Results. Clinical reports of transplant recipients

Transcription

1 Cloning of EBV genes as fusion proteins with Renilla luciferase for Luciferase Immunoprecipitation System (LIPS) analysis A panel of 13 different EBV proteins was generated as Renilla luciferase (Ruc) fusion protein for serological EBV testing using LIPS. In addition to the previously described N-terminal EBV antigen fusions of gp350 constructed in the pren3s vector and the C-terminal fusion of BZLF2 constructed in pren2, 1 11 new EBV proteins were generated in pren2 vector and included BLRF2 (p23), BFRF3 (p18), BMRF1, BMLF1, BZLF1, BHRF, BALF1, BKRF2, BMLF1, BCRF1, and LMP2A. The coding sequences of these EBV proteins were amplified by PCR from genomic DNA with gene specific linker-primer adapters and then the corresponding cdna fragments were subcloned downstream of Ruc. The sequence of the primer-linker oligonucleotides used for amplification are as follows: BLRF2; 5 -GAGAGATCTAGTG GGCAGCAGAGAGGC and 5 -GAGCTCG AGTTAATCAGAAATTTGCAC, BFRF3: 5 -GAGGGATCCGC ACGCCGGCTGCC CAAG and 5 -GAGCTCGAGCTACTGTTT CT TACGTGC, BMRF1; 5 -GAGGGATCCCCTGAATTTGTTAAGCTC and 5 -GAG CTCGAGTTAA ATGAGGGGGTTAAAG, BMLF1; 5 -GAGAGATCTGTTC CTTC TCAGAGACTCTCC and 5 -GAGGTCGACTTATTGATTTAATCCAGGAAC, BHRF1; 5 -GAGAGATCTGCCTATTCAACAAGGGAG and 5 -GAGCTCGAGTTA GTGTCTTCCT CTGGAG, and EBNA1; 5 -GAGGGATCCTCTGACGAGGGGCCAG GT and 5 -GAGCTCGAGTCACTCCTGCCCTTCCTC. Additional details for primers and nucleotide/ protein sequences for all the constructs are available upon request. Results Clinical reports of transplant recipients Patient 9 A 17-year-old white man presented with fatigue, myalgias, fever, and pancytopenia. The symptoms initially resolved, but recurred and included hepatitis, splenomegaly, encephalitis, peripheral neuropathy, facial palsy. EBV serologies showed evidence of prior infection. He was treated with acyclovir, intravenous immune globulin (IVIG), and corticosteroids. He developed diplopia and peripheral neuropathy and an MRI showed multiple cerebellar and cerebral lesions. IFN-β was added, and an MRI showed demyelinating lesions in the thoracic spine and a lymph node biopsy showed hemophagocytosis. He was treated with acyclovir, corticosteroids, and cyclosporine and underwent splenectomy which showed hemophagocytosis; many cells contained EBV RNA. CT scans showed lymphadenopathy and a lesion in the liver; biopsies of a lymph node and liver were positive for EBV RNA. He was treated with corticosteroids and azathioprine. Bone marrow and liver biopsies showed an EBV-positive lymphohistiocytic T-cell infiltrate. He was treated with azathioprine, corticosteroids and IVIG, followed by etoposide, cytosine arabinoside, cyclophosphamide, antithymocyte globulin, and total body irradiation. He underwent an allogeneic transplant using bone marrow from a matched unrelated donor while the liver lesion was progressing. His liver lesion resolved and his course was complicated by mild GVHD. He is currently 11 years post-transplant on no immunosuppressive therapy and his EBV serology and EBV blood PCR remains negative.

