Reservoir BINGO. Methods Small group work/ large group discussion
|
|
|
- Hillary Curtis
- 5 years ago
- Views:
Transcription
1 Reservoir BINGO Objectives Describe the differences in current technologies available for measuring the reservoir Discuss the risk and benefit of each technology Methods Small group work/ large group discussion Materials Required Technology Descriptions Reservoir Boards Container for Technology Descriptions Flip chart Markers Tape Scissors Prize(s) for winners (optional) To Prepare for the Session Review the content in the slides and additional resources Make a copy of the Technology Descriptions and follow the instructions provided. Make copies of the Reservoir BINGO Boards. You ll need a board for each participant. Five boards are provided. For groups of more than five, either make multiple copies (although some players will have identical boards, they may play them differently) or have participants share a board and play as a team. To Conduct the Session Step 1 Pass out a Reservoir BINGO Board to each participant, and tell participants that they are going to play a game called Reservoir BINGO based on the information they learned in the presentation. Hold up the container and explain that each slip of paper has a description of a technology used to measure the reservoir. Tell participants tht you will be drawing descriptions from the container, one at a time, and reading them out loud. Those who can name the corresponding technology should raise their hand, and you ll call on the first person whose hand you see. If their responses is correct, all participants should mark the corresponding X, filling in only one space at a time. Explain that the participants can place an X: on any square that says free space. The first person to form a winning pattern a straight horizontal line should call out BINGO 1
2 Step 2 Start the game by drawing the first piece of paper. When a participant offers an answer, ask the other participants if the answer is correct. Continue game until someone wins or all papers have been drawn. Step 4 Congratulate the winner of the game and all participants for their valuable input. Award any prizes Debrief by asking participants the following question o What are the patient specific considerations for each of these assays? Facilitate any discussion that follows. Wrap up the session by asking if there are any additional questions about the current technologies used in measuring the reservoir. 2
3 Technology Descriptions Trainer s Instruction: Print pages 3-4, cut along the dotted lines, and fold the individual strips of paper into small squares. Place them in a hat, bowl, or other container for random drawing during the GPP Principles Bingo game. Virus is present but not active in a cell No consensus on cellular markers in immune cells Established very early in infection This assay cannot distinguish defective vs. intact provirous. This assay is the only assay that can currently be used in resource limited settings This assay measures the amplification of DNA using fluorescence This assay is used to diagnose infants This assay can detect RNA below the undetectable limit in current FDA assays. This assay uses a plasma samples to test for viral RNA This assay uses protein markers to determine the presence of virus This assay can assess ongoing viral replication in patients using 2-LTR as a marker Limiting dilution is a major feature of this assay. Inducible RNA can be measured by this assay. 3
4 This assay activates resting CD4 cells to measure virus This assay requires at least two weeks to complete This assay depicts the smallest version of the reservoir. This assay requires 200 ml of whole blood from participants in order to purify enough resting CD4+ T cells. Resource limited settings, including research settings that conduct clinical trials, would have the most difficulty implementing this 4
5 Answer Key Virus is present but not active in a cell Answer: Viral reservoir No consensus on cellular markers in immune cells Answer: viral reservoir Established very early in infection Answer: viral reservoir This assay cannot distinguish defective vs. intact provirous. Answer: This assay is the only assay that can currently be used in resource limited settings. Answer: This assay is used to diagnose infants Answer: This assay measures the amplification of DNA using fluorescence Answer: This assay can detect RNA below the undetectable limit in current FDA assays using only a single patient s cells. Answer: This assay uses a plasma samples to test for viral RNA Answer: This assay can assess ongoing viral replication in patients using 2-LTR as a marker Answer This assay uses protein markers to determine the presence of virus Answer: Limiting dilution is a major feature of this assay. Answer: Inducible RNA can be measured by this assay. Answer: This assay activates resting CD4 cells to measure virus Answer: This assay requires at least two weeks to complete Answer: This assay depicts the smallest version of the reservoir. Answer: This assay requires 200 ml of whole blood from participants in order to purify enough resting CD4+ T cells. Answer: Resource limited settings, including research settings that conduct clinical trials, would have the most difficulty implementing this. Answer: 5
