Overproduction of ristomycin A by activation of a silent gene cluster in Amycolatopsis japonicum MG417-CF17

Size: px

Start display at page:

Download "Overproduction of ristomycin A by activation of a silent gene cluster in Amycolatopsis japonicum MG417-CF17"

Neil Mitchell
5 years ago
Views:

1 Supplemental Material for verproduction of ristomycin A by activation of a silent gene cluster in Amycolatopsis japonicum MG417-CF17 Marius Spohn, a orbert Kirchner, b,c Andreas Kulik, a, Angelika Jochim, a Felix Wolf, a Patrick Muenzer, d liver Borst, e arald Gross, b,c Wolfgang Wohlleben, a,b Evi Stegmann, a,b # Interfaculty Institute of Microbiology and Infection Medicine Tuebingen, University of Tuebingen, Tuebingen, Germany a German Centre for Infection Research (DZIF), Partner Site Tuebingen, Tuebingen, Germany b Pharmaceutical Institute, Department of Pharmaceutical Biology, University of Tuebingen, Tuebingen, Germany c Department of Physiology I, University of Tuebingen, Tuebingen, Germany d Department of Cardiology & Cardiovascular Medicine, University of Tuebingen, Germany e Running title: Activation of a silent ristomycin A cluster # Address correspondence to Evi Stegmann, evi.stegmann@biotech.unituebingen.de. 1

2 FIGURE AD TABLE LEGEDS Table S1. List of primers. Table S2. antismas 2.0 predicted gene clusters within the A. japonicum genome. Fig. S1. PLC-ESI-MS/MS spectra of A. japonicum glycopeptide (negative mode). Fig. S2. PLC-ESI-MS/MS spectra of A. japonicum glycopeptide (positive mode). Fig. S3 Key fragment ions observed in collisionally induced ESI-MS/MS experiments. Fig. S4. R-ESI-TF mass spectrum of the isolated glycopeptide from A. japonicum. Fig. S5. R-ESI-TF mass spectrum of a commercially available ristomycin A monosulfate standard. Fig. S6. Superimposed 1 MR spectra (500 Mz, d 6 -DMS) of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. Fig. S7. Detail region (0 4 ppm) of the superimposed 500 Mz 1 MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard Fig. S8. Detail region (4 8 ppm) of the superimposed 500 Mz 1 MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. Fig. S9. Detail region (8 11 ppm) of the superimposed 500 Mz 1 MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. Fig. S10. Superimposed 13 C MR spectra (125 Mz, d 6 -DMS) of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. Fig. S11. Detail region (0 50 ppm) of the superimposed 125 Mz 13 C MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. Fig. S12. Detail region ( ppm) of the superimposed 125 Mz 13 C MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. Fig. S13. Detail region ( ppm) of the superimposed 125 Mz 13 C MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. Fig. S14. Detail region ( ppm) of the superimposed 125 Mz 13 C MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. Fig. S Mz 1-13 C-SQC MR spectrum of the isolated glycopeptide from A. japonicum. Fig. S Mz 1-1 -DQF-CSY MR spectrum of the isolated glycopeptide from A. japonicum. 2

3 Fig. S Mz 1-1 -TCSY MR spectrum of the isolated glycopeptide from A. japonicum. Fig. S Mz 1-13 C-MBC MR spectrum of the isolated glycopeptide from A. japonicum. Fig. S Mz 1-1 -RESY MR spectrum of the isolated glycopeptide from A. japonicum. Figure S20. Chemical structure of ristomycin A, numbering scheme and MR key correlations. Table S3. MR spectral data of isolated ristomycin A in d 6 -DMS. Fig. S21. CD spectra of the isolated glycopeptide from A. japonicum and a ristomycin standard. 3

4 Table S1. List of primers used for this study. Primer Sequence (5-3 ) Experiment, restriction sites bbraba-fp ATTCATATGGTGGATCCGACGAGAGTT verexpression of bbr Aba, dei bbraba-rp ATATTCTAGAGTCATCCCGCGGCCAGCTCGGT verexpression of bbr Aba, XbaI ajrr-fp TAACATATGGATCCGACGAGAGTTGAC verexpression of ajrr, dei ajrr-rp AATAAGCTTTCATCGTGCGGCCAGATCG verexpression of ajrr, indiii strr-rt-fp GATCCGACGAGAGTTGAC RT-PCR of bbr Aba /ajrr strr-rt-rp ATGCGTCCCGATGATCTG RT-PCR of bbr Aba /ajrr riaa-rt-fp TGAGGCCAACGTCTTCCAC RT-PCR of riaa riaa-rt-rp GTTCCCCGGCTCCATCTTG RT-PCR of riaa dpga-rt-fp TTCCTGAACAGCGCCATCG RT-PCR of dpga dpga-rt-rp CAGGAACCCGGTCGAGGTG RT-PCR of dpga bhp-rt-fp TCGTCGGCACGTCGATGG RT-PCR of bhp bhp-rt-rp TCGTCGTCGGCGAGCGTC RT-PCR of bhp oxya-rt-fp CGACTTCCTCGGCATCCC RT-PCR of oxya oxya-rt-rp CAGTTCCGCGTCGGTGAT RT-PCR of oxya hmas-rt-fp CAGAATTTCGAGATCGACTA RT-PCR of hmas hmas-rt-rp CGCTCTGGATCAGGGTGTG RT-PCR of hmas van-rt-fp GCGTAATTCCGACCATTGTG RT-PCR of van van-rt-rp TCAGCATCAGCGTGAAATCG RT-PCR of van 4

