan Diseases Obihiro University of Agriculture and Veterinary Medicine Obihiro, Hokkaido , Japan Tel.: ; Fax:
2 Babesia spp infections in dogs Introduction Taxonomic classification Morphology Life cycle Pathogenesis Clinical signs Host defenses Epidemiology Diagnosis Treatment Prevention
3 Introduction Canine babesiosis is tick-bone disease caused by two intraerythrocytic protozoan parasites, Babesia canis and Babesia gibsoni.
4 Morphology B.canis usually appears as paired pyri form organisms in canine red blood cells. B.gibsoni usually appears as single ring form organisms in canine red blood cells.
5 Taxonomic classification Phylum: Apicomplexa Class: Sporozoasida Order: Piroplasmida Family: Babesiidae Genus: Babesia
6 Life cycle Following attachment of an infected tick, Babesia spp. trophozoites are released into the blood, infecting erythrocytes. Within the erythrocytes, the parasite multiplies by binary fission, an asexual form of schizogony. Naïve ticks attach to the dog and become infected with Babesia ssp. when they ingest a blood meal.
7 Pathogenesis The transmission of parasites takes place after 2-3 days of attachment of the tick, at which time infective sporozoites migrate from the tick s salivary glands into the host s circulation. Babesia organisms are obligate intracellular parasites that invade, divide within, and rupture erythrocytes. An important pathogenic mechanism therefore is direct parasite-induced red cell damage resulting in an intravascular haemolysis, but the severity of this is usually not proportional to the low parasitemia that is typically observed. It is now recognised that other significant mechanisms are involved, including immun-mediated lysis and oxidative injury of the red cell membrane.
8 Clinical signs Acute infection: anemia with icterus, inappetence, thirst, pyrexia (>39 ). Chronic infection: irregular temperature, capricious appetite, and loss of conditions.
9 Host defenses Humoral responses Cell-mediated responses Nonspecific responses
10 Epidemiology B. canis canis: Europe, Asia B. canis rossi: South Africa B. canis vogeli: USA, tropical and subtropical areas B. gibsoni Asian type: Asia B. gibsoni Spanish type: Europe B. gibsoni California type: USA
11 Diagnosis Microscopic examination Serodiagnosis Molecular diagnosis
12 Microscopic examination
13 Enzyme-linked immunosorbent assay (ELISA)
14 Immunofluorescent-antibody test (IFAT)
15 1 2 3 Absorbent pad Control line Test line Conjugate pad Sample pad + Examples of the ICT strips pre- (1) and post- (2 and 3) tests. +, the positive result; -, the negative result. Immunochromatographic test (ICT)
16 M Polymerase chain reaction (PCR)
17 Loop-mediated isothermal amplification (LAMP)
18 Treatment Chemotherapy against canine babesiosis at the early phase of infection is very important to reduce the severity of disease and mortality, although it cannot completely eliminate the parasites. Diminazene acceturate, phenamicine isethionate, and pentamicine isethionate have been demonstrated to be effective against canine babesiosis. Supportive therapy, such as intravenous fluids and transfusions, is recommended for canine babesiosis, particularly for dogs with severe anemia.
19 Prevention For the control of canine babesiosis, vaccination is generally considered to be the most effective means. It is known that the inactivated whole parasite antigen or soluble parasite antigen that is derived from a supernatant of an in vitro culture of Babesia parasites is useful antigen for vaccination and induces partial protection against canine babesiosis. On the other hand, tick control is considered the most important means for prevention of canine babesiosis, since treatment is not always successful.
20 Cloning of a novel gene encoding a major surface antigen P50 of Babesia gibsoni and development of serodiagnostic methods using recombinant P50