6 Measuring the Reservoir BINGO Boards FREE SPACE 6
7 FREE SPACE 7
8 FREE SPACE 8
9 FREE SPACE 9
10 FREE SPACE 10
CLINICAL TRIALS HIV GAME
CLINICAL TRIALS HIV 1-2-3 GAME Trainer Instructions Time frame (45 minutes) Purpose To reinforce learning from the first training weekend To allow learners the opportunity to demonstrate what they know
Offering Testing for Hepatitis B and C in Primary Care
Offering Testing for Hepatitis B and C in Primary Care Presentation 3 October 2016 Quality Education for a Healthier Scotland 1 Learning Outcomes Participants will be able to:- Undertake a pre-test discussion
The Chromosomes of a Frimpanzee: An Imaginary Animal
The Chromosomes of a Frimpanzee: An Imaginary Animal Introduction By now, you have heard the terms chromosome, mitosis, and meiosis. You probably also know that chromosomes contain genetic information
September 21, 18. If adaptations were made or activity was not done, please describe what was changed and why. Please be as specific as possible.
Washington State Snap-Ed Curriculum Fidelity for Continuous Improvement Lesson Assessment Tool for Food Smarts Workshop: Kids 6 week, 90 minutes Week 2 What Is On a Healthy Plate? Educator Self-Assessment
Droplet Digital PCR, the new tool in HIV reservoir quantification? Ward De Spiegelaere
Droplet Digital PCR, the new tool in HIV reservoir quantification? Ward De Spiegelaere Droplet Digital PCR, the new tool in HIV reservoir quantification? Content: - Digital PCR - Applications - Total HIV
Dealing with Post-market Issues: PCV Case Study
Dealing with Post-market Issues: PCV Case Study CASE STUDY: Adventitious agent in raw material ISSUE: Presence of porcine circovirus (PCV-1) DNA detected in marketed rotavirus vaccine by an independent
Lights. Camera. Karyotypes. STUDENT HANDOUT. Module 3
Lights. Camera. Karyotypes. Module 3 Genetics for Kids: Module 3 Part I: Introduction DNA is the hereditary material that contains instructions for the appearance and function of all parts of living organisms.
Mo-Bility 13. Station 1 Card: How Stable Am I? 1LESSON 3. PROBLEM STATEMENT: How does obesity affect your
Station 1 Card: How Stable Am I? PROBLEM STATEMENT: How does obesity affect your balance? In this experiment you will test the relationship between the center of gravity of an object and the base of support.
Name Section Problem Set 6
Name Section 7.012 Problem Set 6 Question 1 The viral family Orthomyxoviridae contains the influenza A, B and C viruses. These viruses have a (-)ss RNA genome surrounded by a capsid composed of lipids
Eat Right Stay Healthy Brownie Girl Scout Try-It
Girl Scouts of Sycamore Council Eat Right Stay Healthy Brownie Girl Scout Try-It Overview This guide provides troop leaders with a template for three troop meetings that center around the topic of eating
Some Similarities between the Spread of Infectious Disease and Population Growth 1
Some Similarities between the Spread of Infectious Disease and Population Growth 1 The Spread of Infectious Disease 1. An infectious disease is any disease caused by germs such as viruses or bacteria.
Normal Distribution Foldable
Normal Distribution Foldable Thank you for buying my game! Foresta Math Please stop back to my store and let me know how the game went. http://www.teacherspayteachers.com/store/foresta- Math Facebook:
Low-Level Viremia in HIV
Mountain West AIDS Education and Training Center Low-Level Viremia in HIV Brian R. Wood, MD Medical Director, Mountain West AETC ECHO Telehealth Program Assistant Professor of Medicine, University of Washington
Non-profit education, research and support network offers money in exchange for missing science
Alive & Well $50,000 Fact Finder Award Find One Study, Save Countless Lives Non-profit education, research and support network offers money in exchange for missing science http://www.aliveandwell.org Tel
Viruses. Instructions fill in the blanks with the appropriate term to have the sentence make sense.
