Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M0042F): Acid-mediated intra-molecular cycloadditions enhance

Size: px

Start display at page:

Download "Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M0042F): Acid-mediated intra-molecular cycloadditions enhance"

Brendan Hudson
5 years ago
Views:

1 SUPPORTING INFORMATION Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M42F): Acid-mediated intra-molecular cycloadditions enhance chemical diversity Zhuo Shang, Ritesh Raju, Angela A. Salim, Zeinab G. Khalil and Robert J. Capon* Institute for Molecular Bioscience, The University of Queensland, St Lucia, Queensland 42, Australia

2 Table of Contents Taxonomy of CMB-M42F... S4 2 Cultivation of CMB-M42F... S6 PLC chromatograms... S6 4 Tabulated NMR data and NMR spectra... S S2

3 List of Tables Table S. NMR (6 Mz, CDCl ) data for cytochalasin J ()... S Table S2. NMR (6 Mz, CDCl ) data for cytochalasin (2)... S2 Table S. NMR (6 Mz, CDCl ) data for cytochalasin J ()... S Table S4. NMR (6 Mz, CDCl ) data for cytochalasin J 2 (4)... S4 Table S. NMR (6 Mz, CDCl ) data for cytochalasin J ()... S Table S6. NMR (6 Mz, CDCl ) data for cytochalasin (6)... S6 Table S. NMR (6 Mz, CDCl ) data for cytochalasin 2 ()... S Table S. Diagnostic ROESY (6 Mz, CDCl ) data for cytochalasins J () and 2 ()... S List of Figures Figure S. Colony photos of fungus Phomopsis sp. CMB-M42F on saline M agar plates and saline rice solid media after 2 days cultivation at 26. C... S6 Figure S2. PLC-DAD profiling (2 nm) of the EtOAc crude extract of fungus Phomopsis sp. (CMB-M42F) on different culture media... S6 Figure S. PLC-DAD profiles for the TFA treatments of cytochalasin J ()... S Figure S4. PLC-DAD profiles for the TFA treatments of cytochalasin (2)... S Figure S. PLC-DAD profiles for the the CCl /acetone/acid treatment of cytochalasin J ()... S Figure S6. PLC-QTOF profiles for the CCl /acetone/acid treatment of cytochalasin J ()... S Figure S. Cytotoxicity assay of the cytochalasins (-) against SW62, NCI-46, epg2 and EK2 cell lines... S Figure S. -NMR (6 Mz, CDCl ) spectrum of cytochalasin J ()... S Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin J ()... S Figure S. -NMR (6 Mz, CDCl ) spectrum of cytochalasin (2)... S2 Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin (2)... S2 Figure S2. -NMR (6 Mz, CDCl ) spectrum of cytochalasin J ()... S2 Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin J ()... S2 Figure S4. -NMR (6 Mz, CDCl ) spectrum of cytochalasin J 2 (4)... S Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin J 2 (4)... S Figure S6. -NMR (6 Mz, CDCl ) spectrum of cytochalasin J ()... S2 Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin J ()... S2 Figure S. -NMR (6 Mz, CDCl ) spectrum of cytochalasin (6)... S24 Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin (6)... S24 Figure S2. -NMR (6 Mz, CDCl ) spectrum of cytochalasin 2 ()... S2 Figure S2. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin 2 ()... S2 S