21 Gene hunting Babesia-infected RBC mrna cdna library Immunoscreening Novel genes (P50) Vaccine development DNA vaccine Vector vaccine Subunit vaccine Diagnostic methods ELISA ICT PCR
22 Atgaatgtcgttcgttcattcctgtttttcccaatcgccttctccctggtaagggcaaatggtgaggggaagacggcagaggccacccctgcaggaacatcgaca MetAsnValValArgSerPheLeuPhePheProIleAlaPheSerLeuValArgAlaAsnGlyGluGlyLysThrAlaGluAlaThrProAlaGlyThrSerThr Cccactgaacctaaggcagctgaggctgctcccaaagcagtagacgcagctgctgttacctttaaacagtatctggactttgcaatgaagttaaacgaggccgtg ProThrGluProLysAlaAlaGluAlaAlaProLysAlaValAspAlaAlaAlaValThrPheLysGlnTyrLeuAspPheAlaMetLysLeuAsnGluAlaVal Acactccgtgaggaagacactaggaaaaagcttttggttaacttccctcttttcggagctcccccgttcgatggtgcatggggggatttgaaagacttattgaag ThrLeuArgGluGluAspThrArgLysLysLeuLeuValAsnPheProLeuPheGlyAlaProProPheAspGlyAlaTrpGlyAspLeuLysAspLeuLeuLys Aaagttactgagcttcgggcacttctacttaagggtcacacattcggtttaccagcggcaaccacaacagacaaacagcaacaggatgctaaccaaactgtcggt LysValThrGluLeuArgAlaLeuLeuLeuLysGlyHisThrPheGlyLeuProAlaAlaThrThrThrAspLysGlnGlnGlnAspAlaAsnGlnThrValGly Gctttatttgatttcattgtcggagtagcaactgatgcagtcaccgttgctgataaggctactagggctgttactggaatggaccccgataaagccgtgggattc AlaLeuPheAspPheIleValGlyValAlaThrAspAlaValThrValAlaAspLysAlaThrArgAlaValThrGlyMetAspProAspLysAlaValGlyPhe Cacgtcacaccagcaacggctgatgccctatttgagtttgttccagatctctatgaaaagttgaaggatttgcatagtaaggttggagagtgggttgaaattaag HisValThrProAlaThrAlaAspAlaLeuPheGluPheValProAspLeuTyrGluLysLeuLysAspLeuHisSerLysValGlyGluTrpValGluIleLys Tccacctttgatgacacgaaattggtaacccaagctggtgatcacaggccgaaacactggttaaggcagggtgggtttactgaccaggaggttaaaggtgatacc SerThrPheAspAspThrLysLeuValThrGlnAlaGlyAspHisArgProLysHisTrpLeuArgGlnGlyGlyPheThrAspGlnGluValLysGlyAspThr Accttggaaactttgaaaactaaactgggtgagctcgttggtcctactaagccttgtgagaaggttttgtgtacccttgcttcatatgcgcttatgaagacccct ThrLeuGluThrLeuLysThrLysLeuGlyGluLeuValGlyProThrLysProCysGluLysValLeuCysThrLeuAlaSerTyrAlaLeuMetLysThrPro Caagatgcagctggcaagcaggcatggatctttttattggcaagtgcaatgaataacaatgctatgaaagctaagcttgaggtagcagtaaacgcggttactccc GlnAspAlaAlaGlyLysGlnAlaTrpIlePheLeuLeuAlaSerAlaMetAsnAsnAsnAlaMetLysAlaLysLeuGluValAlaValAsnAlaValThrPro Ggtaagggagaaacctttgtcaaccaactaaaggaggttggcaaatcactccagcttcccaaggaacaagttcctaagcaatatcgtttccctggtgtctatgca GlyLysGlyGluThrPheValAsnGlnLeuLysGluValGlyLysSerLeuGlnLeuProLysGluGlnValProLysGlnTyrArgPheProGlyValTyrAla Aacctcgatgtgcaacacttttggactgtgttaaccggcgtctttggcactatactgactgaccttgaggttgacgaaaaggatgctcagggtaaagcaggacag AsnLeuAspValGlnHisPheTrpThrValLeuThrGlyValPheGlyThrIleLeuThrAspLeuGluValAspGluLysAspAlaGlnGlyLysAlaGlyGln Gttgctactagagttgcggagcttgtcaaggtggaaggtccacttcacagcctcactgtgcaagtagctgagatgactaaggctggagcgggtgctggtggtgaa ValAlaThrArgValAlaGluLeuValLysValGluGlyProLeuHisSerLeuThrValGlnValAlaGluMetThrLysAlaGlyAlaGlyAlaGlyGlyGlu Gctcctgctcaggcagctgctgggacagcaggagcacgtgcagaagctccagccaaggaaggccaaggtgaggatggtgcgcacttttgtggcatcggaatgaca AlaProAlaGlnAlaAlaAlaGlyThrAlaGlyAlaArgAlaGluAlaProAlaLysGluGlyGlnGlyGluAspGlyAlaHisPheCysGlyIleGlyMetThr gttttctttgtttctgtggttatcgctgtcttttaa 1401 ValPhePheValSerValValIleAlaValPhe*** 466 Nucleotide and amino acid sequences of P50 gene
23 Hydrophilicity Amino acid number P50f P50t nt aa nt aa Truncated P50 gene without SP and TM
24 kda M , rp50f-soluble 2, rp50f-insoluble 3, rp50t-soluble 4, rp50t-insoluble 20 Expression of rp50 in E. coli
25 kda M Purification of rp50 expressed in E. coli
26 (A) (B) ( C ) GST-P50t GST Antigenicity of rp50 expressed in E. coli
27 A kda 94 B. gibsoni nrbc B Anti-P50 DIC P50 30 Western blotting IFAT Identification of native P50 on parasites
28 The principle of ELISA:(1) Coat antigen; (2) Wash uncoated antigen; (3) Add serum samples; (4) Wash nonbound antibodies; (5) Add HRP-condugated anti-dog IgG antibody; (6) Wash un-bound 2nd antibody; (7) Add substrate (ABTS); (8) Positive result appears as blue color.