Viruses Part 1 Viral Life Cycle Instructions fill in the blanks with the appropriate term to have the sentence make sense. 1.) A virus is not considered to be a living organism by most scientists. It is
Chapter 4. Navigating. Analysis. Data. through. Exploring Bivariate Data. Navigations Series. Grades 6 8. Important Mathematical Ideas.
Navigations Series Navigating through Analysis Data Grades 6 8 Chapter 4 Exploring Bivariate Data Important Mathematical Ideas Copyright 2009 by the National Council of Teachers of Mathematics, Inc. www.nctm.org.
HIV-DNA: nuovo marcatore virologico. Metodiche a confronto per la quantificazione di HIV-DNA
HIV-DNA: nuovo marcatore virologico Metodiche a confronto per la quantificazione di HIV-DNA Maria Carla Re Laboratorio Retrovirus e Agenti infettivi HIV correlati UO di Microbiologia, Università di Bologna
Beebops Genetics and Evolution Teacher Information
STO-105 Beebops Genetics and Evolution Teacher Information Summary In Part 1 students model meiosis and fertilization using chromosomes/genes from fictitious Beebop parents. They decode the genes in the
TOPIC NFL PLAY 60 Kids Day Live Virtual Field Trip
EDUCATOR COMPANION GUIDE TOPIC NFL PLAY 60 Kids Day Live Virtual Field Trip KEY LEARNING OBJECTIVES In the following activities students will: Model the functioning of the heart. Describe how the heart
This World Mental Health Day say #HelloYellow at your school
#HelloYellow Go yellow for young people s mental health This World Mental Health Day say #HelloYellow at your school #HelloYellow Fundraising Kit Dear Lovely Person, Friend, and Superhero Fundraiser, It
UNDERSTANDING SEXUAL HEALTH AND RISK.
UNDERSTANDING SEXUAL HEALTH AND RISK. HIV Sexual Health STIs AIDS Semen Violence HIV transmission Sexual activities 25 minutes To understand the different modes of transmission of HIV. To understand risk
Nature Medicine: doi: /nm.2109
HIV 1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs Christoph C. Carter, Adewunmi Onafuwa Nuga, Lucy A. M c Namara, James Riddell IV, Dale Bixby, Michael
Character and Life Skills: Self-Control Lesson Title: Red Light, Green Light Grade Level: 3-5
Lesson Title: Red Light, Green Light Project and Purpose Students discuss various strategies to show self-control and use a red light, yellow light, green light model to represent how they choose to show
SIGN UP TODAY ENTRY FEE: PRIZE: ORGANISER:
SIGN UP TODAY ENTRY FEE: PRIZE: ORGANISER: Argentina Australia Belgium Brazil Columbia Costa Rica Croatia Denmark Egypt England France Germany Iceland Iran Japan Mexico Morocco Nigeria Panama Peru Poland
Supplementary Figure 1. Gating strategy and quantification of integrated HIV DNA in sorted CD4 + T-cell subsets.
Supplementary information HIV reservoir size and persistence are driven by T-cell survival and homeostatic proliferation. Chomont, N., M. El Far, P. Ancuta, L. Trautmann, F. A. Procopio, B. Yassine-Diab,
TGTTAGATTCAGAGTCGCTAGCTAGCTAGCTATATTCTCGTATAGACTATCGTAGCGC-3 3 -ACAATCTAAGTCTCAGCGATCGATCGATCGATATAAGAGCATATCTGATAGCATCGCG-5
LS1a Problem Set #5 Due Friday 11/3 by noon in your TF s drop box on the 2 nd floor of the Science Center All questions including (*extra*) ones must be answered 1. If you recall from last week, nerve
What does it mean to pledge my health to better living?