5 Table S2. antismas 2.0 predicted gene clusters within the A. japonicum genome. 5

6 Fig. S1. PLC-ESI-MS/MS spectra (negative mode) of A. japonicum glycopeptide. Fragmentation pattern of (TP) ristomycin A standard (0.1 mg ml 1 ) and (BTTM) A. japonicum prm4-bbr Aba glyopeptide. 6

7 Fig. S2. PLC-ESI-MS/MS spectra (positive mode) of A. japonicum glycopeptide. Fragmentation pattern of (TP) ristomycin A standard and (BTTM) A. japonicum prm4-bbr Aba glyopeptide. The quasimolecular ion [M+2] 2+ = 1034 m/z was selected as precursor ion. 7

1643 [M+] + 130 [M+] + 2 1465 [M+] + C 1772 [M+] + D 960 [M+2] 2+ E 3 + 3 CC A B 1903 [M-] - 953 [M+2] 2+ C 3 F G 725 [M+2] 2+ 1755 [M+] + 951 [M+2] 2+ 2 960 [M+2] 2+ C D E 130 [M+] + 3 + 3 CC A B C

8 1643 [M+] [M+] [M+] + C 1772 [M+] + D 960 [M+2] 2+ E CC A B 1903 [M-] [M+2] 2+ C 3 F G 725 [M+2] [M+] [M+2] [M+2] 2+ C D E 130 [M+] CC A B C 3 F G Fig. S3 Key fragment ions observed in collisionally induced ESI-MS/MS experiments with ristomycin A. The upper structural diagram shows the fragments of the regular form of ristomycin A, while the bottom structural diagram depicts the fragments derived from ristomycin A containing a dehydrated ß-hydroxy-tyrosine moiety (indicated in blue). 8

9 Fig. S4. R-ESI-TF mass spectrum of the isolated glycopeptide from A. japonicum. Boxed region shows details about the quasimolecular ion [M+2] 2+. 9

10 Fig. S5. R-ESI-TF mass spectrum of a commercially available ristomycin A monosulfate standard. Boxed region shows details about the quasimolecular ion [M+2]

11 Fig. S6. Superimposed 1 MR spectra (500 Mz, d 6 -DMS) of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. The ristomycin standard showed an additional peak at 6.99 ppm (see detailed 1 MR regions), which can be attributed to the presence of ristomycin derivatives (up to 10%) in the commercially available standard. 11

12 Fig. S7. Detail region (0 4 ppm) of the superimposed 500 Mz 1 MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. 12

13 Fig. S8. Detail region (4 8 ppm) of the superimposed 500 Mz 1 MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. The ristomycin standard showed an additional peak at 6.99 ppm (*), which can be attributed to the presence of ristomycin derivatives (up to 10%) in the commercially available standard. 13

14 Fig. S9. Detail region (8 11 ppm) of the superimposed 500 Mz 1 MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. 14

15 Fig. S10. Superimposed 13 C MR spectra (125 Mz, d 6 -DMS) of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. The ristomycin standard showed additional peaks in the double bond region (see detailed 13 C MR regions), which can be attributed to the presence of ristomycin derivatives (up to 10%) in the commercially available standard. 15

16 Fig. S11. Detail region (0 50 ppm) of the superimposed 125 Mz 13 C MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. 16

# # Fig. S12. Detail region (50 100 ppm) of the superimposed 125 Mz 13 C MR spectra of the isolated glycopeptide from A.

17 # # Fig. S12. Detail region ( ppm) of the superimposed 125 Mz 13 C MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. ash mark indicates a minor impurity at 70.8 ppm in both samples. 17

# # # * * Fig. S13. Detail region (100 150 ppm) of the superimposed 125 Mz 13 C MR spectra of the isolated glycopeptide from A.

18 # # # * * Fig. S13. Detail region ( ppm) of the superimposed 125 Mz 13 C MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. The ristomycin standard showed additional peaks at and ppm (*). ash marks indicate minor impurities at and ppm in both samples. 18

* Fig. S14. Detail region (150 180 ppm) of the superimposed 125 Mz 13 C MR spectra of the isolated glycopeptide from A.