4 Taxonomy of CMB-M42F Genomic DNA of CMB-M42F was extracted from the mycelia using the DNeasy Plant Mini Kit (Qiagen) as per the manufacturers protocol. The rrna genes were amplified by PCR using the universal primers ITS ( -TCCGTAGGTGAACCTGCGG- ) and ITS 4 ( - TCCTCCGCTTATTGATATGC- ) purchased from Sigma-Aldrich. The PCR mixture ( µl) contained µl of genomic DNA (2 4 ng), 2 µm of each deoxynucleoside triphosphate (dntp),. mm MgCl 2,. µm of each primer, U of Taq DNA polymerase (Fisher Biotec) and µl of PCR buffer. PCR was performed using the following conditions: initial denaturation at C for min, cycles in series of 4 C for s (denaturation), C for 6 s (annealing) and 2 C for 6 s (extension), followed by one cycle at 2 C for 6 min. The PCR products were purified with PCR purification kit (Qiagen) and sequenced. The BLAST search showed the amplified ITS sequence (GenBank accession no. KU64) has % homology with other members of the genus Phomopsis sp. ITS gene sequence of CMB-M42F GGCGCACCCAGAAACCCTTTGTGAACTTATACCTTACTGTTGCCTCGGCGTACGC TGGCCCCTAGGGGTCCCTCTTGTCTCAAGAGGAGCAGGCGCGCCGGCGGCCAAG TTAACTCTTGTTTTTACACTGAAACTCTGAGAAAAAAAACAAAATGAATCAAAA CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGC GATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACA TTGCGCCCTCCGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTC AAGCCTGGCTTGGTGTTGGGGCACTGCCTGTAAAAGGGCAGGCCCTCAAATCTA GTGGCGAGCTCGCCAGGACCCCGAGCGTAGTAGTTAAACCCTCGCTTTGGAAGG CCCTGGCGGTGCCCTGCCGTTAAACCCCCAACTTTTGAAAATTTGACCTCGGATC AGGTAGGAATACCCGCTGAACTTAAGCATA ( bp) S4

5 BLAST search of CMB-M42F (closest match) S

C PLC chromatograms 2 PYG agar (DW) 4 UV absorbance at 2 nm 6 2 4 2 4 2 4 2 4 PYG agar (SW) 6 M agar (SW) 6 rice

6 2 Cultivation of CMB-M42F Figure S. Colony photos of fungus Phomopsis sp. CMB-M42F on saline M agar plates (left) and saline rice solid media (right) after 2 days cultivation at 26. C PLC chromatograms 2 PYG agar (DW) 4 UV absorbance at 2 nm PYG agar (SW) 6 M agar (SW) 6 rice solid media (SW) 4 6 Retention time (min) Figure S2. PLC-DAD profiling (2 nm) of the EtOAc crude extract of fungus Phomopsis sp. (CMB-M42F) on different culture media S6

7 UV absorbance at 2 nm cytochalasin J () 2 4 cytochalasin J () 2 4 cytochalasin J 2 (4) 2 4 cytochalasin J () 2 4 in % TFA/MeO 2 4 in % TFA/MeO 2 4 in % TFA/MeO 2 4 in % TFA/ 2 O 2 4 in % TFA/ 2 O 2 4 in % TFA/ 2 O 2 4 Retention time (min) Figure S. PLC-DAD profiles for the TFA treatments of cytochalasin J () S

8 absorbance at 2 n UV m cytochalasin (2) 2 4 cytochalasin (6) 2 4 cytochalasin 2 () in % TFA/MeO in % TFA/MeO in % TFA/MeO in % TFA/ 2 O in % TFA/ 2 O in % TFA/ 2 O 2 4 Retention time (min) Figure S4. PLC-DAD profiles for the TFA treatments of cytochalasin (2) cytochalasin J () UV absorbance at 2 nm 2 4 in CCl /acetone * 2 4 in CCl /acetone/cl * Retention time (min) Figure S. PLC-DAD profiles for the the CCl /acetone/acid treatment of cytochalasin J () Peak * shows m/z = 4 [M+] + S

9 Figure S6. PLC-QTOF profiles for the CCl /acetone/acid treatment of cytochalasin J () *Extracted ion chromatogram at 4.26 gives MF of C 2 NO 4 (matched that of phomopchalasin B) S

10 Absorbance at 6 nm SW62 (human colon adenocarcinoma) conc [µm] cytochalasin (2) cytochalasin (6) cytochalasin 2 () cytochalasin J () cytochalasin J () cytochalasin J2 (4) cytochalasin J () vinblastine DMSO Absorbance at 6 nm NCI-46 (human lung carcinoma) conc [µm] cytochalasin (2) cytochalasin (6) cytochalasin 2 () cytochalasin J () cytochalasin J () cytochalasin J2 (4) cytochalasin J () vinblastine DMSO Absorbance at 6 nm. epg2 (hepatocellular carcinoma) conc [µm] cytochalasin (2) cytochalasin (6) cytochalasin 2 () cytochalasin J () cytochalasin J () cytochalasin J2 (4) cytochalasin J () DMSO vinblastine Absorbance at 6 nm EK2 (human embryonic kidney) conc [µm] cytochalasin (2) cytochalasin (6) cytochalasin 2 () cytochalasin J () cytochalasin J () cytochalasin J2 (4) cytochalasin J () vinblastine DMSO Figure S. Cytotoxicity assay of the cytochalasins (-) against SW62 (human colon cancer cell line), NCI-46 (human lung carcinoma), epg2 (hepatocellular carcinoma) and EK2 (human embryonic kidney) cell lines S