What does it mean to pledge my health to better living? 8 USC 707 Ask your club members what they do to put the -H pledge into action. How can you live by this pledge during your club meetings? 9 Taking
1077HS. Participant Manual. for Community Advisory Boards. School of Nursing, University of Medicine & Dentistry of New Jersey
1077HS Participant Manual for Community Advisory Boards School of Nursing, University of Medicine & Dentistry of New Jersey This teaching tool was developed by the François-Xavier Bagnoud Center at the
Guide to Conference Sponsorship and Exhibit Opportunities
December 5-9, 2016 The Riverside Hotel Boise, Idaho Guide to Conference Sponsorship and Exhibit Opportunities 2016 New Sheriffs School Build your brand; increase sales and market share through exhibits
Leader Guide. Session 8. FOOD is Fuel. Lesson 1: Welcome Back & Recap (10 minutes) Lesson 2: FOOD Choices in Your Day (5 Minutes)
Leader Guide Session 8 FOOD is Fuel Lesson 1: Welcome Back & Recap (10 minutes) Lesson 2: FOOD Choices in Your Day (5 Minutes) Lesson 3: FOOD and MOOD Relay (10 Minutes) Lesson 4: Fitness Challenge Dance
7.012 Problem Set 6 Solutions
Name Section 7.012 Problem Set 6 Solutions Question 1 The viral family Orthomyxoviridae contains the influenza A, B and C viruses. These viruses have a (-)ss RNA genome surrounded by a capsid composed
Population. population. parameter. Census versus Sample. Statistic. sample. statistic. Parameter. Population. Example: Census.
Population Population the complete collection of ALL individuals (scores, people, measurements, etc.) to be studied the population is usually too big to be studied directly, then statistics is used Parameter
The HIV life cycle. integration. virus production. entry. transcription. reverse transcription. nuclear import
The HIV life cycle entry reverse transcription transcription integration virus production nuclear import Hazuda 2012 Integration Insertion of the viral DNA into host chromosomal DNA, essential step in
Modeling Natural Selection Activity
Name: Date: Modeling Natural Selection Activity This laboratory investigation is a simulation of natural selection. One definition of simulation is the act of representing the functioning of a system or
Women and Viral Load. Together, we can change the course of the HIV epidemic one woman at a time.
Women and Viral Load Together, we can change the course of the HIV epidemic one woman at a time. #onewomanatatime #thewellproject What Is Viral Load? Viral load is the amount of HIV (number of viruses
Get ready to go elf!
Get ready to go elf! It s fun. It s festive. And it s for a fantastic cause. Schools, nurseries and youth groups are all perfect places to host an Elf Day. You ve got a ready-made supply of little helpers
Monitoring Hepatitis C
Monitoring Hepatitis C Section Six Monitoring Hepatitis C Screening for hepatitis C is not routinely done, so you may have to request a test from your medical provider. This usually involves an antibody
Genetics Project. Using the same traits from our Jane and John activity, we will determine how an offspring of yours could look.
Genetics Project Name 7 th Grade PSI Science Partner s Name Due Date In our Jane and John activity, we looked at the traits of fictional characters. For this final project, we will now talk about YOUR
Offering Testing for Hepatitis B and C in Primary Care. Presentation 3. October 2017
Offering Testing for Hepatitis B and C in Primary Care Presentation 3 October 2017 0 Learning Outcomes Participants will be able to: Undertake a pre test discussion for Hepatitis C and Hepatitis B testing
The Human Ear. Grade Level: 4 6
The Human Ear Grade Level: 4 6 Teacher Guidelines pages 1 2 Instructional Pages pages 3 5 Practice Pages pages 6 7 Homework Page page 8 Answer Key page 9 Classroom Procedure: 1. Give a blank sheet of paper,
Unit 2: Lesson 3 Development of Vaccines
Unit 2, Lesson 3: Teacher s Edition 1 Unit 2: Lesson 3 Development of Vaccines Lesson Questions: o What is the purpose of a vaccine? o What are the different ways in which vaccines are made? o How do vaccines
Summary Students will be able to: 쐌 Compare and contrast the information on two posters. (Language Arts) 쐌 Make a stacked bar graph.