19 * Fig. S14. Detail region ( ppm) of the superimposed 125 Mz 13 C MR spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. The ristomycin standard showed an additional peaks at ppm (*). 19

20 Fig. S Mz 1-13 C-SQC MR spectrum of the isolated glycopeptide from A. japonicum in d 6 - DMS. Fig. S Mz 1-1 -DQF-CSY MR spectrum of the isolated glycopeptide from A. japonicum in d 6 -DMS. 20

21 Fig. S Mz 1-1 -TCSY MR spectrum of the isolated glycopeptide from A. japonicum in d 6 -DMS. Fig. S Mz 1-13 C-MBC MR spectrum of the isolated glycopeptide from A. japonicum in d 6 -DMS. 21

22 Fig. S Mz 1-1 -RESY MR spectrum of the isolated glycopeptide from A. japonicum in d 6 -DMS. 22

23 (4) (6) (3) (2) I(4) I(5) I(3) (5) 2 (1) 3 CC A(2) I(1) C(1) J(6) K(2) J(3) J(4) K(1) A(1) A A(4) C(5) C C(2) B(1) B(3) J(1) J(2) B K(3) B(5) D(5) M(1) M(2) K(4) D K(6) D(1) M(5) L(1) L(2) D(3) F(2) C 3 E(4) F F(1) F(4) L(6) L(3) E E(6) F(6) L(4) E(2) G(2) G 2 G(1) G(5) Figure S20. Chemical structure of ristomycin A, numbering scheme and 1-1 -RESY- and 1-13 C- MBC MR key correlations. 23

24 Table S3. MR spectral data of isolated ristomycin A in d 6 -DMS, measured at 300 K (c = 22 mg/ml, δ in ppm, J in z). residue position δ C δ residue position δ C δ Ring A: α d (5.5) Ring F: α A(1) F(1) Dpg A(2) d (1.5) 4-Me-Dpg F(2) s methyl ester A(3) F(3) A(4) brs F(4) A(5) F(5) A(6) F(6) s α-c α-c C α α brs F(3) 9.66 s A(3) 9.74 F(4) C s Ring B: α Ring G: α B(1) G(1) para-pg B(2) s 3,4-di-pg G(2) s B(3) G(3) B(4) G(4) B(5) G(5) B(6) d (8.5) G(6) α-c α-c α d (5.2) α- 2 n.o. B(4) 9.45 s G(4) 9.73 Ring C: α Ring : (1) β (2) & 2.19 ß-t C(1) ristosamine (3) C(2) (4) C(3) d (7.9) (5) C(4) (4) 5.98 d (4.0) C(5) d (8.2) (5) C d (5.0) C(6) Ring I: I(1) α-c I(2) α arabinofuranose I(3) Ring D: α d (7.8) I(4) ,4,5-tri- pg D(1) I(5) D(2) brs I(2) 5.17 D(3) I(3) 4.96 D(4) I(5) 4.64 t (5.4) D(5) Ring J: J(1) D(6) brs J(2) α-c mannose J(3) α d (7.8) J(4) Ring E: α J(5) β J(6) & 3.61 ß-t E(1) J(3) n.o. E(2) d (8.0) J(4) 4.69 E(3) J(6) 4.21 E(4) Ring K: K(1) E(5) K(2) E(6) glucose K(3) α-c K(4) α K(5) (ß) 6.05 d (3.4) K(6) & 3.83 K(3) 5.02 K(4)

25 residue position δ C δ residue position δ C δ Ring L: L(1) brs Ring M: M(1) L(2) M(2) rhamnose L(3) mannose M(3) L(4) M(4) L(5) M(5) L(2) n.o. M(6) & 3.48 L(3) n.o. M(2) 4.11 L(4) 4.79 M(3) 4.44 L(5) C d (6.0) M(4) 4.29 M(6) n.o. All shift assignments are in good agreement with former studies about ristomycins (Sztaricskai et al., 1980, Tetrahedron Lett. 21: ; Kalman and Williams, 1980, J. Am. Chem. Soc. USA 102: ; Williamson and Williams, 1981, J. Chem. Soc. Perkin Trans. 1: ). Abbreviations: Dpg = 3,5-dihydroxyphenylglycine-methyl ester; pg = hydroxy-phenylglycine; ß-t = ß-hydroxy-tyrosine; br = broad; s = singlet; d = doublet; n.o. = not observed. Fig. S21. CD spectra of the isolated glycopeptide from A. japonicum and a desalted commercially available ristomycin standard. A concentration of 0.1 mg/ml in 2 of the isolated glycopeptide from A. japonicum and the commercially available standard of ristomycin A was used to generate the spectra. 25

Supplementary Figure 1. ESI/MS/MS analyses of native and de-acetylated S2A Supplementary Figure 2. Partial 1D 1H NMR spectrum of S2A

Supplementary Figure 1. ESI/MS/MS analyses of native and de-acetylated S2A. Panel A, Positive ESI mass spectra of native (N) and de-acetylated (DA) non-active S2A were obtained, and demonstrated a shift