2 Patient 12 A 55-year-old white man presented with fever, chills, lymphadenopathy, and splenomegaly. Serologies were consistent with prior EBV infection. His symptoms responded to prednisone; however, an auxiliary lymph node showed a polymorphic B cell lymphoma composed of CD20 + and CD20 B cells; the tumor cells were positive for EBV RNA. He developed arthralgia, lymphadenopathy, splenomegaly, anterior uveitis, peripheral neuropathy, and rash over the upper extremities. A skin biopsy showed a perivascular lymphocytic infiltrate that was positive for EBV RNA. PCR of the peripheral blood showed 500,860 EBV copies per 10 6 cells. A lumbar puncture showed atypical lymphocytes and PCR was positive for EBV DNA. He was treated with IFN-α at doses up to 25 million units three times a week and after a transient response his symptoms returned and viral load rose to 10 6 EBV copies per 10 6 cells. Bortezomib was added to IFN-α therapy, but was discontinued because of gastrointestinal side effects. IVIG was given for peripheral neuropathy thought to be secondary to SCAEBV. He received autologous EBVspecific cytotoxic T cells and rituximab, but without a sustained response. He received two courses of EPOCH chemotherapy (etoposide, prednisone, vincristine, cyclophosphamide, doxorubicin) with rituximab and fludarabine, and while there was a transient improvement in symptoms and EBV viral load, his symptoms and EBV load subsequently increased. He received cyclophosphamide and fludarabine followed by allogeneic transplant using peripheral blood stem cells from an HLA-matched sibling. Due to low blood cell counts, he received a boost of stem cells from the same donor. His symptoms resolved and his viral load became undetectable, then spiked to 220,000 EBV copies per 10 6 cells and rapidly declined to undetectable again. His posttransplant course was complicated by Aspergillus pneumonia, toxoplasmosis encephalitis, adrenal insufficiency, and GVHD of the liver. He is currently 6 years post-transplant and EBV PCR in the blood is undetectable. Patient 13 A 44-year-old white man presented with a diffuse abdominal rash, fever, pancytopenia, and pulmonary nodules. Serology was consistent with prior EBV infection. The CD4 count was 223 and NK cell count 5. A CT scan showed diffuse lymphadenopathy and splenomegaly. A lymph node biopsy showed a polymorphic B cell infiltrate with EBV-positive immunoblasts; with CD20 + and CD20 EBV-positive B cells. The EBV DNA in the blood was 290,000 EBV copies per 10 6 cells. He was treated with IFN-α, but had persistent lymphadenopathy. His blood showed 1,700,000 EBV copies per 10 6 cells and CSF showed 310,000 copies per 10 6 cells. He was treated with bortezomib and ganciclovir, but his viral load remained elevated at 800,000 EBV copies per 10 6 cells. His lymphadenopathy, and pulmonary nodules persisted, and he was treated with EPOCH and rituximab. Hemophagocytosis was noted in the bone marrow. He received additional courses of rituximab and developed polyneuropathy. Due to persistent disease, he received cyclophosphamide and fludarabine and underwent allogeneic transplant using peripheral blood stem cells from a sibling. While his lymphandenopathy, pulmonary nodules, and viral load declined, he developed septic shock, multiorgan failure, hemophagocytic syndrome, central pontine myelinolysis, and died on post-transplant day 20. At the time of death the EBV PCR of the blood was negative. At autopsy there was EBV-positive lymphoma in the lung, liver, lymph nodes, kidneys, pancreas, and spleen that was largely necrotic indicating a response to the transplant.

3 Patient 15 This patient was previously reported in reference 16. Patient 16 A 29-year-old white man presented with fever, night sweats, and malaise, and diffuse lymphadenopathy. His symptoms resolved, but recurred soon thereafter and a cervical lymph node showed a polymorphic EBV-positive lymphoproliferative disorder with both CD20 + and CD20 cells and necrosis. EBV RNA was detected in B cells. His symptoms recurred nearly monthly and responded to prednisone. A bone marrow showed EBV-positive cells and blood showed 46,000 EBV copies per 10 6 cells. He was treated with rituximab and his symptoms resolved and EBV DNA declined, but fever and lymphadenopathy recurred. A lymph node biopsy showed progressive disease and increasing numbers of CD20-negative B cells. He received IFN-α (up to 20 MU 3 times weekly), but had persistent lymphadenopathy and fever. A lymph node biopsy showed polymorphic B cell lymphoma and he received EPOCH and ritxuimab. Additional studies showed impaired NK cell function and he received additional chemotherapy and fludarabine followed by an allogeneic transplant using peripheral blood stem cells from a sibling. He failed to engraft and received donor lymphocyte infusion and stem cell boosts. He developed pulmonary nodules that were positive for EBV by PCR and liver disease consistent with progressive EBV lymphoproliferative disease. He received a second allogeneic transplant using peripheral blood stem cells from a matched unrelated donor after fludarabine and total body irradiation and developed progressive hepatic failure with erythrophagocytosis in the liver, renal failure, and failure to engraft. At autopsy lymphoma was present in the lungs, liver, kidney, and mediastinal lymph nodes. Patient 17 A 5-year-old Hispanic girl presented with fever, sinusitis, and lymphadenopathy. A bone marrow showed hemophagocytosis and she was treated with etoposide, dexamethasone, and cyclosporine. Her symptoms recurred the EBV DNA in the blood was 2,189,000 copies/μg of DNA. The EBV IgG was >1:10,240 and EBV VCA IgM was <10. A lymph node biopsy showed EBV-positive B cell lymphoproliferative disease and she was treated with rituximab with a good response. Two years later the disease recurred with fever, lymphadenopathy, mediastinal mass and an EBV DNA viral load of 51,000 copies/μg of DNA. A lymph node biopsy again showed EBV lymphoproliferative disease and she received two additional doses of rituximab and her EBV DNA viral load became undetectable. Six months later the mediastinal mass increased in size and her EBV DNA viral load increased to 5,000 copies/μg of DNA and she received two doses of autologous EBV-specific cytotoxic T cells and rituximab. The following year an iliac crest mass showed an EBV-positive polymorphic B cell lymphoma. She was treated with chemotherapy (vincristine, doxorubicin, methotrexate and prednisone), but due to persistent lymphadenopathy she underwent conditioning with busulphan, cyclophosphamide, cytosine arabinoside, and alemtuzumab (campath) and received a matched, unrelated donor bone marrow transplant. Her course was complicated by fever and elevated serum transaminases at the time of engraftment, and she developed an atypical mycobacteria infection involving the skin and lungs which responded to antibiotic therapy. She has returned to school and is currently 5 years post transplant. Her EBV DNA viral load has remained low or undetectable.