ACTIVITY 5 COUNT YOUR SERVINGS ACTIVITY 5 Estimated Lesson Length UR O Y T GS N U CO ERVIN S 60 minutes Nutrition Objective Students will be able to: 쐌 State daily servings from each of the five food groups.
THE UNFOLDING CONVERSATION ACTIVITY (see background information on next page for rationale)
Caring, Connected Relationships are a BIG DEAL to young people AND, it impacts their mental health. THE UNFOLDING CONVERSATION ACTIVITY (see background information on next page for rationale) Goal: Students
4th H for Health Challenge
4th H for Health Challenge 18 USC 707 "I pledge my head to clearer thinking, my heart to greater loyalty, my hands to larger service, and my health to better living, for my club, my community, my country,
Sleep Walker Relay. Materials Needed
Sleep Walker Relay Sleep is crucial for growing bodies and is a cornerstone of healthy living. But sometimes, other priorities push back bedtimes and can leave youth drowsy. Lack of sleep puts people at
How HIV Works in Your Body
How HIV Works in Your Body It helps to know what s going on with your virus What is HIV and how do people get it? The initials HIV stand for Human Immunodeficiency Virus meaning a virus that causes the
Micropathology Ltd. University of Warwick Science Park, Venture Centre, Sir William Lyons Road, Coventry CV4 7EZ
www.micropathology.com info@micropathology.com Micropathology Ltd Tel 24hrs: +44 (0) 24-76 323222 Fax / Ans: +44 (0) 24-76 - 323333 University of Warwick Science Park, Venture Centre, Sir William Lyons
AT THE MARKET (PART II)
AT THE MARKET (PART II) AS YOU MAY REMEMBER, WE ENDED THE LAST WORKSHOP BY DISCUSSING HEALTHY SHOPPING TIPS. NOW WE RE GOING TO HAVE A BIT OF FUN WHILE DISCUSSING THE FOOD PYRAMID. THE FOOD PYRAMID WILL
The Wellbeing Bingo Game. Instructions
The Wellbeing Bingo Game Instructions Getting it right for every child The Wellbeing Bingo Game has been designed to encourage young people to think about their own wellbeing, to share any concerns they
Module R: Recording the HIV Reservoir
Module R: Recording the HIV Reservoir Satish K. Pillai, Ph.D. MODULE LEADER Satish Pillai amfar Institute for HIV Cure Research Module R Team Michael Busch Timothy Henrich Sheila Keating Sulggi Lee Henry
4th H for Health Challenge
4th H for Health Challenge 8 USC 707 "I pledge my head to clearer thinking, my heart to greater loyalty, my hands to larger service, and my health to better living, for my club, my community, my country,
Leader Guide. Session 8. FOOD is Fuel. Lesson 1: Welcome Back & Warm-up (10 minutes) Lesson 2: FOOD Choices in Your Day (5 Minutes)
Leader Guide Session 8 FOOD is Fuel Lesson 1: Welcome Back & Warm-up (10 minutes) Lesson 2: FOOD Choices in Your Day (5 Minutes) Lesson 3: FOOD and MOOD Relay (10 Minutes) Lesson 4: Fitness Challenge Circuit
4th H for Health Challenge
4th H for Health Challenge 8 USC 707 "I pledge my head to clearer thinking, my heart to greater loyalty, my hands to larger service, and my health to better living, for my club, my community, my country,
Identification and Characterization of CD4 T cells actively transcribing HIV RNA in Peripheral Blood
Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Identification and Characterization of CD4 T cells actively transcribing
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
Reverse transcription and integration
Reverse transcription and integration Lecture 9 Biology 3310/4310 Virology Spring 2018 One can t believe impossible things, said Alice. I dare say you haven t had much practice, said the Queen. Why, sometimes
Clever Hans the horse could do simple math and spell out the answers to simple questions. He wasn t always correct, but he was most of the time.