29 Procedure of ELISA with rp50 Materials GST-NcSAG1 (purified ) GST(purified ) Antigen coating buffer (50 mm carbonate-bicarbonate ph9.6) Antibody diluting buffer (PBS containing 3% skim milk) Substrate buffer (0.1 M citric-0.2 M sodium phosphate, ph4.0) Washing buffer (PBS containing 0.05% Tween 20) ABTS(2,2 -azino-bis(3-ethylbenz-thiazoline-6-sulfonic acid)) H 2 O 2 (30%) Substrate solution (substrate buffer containing 0.05% ABTS and 0.003% H 2 O 2 ) HRP-conjugated goat anti-dog IgG(ICN Biochemicals USA) ELISA plate(nunc, Denmark ) Add subatrate solution (100µl/well) RT, dark place, 1 h Read the absorbance at 415 nm Judge 4) 1) Add the diluted GST-rP50 (2 µg/ml) to lanes 2, 4, 6, 8, and 10; add the diluted control GST (2 µg/ml) to lanes 3, 5, 7, 9, and 11. Methods Coat antigens (50µl/well) 1) 4, overnight Wash once Add antibody diluting buffer (100µl/well ) 37, 1 h Wash once Add canine sera (1:100, 50µl/well) 2) 37, 1 h Wash six times Add HRP-conjugated goat anti-dog IgG (1:4000, 50µl/well) 3) 37, 1 h Wash six times 2) Add each sample to duplicate wells. Samples Positive control Negative control Blank 3) To check the optimal secondary antibody titers in advance. 4) The result is judged as positive when the OD value (substrate the average of 2 wells with GST from the average of 2 wells with GST-rP50) equal to or greater than 0.1.
30 1E Antibody titer 1E+05 1E+04 1E+03 1E+02 1E+01 ELISA titer Parasitemia Parasitemia (%) 1E Days-post infection Detection of antibody to P50 in a dog experimentally infected with B. gibsoni by the ELISA
31 OD 415 nm B. gibsoni-infected dog sera (n=22) 2. SPF dog sera (n=30) 3. B. canis canis-infected dog sera (n=2) 4. B. canis canis-infected dog sera (n=2) 5. B. canis vogeli-infected dog sera (n=2) 6. B. canis rossi-infected dog sera (n=2) 7. L. infantum-infected dog sera (n=2) Sensitivity and specificity of the ELISA
32
33 Immunochromatographic test (ICT) Easy performance Quick results (~15 min) Sensitive and specific as ELISA Colloidal gold particle-conjugated antigen Colloidal gold particle Antigen Conjugate pad Test line Nitrocellulose m embrane Absorbent pad The composition of ICT
34 Principle of ICT for B. gibsoni infection 1 Antibodies in serum rp50 conjugated with gold colloids rp50 Rabbit antirp50 IgG ) Pre-test 2) Positive serum 3) Negative serum
35 Absorbent pad Control line Test line Sample pad Conjugate pad The sensitivity and specificity of the ICT
36 3 10 Absorbance OD 415nm ELISA Parasitemia Parasitemia (%) Days post infection Days post infection Detection of antibodies to B. gibsoni in an experimentally infected dog by ELISA and ICT
37
38 6 ( n = 6, * P < 0.05 ) P50 Parasitemia (%) * * * * * * * NRS β-gal Days-post challenge Anti-rP50 antibodies significantly inhibited the growth of B. gibsoni in SCID mouse model
39 Immunization Challenge ( 2 x 10 8 parasites ) Absorbance ( OD at 415nm ) * * * * * * * ( n = 3, * P < 0.05 ) rp50t β-gal Con Days-post challenge Recombinant P50 could induce strong humoral immunity in dogs
40 12 ( n = 3, * P < 0.05 ) rp50t Parasitemia (%) * * β-gal Con Days-post challenge Recombinant P50 could induce protective immunity in dogs
41 Conclusions A gene encoding major surface protein P50 of B. gibsoni was cloned. P50 was identified as an immunodominant antigen in both acute and chronic B. gibsoni infections in dogs. Recombinant P50 expressed in E. coli is a promising diagnostic antigen for detection of specific antibodies to B. gibsoni in dogs. Recombinant P50 is a promising vaccine candidate to control B. gibsoni infection in dogs.