11 4 Tabulated NMR data and NMR spectra 2 ' N 4 2 O O 2 O O Table S. NMR (6 Mz, CDCl ) data for cytochalasin J () Pos. δ (mult., J (z)) δ C COSY MBC ( to C) N. (br s) - - 4,. (m) 4. 4, a, b, ' (m) d.,,,, 6,,, (m) b. 4, 6,,, (d,.)., 2a, 2b, 6, 2, 2. (m) b 46.,,,,, 4, a 2.2 (m) b 4., b, 4, ', 2'/6' b 2. (dd,.6,.2) d, a, ', 2'/6'. (d, 6.) 4.2 4,, 6 2 a.4 (s) a 4., 6, b.2 (s), 6,. (dd,.,.) c 2., 4,, 4. (m) a., a, b, a 2.2 (m) 42. 4, b, 6, 4, 6,, b. (m) e 4, a, 6, 4, 6, 6. (m) e 2.6 a, b,, - a. (dd, 4.4,.4). 6, b, 6 b. (dd, 4.4,.) 6, a 6,,,, (dd, 6., 2.2) c.2 2 2, (dd, 6., 2.6).2, 2, (dd, 2.6, 2.2) ,,,, 2.4 (d, 6.6) , 6, 2.6 (s). -,, ' '/6'. (dd,.,.) 2. '/', 2'/6', '/'.2 (dd,.,.) 2. 2'/6', ', '/'.24 (dd,.,.) 2. '/' 2'/6' a,b,c,d,e Overlapping signals and assignments were supported by SQC and MBC. S

12 2 ' N 4 2 OOAc 2 O O Table S2. NMR (6 Mz, CDCl ) data for cytochalasin (2) Pos. δ (mult., J (z)) δ C COSY MBC ( to C) N.6 (br s) -,, 4,.2 (m). 4, a, b, 2-N, 4,, ' (dd, 4., 4.).6,,,, 6,,, 2 2. (qd, 6.6, 4.). 4,, 4, 6,, (d,.) 6., 2a, 2b, 6,,, 2, 2.4 (dd,.,.) 4.,, 6,,,, 4, a 2.6 (dd,.6, 4.2) 4., b, 4, ', 2'/6' b 2.6 (dd,.6,.), a, 4, ', 2'/6'. (d, 6.6) 4.2 4,, 6 2 a. (s) 4., 6, b. (s), 6,. (dd,.2,.) 2.2 c, 4,, 4.4 (m)., a, b,, 6 a 2.4 (m) 42. 4, b, 6, 4, 6,, b. (m) a 4, a, 6, 4, 6, 6. (m) a 2.6 a, b,, - a. (dd, 4.4, 2.4). 6, b, 6 b.6 (dd, 4.4, 2.) 6, a,,, (m) b. 2 2, 2, (dd, 6.4, 2.4) 26., 2,, 2 2. (m) b.6 2 4,,,, 2, 2-OCOC.4 (d, 6.) , 6, 2.4 (s). -,, ' '/6'.4 (d,.2) 2. '/', 2'/6', '/' '/'.2 (dd,.2,.2) 2.2 2'/6', ', '/'.24 (d,.2) 2.2 c '/' 2'/6' 2-OCOC OCOC 2.24 (s) OCOC a,b,c Overlapping signals and assignments were supported by SQC and MBC. S2