Clever Hans the horse could do simple math and spell out the answers to simple questions. He wasn t always correct, but he was most of the time. While a team of scientists, veterinarians, zoologists and
Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR
Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4
10 session activity guide for women s circles
WOMENS CIRCLE Identity Who I Am 10 session activity guide for women s circles Authors: Karrie A. Mills, Christa J. Porter, and Vicki K. Pitstick With Giovanna Taormina, Kitty Tyrol, and Beth Hossfeld,
Standards Alignment...5 Safe Science...7 Scienti c Inquiry...9 Assembling Rubber Band Books...13
Standards Alignment... Safe Science...7 Scienti c Inquiry...9 Assembling Rubber Band Books...13 Organization and Development of Living Organisms Parts...1 Brain Power... 2 Heart Smart... 3 A Look at Lungs...
SECURE A PRB SPONSORSHIP
MARCH 19-22, 2018 Gaylord Opryland Resort & Convention Center Nashville, TN SECURE A PRB SPONSORSHIP The PRB Coal Users Group was formed to promote the safe, efficient and economic use of PRB Coals. Managers
Ohio SNAP-Ed Adult & Teen Programs Eat a Rainbow of Snacks
Page 1 Ohio SNAP-Ed Adult & Teen Programs Eat a Rainbow of Snacks Task Topic: Task Title: Teaching Message(s): Resources: Vegetables & Fruits Eat a Rainbow of Snacks Eat at least one kind of fruit daily.
Analyzing Text Structure
Part 1: Introduction Analyzing Text Structure LAFS 7.RI.2.5: Analyze the structure an author uses to organize a text, including how the major sections contribute to the whole and to the development of
LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication
DEFINITIONS OF TERMS Eukaryotic: Non-bacterial cell type (bacteria are prokaryotes).. LESSON 4.4 WORKBOOK How viruses make us sick: Viral Replication This lesson extends the principles we learned in Unit
Professor Jonathan Weber
HIV/AIDS at 30: Back to the Future BHIVA / Wellcome Trust Multidisciplinary Event to mark World AIDS Day 2011 British HIV Association (BHIVA) 2011 HIV/AIDS at 30: Back to the Future BHIVA / Wellcome Trust
Viruses 101., and concluded that living organisms do not crystallize. In other words,.
Viruses 101 In 1897, Dutch scientist called tiny particles in the liquid extracted from a plant disease, which is the Latin word for. In 1935, American biochemist isolated crystals of, and concluded that
Early Antiretroviral Therapy
Early Antiretroviral Therapy HIV Cure Research Training Curriculum HIV and Cure Early ART Presented by: Jintanat Ananworanich, MD, PhD June 2016 The HIV CURE research training curriculum is a collaborative
Day Seven: Helping HIV Affected Children and Orphans
Note: This training material is continually being evaluated and updated to reflect current needs and best practices therefore it should be viewed as work in progress. Any person, organization, or institution
3.1.2 MOVEMENT ANALYSIS
3.1.2 MOVEMENT ANALYSIS 3.1.1.1 Levers Mechanical Advantage starter 1. Stick in your Assessment Grids from last lesson. NOT FOLDED 2. Fill out the score underneath the start of the lesson Start = % End
AL-ANOPOLY. Step 10. Step 10. Step 10. Al-Anopoly Al-Anon/Alateen Service Manual Game FINISH START. Concepts. Concepts
Al-Anon/Alateen Service Manual Game This is a game modeled after the popular game of Monopoly, and uses the 2014-2017 Al-Anon/Alateen Service Manual (P-24/27). The game can be played as a workshop activity
The Third D: Long Term Solutions to End the Epidemic. Mitchell Warren Executive Director, AVAC 12 February 2014
The Third D: Long Term Solutions to End the Epidemic Mitchell Warren Executive Director, AVAC 12 February 2014 Key clinical trial milestones: HIV vaccine research First HIV vaccine trial opens Phase
RNA PCR, Proviral DNA and Emerging Trends in Infant HIV Diagnosis
RNA PCR, Proviral DNA and Emerging Trends in Infant HIV Diagnosis 1 B R E N D A N M C M U L L A N I N F E C T I O U S D I S E A S E S, S Y D N E Y C H I L D R E N S H O S P I T A L S C H O O L O F W O
A Bright Future Begins with a Healthy Smile. Activity Book
A Bright Future Begins with a Healthy Smile Activity Book Two Willow Street, Southborough, MA 01745 800.342.8747 massdental.org Brushing Chart Brush two minutes, two times a day to keep your smile healthy.