42 Publications about P50 of B. gibsoni 1. Fukumoto et al., J. Clin. Microbiol. 39: , Fukumoto et al., Clin. Diagn. Lab. Immunol. 10: , Fukumoto et al., Infect. Immun. 72: , Fukumoto et al., J. Parasitol. 90: , Verdida et al., J. Vet. Med. Sci. 66: , Verdida et al., Parasitology 131: Fukumoto et al., Clin. Diagn. Lab. Immunol. 12: , Fukumoto et al., Vaccine (in press)
43 Other ELISAs B. equi ELISA-BeEMA2 B. caballi ELISA-BcP48 B. bovis ELISA-BboRAP1 B. bigemina ELISA-BbiRAP1 T. gondii ELISA-TgSAG2 N. caninum ELISA-NcSAG1 C. parvum ELISA-CpP23
44 Other ICTs B. equi ICT-BeEMA2 B. caballi ICT-BcP48 B. bovis ICT-BboRAP1 B. bigemina ICT-BbiRAP1 T. gondii ICT-TgSAG2 N. caninum ICT-NcSAG1
45
Bordetella pertussis igg-pt elisa Kit
Bordetella pertussis IgG-PT ELISA Kit Application Bordetella pertussis IgG-PT ELISA Kit is a quantitative test for the detection of IgG antibodies against pertussis toxin in human serum samples. Background
More informationHIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual)
HIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual) BACKGROUND Human Immunodeficiency Virus ( HIV ) can be divided into two major types, HIV type 1 (HIV-1) and HIV type 2 (HIV-2). HIV-1 is related to
More informationTSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details
More informationMalaria. Population at Risk. Infectious Disease epidemiology BMTRY 713 (Lecture 23) Epidemiology of Malaria. April 6, Selassie AW (DPHS) 1
Infectious Disease Epidemiology BMTRY 713 (A. Selassie, DrPH) Lecture 23 Vector-Borne Disease (Part II) Epidemiology of Malaria Learning Objectives 1. Overview of malaria Global perspectives 2. Identify
More informationCONTENTS. STUDY DESIGN METHODS ELISA protocol for quantitation of mite (Dermatophagoides spp.) Der p 1 or Der f 1
CONTENTS STUDY DESIGN METHODS ELISA protocol for quantitation of mite (Dermatophagoides spp.) Der p 1 or Der f 1 ELISA protocol for mite (Dermatophagoides spp.) Group 2 ALLERGENS RESULTS (SUMMARY) TABLE
More informationAnti-Lamin B1/LMNB1 Picoband Antibody
Anti-Lamin B1/LMNB1 Picoband Antibody Catalog Number:PB9611 About LMNB1 Lamin-B1 is a protein that in humans is encoded by the LMNB1 gene. The nuclear lamina consists of a two-dimensional matrix of proteins
More informationHuman HBcAb IgM ELISA kit
Human HBcAb IgM ELISA kit Catalog number: NR-R10163 (96 wells) The kit is designed to qualitatively detect HBcAb IgM in human serum or plasma. FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC PURPOSES
More informationab Cathepsin D Human ELISA Kit
ab119586 Cathepsin D Human ELISA Kit Instructions for Use For quantitative detection of Human Cathepsin D in cell culture supernatants, serum and plasma (heparin, EDTA). This product is for research use
More informationEXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids
DATA SHEET EXOTESTTM ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids INTRODUCTION Exosomes are small endosome-derived lipid nanoparticles
More informationIdentification of Microbes Lecture: 12
Diagnostic Microbiology Identification of Microbes Lecture: 12 Electron Microscopy 106 virus particles per ml required for visualization, 50,000-60,000 magnification normally used. Viruses may be detected
More informationCHAPTER 4 IMMUNOLOGICAL TECHNIQUES
CHAPTER 4 IMMUNOLOGICAL TECHNIQUES Nitroblue Tetrazolium Chloride (NBT) Reduction test NBT reduction test was evaluated by employing the method described by Hudson and Hay,1989 based upon principle that
More informationHuman Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set
Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set Catalog Number : SEK11695 To achieve the best assay results, this manual must be read carefully before using this product
More informationTherapeutic Parasite Reduction or Removal of Harmful Materials. Yanyun Wu, MD, PhD Chief Medical Officer
Therapeutic Parasite Reduction or Removal of Harmful Materials Yanyun Wu, MD, PhD Chief Medical Officer None Conflict of Interest Puget Sound Blood Center is now Bloodworks Northwest After 70 years Puget
More informationMouse Cathepsin B ELISA Kit
GenWay Biotech, Inc. 6777 Nancy Ridge Drive San Diego, CA 92121 Phone: 858.458.0866 Fax: 858.458.0833 Email: techline@genwaybio.com http://www.genwaybio.com Mouse Cathepsin B ELISA Kit Catalog No. GWB-ZZD154
More informationH5N1 ( Avian Flu ) Hemagglutinin ELISA Pair Set
H5N1 ( Avian Flu ) Hemagglutinin ELISA Pair Set Catalog Number : SEK002 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized
More informationNF-κB p65 (Phospho-Thr254)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual
More informationInfluenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set
Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay
More informationInfluenza B Hemagglutinin / HA ELISA Pair Set
Influenza B Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK11053 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized
More informationEVALUATION OF AN ENZYME LINKED IMMUNOSORBENT ASSAY-KIT FOR THE DETECTION OF BABESIA BOVIS-ANTIBODIES IN CATTLE IN ARGENTINA
EVALUATION OF AN ENZYME LINKED IMMUNOSORBENT ASSAY-KIT FOR THE DETECTION OF BABESIA BOVIS-ANTIBODIES IN CATTLE IN ARGENTINA S.T. DE ECHAIDE*, I.E. ECHAIDE*, A.B. GAIDO**, A.J. MANGOLD*, C.I. LUGARESI*,
More informationHUMASIS MALARIA ANTIGEN TEST HIGH SENSITIVE DIFFERENTIAL DIAGNOSIS OF MALARIA INFECTION
HUMASIS MALARIA ANTIGEN TEST HIGH SENSITIVE DIFFERENTIAL DIAGNOSIS OF MALARIA INFECTION References 1) World Malaria Report 2010, WHO 2) Rapid diagnostic tests for malaria parasites, Clin. Microbiol. Rev.