4 Patient 18 A 4-year-old Vietnamese boy presented with fever, lymphadenopathy, conjunctivitis, red lips, and swollen feet. The EBV IgG was >1:10,240 and the bone marrow showed EBV DNA. He was treated with IVIG, acyclovir, and prednisone. His symptoms resolved, then recurred 3 years later and also included hepatosplenomegaly, anemia, and hepatitis. A liver biopsy showed T cell CAEBV, and the EBV DNA in the blood was 115,327 copies/μg of DNA. He was treated with decadron, etoposide, and cyclosporine without response. He underwent allogeneic transplant using bone marrow obtained from his identical twin. He developed fever and pleural effusions, and his EBV DNA rose to 1,219 copies/μg of DNA. He was treated with donor lymphocytes followed by several courses of donor derived EBV-specific CTLs. A lymph node biopsy showed T cell EBV-positive lymphoproliferative disease and he received additional donor lymphocytes, anti-cd45 monoclonal antibody, and EBV LMP-2 specific CTLs. The EBV viral DNA ranged from 100,000 to 150,000 copies/μg of DNA and he had generalized lymphadenopathy. A repeat lymph node biopsy showed T cell CAEBV and his disease progressed and he died of EBVpositive T-cell lymphoma. Patient 19 A 7-year-old Hispanic boy presented with hypersensitivity to mosquito bites with subsequent ulcerations requiring skin grafting. EBV DNA was present in NK cells in a skin biopsy. The EBV DNA was >262,144 copies per ug of DNA and the EBV VCA was 1:320. NK cells were present in 47% of the peripheral blood lymphocytes. He did not respond to EBV-specific CTLs and he received an allogeneic transplant using peripheral blood stem cells from a matched unrelated donor at age 12. Initially his EBV DNA was undetected, but when it rose to 5,458 he received EBV-specific T cells and his PCR has remained undetectable and he is currently 2 years posttransplant. REFERENCES 1. Sashihara J, Burbelo PD, Savoldo B, Pierson TC, Cohen JI. Human antibody titers to Epstein- Barr virus (EBV) gp350 correlate with neutralization of infectivity better than antibody titers to EBV gp42 using a rapid flow cytometry-based EBV neutralization assay, Virology, 2009;391:

5 Table S1. EBV serologies Patient EBV VCA IgM a EBV VCA IgA EBV EA-D Unknown if B, T, or NK cell disease 1 1:40,<1:8 1:640 1:5,120 2 <1:8 1:640 1:20,480 4 ND 1:160 1:1, :8 ND <1:10 B-cell disease 3 <1:8 1:320 1:20, :8, <1:8 ND 1:5, :1,024, 1:16 1:8 1:10,240 8 <1:8 1:256 1:2,560 9 <1:8 1:256 1: negative ND 1:163, negative ND ND 13 negative ND ND 14 positive, negative ND ND 16 negative ND ND 17 <10 ND ND T-cell disease 10 <1:8 1:1,024 1:10, negative ND ND 18 ND ND ND NK-cell disease 19 negative ND ND a Some laboratories report a titer for VCA IgM and other report results as negative or positive based on ELISA assay. EBV, viral capsid antigen; EA-D, early antigen-diffuse; ND, not done.