Combine Multiple Servings by Count
Lesson Overview Lesson Participants: School Nutrition Assistants/Technicians Type of Lesson: Short face-to-face training session Time to Conduct the Lesson: 20 minutes Lesson Description: This lesson explains
FOUR STEPS TO BECOMING A TEAM CAPTAIN
FOUR STEPS TO BECOMING A TEAM CAPTAIN I can t wait to get started... When you form a team, you make an even bigger difference in the Tour de Cure fund-raising community. This booklet will show you how
Red Ribbon Week Your Future is Key, so Stay Drug Free. October History
Red Ribbon Week 2017 October 23-27 Your Future is Key, so Stay Drug Free The Red Ribbon is a symbol of our community s commitment towards the creation of a drug free America. Your school community creates
How Faithful is the Old Faithful? The Practice of Statistics, 5 th Edition 1
How Faithful is the Old Faithful? The Practice of Statistics, 5 th Edition 1 Who Has Been Eating My Cookies????????? Someone has been steeling the cookie I bought for your class A teacher from the highschool
Laboratory Considerations
Laboratory Considerations In Support of HPV Vaccine Programs Elizabeth R. Unger PhD, MD Team Leader HPV Laboratory Centers for Disease Prevention and Control Towards Comprehensive Cervical Cancer Control:
Supplementary information. Early development of broad neutralizing antibodies in HIV-1 infected infants
Supplementary information Early development of broad neutralizing antibodies in HIV-1 infected infants Leslie Goo, Vrasha Chohan, Ruth Nduati, Julie Overbaugh Supplementary Figure 1. Neutralization profile
INTRODUCTORY LESSON: Facilitator s Guide
INTRODUCTORY LESSON: Facilitator s Guide GETTING READY FOR THE PROGRAM Overall Curriculum and Introductory Lesson ONE MONTH BEFORE THE PROGRAM: 1. Read through the Introduction and the Introductory Lesson
A Summary of Clinical Evidence
A Summary of Clinical Evidence Supporting the use of the Alere Determine HIV-1/2 Ag/Ab Combo Rapid Test to assist in the diagnosis of Human Immunodeficiency Virus (HIV) TAP HERE TO SEE THE PRODUCTS Table
1077HS. Training Manual. for Community Advisory Boards. School of Nursing, University of Medicine & Dentistry of New Jersey
1077HS Training Manual for Community Advisory Boards School of Nursing, University of Medicine & Dentistry of New Jersey This teaching tool was developed by the François-Xavier Bagnoud Center at the University
Learning. My Treatment
8 BOOKLET EIGHT Learning about My Treatment can befun Why is this booklet important? We need to keep up with the latest information on HIV and treatment, if we are to help ourselves fight our illness
Facilitating the Lesson
Facilitating the Lesson Program Overview This program contains the background information, step-by-step plans and handouts you need to teach sessions and conduct activities on 10 topics. Sessions are designed
Towards a block and lock strategy: LEDGINs hamper the establishment of a reactivation competent HIV reservoir.
Abstract no. MOLBPEA13 Towards a block and lock strategy: LEDGINs hamper the establishment of a reactivation competent HIV reservoir. G. Vansant,,A. Bruggemans, L. Vranckx, S. Saleh, I. Zurnic, F. Christ,
Verrucae / warts Information sheet
Verrucae / warts Information sheet What is a verruca? A verruca is simply a wart that is found on the sole of your feet. They can also appear around the toes. Verrucae are slightly raised and circular
Fundraising toolkit. Tea and Talk. Dress down for dementia. Quiz and raffle. Rock paper scissors tournament. How can you get involved?