More informationLab Tuesday: Virus Diseases
Lab Tuesday: Virus Diseases Quiz for Bacterial Pathogens lab (pp 67-73) and Biocontrol of Crown Gall (p. 113-117), Observation of Viral Movement in Plants (p. 119), and Intro section for Viruses (pp. 75-77).
More informationXUENAN XUAN, ALEJANDRA LARSEN, HIROMI IKADAI, TETSUYA TANAKA, IKUO IGARASHI, HIDEYUKI NAGASAWA, KOZO FUJISAKI, YUTAKA TOYODA, NAOYOSHI SUZUKI,
JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 2001, p. 705 709 Vol. 39, No. 2 0095-1137/01/$04.00 0 DOI: 10.1128/JCM.39.2.705 709.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Expression
More informationRayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit
RayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit Catalog #: PEL-NFKBP65-S536-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information
More informationHuman LDL Receptor / LDLR ELISA Pair Set
Human LDL Receptor / LDLR ELISA Pair Set Catalog Number : SEK10231 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationHIV-1 p24 Antigen ELISA Catalog Number:
INTENDED USE The RETRO-TEK HIV-1 p24 Antigen ELISA is supplied for research purposes only. It is not intended for use in the diagnosis or prognosis of disease, or for screening and may not be used as a
More informationToxoplasma gondii IgM (Toxo IgM)
DIAGNOSTIC AUTOMATION, INC. 21250 Califa Street, Suite 102 and116, Woodland Hills, CA 91367 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com
More informationLab Tuesday: Virus Diseases
Lab Tuesday: Virus Diseases Quiz for Bacterial Pathogens lab (pp 69-75) and Biocontrol of Crown Gall (p. 115-119), Observation of Viral Movement in Plants (p. 121), and Intro section for Viruses (pp. 77-79).
More informationVETERINARSKI ARHIV 80 (6), , Vet. arhiv 80, , 2010.
VETERINARSKI ARHIV 80 (6), 715-722, 2010 Immunochromatographic assay of Babesia caballi and Babesia equi Laveran 1901 (Theileria equi Mehlhorn and Schein, 1998) (Phylum Apicomplexa) infection in Philippine
More informationRayBio Human Phospho-DDR2 (Tyr740) and Total DDR2 ELISA Kit
RayBio Human Phospho-DDR2 (Tyr740) and Total DDR2 ELISA Kit Catalog #: PEL-DDR2-Y740-T User Manual Last revised March 22, 2018 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607
More informationMitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit
PROTOCOL Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit DESCRIPTION Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit Sufficient materials
More information2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit
2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as
More informationTECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C
Phospho-Stat3 (ptyr 705 ) and pan-stat3 ELISA Kit for detection of human, mouse, or rat phospho-stat3 (ptyr 705 ) and pan-stat3 in cell and tissue lysates Catalog Number RAB0447 Storage Temperature 20
More informationhuman Total Cathepsin B Catalog Number: DY2176
human Total Cathepsin B Catalog Number: DY2176 This DuoSet ELISA Development kit contains the basic components required for the development of sandwich ELISAs to measure natural and recombinant human Total
More informationIdentification of vaccine candidate antigens for a Babesia bovis transmission blocking vaccine
Identification of vaccine candidate antigens for a Babesia bovis transmission blocking vaccine Carlos E. Suarez Animal Disease Research Unit ARS-USDA Department of Veterinary Microbiology and Pathology
More informationRayBio Human Phospho-DDR1 (Tyr792) ELISA Kit
RayBio Human Phospho-DDR1 (Tyr792) ELISA Kit Catalog #: PEL-DDR1-Y792 User Manual Last revised March 22, 2018 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane,
More informationInfluenza A H1N1 HA ELISA Pair Set
Influenza A H1N1 HA ELISA Pair Set for H1N1 ( A/Puerto Rico/8/1934 ) HA Catalog Number : SEK11684 To achieve the best assay results, this manual must be read carefully before using this product and the
More informationRayBio Human Phospho-DDR1 (Tyr792) and Total DDR1 ELISA Kit
RayBio Human Phospho-DDR1 (Tyr792) and Total DDR1 ELISA Kit Catalog #: PEL-DDR1-Y792-T User Manual Last revised March 22, 2018 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607
More informationHuman Immunodeficiency Virus type 1 (HIV-1) gp120 / Glycoprotein 120 ELISA Pair Set
Human Immunodeficiency Virus type 1 (HIV-1) gp120 / Glycoprotein 120 ELISA Pair Set Catalog Number : SEK11233 To achieve the best assay results, this manual must be read carefully before using this product
More informationHIV-1 p24 Antigen ELISA 2.0 Catalog Number:
INTENDED USE The RETRO-TEK HIV-1 p24 Antigen ELISA 2.0 is an enzyme linked immunoassay used to detect Human Immunodeficiency Virus Type 1 (HIV-1) p24 antigen in cell culture media. It can be used to monitor
More informationRecent Diagnostic Methods for Intestinal Parasitic Infections
Recent Diagnostic Methods for Intestinal Parasitic Infections By Dr. Doaa Abdel Badie Salem Lecturer of Medical Parasitology, Mansoura Faculty of Medicine Agenda Intestinal parasites. Traditional Diagnostic
More informationE. Histolytica IgG (Amebiasis)
DIAGNOSTIC AUTOMATION, INC. 21250 Califa Street, Suite 102 and 116, Woodland hills, CA 91367 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com
More informationPARASITOLOGICAL EXAMINATIONS CATALOGUE OF SERVICES AND PRICE LIST
INSTITUTE OF PARASITOLOGY Biomedical Research Center Seltersberg Justus Liebig University Giessen Schubertstrasse 81 35392 Giessen Germany Office: +49 (0) 641 99 38461 Fax: +49 (0) 641 99 38469 Coprological
More informationSTAT3 (py705) (Human/Mouse/Rat) ELISA Kit
STAT3 (py705) (Human/Mouse/Rat) ELISA Kit Catalog Number KA2175 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT3 (py705) (Human/Mouse/Rat) ELISA (Enzyme-Linked
More informationHuman Oxidized LDL ELISA Kit (MDA-LDL Quantitation), General
Human Oxidized LDL ELISA Kit (MDA-LDL Quantitation), General For the detection and quantitation of human OxLDL in plasma, serum or other biological fluid samples Cat. No. KT-959 For Research Use Only.
More informationSTAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit
STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...
More informationOxiSelect MDA Adduct ELISA Kit
Revised Protocol Product Manual OxiSelect MDA Adduct ELISA Kit Catalog Number STA-332 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipid peroxidation is a well-defined
More informationExosome ELISA Complete Kits
Exosome ELISA Complete Kits EXOEL-CD9A-1, EXOEL-CD63A-1, EXOEL-CD81A-1 User Manual See PAC for Storage Conditions for Individual Components Version 12 4/17/2017 A limited-use label license covers this
More informationToxocara. Cat # Toxocara ELISA. Enzyme Linked Immunosorbent Assay. ELISA-Indirect; Antigen Coated Plate
DIAGNOSTIC AUTOMATION, INC. 23961 Craftsman Road, Suite D/E/F, Calabasas, CA 91302 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com See external
More informationHuman IL-2 Uncoated ELISA Catalog Number: Also known as: Interleukin-2 RUO: For Research Use Only. Not for use in diagnostic procedures.
Page 1 of 2 Human IL-2 Uncoated ELISA Catalog Number: 88-7025 Also known as: Interleukin-2 RUO: For Research Use Only. Not for use in diagnostic procedures. Product Information Contents: Human IL-2 Uncoated
More informationExosome ELISA Complete Kits
Exosome ELISA Complete Kits EXOEL-CD9A-1, EXOEL-CD63A-1, EXOEL-CD81A-1 User Manual See PAC for Storage Conditions for Individual Components Version 12 4/17/2017 A limited-use label license covers this
More informationChapter 13 Viruses, Viroids, and Prions. Biology 1009 Microbiology Johnson-Summer 2003
Chapter 13 Viruses, Viroids, and Prions Biology 1009 Microbiology Johnson-Summer 2003 Viruses Virology-study of viruses Characteristics: acellular obligate intracellular parasites no ribosomes or means
More informationHuman Cathepsin D ELISA Kit
GenWay Biotech, Inc. 6777 Nancy Ridge Drive San Diego, CA 92121 Phone: 858.458.0866 Fax: 858.458.0833 Email: techline@genwaybio.com http://www.genwaybio.com Human Cathepsin D ELISA Kit Catalog No. GWB-J4JVV9
More informationLDL Uptake Cell-Based Assay Kit
LDL Uptake Cell-Based Assay Kit Catalog Number KA1327 100 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
More informationDivision of Global Epidemiology, Research Center for Zoonosis Control. Conduct of ELISA test sample collection for the research study in Japan
(Abroad)Official trip report form(student) 13/07/29 Name Laboratory Year (Grade) Destination Marvin Ardeza Villanueva Division of Global Epidemiology, Research Center for Zoonosis Control First Year PhD
More informationHuman Apolipoprotein A1 EIA Kit
A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent
More informationInfluenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set
Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK40103 To achieve the best assay results, this manual must be read carefully before using this product and the assay
More informationLaboratory diagnosis of congenital infections
Laboratory diagnosis of congenital infections Laboratory diagnosis of HSV Direct staining Tzanck test Immunostaining HSV isolation Serology PCR Tzanck test Cell scrape from base of the lesion smear on
More informationTECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates
Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates Catalog Number RAB0011 Storage Temperature 20 C TECHNICAL BULLETIN Product Description
More informationRecombinant Protein Expression Retroviral system
Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential
More informationPage 1 of 2. Standard curve of Human IFN gamma ELISA Ready- SET-Go! Product Information Contents: Human IFN gamma ELISA Ready- SET-Go!
