Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR

Transcription

1 Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4 envelope protein (24) were used to co-transfect HEK293 cells. In NL4-3-Δnef-GFP, the coding sequence for enhanced Green Fluorescent Protein (GFP) was inserted within the nef open reading frame. In NL4-3-Δ6-drGFP, all viral genes except tat and rev were mutated by introducing premature stop codons or by truncation. The coding sequence for enhanced GFP was inserted within the env open reading frame. Viruses were collected 3 days after transfection. To isolate viruses from patient plasma, 9 ml or 25 ml of plasma were collected from HIV-1-infected patients. Viruses were concentrated from patient plasma by ultracentrifugation at 5, rpm for 3 mins. The pellet was collected for genomic viral RNA extraction and quantitative RT-PCR. To determine the sensitivity and accuracy of this assay, we used the HIV-1 VQA RNA Quantification Standard obtained through the NIH AIDS Research and Reference Reagent Program, DAIDS, NIAID from the DAIDS Virology Quality Assurance (VQA) Program (22). This viral standard consists of 15, copies HIV-1 RNA/mL determined by electron microscopy. It was diluted with PBS to different concentrations in a final volume of 1 μl before genomic viral RNA extraction and quantitative RT-PCR. To compare this assay with conventional PCR assay, single copy assay was also performed as previously described (9). Quantitative Reverse Transcription PCR HIV-1 RNA was extracted using QIAamp Viral RNA Mini Kit. Random hexamers were used as primers for reverse transcription. Real-time PCR was performed using TaqMan PreAmp Master Mix. The cycling parameters of quantitative PCR were as follows: (i) 2 min at 5 C and then 1 min at 95 C; (ii) to 45 cycles at 95 C for 15 s, 56.5 C for 6 s. To quantify genomic viral RNA, p951 and Oligo dt containing primers were used to perform quantitative PCR (Supplemental Table 1). To quantify spliced viral transcripts, gene specific primers paired with an upstream primer in front of the major splice donor site (Supplemental Table 1) were used. Generation of molecular standard for quantitative PCR To generate a molecular standard for quantitative PCR, the reporter virus NL4-3-Δnef-GFP was generated by transfection of HEK293T cells with pnl4-3-δnef-gfp and genomic viral RNA was isolated from the culture supernatant. The RNA was reverse transcribed into cdna. Primers P9285 and Tmix were used for PCR reaction (Supplemental Table 1). Tmix is a mixture of sixteen primers containing 28 deoxythymidines followed by a random dinucleotide. The amplicon, which consists of the last 352 nucleotides

2 of viral genomic RNA plus 3 deoxyadenosines, was purified and cloned into the TOPO TA cloning vector (Invitrogen). Serial dilutions of the resulting plasmid (pvqa) were used to generate a standard curve to quantify HIV-1 mrna in this study. To make the standards for spliced viral transcripts, gene specific primers (Supplemental Table 1) were used to amplify viral RNA, and the amplicons were cloned into TOPO TA cloning vector as described above. To optimize quantitative PCR conditions, the recombinant plasmid pnl4-3 containing NL4-3 proviral DNA but not poly(a) sequence was used as negative control. pvqa was used as positive control for standard curves. Quantification of virus production To measure virus production, reporter viruses NL4-3-Δnef-GFP or NL4-3-Δ6-drGFP were used to infect in primary CD4 + T cells or Jurkat T cells. For the measurement of virus burst size, GFP + primary CD4 + T cells were collected 3 days after infection by fluorescence-activated cell sorting and cultured in fresh medium at 1 million cells per ml for 24 hours. μl aliquots of supernatants of infected cell cultures were collected and treated with Benzonase (Sigma) to remove extra-virion viral mrna or DNA before genomic viral RNA extraction. Primers P951 and 5T25 were used for quantitative RT-PCR. Given the number of infected cells in the culture and the length of culture period (24 hours), virus burst size was calculated in units of copies per cell per day. For the measurement of spliced HIV-1 mrna, the supernatants of cultures containing infected Jurkat T cells (without fluorescence-activated cell sorting) were collected 3 days after infection and treated with Benzonase (Sigma) to remove extra-virion viral mrna or DNA before viral RNA extraction and reverse transcription. Primers P951 and 5T25 or primers P675 and gene specific primers were used for quantitative PCR.

3 Supplemental Table 1: Probe and primers for quantification of viral genomic RNA. Primer/probe Sequence HXB2 coordinates Probe CCTGTACTGGGTCTCTCTGG P9285 CTTGTTACACCCTGTGAGCCTGC P951 CAGATGCTGCATATAAGCAGCTG Tmix TTTTTTTTTTTTTTTTTTTTTTTTTTTTNN T3 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 3T27 TTTTTTTTTTTTTTTTTTTTTTTTTTTTGA a T25 TTTTTTTTTTTTTTTTTTTTTTTTTTGAAG T23 TTTTTTTTTTTTTTTTTTTTTTTTGAAGCA T TTTTTTTTTTTTTTTTTTTTTGAAGCACTC P675 GAGGAGATCTCTCGACGCAGGAC PVif CTTGCCACACAATCATCACCTGCC PVpr CATTGTATGGCTCCCTCTGTGG PTat GAGAAGCTTGATGAGTCTGACTG a The letters in red represent the nucleotides complimentary to the 3 end of the R region of the LTR. Oligo-dT-containing primers were named based on the number of overlap nucleotides and number of deoxythymidines in the primers.

4 Supplemental Figure 1: Primers and probe for this novel PCR are highly conserved among viral isolates HIV-1 sequences from the Los Alamos HIV Sequence Database were aligned. In oligo-dt-containing primers (A), the forward primer (B) or the probe (C), the frequency of each nucleotide at indicated positions is shown.

5 A G A G U G C U U C A 6 B Nucleotides from poly(a) tail C A G A U G C U G C A U A U A A G C A G C U G 6 C Forward primer (HXB2 coordinates) C C U G U A C U G G G U C U C U C U G G Probe (HXB2 coordinates)