Insurance Day of Giving Uniting against dementia Thursday 8 November Thank you for joining the Insurance Day of Giving! On 8 November the sector will unite against dementia. Get as many people involved
Novel mutations located outside the integrase gene confer HIV-1 integrase strand-transfer inhibitors resistance.
Novel mutations located outside the integrase gene confer HIV-1 integrase strand-transfer inhibitors resistance. Dr Olivier Delelis Pr Anne-Geneviève Marcelin 1 Resistance to Anti-Integrases Raltegravir(RAL)
News Update. May The following article has been taken from the Worthing Herald report on our launch event Wednesday 24 th May 2017.
News Update May 2017 The following article has been taken from the Worthing Herald report on our launch event Wednesday 24 th May 2017. Sight Support Worthing is the new name for a very old charity. Worthing
Canadian Cancer Society Relay For Life Awareness Chair
Canadian Cancer Society Relay For Life Awareness Chair ROLE This position is responsible for two types of awareness: awareness and promotion cancer awareness and education In order to have a successful,
Please copy into your agenda:
Monday, September 19 Please copy into your agenda: Monday: Finish Snapchat (due Tuesday) Advanced only-project part 2 (due Fri) Tuesday: Vocab bonds (due Wednesday) Wednesday: Human inheritance (due Thur)
Statistics: Interpreting Data and Making Predictions. Interpreting Data 1/50
Statistics: Interpreting Data and Making Predictions Interpreting Data 1/50 Last Time Last time we discussed central tendency; that is, notions of the middle of data. More specifically we discussed the
2) What is the difference between a non-enveloped virion and an enveloped virion? (4 pts)
Micro 260 SFCC Spring 2010 Name: All diagrams and drawings shall be hand drawn (do not photo-copied from a publication then cut and pasted into work sheet). Do not copy other student s answers. Para phase
LESSON 4.5 WORKBOOK. How do viruses adapt Antigenic shift and drift and the flu pandemic
DEFINITIONS OF TERMS Gene a particular sequence of DNA or RNA that contains information for the synthesis of a protien or RNA molecule. For a complete list of defined terms, see the Glossary. LESSON 4.5
PROJECT PLANNING TEMPLATE IDENTIFICATION
PROJECT PLANNING TEMPLATE IDENTIFICATION TITLE THE WARM-UP Why do we need to warm up before doing some physical activity? AUTHOR With the support of COE Level B 2 Grade Content areas Number of sessions
2017 National PTA STEM + Families Science Grants Sponsored by Bayer. Hosting Your Science Festival December 12, 2017
2017 National PTA STEM + Families Science Grants Sponsored by Bayer Hosting Your Science Festival December 12, 2017 Agenda 1. Welcome and Congratulations! 2. Toolkit Overview 3. Science Festival Photo
1 Different liquids are added to food as it passes through the digestive system. saliva. gastric juice. bile from the liver
1 Different liquids are added to food as it passes through the digestive system. saliva gastric juice bile from the liver secretions from the pancreas and small intestine (a) One of the liquids released
For purification of viral DNA and RNA from a wide range of sample materials
QIAamp virus kits For purification of viral DNA and RNA from a wide range of sample materials Automatable on QIAGEN s proven QIAamp Kits set the standard for purification of viral DNA and RNA. QIAamp virus
GCSE Art & Design Exemplar Materials Fine Art, Externally Set Assignment
GCSE Art & Design Exemplar Materials Fine Art, Externally Set Assignment 2011-2012 Version 2.0 Contents Introduction... 3 Unit 2 Externally Set Assignment... 4 72 Marks... 4 44 Marks... 18 18 Marks...
Family Trees for all grades. Learning Objectives. Materials, Resources, and Preparation
page 2 Page 2 2 Introduction Family Trees for all grades Goals Discover Darwin all over Pittsburgh in 2009 with Darwin 2009: Exploration is Never Extinct. Lesson plans, including this one, are available