Page 1 of 2 Human IFN gamma ELISA Ready-SET-Go! Catalog Number: 88-7316 Also known as: Interferon-gamma, IFN-g, IFNg RUO: For. Not for use in diagnostic procedures. Standard curve of Human IFN gamma ELISA
More informationACTG Laboratory Technologist Committee Revised Version 2.0 ACTG Lab Man Coulter HIV-1 p24 ELISA May 21, 2004
Coulter HIV p24 1. PRINCIPLE The Human Immunodeficiency Virus Type 1 (HIV-1) is recognized as the etiologic agent of acquired immunodeficiency syndrome (AIDS). The virus is transmitted by sexual contact,
More informationRat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN
YK051 Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418 0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes
More informationHEMOPOIETIC SYSTEM INFECTIONS BACTERIAL INFECTIONS OF THE BLOODSTREAM Reading Assignment: Chapters 50 & 63
HEMOPOIETIC SYSTEM INFECTIONS BACTERIAL INFECTIONS OF THE BLOODSTREAM Reading Assignment: Chapters 50 & 63 Definitions I. Bacteremia: Viable bacteria in the blood as demonstrated by a positive blood culture
More informationCanine C-Reactive Protein ELISA
Canine C-Reactive Protein ELISA Product Data Sheet Cat. No.: RH931CRP01DCR For Research Use Only Page 1 of 12 VERSION 51 020611 46 CONTENTS 1. INTENDED USE 3 2. PRINCIPLE OF ASSAY 3 3. REAGENTS AND MATERIALS
More informationCHAPTER 4 RESULTS 42
CHAPTER 4 RESULTS 42 4.1 Introduction This chapter is divided in two main sections. The first section deals with results obtained for the point-of-care tests, which encompass results of optimization final
More informationAnthrax protective antigen IgG ELISA Kit
Anthrax protective antigen IgG ELISA Kit Catalog Number KA0953 96 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3
More informationE. Histolytica IgG ELISA Kit
E. Histolytica IgG ELISA Kit Catalog Number KA3193 96 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of
More informationBlood Smears Only 07 February Sample Preparation and Quality Control 12B A
NEW YORK STATE Parasitology Proficiency Testing Program Blood Smears Only 07 February 2012 The purpose of the New York State Proficiency Testing Program in the category of Parasitology Blood Smears Only
More informationEGFR (py1045)/ Pan EGFR (Human) ELISA Kit
EGFR (py1045)/ Pan EGFR (Human) ELISA Kit Catalog Number KA2156 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION EGFR (py1045)/pan EGFR (Human) ELISA (Enzyme-Linked Immunosorbent
More informationInfluenza or flu is a
Clinical and Research Area Infectious Diseases Influenza Virus Types A and B Influenza or flu is a respiratory illness that is caused by influenza viruses. Influenza viruses type A and type B cause seasonal
More informationIVD. DRG Toxocara canis ELISA (EIA-3518) Revised 12 Feb rm (Vers. 6.1)
Please use only the valid version of the package insert provided with the kit. Intended Use For the qualitative screening of serum IgG antibodies to Toxocara using an Enzyme-Linked Immunosorbent Assay
More informationRayBio Human Granzyme B ELISA Kit
RayBio Human Granzyme B ELISA Kit Catalog #: ELH-GZMB User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,
More informationSTAT1 (ps727) (Human/Mouse) ELISA Kit
STAT1 (ps727) (Human/Mouse) ELISA Kit Catalog Number KA2171 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT1 (ps727) (Human/Mouse) ELISA (Enzyme-Linked Immunosorbent
More informationTherapeutic Effect of Clindamycin and Tetracycline on Babesia rodhaini Infection in Mouse Model
FULL PAPER Parasitology Therapeutic Effect of Clindamycin and Tetracycline on Babesia rodhaini Infection in Mouse Model Agus WIJAYA, Retno WULANSARI, Hitoshi ANO, Hisashi INOKUMA 1) and Susumu MAKIMURA
More informationSUPPLEMENTARY MATERIALS
SUPPLEMENTARY MATERIALS Supplementary Table 1. Demographic and clinical characteristics of the primary Sjögren's syndrome patient cohort Number % Females/males 73/5 93.6/6.4 Age, median (range) years 65
More informationOxiSelect HNE-His Adduct ELISA Kit
Product Manual OxiSelect HNE-His Adduct ELISA Kit Catalog Number STA-334 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipid peroxidation is a well-defined mechanism
More informationRayBio Human Phosphotyrosine BTK ELISA Kit
RayBio Human Phosphotyrosine BTK ELISA Kit Catalog #: PEL-BTK-Y User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite
More informationSIV p27 Antigen ELISA Catalog Number:
INTENDED USE The RETRO-TEK SIV p27 Antigen ELISA is for research use only and is not intended for in vitro diagnostic use. The RETRO-TEK SIV p27 Antigen ELISA is an enzyme linked immunoassay used to detect
More informationQuickTiter Lentivirus Quantitation Kit (HIV p24 ELISA)
New and Improved Product Manual QuickTiter Lentivirus Quantitation Kit (HIV p24 ELISA) Catalog Numbers VPK-108-HIV-p24 96 tests VPK-108-HIV-p24-5 5 x 96 tests FOR RESEARCH USE ONLY Not for use in diagnostic
More informationHuman TSH ELISA Kit. User Manual
Human TSH ELISA Kit User Manual Catalog number: GTX15585 GeneTex Table of Contents A. Product Description... 2 B. Kit Components... 3 C. Additional Required Materials (not included)... 3 D. Reagent Preparation...