13 2 ' N 4 2 O O 2 O OMe Table S. NMR (6 Mz, CDCl ) data for cytochalasin J () Pos. δ (mult., J (z)) δ C COSY MBC ( to C) N.4 (br s) - -,.2 (m). 4, a, b 4,, ' (m) a.6,,, 6,,,,, (m) b. 4, 6,,, (d,.)., 2a, 2b 6, 2, 2. (m) b 4.,,,,, 4, a 2.2 (m) b 46., b, 4, ', 2'/6' b 2. (m) a, a, 4, ', 2'/6'. (d, 6.) 4. 4,, 6 2 a. (s) 4., 6, b.2 (s), 6,.2 (m) c 2., 4,, 4.6 (m)., a, b, a. (m) 4. 4, b, 6, 4, 6,, b.6 (m) d 4, a, 6, 4, (m) d 2. a, b,, 4.2 (br s). 6, 6,,,, (dd, 6.,.) c. 2 2, (dd, 6., 2.)., 2, (dd, 2.,.).2 2,,, 2.2 (d,.) , 6, 2.2 (s) 24. -,, ' '/6'. (d,.4) 2. '/', 2'/6', '/', '/'.2 (dd,.,.4) 2. 2'/6', ', 2'/6', '/'.24 (d,.) 2.2 '/' 2'/6' -OMe. (s). - -O 2. (s) - 6,, 2-O. (d,.) - 2, 2 a,b,c,d Overlapping signals and assignments were supported by SQC and MBC. S

14 2 ' N 4 2 O O O 2 Table S4. NMR (6 Mz, CDCl ) data for cytochalasin J 2 (4) Pos. δ (mult., J (z)) δ C COSY MBC ( to C) N. (br s) - -, 4.2 (m). 4, a, b 4 2. (dd,.2,.)., 6,, (qd, 6.,.2) 2. 4,, 4, 6,, (dd,.,.) 6.6, 2a, 2b, 6, 2,.6 (dd,.,.6) 46.4,, 6,,,, a 2. (dd,., 4.) 4., b, ', 2'/6' b 2.62 (dd,.,.), a, 4, ', 2'/6'. (d, 6.). 4,, 6 2 a.2 (s) 4., 6, b. (s), 6,. (ddd,.,.6,.4)., 4, 4.6 (m)., a, b, a 2. (dd,.,.4) 4. 4, b, 6, 4, 6,, b. (dd,., 4.) 4, a, 6, 4, 6,, 6 2. (m). a, b,, -.26 (d,.) 6. 6, 2,, (dd, 6.6,.).4 2,, 2, 2, (dd, 6.6,.) 2., 2, (dd,.,.). 2 4,,,, 2.4 (d, 6.) , 6, 2. (s) 2.,, ' '/6'. (dd,.,.) 2. '/', 2'/6', '/'.2 (dd,.,.) 2. 2'/6', ', '/'.2 (d,.) 2.2 '/' 2'/6' S4

15 ' N 4 2 O 2 O O 2 Table S. NMR (6 Mz, CDCl ) data for cytochalasin J () Pos. δ (mult., J (z)) δ C COSY MBC ( to C) N.4 (br s) -, 4,.4 (m).6 4, a, b, 2-N, 4,, ' 4 2. (m) a 4.,,,,,. (m) 6.6 4,, 2a, 2b, 4, (dd,.,.)., 2a, 2b, (dd,., 2.) 44.,, 6,,,, 4,, a 2. (dd,.6,.) 4., b, 2'/6', 4, ', 2'/6' b 2.2 (dd,.6,.2) a, a, ', 2'/6'.2 (d, 6.). 4,, 6 2 a. (s) 4.,, 6, b.2 (s),, 6,. (ddd, 2.,.4,.) 4.2, 4,, 4,,, 4.6 (ddd,.6,., 2.).2, a, b 6, a. (ddd,.6,., 2.) 4. 4, b, 6, 4, 6,, b. (ddd,.6,.6,.6) 4, a, 6, 4, 6,, 6 2. (m). a, b,, -.24 (br s).6 6,, 2, 6,, (ddd,.,.4,.).,, 2a, 2b, 2-2 a 2.6 (ddd, 4.,., 2.) 4., 2b, 2,,, 2 b. (ddd, 4.,., 2.), 2a, 2,,, 2 2. (br dd, 2., 2.).2 2a, 2b,,. (d,.2) 24. 6, 6, 2.4 (s) 2.,,, ' '/6'. (d,.) 2. a, '/', 2'/6', '/', '/'.2 (dd,.4,.) 2. 2'/6', ', '/'.26 b 2. '/' 2'/6', '/' a Overlapping signals and assignments supported by SQC and MBC; b Overlapped with residual CCl signal. S

16 2 ' N 4 2 OOAc 2 O OMe Table S6. NMR (6 Mz, CDCl ) data for cytochalasin (6) Pos. δ (mult., J (z)) δ C COSY MBC ( to C) N.2 (br s) (ddd,., 4., 4.4). 2, 4, a, b (dd, 4.4, 4.4)., - 2. (qd, 6., 4.4). 4,, 4, 6,, (d,.) 6. 6, 2, 2. (dd,.,.) 4.,,,,, a 2. (dd,., 4.) 4., b, ', 2'/6' b 2.6 (dd,.,.), a, 4, ', 2'/6'. (d, 6.) a 4. 4,, 6 2 a.4 (s) 4.4 -, 6, b.2 (s) -, 6,. (dd,.4,.) 2.4, 4, 4.4 (m).6, a, b - a 2. (m) 4.2 4, b, 6 - b. (m) b 4, a, 6-6. (m) b 2. a, b, a, b, - a.4 (d,.) 2. 6, b, 6,,,, 2 b. (d,.) 6, a, 6,,,, (dd,., 2.) c.4 2 2, 2, 2 2. (dd,.,.) 26.2, (m) c. 2.2 (d, 6.) a 26. 6, (s) 24. -,, ' '/6'. (d,.2) 2.2 '/', '/', '/'. (dd,.,.2) 2. 2'/6', ', 2'/6'.26 d 2. '/' 2'/6' -OMe. (s). - 2-OCOC OCOC 2.2 (s) OCOC a,b,c Overlapping signals and assignments supported by SQC and MBC; d Overlapped with residual CCl signal. S6

17 2 ' N 4 2 OOAc O OMe 2 Table S. NMR (6 Mz, CDCl ) data for cytochalasin 2 () Pos. δ (mult., J (z)) δ C COSY MBC ( to C) N.2 (br s) -, 4,.2 (m) a. 2, 4,, 4, 4 2. (dd, 6.,.) 4.2,,, 6,,, 2 2. (qd, 6., 6.) 2. 4,, 4, 6,, (d,.4).2, 6, 2, 2.2 (dd,.,.4) 2.,,,,, (m) 4., ', 2'/6'.4 (d, 6.).4 4,, 6 2 a.2 (s) 4. -, 6, b. (s) -, 6,. (ddd,.,.,.)., 4, 2, 4, 4. (dd,.,.6).2, a, 6, 2, 4-OMe a.6 (m). 4, b, 6, 4 b.6 (m) a 4 6. (m). a, a, - a 2.6 (dd, 4., 6.2). 6, b 6,,,, 2 b. (dd, 4.,.) a (d,.) 2.4 2, 2, 2, (ddd,.,., 2.) 2.2,, 2, 4, 2 2. (d, 2.) 2.6 2,,,. (d, 6.) 24. 6, 6, 2. (s) 2. -,, ' '/6'.2 (dd,.,.) 2. '/', '/'. (ddd,.,.4) 2. 2'/6', '.2 (dd,.4,.) 2. '/' 2'/6' 4-OMe.4 (s) a OCOC OCOC 2.6 (s) OCOC -O. (s) - - 6, a Overlapping signals and assignments supported by SQC and MBC. S