More informationCaspase-3 Assay Cat. No. 8228, 100 tests. Introduction
Introduction Caspase-3 Assay Cat. No. 8228, 100 tests Caspase-3 is a member of caspases that plays a key role in mediating apoptosis, or programmed cell death. Upon activation, it cleaves a variety of
More informationQuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24)
Product Manual QuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24) Catalog Number VPK-107 VPK-107-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction
More informationcolorimetric sandwich ELISA kit datasheet
colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL5 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity
More informationProtein MultiColor Stable, Low Range
Product Name: DynaMarker Protein MultiColor Stable, Low Range Code No: DM670L Lot No: ******* Size: 200 μl x 3 (DM670 x 3) (120 mini-gel lanes) Storage: 4 C Stability: 12 months at 4 C Storage Buffer:
More informationHuman IL-2. Pre-Coated ELISA Kit
Human IL-2 (Interleukin 2) Pre-Coated ELISA Kit Catalog No: 90-2083 1 96 well Format (96 tests) Detection Range: 31.2 2000 pg/ml Sensitivity: < 18.75 pg/ml This immunoassay kit allows for the in vitro
More informationGlobal Headquarters 86 Cummings Park Woburn, MA Tel:
Human IL-2 ELISA Kit Cat:RK00002 This ELISA kit used for quantitation of human interleukin 2 (IL-2) concentration in cell culture supernate, serum and plasma. For research use only, and it s highly recommended
More informationBlood Smears Only 6 October Sample Preparation and Quality Control 15B-K
NEW YORK STATE Parasitology Proficiency Testing Program Blood Smears Only 6 October 5 The purpose of the New York State Proficiency Testing Program in the category of Parasitology - Blood Smears Only is
More informationDog Insulin ELISA Kit (TMB)
Dog Insulin ELISA Kit (TMB) Research Reagent [Advantage] Please, read this instruction carefully before use. (1) Dog Insulin Kit is a high speed EIA. (for 3-4 hours). (2) Dog Insulin Kit can measure in
More informationTrichinella Cat #
DIAGNOSTIC AUTOMATION, INC. 23961 Craftsman Road, Suite E/F, Calabasas, CA 91302 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com See external
More informationSee external label 2 C-8 C Σ=96 tests Cat # EBV-VCA IgA. Cat # EBV -VCA IgA ELISA. ELISA: Enzyme Linked Immunosorbent Assay
DIAGNOSTIC AUTOMATION, INC. 23961 Craftsman Road, Suite D/E/F, Calabasas, CA 91302 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com See external
More information4/16/2013 FARIDA OESMAN DEPARTMENT OF CLINICAL PATHOLOGY FACULTY OF MEDICINE, UNIVERSITY OF INDONESIA TYPHOID FEVER DENGUE FEVER MALARIA LEPTOSPIROSIS
FARIDA OESMAN DEPARTMENT OF CLINICAL PATHOLOGY FACULTY OF MEDICINE, UNIVERSITY OF INDONESIA TYPHOID FEVER DENGUE FEVER MALARIA LEPTOSPIROSIS NOT SPECIFIC DEFINITIVE HOST RESPONSE HEMATOLOGY ACUTE PHASE
More informationHuman Urokinase / PLAU / UPA ELISA Pair Set
Human Urokinase / PLAU / UPA ELISA Pair Set Catalog Number : SEK10815 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized
More informationProthrombin (Human) ELISA Kit
Prothrombin (Human) ELISA Kit Catalog Number KA0496 96 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General
More informationFARIDA OESMAN DEPARTMENT OF CLINICAL PATHOLOGY FACULTY OF MEDICINE, UNIVERSITY OF INDONESIA
FARIDA OESMAN DEPARTMENT OF CLINICAL PATHOLOGY FACULTY OF MEDICINE, UNIVERSITY OF INDONESIA TYPHOID FEVER DENGUE FEVER MALARIA LEPTOSPIROSIS NOT SPECIFIC DEFINITIVE HOST RESPONSE HEMATOLOGY ACUTE PHASE
More informationOxiSelect Human Oxidized LDL ELISA Kit (OxPL-LDL Quantitation)
Product Manual OxiSelect Human Oxidized LDL ELISA Kit (OxPL-LDL Quantitation) Catalog Number STA-358 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipoproteins are submicroscopic
More informationDetection of neuraminidase-inhibiting antibodies for measurement of Influenza vaccine immunogenicity
Borgis New Med 2015; 19(4): 147-155 DOI: 10.5604/14270994.1191796 Detection of neuraminidase-inhibiting antibodies for measurement of Influenza vaccine immunogenicity *Mónika Rózsa 1, István Jankovics
More informationLDL Uptake Cell-Based Assay Kit
LDL Uptake Cell-Based Assay Kit Item No. 10011125 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More information