18 Table S. Diagnostic ROESY (6 Mz, CDCl ) data for cytochalasins J () and 2 () Pos. cytochalasin J () cytochalasin 2 () δ (mult., J (z)) ROESY δ (mult., J (z)) ROESY.4 (m), a,.2 (m) a, 4 2. (m) a 2. (dd, 6.,.), 4, -O. (m) 4, 2. (qd, 6., 6.) 4,, -O 4. (dd,.,.), 2a,, 2 4. (d,.4) 2a, 2.4 (dd,., 2.), (dd,.,.4), 4, -O a 2. (dd,.6,.), 2.6 (m) b 2.2 (dd,.6,.2) a (d, 6.), a, 2b.4 (d, 6.), 2b 2 a. (s) a.2 (s) b.2 (s) b. (s). (ddd, 2.,.4,.), b, 2a. (ddd,.,.,.), b, (ddd,.6,., 2.), a, 6,, 2b. (dd,.,.6) 4,, 6, b, 2, -O a. (ddd,.6,., 2.) 4, 6 a.6 (m) - b. (ddd,.6,.6,.6) b.6 (m) (m) 4, a. (m) 4, 2.24 (br s), 2 a 2.6 (dd, 4., 6.2) b. (dd, 4.,.) 2.4 (ddd,.,.4,.) 4, 2b.64 (d,.) 2, 2 2 a 2.6 (ddd, 4.,., 2.), 2, (ddd,.,., 2.) 4, 6 b. (ddd, 4.,., 2.) 4,, (br dd, 2., 2.), 2a. (d, 2.),. (d,.2). (d, 6.) (s), 2a, 2b. (s) -O - -. (s) 4,,, 4 S

19 CCl ' N O O 2 O O 2 '/' 2'/6' 2α 2 2-N 4 2β 2 α α 4 β α β 6 β ppm Figure S. -NMR (6 Mz, CDCl ) spectrum of cytochalasin J () CCl '/6' '/' 4 2 ' ppm Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin J () S

2 2-OAc ' N 4 2 OOAc 2 O O 2 '/' 2'/6' 2-N 2 2 2α 2β 4 α β 6 4 α β α β.. 6. 6... 4. 4... 2. 2.. ppm...6...6...2....... 2.4... 2..... Figure S.

20 2 2-OAc ' N 4 2 OOAc 2 O O 2 '/' 2'/6' 2-N 2 2 2α 2β 4 α β 6 4 α β α β ppm Figure S. -NMR (6 Mz, CDCl ) spectrum of cytochalasin (2) '/' 2'/6' CCl OCOC 2-OCOC 6 ' ppm Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin (2) S2

21 CCl 2 -OMe ' N 4 2 O O 2 O OMe 2 '/' 2'/6' 2α 2β 2-N O -O α 6 4 β α β ppm Figure S2. -NMR (6 Mz, CDCl ) spectrum of cytochalasin J () CCl '/6' '/' 2 4 ' 2 2 -OMe ppm Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin J () S2

22 CCl ' N O O O 2 2 '/' 2'/6' 2α 2β 4 2 -N 2 β α 6 4 α β ppm Figure S4. -NMR (6 Mz, CDCl ) spectrum of cytochalasin J 2 (4) CCl '/6' '/' ' ppm Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin J 2 (4) S

23 ' N 4 2 O 2 O O ppm Figure S6. -NMR (6 Mz, CDCl ) spectrum of cytochalasin J () CCl 2' 6' ' ' ' ppm Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin J () S2

24 CCl 2 ' N 4 2 O O 2 O O -OMe 2-OAc 2 '/' 2'/6' 2-N 2a 2 4 2b a b b 4 6 a ppm Figure S. -NMR (6 Mz, CDCl ) spectrum of cytochalasin (6) CCl '/6' '/' 2-OCOC 6 4 ' 2 2a 2 -OMe OCOC ppm Figure S. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin (6) S24

25 CCl ' N OOAc O OMe 4-OMe 2-OAc 2 2 -O '/' 2'/6' 2a 2 2b a a b b ppm Figure S2. -NMR (6 Mz, CDCl ) spectrum of cytochalasin 2 () CCl '/6' '/' 2-OCOC 6 ' OMe ppm Figure S2. C-NMR ( Mz, CDCl ) and UV spectra of cytochalasin 2 () S2

Zinc Chloride Promoted Formal Oxidative Coupling of Aromatic Aldehydes and Isocyanides to α- Ketoamides

Supporting information for Zinc Chloride Promoted Formal xidative Coupling of Aromatic Aldehydes and Isocyanides to α- Ketoamides Marinus Bouma, Géraldine Masson* and Jieping Zhu* Institut de Chimie des